KR960010950B1 - IL-1Ñß DERIVATIVES AND DRUGS - Google Patents

Abstract

None.

Description

IL-1α Derivatives and Pharmaceuticals

1 shows a restriction map of the cDNA of plasmid pcD-GIF-16 and plasmid pcD-GIF-207;

2 is a diagram showing how plasmid ptrpIL-1α-113 is constructed from plasmid pcD-GIF-207 and plasmid pTMI;

3 shows anticancer activity test results;

4 and 5 show the results obtained by testing CSF production promoting effect of the polypeptide of the present invention;

6 shows the results obtained by testing the anti-inflammatory effect of the polypeptides of the present invention;

Figure 7 shows the results obtained by testing the radioactive injury prevention activity of the polypeptide of the present invention;

8 shows the results obtained by testing the opportunistic prophylactic activity of polypeptides of the invention.

The present invention relates to novel derivatives of the novel polypeptides, more particularly interleukin-1α (hereinafter referred to as IL-1α) and the pharmaceutical uses of IL-1α and novel derivatives thereof.

The Second Imternational Lymphokine Worksh p, apoptotic activator (LAF), mitosis promoting protein, helper peak-1, and T-cell substitution factor III (TRF) -III), T-cell substitution factor Mφ (TRFM), B-cell activator, B-cell differentiation factor, and the like, interleukin-1 (IL-1), the unified name for the physiologically active substance was adopted (Cellular Immunol., 48 433--436 (1979) This determination is based on the reason why the bioactive substances cannot be distinguished from one another and the physiological activity is expressed in various ways as interpreted at various angles.

And IL-1 activates T lymphocytes and B lymphocytes, has the activity of enhancing the production of interleukin-2 and antibodies, promotes protein synthesis on liver tissue, and promotes the production of prostagladins (See Reviews of Infectious Disease, Vol. 6, No. 1, 51-59 (1984), New England J. of Med., 311, 1413 (1984), etc.).

It has only recently been reported that IL-1 itself is still classified as one substance, whereas there are two different genes that specify the genetic information of a polypeptide or its precursor having LAF activity (Proc. Natl. Acad. Sci. , Vol. 81, 7907-7911 (1984), Nature, Vol. 315, 641 (1985), Nucleic Acid Research, Vol. 13 (16), 5869 (1985)).

According to the above report, it was found that the culture supernatant obtained by the genetic recombination technique had LAF activity, and by the above discovery, the polypeptide represented by the following formula (A) was a polypeptide having LAF activity and named IL-1α. .

However, there are no reports of homogeneously separating and preparing the active substance as well as the bioactive substance known as IL-1, and there is no report on the physiological activity of the homogeneous substance.

The present inventors have conducted in-depth studies on the homogeneous substance of IL-1α, and have already established a technique regarding the body method of the substance and revealed its characteristics, physical properties, and the like. Based on the results of the study, the inventors also confirmed that the polypeptide of formula (A) has LAF activity.

Nevertheless, although polypeptides correspond to biological genes as reported, they are unstable by themselves.

Accordingly, an object of the present invention is to provide a novel polypeptide (IL-1α derivative) having a different amino acid sequence from formula (A), which is more stable in substance and suitable for medical use.

The present invention provides a method for producing an IL-1α derivative, that is, a polypeptide by a gene designating genetic information of a novel IL-1α derivative and genetic engineering techniques using the gene.

In addition, the present invention provides a novel medical use of IL-1α itself.

More specifically, in the formula (A), the present invention provides a modified amino acid sequence of interleukin-1α, which is represented as lacking at least one amino acid residue selected from 36 positions of Asn and 141 positions of Cys or substituted with another amino acid. It provides a polypeptide having.

Amino acids and polypeptides herein are referred to according to the conventions or nomenclature recommended by IUPAC and IUPAC-IUB or symbols commonly used in the art of air technology.

Hexanes of the base sequence are expressed in the same way.

IL-1α derivative of the present invention is LAF activity, activity to inhibit the growth of tumor cells (GIF activity), that is, activity to specifically inhibit the growth of tumor cells, colony stimulating factor (CSF), interferon (IFN), interleukin -2 (IL-2) and interleukin-3 (IL-3) and the like to promote the production of various cytokines, ie, to promote the production of the cytokine to human cells, for example, anti-inflammatory activity, such as For example, when arthritis is administered to a model animal, it may be effective in inhibiting the progression of arthritis, and in preventing an injury by radiation, that is, systematic radiation investigation during bone marrow transplantation, radiation investigation for cancer treatment, and radiation accident. It has activity to prevent any biological disease or serious side effects. Thus, the homogeneous derivatives of the present invention are, for example, immune system stimulants, anticancer agents, promoters of cytokines such as CSF, IFN, IL-2 and IL-3 for promoting antibody production and enhancing the effect of vaccines, It is very useful as an anti-inflammatory agent, an anti-radioactive agent and other similar medicines. In particular, the polypeptides of the present invention have properties that are very stable substances and have low toxicity. And while IL-1 is known to be pyrogenic, the polypeptide of the present invention is excellent in low side effects.

