JPH06220093A - Interleukin-1alpha derivative - Google Patents

Abstract

PURPOSE:To obtain the subject derivative having low toxicity and exhibiting immune system stimulation activity, antitumor activity, cytokine production promoting activity, anti-inflammatory activity, etc., by depleting a specific site of the amino acid sequence of a natural-type interleukin-1alpha or substituting the site with other amino acid. CONSTITUTION:The objective interleukin-1alpha derivative having modified amino acid sequence and improved physiological activity is produced by culturing a human lymphohistocytoma U937 cell in a medium, extracting an mRNA from the cell using conventional method, synthesizing a cDNA using the mRNA as a template, preparing a cDNA library, screening the library to select a clone containing interleukin-1alpha, recovering the DNA, subjecting to restriction enzyme treatment, recombining with T4 DNA ligase to prepare a DNA having the amino acid sequence of formula wherein at least one of the 36th Asn and 141st Cys is depleted or substituted with other amino acid, linking the DNA to an expression vector, introducing into a host and culturing the transformed host.

Description

Detailed Description of the Invention

[0001]

The present invention relates to a novel polypeptide,
More specifically, it relates to a new derivative of interleukin 1α (IL-1α).

[0002]

2. Description of the Related Art At the 2nd International Lymphokine Workshop, the Lymphocyte Activator
ivating Factor (LAF), Mitogenic Protein, Helper Peak-1 (Help)
er peak-1), T lymphocyte replacement factor [T-cell replacing
factor III (TRF-III), T-cell replacing fac
tor Mφ (TRFм)], B cell activation
The physiologically active substances that have been reported under the names such as a factor (B-cell activating factor) and a B-cell differentiation factor are unified under the name of interleukin-1 (IL-1). [Cellular Immunol., 48 , 433-436]
(1979)]. This determination is based on the reason that the above-mentioned physiologically active substances are indistinguishable as substances and merely represent physiological activities by grasping them from different angles.

The above-mentioned IL-1 further has an action of activating, for example, T lymphocytes and B lymphocytes to enhance interleukin 2 production and antibody production, and acts on hepatocytes to synthesize protein. It has also been reported to have an action of enhancing the activity, an action of enhancing the production of prostaglandin, etc. [Reviews of Infectious Disease, Vol. 6, N]
o. 1, 51-59 (1984), New England J. of M.
ed., 311 , 1413 (1984), etc.].

Although the body of IL-1 as a substance is still unclear at present, the existence of a gene encoding a polypeptide having LAF activity or its precursor has recently been reported [Proc. .Natl.Aca
d. Sci., Vol. 81, 7907-7911 (1984), N.
ature, Vol.315, 641 (1985), Nucleic Aci
d Research, Vol. 13, (16), 5869 (198)
5)].

According to the above, from the confirmation of the LAF activity of the culture supernatant obtained by the gene recombination technique, the following formula (A)
It is presumed that the polypeptide represented by is a polypeptide having LAF activity, and this is referred to as "IL-1α".

[0006]

[Chemical 2]

However, not only the above-mentioned active substance but also the physiologically active substance conventionally reported as so-called IL-1 have not been reported as manufactured and isolated as a homogeneous substance. There are no reports on the physiological activity of various substances.

[0008]

DISCLOSURE OF INVENTION Problems to be Solved by the Invention The inventors of the present invention have heretofore made extensive studies on IL-1α as a homogeneous substance, and as a result, have already established a manufacturing technique for the same and have the characteristics as the substance. Physiological activity was also clarified. With the results of this study, the present inventors also confirmed the fact that the polypeptide represented by the above formula (A) has LAF activity.

However, as described above, it was surprisingly found that the polypeptide is unstable as a substance, although it corresponds to a gene in the living body.

Therefore, the object of the present invention is to provide a novel polypeptide (which has a different amino acid sequence from the polypeptide represented by the above formula (A), is more stable as a substance, and has properties suitable for pharmaceutical use ( IL-1α derivative).

[0011]

According to the present invention, in the amino acid sequence of IL-1α represented by the above formula (A), at least one amino acid at Asn at position 36 and Cys at position 141 is deleted, or There is provided an IL-1α derivative (polypeptide) having an altered amino acid sequence characterized by being substituted with other amino acids.

The designations of amino acids and polypeptides herein above and below refer to IUPAC and IUPAC.
-The abbreviations in the nomenclature or rules according to IUB or the abbreviations commonly used in the art for displaying amino acid residues shall be followed, and the same shall apply to the display of nucleic acids in base sequences.

The polypeptide of the present invention has, for example, LAF activity, tumor cell growth inhibitory activity, ie, activity that specifically suppresses the growth of tumor cells, CSF (Colony stimula).
tingfactor; colony stimulating factor), interferon (IFN), interleukin-2 (IL-2), interleukin-3 (IL-3) and other various cytokines production promoting activity, that is, acting on human cells, for example. Activity of significantly promoting the production of these cytokines, anti-inflammatory activity, particularly activity of effectively suppressing the progression of arthritis by administration to, for example, an arthritis model animal, radiation damage preventive effect, that is, whole-body irradiation during bone marrow transplantation, It has an action of preventing or preventing a biological disorder or a serious side effect at the time of radiation irradiation and a radiation accident in cancer treatment and the like. Therefore, this is, for example, an immune system stimulating agent for promoting antibody production or enhancing the effect of a vaccine, an antitumor agent, CSF, IL
-2, IL-3 and other cytokine production-promoting agents, anti-inflammatory agents, radiation-damage preventing agents, and other pharmaceuticals. In particular, the polypeptide of the present invention is characterized in that it is extremely stable as a substance, has low toxicity, and is suitable as the above-mentioned pharmaceutical agent in view of other points. Although IL-1 is known to have a pyrogenicity, the polypeptide of the present invention is also excellent in that it has fewer such side effects.

The polypeptide of the present invention is, for example, CS
When administered to humans as an F production promoter, it can effectively recover granulocytopenia due to bone marrow hypoplasia after cancer chemotherapy or radiation therapy without causing the risk of viral infection or antigen-antibody reaction (granulocyte). Diminished therapeutics). Further, the CSF production promoter utilizing the polypeptide of the present invention can be effectively used as a preventive and therapeutic agent for various diseases based on the action of CSF due to its original CSF production promoting action. For example, CSF acts to promote the function of granulocytes and macrophages [Lopez, AF et a
l.), J. Immunol., 131 , 2983 (1983), Handam et al. (Handam, E. et al.), 122 , 1134 (1).
979) and Vadas, MA et al., Ibid. 13
0, since 795 (1983)], clinical applications are expected as various infectious diseases prevention and treatment, the CSF
The production promoter can also be expected to have clinical application.

In particular, a so-called opportunistic infection or terminal is caused by a pathogen that has been harmless until then, which is caused by exhibiting pathogenicity to an individual (compromised host) whose biological defense ability has been reduced or impaired in recent years. inf
section) is a clinically problematic pathogen (causing fungus)
Pseudomonas, Serrat
Grapes-negative bacilli such as ia), Herpes simplex,
HSV, Varicera-Zoster, V
ZV), Cytomegalovirus (CM)
V) and other viruses, Candida albican
s), Aspergillus fumigatus, fungi such as Nocardia asteroidea, Pneumocystis carinii, Toxoplasma
Plasma gondii) and other protozoa, etc., and currently used antibiotics are difficult to exert sufficient effects against these pathogenic bacteria, and research and development of new drugs against the opportunistic infections have been earnestly desired. The polypeptide of the present invention is also effective as a prophylactic and therapeutic agent for such opportunistic infections, and particularly during administration of an anticancer agent in which such opportunistic infections are frequently observed, that is, during chemotherapy or bone marrow transplantation of acute leukemia. It is useful as a prophylactic and therapeutic agent for infectious diseases such as gandidiasis, cryptococcosis, aspergillosis, zygomycosis, black fungal infection, viral infection, cytomegalovirus pneumonia, and other complications.

An anti-inflammatory agent containing the polypeptide of the present invention as an active ingredient is effective as a prophylactic and therapeutic agent for arthritis and the like.