The derivatives of the present invention are particularly useful as CSF production promoters. When administered to humans, the derivative effectively treats granulocytopenia due to bone marrow deficiency caused by chemical or radiation treatment of cancer without the possibility of viral infection or antigen-antibody reactions (a drug for reducing granulocytosis). CSF production promoters can also be used to prevent and treat various diseases due to CSF production activity promoted by the agents described below. CSF, for example, acts to enhance the function of granulocytes and macrophages (Lopez, AF et al., J. Immunol., 131, 2983 (1983); Handam, E. et al., J. Immunol., 122, 1134 ( 1979) and Vadas, MA, et al., J. Immunol., 130, 795 (1983), for the clinical adaptation of CSF to the prevention and treatment of various diseases.

Recently, it has been known that compromised hosts with impaired biodefense undergo a so-called opportunistic infection or terminal infection if the harmless pathogen becomes pathogenic. Clinically, the infection is Gram-negative bacillus such as Pseudomonas and Serratia, hippie simplex virus (HSV), viricella-zoster virus (VZV) and cytosine. Viruses such as megalovirus (CMV), fungi such as candida albicans, Aspergillus fumigatus and nocardia asteroidea, Pneumocystis carinii And protozoa such as toxoplasma gondii. Since the antibiotics currently used are not fully effective against opportunistic infections, research into the development of novel pharmaceuticals for such infections is desired. The derivatives of the present invention are also effective in the prevention and treatment of opportunistic infections, which often occur when the anticancer agent is administered. For example, various infections that occur during chemotherapy and bone marrow transplantation of acute leukemia, such as candidososis, cryptococcosis, aspergillosis, conjunctivitis, chromogenomycosis, viral infections, cytomegalovirus pneumonia and combinations of these infections It is useful for treating and preventing symptoms.

In addition, the polypeptide of the present invention is effective for the prevention and treatment of arthritis and the like, and thus is useful as an anti-inflammatory agent.

The polypeptide of the present invention has an activity of inhibiting the growth of tumor cells (hereinafter referred to as GIF activity), which is determined by the method described below, and specifically acts on various kinds of tumor cells to inhibit their growth. Therefore, the anticancer composition containing the polypeptide of the present invention as an active ingredient is advantageous to be used as a cancer treatment agent, and especially in combination with various agents for enhanced palliative therapy and palliative maintenance for treating malignant tumors.

In addition to the above-mentioned pharmaceutical uses, the polypeptides of the present invention have an activity of promoting the production of their cytokines, for example, and are useful for producing various useful cytokines from cell lines in vitro. Attention has been directed to the production of natural cytokines, in particular cytokines, glycoproteins. Useful cytokines can be produced efficiently in large quantities.

This study found new biological activity of IL-1α.

IL-1α of the present invention has GIF activity and CSF production promoting activity, and these activities can be used for various therapeutic purposes described above.

Preferred among the polypeptides of the invention are those having an amino acid sequence deficient in at least 36 Asn of Formula (A) or substituted with another amino acid. The amino acid which may be substituted with Asn at position 36 and Cys at position 141 may be any of α-amino acids constituting a biological protein.

However, since Cys has an SH group, it is easy to form intramolecular or intermolecular bonds, and amino acids other than Cys are preferable.

Specifically, Asp is preferable for the Asn substitution at the 36 position and Ser is preferable for the Cys substitution at the 141 position.

Polypeptides of the present invention, for example, by genetic engineering techniques using genes that specify the genetic information of the specific polypeptide of the present invention, that is to put the gene in a carrier for microorganisms to perform replication, transcription and transfer in the microorganisms It can manufacture. The method is advantageous in that mass production is easy.

Genes used in the present method can be synthesized by chemical synthesis of nucleic acids by conventional methods, for example, phosphite triester method (Nature, 310, 105 (1984)), but the genetic information of IL-1α It is convenient to use the gene or precursor thereof. By a conventional method including the above chemical synthesis, the gene is transformed into a hexane sequence which designates the genetic information of the specific amino acid sequence, thereby allowing the desired gene to be easily produced.

Genes that designate the genetic information of IL-1α and precursors thereof are already known. The present inventors have succeeded in producing IL-1α by obtaining a gene designating the genetic information of IL-1α and genetic manipulation using this gene. The genetic engineering techniques used will be described in the reference examples below.

The modified hexane (base) sequences mentioned above are prepared by known methods, which are performed according to the amino acid sequences of the desired polypeptide (Molecular Cloning, Cold Spring Harbor Iaboratory) (1982).

For example, DNA cleavage, conjugation, phosphorylation, and the like can be carried out by conventional methods including treatment of enzymes readily available with products such as restriction enzymes, DNA ligase, polynucleotide kinases and DNA polymerases. Isolation and purification of the genes and hexanes involved in the method is also carried out by conventional methods such as agarose gel electrophoresis. As will be explained later, the gene obtained is replicated using conventional carriers. DNA fragments specifying the desired amino acid sequence and genetic information of the synthetic liquor can be easily prepared by the above-mentioned chemical synthesis. The codons corresponding to the desired amino acids and to be used in the method are known and selected as desired. For this purpose, conventional methods may be used, for example, depending on the codon usage of the host to be used (Nucl. Acids Res., 9, 43-73 (1981)). In order to alter the codons in the relevant hexane sequences, site-specific mutafenesis (Proc. Natl. Acad. Sci., 81, 5662-5666 (1984)) is usually used to specify the genetic information of the desired modification sequence. It is carried out using an initiator containing 15-30 monomers of synthetic oligonucleotides.

The desired gene obtained by the above method may be a nucleotide sequence, for example, Mem. Enzym., 65, 499-560 (1980), or a dideoxynucleotide chain termination method using N13 phage. Messing, J. and Viera, J., Gene, 19, 269-276 (1982)).

The methods and procedures will be described in the following Reference Examples and Examples but are not specifically limited; All known methods in the art can be used.

As described above, the present invention also provides a novel gene (hereinafter, referred to as the gene of the present invention) that designates the genetic information of the polypeptide having the designated amino acid sequence.

The polypeptide of the present invention can be produced by conventional gene synthesis techniques using the gene of the present invention. More specifically, recombinant DNA capable of expressing the gene of the present invention in the host cell is prepared to transform the host cell and culture the transformant.

Useful hosts can be advanced or nucleated cells.

Eukaryotic cells include cells of vertebrates, yeast, and the like. Commonly used vertebrate cells include monkey cells, COS cells (Y. Gluzman, Cell, 23 175-182 (1981)), dihydrofolate reductase defects of Chinese hamster ovary cells (G. Urlaub and LA, Chasin, Proc. Natl. Acad. Sci., USA, 77, 4216-4220 (1980)) and the like, but useful cells are not limited thereto. Useful expression carriers of vertebrate cells include promoters located upstream of the gene to be expressed, RNA conjugation sites, polyadenylation moieties, transcription termination sequences, and the like.

The carrier may have a replication origin when needed.

Examples of useful expression carriers include, but are not limited to, pSV2dhfr (S. Subramani, R. Mulligan and P. Berg, Mol. Cell. Biol., 1 (9), 854-864) with an initial promoter of SV 40. Do not.

Examples of those commonly used as expression carriers of yeast include pAM82 (A. Miyanohara et al., Proc, Natl. Acad. Sic., U.S.A., 80, 1-5 (1983)) having a promoter of an acidic phosphatase gene.

this. Coli and Bacillus certilis are widely used as nucleus-free hosts. The present invention uses, for example, a polyimide carrier capable of replicating in a host cell. To express a gene in a carrier, an expression plasmid with SD (sine-dalgarno) sequences upstream of the promoter and gene and ATG necessary for initiation of protein synthesis can be used. Widely used teeth. Coli host Collie K12 strain. pBR322 is a widely used carrier. However, the above is not limiting, and various strains and carriers can be used.

Promoters that can be used are tryptophan formant, P _L promoter, lac promoter, lpp promoter and the like. The gene can be expressed using any of the above promoters.

To describe how the tryptophan promoter was used, the carrier pTMI (Trymi Imomato, Taisha, Vol. 22, 289 (1965)) with the tryptophan promoter and SD sequence was used as the expression carrier. Genes that specify the genetic information of the desired polypeptides of the present invention and which have an ATG are linked to restriction enzyme ClaI sites downstream of the SD sequence, if necessary.

Incidentally, not only the direct expression system but also the fusion protein expression system can be used using, for example, β-galactosidase, β-lactamase and the like.

The expression carrier obtained as described above is introduced into a host cell and transformed by a conventional method. For example, cells in the logarithmic growth phase are collected and treated with Cacl ₂ to facilitate DNA uptake. The carrier is thereby introduced into the cell. In this method, as is known, transformation efficiency may be increased by using Mgcl ₂ or RbCl together.

The cells can be converted to spiroplasts or protoplasts before transformation.

The desired transformant obtained as described above is cultured in a conventional manner to prepare and accumulate the desired polypeptide.

The culture medium may be any cell culture that is commonly required such as L medium, E medium, M9 medium and the like. Various carbon sources, nitrogen sources, inorganic salts, vitamins and the like are mixed in the medium as is known. Tryptophan promoters can be used to, for example, mix M9 minimal batches with casamino acids to perform the action of the promoter. Chemicals such as indole acrylic acid can be added to the medium at appropriate stages of culture to enhance the action of the tryptophan promoter.

Desired polypeptides of the invention can be isolated from culture and purified by conventional methods. The polypeptide is preferably extracted from the host under mild conditions such as osmotic shock, etc., to maintain its higher order structure.

The separation or purification method is carried out in the same manner as is commonly used to separate protein-like substances from biomass. For example, various processes can be used that take advantage of the physical or chemical properties of the desired polypeptide (see Biological Data Book II pp. 1175-1259, 1st edition, 1st Printing 1980. 23 23 1980 Dooku Family Co., Ltd.) Dojin Publishing). Examples of useful procedures are conventional proteins, precipitants, ultrafiltration, molecular sieve chromatography (gel filtration), liquid chromatography, centrifugation, electrophoresis, affinity chromatography, dialysis and combinations of these processes.

Desired polypeptides are separated from partially purified homogenates. Partial purification is performed using, for example, an organic solvent such as acetone, methanol, ethanol, propanol or dimethylformamide (DMF), an acidic reagent such as acetic acid, perchloric acid (PCA) or trichloroacetic acid (TCA) as a protein precipitant. Treatment is performed by treatment with a salting agent such as ammonium sulfate, sodium sulfate or sodium phosphate and / or ultrafiltration using a dialysis membrane, a flat membrane, a hollow fiber membrane or the like.