Furthermore, the polypeptide of the present invention has a tumor cell growth inhibitory activity (hereinafter referred to as "GIF activity") measured by the method described in Examples below, and is effective against various tumor cells. It exerts the effect of specifically suppressing their growth. Therefore, an antitumor agent containing this as an active ingredient is advantageously used as a chemotherapeutic agent for cancer, in particular, in remission intensification therapy and remission maintenance therapy in combination with various antimalignant tumor agents.

Furthermore, the polypeptide of the present invention can be used very effectively, for example, in the production of various useful cytokines from a cell line in vitro based on its cytokine production promoting activity, in addition to the above-mentioned pharmaceutical use. The production of natural cytokines from such cell lines has attracted attention especially for cytokines that are glycoproteins,
Useful cytokines can be obtained efficiently and in large quantities.

The IL-1α derivative of the present invention is more preferably a polypeptide having an amino acid sequence of Ami represented by the above formula (A) in which Asn at position 36 of IL-1α is at least deleted or substituted with another amino acid. preferable. Other amino acids that can be substituted include α-, which constitutes a human body protein.
Any amino acid may be used, but Cys is the SH
An intermolecular bond may be formed on the basis of a group, and in consideration of this, the amino acid is preferably the above-mentioned amino acid other than Cys. Particularly preferred are, for example,
Asp for 36th Asn, S for 141th Cys
Each er can be illustrated.

The polypeptide of the present invention can be produced, for example, by a genetic engineering technique. That is, it can be produced by using the gene encoding the specific polypeptide according to the present invention, incorporating the gene into a microbial vector, and replicating, transcribing and translating it in the microbial cell. This method is particularly advantageous in that it can be mass-produced.

The gene used in the above method can also be totally synthesized by chemical synthesis of nucleic acid according to a conventional method, for example, a conventional method such as the phosphite triester method [Nature, 310 , 105 (1984)]. However, it is convenient to use a gene encoding IL-1α or a precursor thereof, and from the gene, a nucleic acid sequence encoding the specific amino acid sequence is modified according to a conventional method including the above-mentioned chemical synthesis means. Can be easily manufactured.

The gene encoding IL-1α or its precursor is publicly known (description), and we also obtained the gene, and obtained IL-1α by a genetic engineering method using this gene.
A series of these methods will be clarified in the reference example described later.

The above gene modification operation can be carried out according to a known method according to the amino acid sequence of the desired polypeptide (as a genetic engineering technique, for example, Molecular
Cloning, Cold Spring Harbor Laboratory (1982)
Is referred to). For example, conventional means for treating various enzymes such as restriction enzyme, DNA ligase, polynucleotide kinase, DNA polymerase, etc. for the purpose of cutting, binding, phosphorylation of DNA and the like can be adopted, and those enzymes are easily commercially available. Available. Isolation and purification of the gene or nucleic acid in each operation may be performed according to a conventional method such as agarose electrophoresis. In addition, replication of the obtained gene may be performed according to a method using an ordinary vector, as described later in part. Further, a DNA fragment encoding a desired amino acid sequence and a synthetic linker can be easily produced by the above-mentioned chemical synthesis.

In the above, the codon itself corresponding to the desired amino acid is known, and its selection may be arbitrary. For example, the codon usage frequency of the host to be used may be considered according to a conventional method [Nucl. Acids .Res., 9 , 43-74
(1981)]. In addition, for the operation of partially modifying the codons of these nucleic acid sequences, for example, according to a conventional method, a site-specific mimetic gene synthesis (Site-) using a primer composed of a synthetic nucleotide encoding a desired modification of about 15 to 30-mer is used. Specific Mutagenesis) 〔Proc.N
atl. Aad. Sci., 81 , 5662-5666 (198).
4)] and the like can be adopted.

The desired gene obtained by the above-mentioned method is, for example, the Maxam-Gilbert chemical modification method [Maxam-
Gilbert, Meth. Enzym., 65 , 499-560 (198)
0)] and the dideoxynucleotide chain termination method [Messing, J. et al. and Vieira, J., Gene, 1
9 , 269-276 (1982)] and the like, the base sequence thereof can be determined and confirmed.

Specific examples of the above operations and methods are described in Reference Examples and Examples below, but the methods are not particularly limited, and any of various methods well known in the art may be adopted.

Thus, according to the present invention, a novel gene encoding a polypeptide having the above-mentioned specific amino acid sequence is also provided (hereinafter this gene is referred to as "the gene of the present invention").

The polypeptide of the present invention can be produced by utilizing the above-mentioned specific gene (the gene of the present invention) in accordance with a conventionally known general gene recombination technique. More specifically, a recombinant DNA capable of expressing the above-mentioned gene of the present invention in a host cell
Is prepared, transformed into a host cell by transformation, and the transformant is cultured.

As the host cell, either a eukaryote or a prokaryote can be used. The eukaryotic cells include cells such as vertebrates and yeasts. Examples of the vertebrate cells include Cos cells [Y. Gluzma, which are monkey cells].
n, Cell, 23 , 175-182 (1981)] and a dihydrofolate reductase-deficient strain of Chinese hamster ovary cells [G. Urlaub and LAChasin, Proc. Natl. Acad.
Sci., USA, 77 , 4216-4220 (1980)] and the like are often used, but the invention is not limited thereto. Examples of expression vectors for vertebrate cells include a promoter, RN, which is located upstream of the gene to be normally expressed.
Those having an A splice site, a polyadenylation site, a transcription termination sequence and the like can be used, which may further have an origin of replication. As an example of the expression vector, pSV carrying the SV40 early promoter
2 dhfr [S. Subramani, R. Mulligan and P. Berg, Mol. Ce
II. Biol., 1 (9) , 854-864] and the like, but are not limited thereto.

Yeast is commonly used as a eukaryotic microorganism, and among them, yeast of the genus Saccharomyces can be advantageously used. Examples of the expression vector for eukaryotic microorganisms such as yeast include pAM82 [A. Miyanohara et al., P, which has a promoter for the acid phosphatase gene].
roc.Natl.Acad.Sci., USA, 80 , 1-5 (1983)]
Etc. can be preferably used.

Escherichia coli and Bacillus subtilis are commonly used as prokaryotic hosts. In the present invention, for example, a plasmid vector capable of replicating in the host bacterium is used, and a promoter and an SD (Shine and Dalgarno) nucleotide sequence are provided upstream of the gene so that the gene of the present invention can be expressed in the vector, and further, protein synthesis. Expression plasmids with the ATG required for initiation can be used. As Escherichia coli as the above-mentioned host bacterium, Escherichia coli (Escherichia coli)
coli) K12 strain and the like are often used, and pBR322 is generally often used as the vector, but the present invention is not limited to this, and various known strains and vectors can be used. Examples of the promoter include tryptophan promoter, P _L promoter, lac promoter, lpp
A promoter and the like can be used, and in any case, the gene of the present invention can be expressed.

The case of using the tryptophan promoter will be described in detail. As an expression vector, a vector pT having a tryptophan promoter and an SD sequence is used.
M1 [Now text Man, Metabolism, Vol. 22, 289 (198
5)] is used, and the restriction enzyme C existing downstream of the SD sequence is used.
A gene encoding a desired polypeptide having ATG added thereto may be linked to the la I site, if necessary.

Not only the direct expression system but also a fusion protein expression system utilizing, for example, β-galactonidase or β-lactamase can be used.

As a method for introducing the thus obtained expression vector into a host cell and transforming it by the method, a generally used method is used, for example, cells in the logarithmic growth phase are mainly collected and treated with CaCl ₂ to spontaneously express DNA. It is possible to adopt a method in which the vector is incorporated so that it can be easily incorporated. In the above method, in order to further improve the efficiency of transformation, it is generally known that MgCl ₂
It is also possible to further coexist with RbCl. Alternatively, a method of transforming host cells into spheroplasts or protoplasts and then transforming them can also be used.

The desired transformant thus obtained can be cultured according to a conventional method, and the desired polypeptide is produced and accumulated by the culture. The medium used for the culture may be any of various media commonly used for ordinary cell culture, and specific examples thereof include L medium,
Examples of the medium include E medium, M9 medium and the like, and various types of medium generally known such as carbon sources, nitrogen sources, inorganic salts and vitamins. When the above tryptophan promoter is used, it can be cultivated using, for example, M9 minimal medium to which casamino acid is added in order to make the promoter work. A drug for enhancing the function of the tryptophan promoter such as indole acrylic acid may be added at the time.