The treatment is carried out in the same manner as conventionally carried out under ordinary conditions.

As described above, the crudely purified product is gel filtered to collect a fraction showing the activity of the desired substance. Useful gel filters are not particularly limited and include dextran gels, polyacrylamide gels, agarose gels, polyacrylamide-agarose gels, cellulose and the like. Examples of useful exclusions that are commercially available include Sephadex G, Sephadex LH, Sepharose, Sephacryl (all from Pharmacia), Cellopin (Chiso) Biogel P, and Biogel A (both) Bio-Rad Labs), Ultro Gel-C (LKB), and TSK-G type (made by Torea Industries, Inc.).

Polypeptides of the present invention can be separated from the fraction into homogeneous materials. For example, each fraction can be separated by affinity chromatography using a hydroxyapatite column, ion exchange column chromatography of DEAE, CM or SP method, chromatographic fogging method. , Reversed phase HPLC or the like, or a combination of the above methods.

Chromatography caulking can be carried out by various known methods. The column can be used as, for example, PBE94 (Pharmacia Fine Chemicals), etc., as a starting buffer, for example, imidazole hydrochloric acid, eluents, for example, polybipi 74 (Pharmacia Fine Chemicals) E) and hydrochloric acid (pH 4.0).

Reverse phase HPLC can be carried out, for example, with a C ₄ hypophoric reverse phase HPLC column (Bio-Rad Laboratories) or the like, using acetonitrile, trifluoroacetic acid (TFA), water or the like or a mixture of the solvents as an eluent. have.

In this way, the IL-1α fluid (polypeptide) of the present invention can be obtained separately. Genes that specify genetic information of IL-1α may provide IL-1α through a similar gene recombination process.

IL-1α and its derivatives according to the present invention have excellent pharmacological activity as described above, and can be formulated into useful formulations for the aforementioned medical uses. Examples of the placebo agents include immune stimulants for antibody production, vaccine effect enhancement, and immunodeficiency treatment, anticancer agents, cytokine production promoters, anti-inflammatory agents, anti-injury prevention or therapeutic agents, branching prevention or treatment agents, and the like. Such pharmaceutical preparations are usually formulated in the form of a pharmaceutical composition containing a peptide or IL-1α of the present invention which is pharmaceutically effective and a suitable carrier. Examples of useful carriers include diluents and excipients commonly used in the manufacture of pharmaceuticals of the desired form, fillers, extenders, binders, absorbents, developing agents, surfactants and the like. The form of the pharmaceutical composition is not limited to a specific one so long as it effectively contains the polypeptide of the present invention or IL-1α, and may be, for example, in the form of tablets, powders, granules, pills or similar solid preparations. Typically, however, the composition may be for columnar use, such as solutions, suspensions, emulsions, and the like. On the one hand, the composition may be a dry matter which can be made liquid by adding a suitable carrier before use. The above-mentioned pharmaceutical composition can be prepared by conventional methods.

Depending on the form of the pharmaceutical composition obtained, the composition is administered by appropriate route. For example, the injectable composition is administered intravenously, intramuscularly, subcutaneously, or intraperitoneally. Solid compositions are administered orally or enterally. The active ingredient content and administration of the composition are appropriately determined depending on the method and form of administration, the purpose of use, the symptoms of the patient, and the like. In general, it is preferable to incorporate 1 to about 80% by weight of the active ingredient into the medicament, and calculate the active ingredient to administer the preparation at about 0.1 μg to about 10 mg per adult. The agent need not always be administered at one time, but may be administered in three to four divided doses.

In the following examples, physiological activity is determined by the following method.

(1) Determination of IL-1 activity.

It is expressed as the term of LAF activity by J. J. Oppenhein et al. (J. Immunol., 116, 1466 (1976)) using thymocytes of a young mouse C3H / HeJ cell line.

(2) Determination of GIF Activity.

A portion of the sample solution diluted to different concentrations (0.1 ml) is placed in each groove of a 96-well microplate (Corning Corporation), and contains human melanoma A375 in an amount of 2 × 20 ⁴ cells / ml. 0.1 ml of Eagle's MEM suspension of 10% FCS is placed in each groove and incubated in CO ₂ incubator for 4 days. After incubation, 0.05 ml of 0.05% Neutral Red (Wako Junyakusa) was placed in each groove and allowed to react at 37 ° C for 2 hours. After removing the supernatant, 0.3 ml PBS (phosphate buffered saline) is poured gently into each groove and washed. After removing the wash solution, add 0.1 ml of the same mixture of basic sodium phosphate and ethanol into each groove, shake with a fine mixer for several minutes, and then use a photometer (Titertec MultiScan, Flow Lab) for 96-well microtiter plates. The growth inhibition activity is determined by measuring the amount of pigment absorbed into the cells by using an absorbance of 540 µm. A test group showing 50% inhibition of control cell growth, i.e., a test group showing half the absorbance measured in the control group, is found. The inverse of the dilution factor of the test group is taken as the GIF active unit. Thus, for example, if GIF activity is 10 units, the test solution has 50% inhibition of cell growth even when diluted 10-fold.