Purification and isolation of the desired polypeptide, that is, the polypeptide of the present invention from the thus obtained culture containing the active substance can be carried out by a conventional method.
In extracting the polypeptide of the present invention from the host, it is preferable to use mild conditions such as the osmotic pressure shock method from the viewpoint of maintaining the higher order structure.

The above-mentioned purification and isolation can be carried out, for example, according to various treatment operations utilizing the physical and chemical properties of the polypeptide [for example, "Biochemical Data Book".
II ”pp1175-1259, 1st edition 1st printing, 1980
June 23, 2014, see Tokyo Kagaku Doujin Co., Ltd.] Specific examples of the method include treatment with an ordinary protein precipitation agent, ultrafiltration, molecular sieve chromatography (gel filtration), liquid chromatography, centrifugation, electrophoresis, affinity chromatography, dialysis. It is possible to adopt a combination of laws, rules, etc.

More specifically, the above operation can be carried out, for example, as follows. That is, first, the polypeptide of interest is partially purified in advance from the culture supernatant. This partial purification is carried out, for example, with an organic solvent such as acetone, methanol, ethanol, propanol, dimethylformamide (DMF), acetic acid, perchloric acid (PCA), trichloroacetic acid (TC).
By treatment using an acid such as A) as a protein precipitant, treatment with a salting-out agent such as ammonium sulfate, sodium sulfate, sodium phosphate and / or ultrafiltration treatment using a dialysis membrane, flat plate membrane, hollow fiber membrane, etc. Done. The operations and conditions of each process may be the same as those of the ordinary method of this kind.

Then, the crudely purified product obtained above is subjected to gel filtration to obtain a fraction in which the activity of the target substance is recognized. The gel filtration agent used here is not particularly limited, and for example, any one made of dextran gel, polyacrylamide gel, agarose gel, polyacrylamide-agarose gel, cellulose or the like can be used. As a concrete example of the above, Sephadex G
Type, LH type, Cefalose type, Cefacryl type (above, Pharmacia), Cellulophane (Chitsuso Co., Ltd.), Biogel P type, A type (Bio-Rad Co.), Ultrogel (LKB company), TS
Commercial products such as K-G type (Toyo Soda Co., Ltd.) can be exemplified.

The polypeptide of interest is obtained by subjecting the active fraction obtained by the above gel filtration to ion exchange column chromatography such as affinity chromatography using a hydroxyapatite column, DEAE method, CM method, SP method and the like. , A chromatofocusing method, reverse-phase high-performance liquid chromatography, etc., or a combination of the above operations, etc. to further purify and isolate as a homogeneous substance.

The chromatofocusing method can be carried out by various known methods. As the column, for example, P
BE94 (manufactured by Pharmacia), a starting buffer such as imidazole-hydrochloric acid, and an eluent such as Polybutafer 74 (manufactured by Pharmacia)-
Hydrochloric acid (pH 4.0) and the like can be used.

The above-mentioned reversed-phase high performance liquid chromatography is
For example, a C ₄ Hypoor reverse phase HPLC column (Bio-Rad Laboratories) or the like can be used, and acetonitrile, trifluoroacetic acid (TFA), water or the like and a mixed solvent of water or the like can be used as a transfer agent. . Thus, the polypeptide of the present invention can be isolated and obtained.

IL-1α can be obtained from the gene encoding IL-1α in the same manner as above.

The resulting polypeptide of the present invention or IL-1
α can be used as an active ingredient to prepare a pharmaceutical preparation useful for the above-mentioned various pharmaceutical applications. The pharmaceutical formulation is
Usually, a suitable pharmaceutical carrier is mixed with the polypeptide of the present invention or IL-1α to prepare a pharmaceutical composition.
Examples of the pharmaceutical carrier include fillers, fillers, binders, moisturizers, disintegrants, surface-active agents, and other excipients or diluents that are commonly used to prepare pharmaceutical preparations depending on the form of use. Can also be used. The form of the pharmaceutical composition is such that it contains the polypeptide of the present invention or IL-1α effectively.
There is no particular limitation, and it may be a solid preparation such as tablets, powders, granules, pills, etc., but it is usually preferable to make injections such as solutions, suspensions, emulsions and the like. It can also be made into a dried product which can be made into a liquid by adding a suitable carrier before use. Any of these pharmaceutical compositions can be prepared according to a conventional method.

The obtained pharmaceutical preparation is administered by a suitable administration route depending on the form of the pharmaceutical composition, for example, injection preparations are administered intravenously, intramuscularly, subcutaneously, intracutaneously, intraperitoneally or the like. The solid dosage form pharmaceutical preparation can be administered orally or enterally. The amount of the active ingredient in the pharmaceutical preparation and the dose of the preparation are appropriately selected depending on the administration method of the preparation, the administration form, the purpose of use, the symptoms of the patient to which the preparation is applied, etc. It is prepared in a dosage form containing about 1 to 80% by weight of the active ingredient, and this preparation is administered in such a range that the amount of the active ingredient contained therein is about 0.1 μg to 10 mg per adult per day. Is desirable. The administration is 1 a day
It does not have to be once and can be divided into 3 to 4 times a day.

[0046]

EXAMPLES The present invention will be described in more detail below with reference to reference examples and examples.

In the following examples, various physiological activities were measured by the following methods.

<Measurement of activity> (1) Measurement of IL-1 activity Method of Oppenhain et al. (J. Oppenhein et al) [J.
Immunol., 116, 1466 (1976)], C
L measured using thymocytes of 3H / He J strain mouse
It was indicated by AF activity.

(2) Measurement of GIF activity 0.1 ml of the test solution diluted to various concentrations was placed in a 96-well microplate (Corning), and then 2 × 10 ⁴ human melanoma cells A375 / ml were placed in each well. 0.1 ml of Eagles MEM suspension containing 10% FCS contained in the above concentration was added to a carbon dioxide incubator (manufactured by Nafco).
Incubate for 4 days. After completion of the culture, 0.05 ml of 0.05% neutral red (manufactured by Wako Pure Chemical Industries, Ltd.) is added to each well, and the mixture is incubated at 37 ° C. for 2 hours. After removing the supernatant,
Wash the wells by gently adding 0.3 ml of phosphate buffered saline to each well. After removing the washing solution, 0.1 m of monosodium phosphate-ethanol equivalent mixture solution was added to each well.
1 and shaken with a micromixer for several minutes to measure the amount of dye taken up in the cells using a photometer for a 96-well microtitration plate (Titer Check Multiscan, manufactured by Flow Laboratories). 5
It is measured at 40 mμ to determine the growth inhibitory activity. The reciprocal of the dilution ratio of the test group showing 50% inhibition of cell growth in the control group (control group), that is, the test group showing the absorbance measurement value of 1/2 of the absorbance measurement value of the control group, was taken to obtain the GIF activity. Use as a unit. Therefore, for example, when the GIF activity is 10 units, the test solution still has an activity of suppressing cell growth by 50% even when diluted 10-fold.

[0050]

[Reference Example 1] Culture of U937 cells Human lymphohistiocytoma U937 cells (Ascenso, JLet a
l., Blood, Vol. 57, p 170 (1981)] 1.
4 × 10 ⁹ pieces of 12-O-tetradecanoylphorbol-13-acetate (TPA) (manufactured by Pharmacia)
25 ng / ml, Concanavalin A (ConA) (manufactured by Sigma) 10 μg / ml and 10% fetal calf serum (FCS)
Was added to RPMI-1640 medium to prepare a cell suspension having a concentration of 4 × 10 ⁵ cells / ml.

10 ml each of this cell suspension was used to measure the diameter 9c.
m Ciale (Falcon 3003), the mixture was cultured in 5% carbon dioxide gas at 37 ° C for 3 days, the culture supernatant was removed with an aspirator, and 10% FCS and bacterial lipopolysaccharide (LPS) (Daifco 10 μg / ml, Muramyl dipeptide (MDP) (Wako Pure Chemical Industries, Ltd.) 1 μg / ml
RPMI-1640 containing 1 ml / ml of TPA and 1 ml of TPA
10 ml of medium was dispensed into each dish. After culturing in this medium in 5% carbon dioxide at 37 ° C. for 18 hours, U937 cells attached to the bottom of the shearle were used as a material for mRNA preparation.