The following figures are cited in the Reference Examples and Examples.

1 shows a restriction map of the cDNA of plasmid pcD-GIF-16 and plasmid pcD-GIF-207; 2 shows how plasmid ptrpIL-1α113 is constructed from plasmid pcD-GIF-207 and plasmid pTMI; 3 shows anticancer activity test results; 4 and 5 show the results obtained by testing the CSF production promoting effect of the polypeptide of the present invention; 6 shows the results obtained by testing the anti-inflammatory effect of the polypeptide of the present invention; Figure 7 shows the results obtained by testing the radioactive injury prevention activity of the polypeptide of the present invention; 8 shows the results obtained by testing the opportunistic prophylactic activity of polypeptides of the invention.

Reference Example 1

(1) Prevention of U937 Cells

1.4 × 10 ⁹ human tissue lymphocyte lymphocytes U397 cells (Ascenso, JK et al., Blood, Vol. 57, 170 (1981) were added to 25ng / ml of 12-0-Niradecanoylphorball-13-acetate (TPA, Pharmacia). Product), 10 μg / ml Concanavalin A (ConA, Sigma) and 10% FCS in RPMI-1640 culture solution containing a suspension having a concentration of 4 × 10 ⁵ cells / ml.

10 ml each of the cell suspension is placed in a culture dish (Falcon 3003, 9 cm in diameter) and incubated at 37 ° C. in 5% carbon dioxide gas for 3 days. After removing the culture supernatant using an aspirator, 10 μg / ml of bacterial lipopolysaccharide (LPS, manufactured by Difco), 1 μg / ml of muramyldipeptide (MDP, manufactured by Wako Pure Chemical) and TPA 10 ml of PRMI-1640 medium containing lng / ml is placed in each dish.

Incubate the cells for 18 hours at 37 ° C. in 5% carbon dioxide gas. U937 cells attached to the bottom of the dish are used for mRNA preparation.

(2) preparation of mRNA

Guanidinium / silver phenol method (Feramisco, JR et al., J. Bio. Chem. Vol. 257, 11024 (1982) and guanidinium / cesium chloride method (Glisin, V, et al., Biochemistry, Vol. 13, 2633 ( 1974) is used to extract RNA.

In order to wash the U937 cells cultured by the step (1), the dish is washed with 5 ml of PBS (-) solution after removing the supernatant. Each dish is then lysed with 1 ml of 4M guanidine isothiocyanate solution (Fluka), 50 mM Tris-HCl (pH 7.6), 10 mM EDTA and 2% sodium lauroyl sarcosinate. The solution was collected with a rubber stamper and Pasteur pipette, 420 ml of cell solution was collected, maintained at 60 ° C., and passed through an 18 G needle to cut chromosomal DNA. Subsequently, phenol heated to 60 ° C. is added to the solution in the same amount as the solution, and the mixed solution is stirred with an 18 G needle to cut more. To the mixture is added 210 ml of 0.1 M sodium acetate-10 mM Tris-HCl (pH 7.4) -1 mM EDTA solution and 420 ml of chloroform-isoamyl alcohol mixture (volume ratio 24: 1). The mixture is vigorously stirred at 60 ° C. for 15 minutes, then cooled with ice and centrifuged at 3000 r.p. m at 4 ° C. for 20 minutes.

Two times the amount of ethanol of the aqueous layer is added to the collected aqueous layer. The mixture is left at -70 [deg.] C. overnight to give crude RNA precipitate. The crude RNA is dissolved in 48 ml of 6M guanidine isothiocyanate-5 mM sodium citrate, pH 7.0-0.1m β-mercapto ethanol-0.5% sodium lauroyl sarcosinate solution. Cesium chloride (19.2 g) is dissolved in the solution. 7 ml of the resulting solution is placed on 4 ml of 5.7 M cesium chloride-0.1 M EDTA (pH 7.5). RNA is collected by centrifugation (using Beckman SW40Ti Rota) at 25 ° C. for 20 hours at 31500 r.p.m.

Thus, 9.7 mg of RNA is obtained.

To obtain mRNA from RAN, RNA is subjected to column chromatography of oligo (dT) -cellulose (manufactured by Collaborative Research Inc.). To adsorb, 10 mM Tris-HCl (pH 7.5) -0.5M NaCl-1 mM EDTA is used. To elute, 10 mM Tris-HCl (pH 7.5) -1 mM EDTA is used.

As a result, 400 μg of mRNA is obtained.

(3) The cDNA library is produced by the Amazon-Bug method, and cDNA can be expressed in animal cells by this method. The dT tailed carrier initiators used for cDNA cloning are prepared from plasmid pcDVl and the dG tail-attached linker DNA is prepared from plasmid PL1, respectively (Okayama, H. and P. Berg, Molecular). and Celluar Biology, Vol., 3, p. 280 (1983)).