Preparation of mRNA RNA extraction was performed using guanidinium / heat phenol (guanine).
idium / hot phenol) method [Feramisco, JR, et al.,
J. Biol. Chem., Vol. 257, p 11024 (198).
2)] and guanidinium / cesium chloride (guanid
inium / cesium chloride) method [Glisin, V., et al.,
Biochemistry, Vol. 13, p 2633 (1974)].

In order to wash the U937 cells cultured above, after removing the culture supernatant, each dish was rinsed with 5 ml of PBS (-) solution, and then each dish was washed with 1 ml.
ml 4M-guanidine isothiocyanate mixed solution [4M-guanidine isothiocyanate (Fluka), 50 mM Tris HCl (pH 7.6), 10 mM
EDTA, 2% sodium lauroyl sarcosinate] was added to lyse the cells. The lysate was collected with a rubber policeman and a Pasteur pipette to obtain 420 ml of a cell lysate. Keep this solution at 60 ℃, 18G
Chromosomal DNA is sheared by passing it through an injection needle, and then an equal amount of phenol kept at 60 ° C is added to
The solution was further mixed with an 8G injection needle and sheared. Next, to this mixed solution, 210 ml of 0.1 M sodium acetate-10 mM Tris HCl (pH 7.4) -1 mM EDTA solution was added.
And 420 ml of a mixed solution of chloroform-isoamyl alcohol (24: 1 by volume) were added, while keeping the temperature at 60 ° C,
Stir vigorously for 15 minutes. After cooling the mixture on ice, 3000 rp
The mixture was centrifuged at 4 ° C for 20 minutes, and the aqueous layer was collected. 2 in the water layer
Volume of ethanol was added, and the mixture was allowed to stand at -70 ° C overnight, then the crude R
A NA precipitate was obtained. The crude RNA was treated with 6 M guanidine isothiocyanate-5 mM sodium citrate (pH 7.
0) -0.1 M β-mercaptoethanol-0.5% sodium lauroyl sarcosinate solution 48 ml was dissolved, and cesium chloride 19.2 g was added and dissolved. Next, each 7 ml of this mixed solution was added to 5.7 M cesium chloride-
Layer over 4 ml of 0.1 M EDTA (pH 7.5),
Beckman SW40Ti rotor at 25 ℃, 315
RNA was collected by centrifugation at 00 rpm for 20 hours.

The amount of RNA thus obtained was 9.7 mg.

Next, in order to obtain mRNA from the RNA obtained above, oligo (dT) -cellulose (Collaborative Research, Inc.
Column chromatography. Adsorption was performed with 10 mM Tris HCl (pH 7.5) -0.
5M NaCl-1mM EDTA was used and elution was carried out with 10mM Tris HCl (pH 7.5) -1mM EDT.
Conducted in A.

As a result, the obtained mRNA was 400 μm.
It was g.

Preparation of cDNA Library cDNA library was prepared as follows.
Can be expressed in animal cells
ama-Berg) method. That is, the vector primer to which the dT chain was added used for cDNA cloning was obtained from the plasmid pCDV1 and the linker DNA to which the dG chain was added was obtained from the plasmid pL1 by the method of Okayama et al. [Okayama, H. and P. Berg. Molecular an
d Cellular Biology., Vol. 3, p 280 (198
3)].

Next, 15 μg of the above-obtained mRNA was added to 5
mM Tris HCl (pH 7.5) -0.5 mM EDT
Dissolve in 20 μl of A (pH 7.5) aqueous solution and
After incubating for 5 minutes at 37 ° C. for 5 minutes, the reaction solution (total volume 40 μl) was added to 50 mM Tris HCl (pH
8.3), 8 mM MgCl ₂ , 30 mM KCl,
0.3 mM dithiothreitol, 2 mM each dATP,
dGTP, dCTP and dTTP, 2.8 μg of vector primer DNA, RNase inhibitor (Promega
Biotech (60 units) and reverse transcriptase (Bio-Rad) (40 units) were adjusted to incubate at 37 ° C. for 1 hour and 0.5 M EDTA (pH).
7.5) The reaction was stopped by adding 2 μl and 2 μl of 10% SDS. Then, phenol-chloroform extraction and chloroform extraction were performed, and the vector primer cDNA: mRNA was recovered by ethanol precipitation.

Recovered vector primer cDNA
A: mRNA, 140 mM sodium cacodylate, 3
0 mM Tris HCl (pH 6.8), 1 mM CaCl
₂ , after incubating at 37 ° C. for 5 minutes in a reaction solution of 30 μl consisting of 0.1 mM dithiothreitol, 0.3 μg poly (A), 66 μM dCTP and 38 units of terminal deoxynucleotidyl transferase (manufactured by Pharmacia), 0.5M EDTA (pH
7.5) 1.5 μl and 10% SDS 1.5 μl were added to stop the reaction, phenol-chloroform extraction and chloroform extraction were performed, and oligo dC chain-added cDNA: mRNA-vector primer was recovered as an ethanol precipitate.

This recovered nucleic acid was treated with 7 mM Tris HC.
1 (pH 7.5), 7 mM MgCl ₂ , 60 mM Na
Cl, 100 μg / ml bovine serum albumin and 12 units of a restriction enzyme Hind III (manufactured by Nippon Gene Co., Ltd.) in a reaction solution of 20 μl, incubated at 37 ° C. for 90 minutes, then 0.5 M EDTA (pH 7.5) 1 μl and 10 The reaction was stopped by adding 1 μl of SDS. Then, phenol-chloroform extraction and chloroform extraction were performed, and the HindIII-degraded oligo dC chain-added cDNA: mRNA-vector primer was recovered as an ethanol precipitate. Add this to 10 mM Tris HCl (p
H7.5) -1 mM EDTA (pH 7.5) (TE
(PH 7.5)) It was dissolved in 10 μl. One of these
Using μl, the above TE (pH 7.5), 0.1M N
Linker DNA1 with aCl and oligo dC chains added
Incubation was performed at 65 ° C. for 2 minutes in 10 μl of a reaction solution containing 4 ng, then at 42 ° C. for 30 minutes, and then cooled to 0 ° C.

The above reaction solution was further added with 20 mM Tris HCl.
(PH 7.5), 4 mM MgCl ₂ , 10 mM (NH
₄ ) ₂ SO ₄ , 0.1 M KCl, 50 μg / ml bovine serum albumin, 0.1 mM β-NAD (nicotinamide adenine dinucleotide, manufactured by Pharmacia) and 0.6 μg of Escherichia coli DNA ligase (Pharmacia) Was adjusted to 100 μl of the reaction solution containing the product, and incubated at 12 ° C. overnight. To this reaction solution, each of dATP, dGTP, dCTP and dTTP was adjusted to 40 μM, and β-NAD was added to 0.15 m.
M, respectively, and 0.4 μg of Escherichia coli DNA ligase, Escherichia coli DN
4.6 units of A polymerase I (manufactured by Boehringer Mannheim) and 1 unit of Escherichia coli RNase H (manufactured by Pharmacia) were added, and incubated at 12 ° C for 1 hour and then at 25 ° C for 1 hour.

The reaction solution obtained above was used to transform Escherichia coli HB101 strain. As a competent cell of Escherichia coli HB101 strain,
Bethesda Res Laboratories
earch Laboratories: BRL)
The above transformation was performed according to the manufacturer's manual.

Thus, a cDN consisting of about 21000
A library was obtained.

Transfection into monkey COS-1 cells The cDNA library obtained above was divided into groups with an average of 70 clones per group, and plasmid DNA was prepared from each group.

The plasmid DNA is obtained by the alkaline lysis method (Mo
lecular Cloning-A Laboratory Manual, Cold Spring H
arbor Laboratory, 1982, p 368).