MRNA (15 μg) obtained by step (2) was dissolved in 20 μl of 5 mM Tris-HCl (pH 7.5) -0.5 mM EDTA (pH 7.5) aqueous solution and reacted at 65 ° C. for 5 minutes and then at 37 ° C. for 5 minutes. The total amount of the reaction mixture was adjusted to 40 μl, in which 50 mM Tris-HCl (pH 8.3), 8 mM MgCl ₂ , 30 mM KCl, 0.3 mM dithiothreitol, dATP, dGTP, dCTP and dTTP were respectively added to the 2 mM carrier initiator DNA 2.8. 60 μg, RN agonist inhibitor (Promega Biotech) and 40 units of reverse transcriptase (Bio-Lad). Then incubate for 1 hour at 37 ℃. 2 μl of 0.5 M EDTA (pH 7.5) and 2 μl of 10% SDS were added to terminate the reaction. Subsequently, the reaction solution was extracted by phenol-chloroform extraction and chloroform extraction, and the extract was precipitated with ethanol to collect carrier initiator cDNA and mRNA. .

The collected carrier initiator cDNA: mRNA was collected from 140 mM sodium cacodylate, 30 mM Tris-HCl, pH 6.8, 1 mM CaCl ₂ , 0.1 mM dithiothreitol, poly A 0.3 μg, 66 μM dCTP and terminal deoxynucleotidyl transferase (Pharmacia Co., Ltd.) After reaction at 37 ° C. for 5 minutes in 30 μl of a reaction mixture containing 38 units, 1.5 μl of 0.5 M EDTA (pH 7.5) and 1.5 μl of 10% SDS are added to the mixture to terminate the reaction. The mixture was extracted with phenol-chloroform extraction and chloroform extraction to precipitate the extract with ethanol to obtain cDNA, mRNA-carrier initiator with oligo dC tail.

The collected hexanes were added to 90 mM in 20 μl of a reaction mixture containing 7 mM Tris-HCl (pH 7.5), ₇ mM MgCl ₁ , 60 mM NaCl, 100 g / ml 闇 serum albumin and 12 units of purified enzyme Hind III (manufactured by Nippon gene). The reaction is carried out at 37 ° C for minutes. Subsequently, 1 μl of 0.5 M EDT (pH 7.5) and 1 μl of 10% SDS were added to the mixture to terminate the reaction, followed by extraction with phenol-chloroform and then chloroform, followed by precipitation with ethanol. CDNA: mRNA-carrier initiators are collected. The product is dissolved in 10 μl of 10 mM Tris-HCl (pH 7.5) -1 mM EDTA (pH 7.5) (TE (pH 7.5)). 1 μl of this solution is incubated in 10 μl of the reaction mixture consisting of TE (pH 7.5), 0.1 M NaCl and linker DNA (14 ng) with oligo dG tail, initially at 65 ° C. for 2 minutes, then at 42 ° C. Incubate for 30 minutes at. The mixture is then cooled to 0 ° C.

Adjust the reaction mixture to 100 μl, in the solution 20 mM Tris-HCl (pH 7.5), 4 mM MgCl ₂ , 10 mM (NH ₄ ) ₂ SO, 0.1M KDl, 50 μg / ml bovine serum albumin, 0.1 mM β-NAD (nicotine Amide-adenine-dinucleotide, manufactured by Pharmacia) and 0.6 μg of this, Coli DNA ligase (manufactured by Pthrmacia). Then incubate overnight at 12 ° C. 40 µM and -NAD 0.15 mM of dATP, dGTP, dCTP and dTTP are added to the reaction mixture, respectively. Also this. 0.4 μg of Coli DNA ligase, E. Coli DNA Polymerase I (manufactured by Boehringer Mannheim) and E. coli. One unit of Coli RNase H (manufactured by Pharmacia) is added, and the mixed solution is incubated at 12 ° C for 1 hour and then at 25 ° C for 1 hour.

As a result, a cDNA library (containing about 21000 clones) is obtained.

(4) Infection of Monkey COS-1 Cells

The cDNA libraries obtained by the above process (3) are each divided into groups containing an average of about 70 clones. Plasmid DNA from each group was cultured by monkey lysis (Molecular Cloning-A test book, Cold Spring Harbor Laboratory, 1982, p. 368), COS-1 cells (Gluzman, Y., Cell, Vol. 23). , p. 175 (1981) for infectious infection using plasmid DNA prepared from each group above The transfection was carried out using the DEAE-dextrin method (Yokota, T. et al., Proc. Natl. Acad. Sci. USA Vol. 81, p. 1070 (1984) In more detail, trypsin-treated COS-1 cells were suspended in RPMI-1640 medium containing 10% FCS so that the concentration was 1 × 10 ⁶ cells. / μl. Then, 500 μl of the suspension is placed in 6 wells of each well plate containing 2 ml of RPMI-1640 medium containing 10% FCS, and the cells are incubated at 37 ° C. Supernatant was removed, cells were washed with serum free medium, 10 μg / ml plasmid DNA, 0.4 μg / ml DETE-dextrin (Pharm) 1 ml of RPMI-1640 medium containing 50 mM Tris-HCl (pH 7.4) and 10% FCS into each groove, and incubated for 4.5 hours at 37 ° C. Then, the supernatant was removed, The cells were washed with medium without serum, and 2 ml of RPMI-1640 medium containing 150 μM chlorokin (manufactured by Sigma) and 10% FCS were placed in each groove, and then incubated for 3 hours at 37 ° C. After washing the media with serum-free medium, 3 ml of RPMI-1640 medium containing 10% FCS was added to the cells in each groove and incubated for 72 hours at 37 ° C. After the supernatant was collected, 10% 2 ml of RPMI-1640 medium containing FCS is placed in each groove, followed by two freeze-thaw cycles, after which cell extracts are collected GIF activity of the culture supernatant and cell extracts are examined.

The group representing GIF activity was divided into 24 groups of 10 clones, respectively, and the same process was repeated to determine GIF activity. The same process as above is repeated to confirm that the clone in the group showing GIF activity is a clone showing GIF activity.

As a result, two kinds of clones are obtained, namely pcD-GIF-16 and pcD-GIF-207.

Table 1 shows the GIF activity (GIF units / ml) of the clones.

(5) analysis of clones

Figure 1 shows the restriction map of the cDNA of plasmid pcD-GIF-16 and plasmid pcD-GIF-207.

The base sequence of each cDNA of each of the plasmids was determined by basee-specific chemical modification (Methods in Enzymology, Vol. 65, 499 (1980) and Mide sebum carrier (Decoxy chain detection method (Proc. Natl. Acad. Sci., USA, Vol 74, 5463 (1977)) and Gene, Vol. 19, 269 (1982).

As a result, it was found that the cDNA of pcD-GIF-207 was the same as the cDNA of the coding region of IL-1α reported by March et al., Nature, Vol. 315, 641 (1985).

E. coli strain x1776 containing plasmid pcD-GIF-207 having cDNA specifying the genetic information of the precursor protein of IL-1α was assigned the accession number FERM BP 1294, S. Was deposited under the name Carrickia coli x1776 / pcD-GIF-207. In addition, this strain was deposited on June 2, 1987, with the accession number of KFCC-10374 to the Korean Society of Seedling Association.

(6) Expression and Preparation of Polypeptides

The plasmid pcD-GIF-207 was digested with restriction enzymes HindIII and HincII, electrophoresed on agarose gel to isolate and purify about 0.66 kb HindIII-HincII DNA fragment, and treated with restriction enzyme Alu I to treat about 0.5-kb Alu I -Hinc II DNA fragments are obtained by isolation.

Next, the synthetic oligonucleotides (5 ′ CGATAATGTGTCAGCACCTTTTAG 3 ′ and 5 ′ CTAAAAGGTGCTGACATTAT 3 ′) were hinched at the 5 ′ end with T4 polyylnucleotide kinase and obtained with the Alu I-Hinc II DNA fragment and T4 DNA ligase obtained above. Bond. Cleaved with the conjugated restriction enzyme Cla I and electrophoresed on an Ararose gel to isolate and purify about 0.54-kb Cla I-Cla I DNA fragment.

On the other hand, the plasmid pTMI (Fumio Imamoto, Daishi Vol. 22 289 (1985)) was digested with restriction enzyme Cla I, reacted with calf intestinal alkali phosphatase (CIAP) and then prepared about 0.54- kb Cla I-Cla I -Cla I DNA fragments were combined with T4 DNA ligase to obtain the expression plasmid ptrpIL-1α-113 of the desired polypeptide.

The plasmid to E. coli. Coli HB101 is transformed and the desired transformants are selected by analyzing the size of the cut fragments of the plasmid DNA obtained by boiling.

2 diagrammatically shows the method.

The plasmid ptrpIL-1α-113 is extracted from a selected transformant and transformed into E. coli W3110 to obtain E. coli W3110 / ptrpIL-1α-113.

Example 1

(1) culturing transformants

The transformant (E. coli W3110 / ptrpIL-1α-113) dmf 50 μg / ml obtained in Reference Examples 1 and 56 contained LB tryptophan containing 1 mg / ml L-tryptophan (1%). Incubate overnight at 37 ° C. with 10 ml of tryptone, 0.5% yeast extract and 0.5% NaCl). With 8 ml of culture, 400 ml of M9 medium (0.6% KHPO, 0.05% NaCl, 0.1% NHCl, 2 mM MgSO, 0.2% Glucose and 0.1 mM CaCl) containing 50 μg / ml of impicillin and 1% casamino acid Inoculate and incubate at 37 ° C. for 9 hours. Obtained tooth. Coli cells are suspended in 10 ml of 1 M Na 2 HPO 4, left overnight in the refrigerating chamber and dialyzed with 10 mM Tris-HCl buffer (pH 8.0) for 2 days.

The dialysate is centrifuged to separate the precipitate and the supernatant. The supernatant was obtained with 28 ml and had a CIF activity of 7.3 × 10 7 units.

(2) Purification of Polypeptides

2 ml of the supernatant obtained in the above procedure (1) was purified by ion exchange HPLC using an ULTROCHROM GTi (LKB) chromatography system under the following conditions.

Column: TSK gel DEAE-5PW (7.5 × 75mm, manufactured by Torea Corp.)

Eluent A: 20 mM Tris-HCl buffer (pH 8.0)

Eluent B: 20 mM Tris-HCl buffer solution containing 0.5 M NaCl (pH 8.0)

Flow rate: 1ml / min

Fraction Volume: 1ml / min / Test Tube

Draft Profile:

% B% B

0 0

5 0

65 60

70 100

80 100

85 0

100 0

DEAE-HPLC yields two GIF-active fractions, namely a fraction with a residence time of 26 to 28 minutes (hereinafter referred to as fraction 1) and a fraction with a residence time of 32.5 to 34.5 minutes (called hyal fraction 2).