The plasmid DNA thus prepared from each group was used as COS-1 cell (Gluzman, Y., Cell, Vol. 23, p 175 (198) of monkey culture cells, respectively.
1)]. The transfer function was obtained by the DEAE-dextran method [Yokot
a, T. et al., Proc.Natl.Acad.Sci., USA., Vol. 8, p.
1070 (1984)]. That is, COS-1 cells were treated with trypsin to obtain RPMI-16 containing 10% FCS.
After suspending the cells in 40 medium and adjusting the cell number to 1 × 10 ⁶ cells / ml, RPMI-1640 medium containing 10% FCS was added to 2 cells.
Add 500 μl to each 6-well plate containing ml / well.
It was dispensed in liters. After culturing overnight at 37 ° C., the supernatant was removed, the cells were washed with a serum-free medium, and 10 μg / ml plasmid DNA, 0.4 mg / ml DEAE-dextran (manufactured by Pharmacia), 50 mM Tris HCl (pH) was added.
RPMI-1640 medium containing 7.4) and 10% FCS was added at 1 ml / well and cultured at 37 ° C. for 4.5 hours. Then, the supernatant was removed, the cells were washed with a serum-free medium, and 150 μM chloroquine (manufactured by Sigma) and 10
RPMI-1640 medium containing 2% FCS was added at 2 ml / well and further cultured at 37 ° C. for 3 hours. Remove the supernatant,
After washing the cells with a serum-free medium, RPMI-1640 medium containing 10% FCS was added at 3 ml / well to give 3 cells.
It was cultured at 7 ° C. for 72 hours. 10% F after collecting the supernatant
RPMI-1640 medium containing CS was added at 2 ml / well and freeze-thawing was repeated twice to recover a cell extract. GIF activity was measured for this culture supernatant and cell extract.

The group showing GIF activity was divided into 24 groups of 10 clones / group, the same operation as described above was carried out, and the GIF activity was measured. For the group showing activity, and for each clone in the group, A clone showing GIF activity was identified by performing the same operation as in.

Thus, pcD-GIF-16 and pcD-
Two clones of GIF-207 were obtained.

The GIF activity (GIF units / ml) of these clones is shown in Table 1.

Table 1 Clone culture supernatant cell extract pcD-GIF-16 48.3 120.7 pcD-GIF-207 62.6 196.9 pcDV1 (control) 0 clone analysis Plasmid pcD-GIF-16 And pcD-GIF-20
The restriction enzyme map of cDNA of 7 is shown in FIG.

In addition, the nucleotide sequence of the cDNA of these et al. Was analyzed by a base-specific chemical modification method [Methods in Enzymology, Vol. 65, p.
499 (1980)] and Phage M13 vector [Ge
ne, Vol. 19, p 269 (1982)] using dideoxy chain termination [Proc. Natl. Aca
d.Sci., USA, Vol.74, p 5463 (1977)].

As a result, the cDNA of pcD-GIF-207 was confirmed to be IL-1α [Carl JM reported by March et al.
arch et al., Nature, Vol. 315, p 641 (198
5)] was confirmed to be the same as the translation region cDNA sequence.

A strain carrying the plasmid pcD-GIF-207 having the cDNA encoding the above IL-1α precursor protein in Escherichia coli χ1776 strain was transferred to the Institute of Microbiology, Institute of Industrial Science and Technology, "Escherichia coli χ17.
The name “76 / pcD-GIF-207” was deposited as Microindustrial Research Institute No. 1294 (FERM BP1294).

Expression and production of polypeptide The above plasmid pcD-GIF-207 was digested with the restriction enzyme Hin.
About 0.66 kb after cutting with d III and Hinc II
The HindIII-HincII DNA fragment was isolated and purified by agarose gel electrophoresis. This DNA fragment was further cleaved with the restriction enzyme Alu I to give about 0.5
A kb Alu I-Hinc II DNA fragment was similarly isolated.

Next, the synthetic oligonucleotide [5'CG
ATAATGTCAGCACCTTTTTAG 3'and
5'CTAAAAGGTGCTGACATTAT 3 ']
Each of the 5'ends was phosphorylated with T4 polynucleotide kinase, the Alu I-Hinc II DNA fragment obtained above was ligated with T4 DNA ligase, and then cut with a restriction enzyme Cla I. About 0.54 kb Cla I-Cla IDN after agarose gel electrophoresis
The A fragment was isolated and purified.

On the other hand, the plasmid pTMI [Nakamoto, O., Metabolism, Vol. 22, 289 (1985)] was used as a restriction enzyme Cla.
Cut with I and calf intestinal alkaline phosphatase (CIAP;
calfintestine alkaline phosphatase) and then prepared about 0.54 kb Cla I-Cla IDN previously prepared.
The fragment A for ligation with T4 DNA ligase was used to express the desired polypeptide ptrp IL-1α-1
I got 13.

The plasmid was transformed into Escherichia coli H
B101 is transformed into B101, and the desired transformant is transformed into plasmid D obtained by the boiling method.
It was selected by analyzing the size of the fragment cut by the NA restriction enzyme.

The outline of the above is shown in FIG.

From the transformant obtained above, the plasmid p trp IL-1α-113 was extracted and transformed into Escherichia coli W3110 to obtain Escherichia coli W3110 / p.
trp IL-1α-113 was obtained.

[0080]

Example 1 (1) Cultivation of transformant The transformant obtained in Reference Example 1 (Escherichia coli W)
3110 / p trp IL-1α-113)
50 μg / ml and L-tryptophan 20 μg / m
LB medium containing 1 (1% tryptone, 0.5% yeast extract)
And 0.5% NaCI) in 10 ml at 37 ° C overnight.
Culture with shaking, and add 8 ml of this to 50 μg / ml ampicillin.
And M9 minimal medium containing 1% casamino acid (0.6% Na
₂HPO _Four, 0.3% KH₂PO_Four, 0.05% NaC
1, 0.1% NH_FourCl, 2 mM MgSO_Four, 0.2%
Glucose and 0.1 mM CaCl₂) In 400 ml
The cells were inoculated into and cultured at 37 ° C. with shaking. E. coli after 9 hours
1M Na₂HPO_FourSuspend in 10 ml and keep in a cold room overnight
After standing, 10 mM Tris HCl buffer (pH 8.
0) was dialyzed for 2 days.

The dialysate obtained was centrifuged to separate into a supernatant and a precipitate. The resulting supernatant was 28 ml and had GI
The F activity was 7.3 × 10 ⁷ units.

(2) Purification of Polypeptide 2 ml of the supernatant obtained in (1) above was subjected to ion exchange chromatography (DEAE-HPLC) using GTi Ultrochrome High Performance Liquid chromatography system (manufactured by LKB). Was purified under the following conditions.

Column: TSK gel DEAE-5PW
(7.5 × 75 mm, manufactured by Toyo Soda Co., Ltd.) Eluent A: 20 mM Tris HCl buffer (pH 8.0) Eluent B: 0.5 mM Na Cl-containing 20 mM Tris HC
l Buffer solution (pH 8.0) Flow rate: 1 ml / min Fraction volume: 1 ml / min / tube As a result of the DEAE-HPLC, the GIF active fraction showed a retention time of 26 to 28 minutes and 32.5 to 34.5 minutes.
It was found in two places. Hereinafter, the active fraction of 26 to 28 minutes will be referred to as "fraction 1", and the fraction of 32.5 to 34.5 minutes will be referred to as "fraction 2".

For each of the above fractions, DEA again.
E-HPLC and high performance gel chromatography were performed to obtain pure fraction 1 and pure fraction 2, respectively.

Since the GIF activity fraction was obtained by separation as described above, the following confirmation test was conducted.

(3) SDS polyacrylamide gel electrophoresis (SDS-PAGE) Method of Laemmli, UK [Nature, 277 , 680 (19)
70)], the SDS-of fractions 1 and 2 above.
I did a PAGE. The conditions are as follows.

Samples: The above fractions 1 or 2 were dried and then dissolved in Laemery's sample buffer [containing 1/20 volume of 2-mercaptoethanol (2ME ⁺ )] and treated at 100 ° C. for 4 minutes.

Gel: 1.5% thick 15% polyacrylamide gel was used.

Electrophoresis device: Bio-Rad
Protean manufactured by the company was used.

Electrophoresis conditions: Electrophoresis was carried out for 2 hours at a constant current of 40 mA.

The gel after the electrophoresis was stained with Bio-Rad's Silver stain kit. As a result, both fractions 1 and 2 have about 1
It was electrophoresed as a single band at 8.3k, and both were almost in agreement with the molecular weight of 18k predicted from the gene.

(4) Isoelectric focusing method (IEF) The isoelectric focusing of the above fractions 1 and 2 was performed on an ampoline PAG plate (L) having a pH range of 3.5-9.5.
KB) and Model 1415 (Bio-Rad). The conditions are as follows.

Sample: Fraction 1 PBS obtained above
A total of 5 lanes of the solution left for 2 days, the same 2 weeks, the fraction 2 PBS solution obtained above for 2 weeks, the control PBS solution and the following marker protein (pI marker protein) used.

<Marker protein> Amyloglucosidase (3.50), soybean trypsin inhibitor (4.
55), β-lactoglobulin A (5.20), bovine
Carbonic anhydrase
drase) B (5.85), human carbonic anhydrase B (6.5)
5), horse myoglobin-acidic band (hors
e myoglobin-acidic band) (6.85), horse myoglobin-basic band
band) (7.35), lentil lectin-acidic band (8.1)
5), lentil lectin-middle band (lentil lec
tin-middle band) (8.45), lentil lectin-basic band
(8.65) and trypsinogen (9.30).

Electrode solution: Anolyte solution = 1MH ₃ PO ₄ Catholyte solution = 1M NaOH Electrophoresis conditions: Constant power 1W / cm gel width cooling for 90 minutes (1
(0 ° C.).

Staining: Staining was carried out with a Silver Stein kit.

After the electrophoresis, the gel was sliced at 1 cm intervals, extracted by shaking with 1 ml of distilled water (2 days), the pH was measured, and the isoelectric point was calculated.

As a result, the isoelectric point of the fraction 2 (p
I) is about 5.0 and was run as a single band at this position. Fraction 1 has an isoelectric point of about 5.
It was run as two bands at 2 and about 5.0.

(5) Amino acid composition 30 μl of each of the above-mentioned fractions 1 and 2 was added to 12 mm.
It was carefully put in the bottom of a thick 120 mm thick test tube made of Pyrex and dried under reduced pressure with a desiccator containing sodium hydroxide particles. 4N- in a test tube containing a dry sample
Methanesulfonic acid [containing 0.2% 3- (2-aminoethyl) indole, manufactured by Pierce] 50 μ
1 was added, and the mixture was degassed at 0.1 to 0.2 mmHg for 1 minute and then sealed under reduced pressure. The hydrolysis was performed in a heater at 118 ° C. for 24 hours. After opening the tube, neutralize with 46 μl of 4N-sodium hydroxide, and 450 μl with citrate buffer for dilution.
And

The amino acid analysis was carried out by injecting 250 μl of the above sample solution using an amino acid analyzer (Hitachi 835 type analyzer). The separated amino acids were detected by the orthophthalaldehyde method. The quantification was performed by using a calibration curve prepared with standard amino acids analyzed before and after the sample.

The results are shown in Table 2 below in terms of molar ratio of each amino acid based on Phe (10 mol). still,
Under the above analysis conditions, Pro and Cys cannot be measured.

[0102] (6) Amino acid sequence 150 μl of each of the above-mentioned fractions 1 and 2 was analyzed by a protein sequencer (Model 470A) manufactured by Applied Biosystems. Generated PTH-amino acid was added in an amount of 100 to 50 μl of 33% aqueous acetonitrile solution.
Was appropriately diluted with 5 μl, and 5 μl thereof was injected with a Waters 710B type autosampler. The chromatographic system operated two Beckman 112 type pumps with a 421 type controller. The column used was 2 mm × 250 mm filled with Ultrasfair ODS-5 μm and kept at 55 ° C. with a column heater. The flow velocity is 0.
3 ml / min, using a mixed solution of 20 mM sodium acetate and acetonitrile, and separating by gradient elution method,
Monitored at 269 nm. Analysis was 45 minutes.

As a result of 40 cycles of analysis, the amino acid sequences of both were identical except for the 36th amino acid,
Each was as follows.

Ser-Ala-Pro-Phe-Ser-Phe-L
eu-Ser-Asn-Val-Lys-Tyr-Asn-Phe-Met
-Arg-Ile-Ile-Lys-Tyr-Glu-Phe-Ile-
Leu-Asn-Asp-Ala-Leu-Asn-Gln-Ser-I
The 36th amino acid of le-Ile-Arg-Ala-X-Asp-Gln-Tyr-Leu fraction 1 (X above) is
The amino acid predicted from the sequence of the gene was Asn, and that of Fraction 2 was Asp.

From the above, the fraction 1 is the polypeptide represented by the above formula (A), that is, IL-1α, while the fraction 2 has Asp at the 36th amino acid of the IL-1α. It was confirmed to be the polypeptide of the present invention. Hereinafter, the polypeptide of the present invention is referred to as "polypeptide I".

It was found that the above IL-1α lacks material stability, and partially changes to polypeptide I, which is more stable even in, for example, Tris-HCl buffer (pH 8.0).

Example 2 (1) Production of Polypeptide I of the Present Invention Using the plasmid p trp IL-1α-113 obtained in Reference Example 1, Site-Specific Mutagenesis [Proc. Nat.Acad.Sc
i., 81 , 5662-5666 (1984)], a plasmid for expressing polypeptide I was obtained, from which polypeptide I was produced as follows.

That is, the M13mp11 charge vector was
Used as a single-stranded (ss) DNA template. First, from the plasmid p trp IL-1α-113, EcoRI / BamHI
The DNA fragment was excised and cloned into the restriction enzyme sites of EcoRI and BamHI of M13mp11 phage (RF). From this, single-stranded (ss) DNA (M13-
IL-1α-113) was obtained, and this was used as a template for miutagenesis.

Synthetic oligonucleotide [5'-ACTG
GGTGAGCTTGGCAG-3 '(primer)]
Was phosphorylated with T4 polynucleotide kinase, which was hybridized with ssM13-IL-1α-113DNA, and after annealing, in the presence of dNTPs, DNA polymerase I (Klenow fragment) and T4DNA.
Each was treated with ligase and incubated at 15 ° C. for 18 hours.

The obtained DNA was transformed into JM105 competent cells, and the resulting colonies were inoculated on 50 agar plates and cultured at 37 ° C. for 18 hours. The filter containing the grown colonies was alkali-denatured by a usual method, dried and then baked at 80 ° C. for 2 hours. After prehybridizing this filter, this and the 5'end of the above primer were
³² and P-gamma-ATP in labeled ³² P- Purobe and hybridized at room temperature. The hybridized filter was washed with a 6 × ssc buffer for 10 minutes at room temperature and then for 5 minutes at 54 ° C., dried, and then dried at −70 ° C. for 1 minute.
Autoradiography was performed for 8 hours.

Of the 5 mutated clones, M was used as a representative.
13-IL-1α-36D was selected, and this was infected with JM105 and cultured to prepare ssDNA and RFDNA.

The mutation of the gene of interest was confirmed by M13 dideoxythiein termination sequencing of the ssDNA obtained above.

From the RF DNA grown in JM105,
An EcoRI / BamHI fragment was prepared and incorporated into an expression plasmid in the same manner as in the above Reference Example to obtain the desired polypeptide I expression plasmid (IL-1α-36D).

Using this plasmid, polypeptide I was expressed in the same manner as in Example 1 and purified (DE
As a result of AE-HPLC, a single GIF activity peak was given) to obtain the target polypeptide I having the above-mentioned physical properties. Its specific activity is about 1 × 10 ⁷ GIF units / m
It was g protein.

[0115]

Example 3 (1) Production of Polypeptides II and III of the Present Invention In Example 2, 5'-ACTGGG was used as a primer.
Using TGAGCTTGGCAG-3 ′, the 141st amino acid (Cys) of IL-1α was converted to S in the same manner.
Thus, p trp IL-1α-141S, which is a plasmid for expressing the polypeptide of the present invention substituted with er, was obtained.

Expression and purification were carried out in the same manner as in Example 1 using the plasmid, and as a result, DEAE- was similarly obtained.
Two peaks of GIF activity were obtained by HPLC.

As a result of the same analysis of the above,
The peak fraction in the earlier retention time is
The polypeptide predicted from the gene sequence, namely IL-1
It was confirmed to be the polypeptide of the present invention (polypeptide III) in which the 141st amino acid (Cys) of α was replaced with Ser.

Further, as a result of the same analysis, the other peak fraction was determined to be the 36th amino acid (A of IL-1α).
sn) and the 141st amino acid (Cys) have been identified as the polypeptide of the present invention in which Asp and Ser are substituted, respectively. Hereinafter, this polypeptide is referred to as "polypeptide I.
I ".

Example 4 (1) Production of Polypeptide II of the Present Invention In the same manner as in Example 3, using the plasmid p trp IL-1α-141S prepared in Example 3 as a primer, 5′-ATTCGAGCCGATGATCAG was prepared. −
By using 3 ′, a desired plasmid for expressing polypeptide II, p trp IL-1α-36D · 141S, was obtained.

The above plasmid p trp IL-1α-36D
・ HB101 strain was made to possess 141S, and this was designated as "Escherichia coli HB101 / IL-1α-3".
6D · 141S ”was deposited as Micro Engineering Research Article No. 1295 (FERM BP1295).

Using the plasmid, expression and purification were carried out in the same manner as in Example 1 to obtain the polypeptide of interest II of the present invention.
Got

The molecular weight of this product was confirmed by SDS-PAGE to be about 18 kd. The isoelectric point (pI) of this product by IEF was about 5.0. Specific activity of polypeptides II and III (GIF activity)
Was equivalent to polypeptide I.

[0123]

[Pharmacological Test Example 1] GIF activity and LAF activity The GIF activity of the polypeptide of the present invention is as described above, and all of the polypeptides I, II and III show LAF activity almost equivalent to the GIF activity. Indicated.

Further, the following tests were conducted on the polypeptide of the present invention.

Anti-tumor effect. 200,000 cells of tumor cell female A (Meth A) were treated with BA
LB / c mice were intradermally inoculated (id) (day 0).
Then, on days 7 and 8, polypeptide I.
3, 1 or 3 μg / mouse was administered once intratumorally to each experimental animal.

[0126] Seven experimental animals were used as one test group. Only the solvent (1% mouse serum) was similarly administered to the control group.

The test results are shown in FIG. In the figure, the horizontal axis represents the days (days) after tumor cell inoculation, and the vertical axis represents the tumor weight (m
curve (1) is the control group, curve (2) is the 0.3 μg administration group of polypeptide I, curve (3) is the 1 μg administration group of polypeptide I, and curve (4) is Each of the 3 μg administration groups of polypeptide I is shown. The tumor weight is shown as mean ± standard deviation (SD),
* P <0.05 in Student's T-test
, ** indicates the same P <0.01.

CSF production promoting effect test -1 Cell line U-373MG [ATCC HTB17,
Glioblastoma, Astrocytoma, Human] was used for the following tests.

That is, first, 2 × 10 ⁵ cells / m 2 of the above cells were prepared.
10% fetal bovine serum (GIBCO
Co., Ltd.), MEM non-essential amino acid (Flow) and MEM sodium pyruvate (Flow)
The cells were suspended in M medium (Nissui Co., Ltd.).

Polypeptide I was added to the above cell suspension at various concentrations, and the mixture was placed in a carbon dioxide incubator at 37 ° C.
After culturing for 24 hours in each culture supernatant, each culture supernatant was collected, and the amount of CSF produced and accumulated in the culture supernatant was measured using mouse myeloma cells [Lewis, IC et al., J. Immunol., 12
8 , 168 (1982)].

The obtained results are shown in FIG. In the figure, the horizontal axis represents the polypeptide concentration (ng / ml), and the vertical axis represents the CSF activity (unit / ml, × 10 ^-2 ).

-2 When the polypeptide I was administered in vivo, it was tested in the following experiment that the in vivo CSF production enhancing action was expressed.

That is, various amounts of polypeptide I were subcutaneously administered to normal mice (BALB / c strain mice, purchased from Shizuoka Experimental Animal Cooperative Association). Blood was collected from each experimental animal 8 hours after the above administration, and the CSF activity in the serum was measured as described above.
Measurement was carried out using mouse myeloma cells in the same manner as in -1.
As a control, a human serum albumin (HSA) administration group was prepared and subjected to the same test.

The results are shown in FIG. In the figure, the horizontal axis represents the dose of polypeptide I or the dose of HSA (both μ
g / mouse), the vertical axis represents CSF activity (unit / ml serum,
× 10 ⁻³ ) is shown.

Anti-Inflammatory Test Winter's method [Proc. Soc. Exptl. Biol.
This test was performed according to Med., 111 , 544-547 (1962)].

That is, 6 to 8 week old male rats (Spraque Da
Wley strains (Charles River Japan, Inc.) were used by dividing them into groups of 6 to 8 animals based on the body weight on the day before the experiment. Carrageenin (produced by Marine Colloid Co., Ltd.) was used as an inflammatory agent suspended in physiological saline to a concentration of 1%, and 0.1 ml was injected subcutaneously into the rat right hind footpad to induce paw edema. Let To assess paw edema, the volume of the right hind footpad was measured with a plethysmometer (plethythym) at fixed times before and after injection of the inflammatory agent.
It was measured using a smometer, manufactured by Ugo-Vasile. The edema rate (swelling)
%).

The test substance was dissolved and diluted in Dulbeco's phosphate buffered saline and injected into the dorsal skin of the rat at an amount of 0.1 ml, 1 hour before the injection of the inflammatory agent. A solvent administration group was prepared as a control group and subjected to the same experiment.

The results are shown in FIG. In the figure, the horizontal axis represents the time (hr) after administration of the inflammatory agent, and the vertical axis represents the edema rate (%). In the figure, curve (1) is the control group, curve (2) is the polypeptide I 0.1 μg administration group, curve (3) is the polypeptide I 1 μg administration group, and curve (4) is the polypeptide Each of the 10 μg administration groups of I is shown.

Radiation injury prevention test BALB / c mice (9 weeks old) were intraperitoneally injected with polypeptide I at 1 μg / mouse or 0.3 μg / mouse 20 hours before irradiation with lethal dose of X-rays. .

Using an X-ray irradiator (MBR-1505R, Hitachi Medical Co.), the mouse was whole-body irradiated with 850 X-rays of X-ray, and thereafter the survival was confirmed every day. As a control, a PBS administration group was set.

The results are shown in FIG. In the figure, the horizontal axis is X
The number of days (day) after irradiation with radiation is shown, and the vertical axis shows the survival rate (%) of the test animals. Curve (1) shows the group administered with 1 μg of polypeptide I, and curve (2) shows the value of 0. The 3 μg administration group and the curve (3) show the control group.

From FIG. 7, in the control group, all the patients died on the 18th day after X-ray irradiation, whereas the polypeptide I
It was confirmed that in the administration group, a radiation damage-preventing action was observed depending on the dose, and particularly in the 1 μg administration group, about 80% were avoided from death due to radiation damage and survived.

Opportunistic Infection Protective Effect Test The following tests were carried out using easily infected model mice.

(1) Male ICR mice (6 weeks old) were used as test animals (7 mice per group), and on the first day, 100 mg / kg of 5-fluorouracil (5-Fu, manufactured by Kyowa Fermentation Co., Ltd.) was used. It was administered intravenously. On the 2nd, 4th and 6th day,
1 μg / mouse of the polypeptide I was subcutaneously administered, and on the 7th day, a predetermined amount of Pseudomonas aeruginosa E-2 was intraperitoneally administered to be infected. On the 10th day, the number of surviving test animals was counted to determine the survival rate (%).

The results are shown in FIGS. 8 (1) to 8 (3).

FIG. 8 (1) shows the results of the above experimental group, the same (2) shows the results of the control group which did not receive the polypeptide I (only 5-Fu was administered), and the same (3). Is 5-F
The results of the control group to which neither u nor polypeptide I was administered are shown.

In FIG. 8, the vertical axis represents the survival rate (%), and the horizontal axis represents groups A to E in which the following doses of Pseudomonas aeruginosa were adopted.

Group A: 19000 bacteria / mouse administration group B group: 3800 bacteria / mouse administration group C group: 750 bacteria / mouse administration group D group: 150 bacteria / mouse administration group E group: 30 bacteria / Mouse administration group F group: 6 bacteria / mouse administration group IL-1α CSF production promoting effect test As a CSF producing strain, a human lung cell-derived strain HFL-1 (Hu
The following tests were performed using man Embryonic Lung Fibroblasts, ATCC registered cell line No. CCL-153).

First, the above HFL-1 cells were adjusted to a cell concentration of 2 × 10 ⁵ cells / ml with a hamster 12K culture medium containing 10% fetal bovine serum [Ham, RG, Proc. Natl. Acad.
Sci., 53 , 288 (1965)]. Next, the IL-1α obtained in Example 1 prepared in various concentrations was added to the cell suspension, and the cells were placed in a carbon dioxide gas incubator at 37
Cultivated at ℃ for 24 hours, 48 hours and 72 hours respectively, collected each culture supernatant and produced and accumulated CSF in the culture supernatant.
Quantities were measured using mouse bone marrow cells [Lews, IC
et al., J. Immunol, 128 , 168 (1982)].

The results are shown in Table 3.

[0151] Based on the above results, the addition of IL-1α was
It is clear that the amount of CSF produced by the -1 cell line is enhanced as compared with that without addition.

Method for Producing Cytokines from Animal Cells Varying concentrations of Polypeptide II and 0.01% PHA-P
In the presence of HBS-2C5B2 cells [J. Immunol., 13
1 , 1682-1689 (1985)], 2 × 10 ⁵
Cultured in cells / well. The supernatant after 24 hours of culturing was collected, and its IL-2 activity was determined by IL-2 dependent mouse T cell (CTLL) according to the method of Kamith et al.
2) was used to measure [J. Immunol., 120 , 2027
(1978)]. The results are shown in Table 4 below.

Table 4 Polypeptide II Concentration (ng / ml) IL-2 Activity (cpm × 10 ⁻³ ) Average (n = 5) 0 0.4 0.0005 0.4 0.005 0.6 0 0.05 2.1 0.5 3.2 5 3.5 50 3.9 500 3.8 From the results shown above, it is possible to efficiently produce natural cytokines from animal cells by using the polypeptide of the present invention. You know what you can do.

When applying the polypeptide of the present invention to such a method, an extremely small amount, usually 10 ng / ml, is used.
The use of a degree is sufficient and also facilitates the purification process of the induced cytokines.

When producing cytokines from animal cells, the polypeptide of the present invention used for attracting production is structurally stable under the conditions, and IL-on the cell surface is
Binding to one receptor is essential. That is, it is important that the polypeptide of the present invention binds to the IL-1 receptor and transmits a signal required for cytokine production into cells.

Therefore, the following test was conducted for binding to the IL-1 receptor on fibroblasts.

On a 6-well plate, almost uniform on one surface
Balb / 3T3 cells (clone A31:
ATCC, CCL-163, 1 x 10⁶cells / well)
To ¹²⁵IL-1β labeled with I [Biochemistry 58,8,
p840 (1986); EPO187991]] 50.
000 cpm / well and D-MEM with 10% FCS in advance
20 ng / incubated for 24 hours at 37 ℃
Add 1 ml of IL-1β or polypeptide II and incubate at 4 ℃.
I responded. Remove the reaction solution with a Pasteur pipette, 10%
Add 1 ml of FCS-supplemented D-MEM and wash gently to remove the supernatant.
I was After repeating this washing operation twice, 1 ml of 1% S was added.
Solubilized solution by solubilizing cells with DS, 0.2N NaOH
And the radioactivity in the solubilized solution in which the wells were washed (bound release)
Radioactivity) was measured with a γ-counter.

The above ¹²⁵ I-labeled IL-1β was prepared by the method of Bolton and Hunter [Biochem.
It was produced and purified according to J., 133 , 529 (1973) (specific activity; 250 μCi / μg protein or more).

The results obtained are shown in Table 5 below.

[0160] The stopping power (%) in the table was calculated by the following formula.

Binding capacity (%) = (A−C) / (A−B) × 100 where A is the bound radioactivity in the absence of unlabeled polypeptide I, and B is non-specific for the plate. The radioactivity adsorbed on the, and C indicates the measured value of the bound radioactivity.

Such an index represents the binding ability of coexisting IL-1β or polypeptide II to the IL-1 receptor.
The IL-1β receptor is known to be common to IL-1α and IL-β.

From Table 5 above, it is understood that the polypeptide II is extremely preferable for such application without lowering the binding power to the IL-1 receptor even under the condition of cytokine-induced production.

[0164]

[Formulation Example 1] Human serum albumin (HSA) was added to a physiological saline solution of 1 × 10 ⁷ units / ml of polypeptide I in a physiological saline solution so as to be 0.5% and filtered (0.22 μm membrane). Then, 1 ml of this was aseptically dispensed into vials and freeze-dried to prepare a preparation for injection.

The preparation thus obtained is used by dissolving it in 1 ml of distilled water for injection before use.

[Brief description of drawings]

FIG. 1: Plasmid pcD-GIF-16 and plasmid
3 shows a restriction map of pcD-GF-207 cDNA.

FIG. 2: Plasmid pcD-GIF-207 and plasmid
1 shows a schematic diagram of constructing plasmid p trp IL-1α-113 from pTM1.

FIG. 3 shows the results of an antitumor effect test.

FIG. 4 shows the results of a CSF production promoting effect test.

FIG. 5 shows the results of a CSF production promoting effect test.

FIG. 6 shows the results of anti-inflammatory test.

FIG. 7 shows the results of radiation damage prevention test.

FIG. 8 shows the results of an opportunistic infection protection effect test.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁵ Identification code Internal reference number FI Technical display location A61K 37/02 AED C12N 15/25 C12P 21/02 ZNA K 8214-4B // (C12P 21/02 C12R 1:19) (31) Priority claim number Japanese Patent Application No. 61-160250 (32) Priority date Sho 61 (1986) July 8 (33) Priority claim country Japan (JP) (31) Priority claim number Japanese patent application Sho 61-200323 (32) Priority date Sho 61 (1986) August 27 (33) Priority claiming country Japan (JP) (72) Inventor Hidemitsu Hong 129- Miyanonishi, Kitahama, Senyo-cho, Naruto-shi, Tokushima Prefecture 4 Sun Lounge House No. 105 (72) Inventor Kazuyoshi Kawai 130-2, Maho, Maho, Matsuho-cho, Itano-gun, Tokushima Prefecture Soleil No. 503 (72) Inventor, Settsuko Kaneka, Kagasuno, Kawauchi Town, Tokushima City, Tokushima Prefecture 1090-18 (72) 72) Inventor Kiyoshi Ishii Ai, Itano-gun, Tokushima Prefecture Sumiyoshi, Sumiyoshi Character 39-46 (72) Inventor, Yasuo Yanagihara 891-6, Omatsu, Kawauchi-cho, Tokushima City, Tokushima Prefecture (72) Inventor, Yoshikatsu Hirai 5-49, Shinkira, Kitajima-cho, Itano-gun, Tokushima Prefecture Ekogawa

Claims (7)

[Claims] 1. The formula: A modified amino acid characterized in that in the amino acid sequence of interleukin-1α represented by, at least one amino acid at position 36 Asn and position 141 Cys is deleted or substituted with another amino acid. An interleukin-1α derivative having a sequence. 2. The interleukin-1α derivative according to claim 1, which has a modified amino acid sequence in which Asn at position 36 is substituted with another amino acid. 3. The interleukin-1α derivative according to claim 2, wherein the other amino acid is Asp. 4. The interleukin-1α derivative according to claim 1, which has a modified amino acid sequence in which Cys 141 is substituted with another amino acid. 5. The interleukin-1α derivative according to claim 1, which has a modified amino acid sequence in which Asn at position 36 and Cys at position 141 are both substituted with another amino acid. 6. The Asn at position 36 is Asp and the Cys at position 141 is S
The interleukin-1α derivative according to claim 5, which has a modified amino acid sequence that is also substituted with er. 7. The interleukin-1α derivative according to claim 1, which has a modified amino acid sequence in which the 36th amino acid is Asp and the 141st amino acid is Cys.