The two fractions are subjected to DEAE-HPLC and gelfiltration HPLC to give fractions 1 and 2 in purified form.

Since the separated GIF-active fraction was obtained as above, the fraction was tested and confirmed as follows.

(3) SDS polyacrylamide gel electrophoresis (SDS-PAGE)

Fractions 1 or 2 were converted to U.K. SDS-PAGE is performed under the following conditions according to the method of Laemry (U.K. Laemmli; Nature, 277 680 (1970).

Specimen: After complete drying of fractions 1 or 2, contain the RAMRI sample buffer (2-mercapto ethanol in an amount of 1/20 of the buffer volume (2ME). Dissolved in)) and treated at 100 ° C for 4 minutes.

Gel: 15% polyacrylamide, thickness: 1.5 mm.

Organization: PROTEAN, Bio-Rad.

Electrophoresis: 40mA, 2 hours constant current.

Electrophoretic gels are stained with silver stain kit (Bio-Rad). As a result, fractions 1 and 2 each move in a single band at a molecular weight of about 18.3 kd, which is almost identical to the molecular weight of 18 kd calculated by the gene.

(4) Isoelectric connection (IEF)

Fractions 1 and 2 were subjected to IEF under the following conditions using Ampoline PAG plates (LKB) in the range 3.5-9.5 pH and model 1415 (Bio-Rad).

Specimen: PBS solution of fraction 1 left for 2 days and 2 weeks.

The PBS solution of fraction 2 was left for 2 days and left for 2 weeks.

PBS solution: 5 lanes of both control and the following labeled protein (pl labeled protein).

Label protein: amyloglucosidase (3.50)

Soy trypsin inhibitor (4.55)

β-lactoglobulin A (5.20)

Bovine Carbonic Anhydrase B (5.85)

Human carbonic anhydrase B (6.55)

Horse myoglobin-acid strips (6.85)

Horse Myoglobin-Basic Strap (7.35)

Lentil Lectin-Acid Strip (8.15)

Lentil Lectin-Neutral Strip (8.45)

Lentil Lectin-Base Band (8.65)

Trypsinogen (9.30)

Electrode solution: Anode solution = 1M HPO

Cathode solution = 1 M NaOH

Electrophoresis: electrostatic power 1W / cm gel width, cooled to 10 ℃, 90 minutes.

Dyeing: using silver stain kit.

The electrophoresis gel was cut at 1 cm intervals and extracted by stirring for 2 days with 1 ml of distilled water. The isoelectric point is calculated by measuring the pH value after electrophoresis.

The isoelectric point of fraction 2 was found to be about 5.0, moving from 5.0 to a single band. Fraction 1 moves to two bands with isoelectric points of about 5.2 and 5.0.

(5) amino acid composition

Fractions 1 and 2 (30 μl) are carefully placed in the bottom of a 12 mm × 120 mm thick, hard Pyrex glass test tube and dried under reduced pressure in a dryer containing a sodium hydroxide mass. 50 μl of 4N methane-sulfonic acid (containing 0.2% 3- (2-aminoethyl) indole, manufactured by Pierce) is added to the dried specimens in vitro, and the test tube is drained at 0.1-0.2 mmHg for 1 minute and the stopper is closed. The specimen is hydrolyzed in a heater at 118 ° C. for at least 24 hours. Open the test tube cap and neutralize the mixture with 46 μl of 4N sodium hydroxide and dilute with citric acid buffer to make 450 μl.

250 μl of the specimen solution is used for amino acid analysis using an amino acid analyzer (Model 835, product of Hitachi). The isolated amino acid is detected by the 0-phthalaldehyde method and quantified by a calibration curve made using pure amino acid.

Table 2 shows the molar ratios of constituent amino acids based on Phe (10 moles). Pro and Cys are not detected under the assay conditions.

TABLE 2

(6) amino acid sequence

Fractions 1 and 2 (150 μl) each are analyzed by sequencer (Model 470A, Applied Biosystems). Each resulting PTH-amino acid is appropriately diluted with 100-50 μl of 33% acetonitrile solution, and 5 μl of the dilution is injected into the chromatography column with an Autosampler of Waters 710B. The chromatographic system operates two Backmann Model 112 pumps with a Model 421 regulator. The column used was 2 mm x 250 mm and filled with Ultrosphere ODS-5 μm and kept at 55 ° C. with a column heater. The flow rate is 0.3 ml / min. A mixture of 20 mM sodium acetate and acetonitrile was used for the gradient elution. Absorbance is measured at 269 nm. Perform analysis for 45 minutes.

Analysis of 40 times revealed that the two fractions were identical except for the 36th amino acid of the following sequence.

The 36th amino acid of fraction 1 (X in the formula) is Asn, which can be predicted from the gene sequence, and fraction 2 is Asp.

It can be seen that fraction 1 is the polypeptide of formula (A), ie IL-1α, and fraction 2 is a derivative of the invention wherein the 36th amino acid of IL-1α is substituted with Asp. The polypeptide of the present invention described above is called polypeptide I.

It was found that IL-1α is unstable by the substance itself and partially converts to more stable polypeptide I when present in Tris-HCl buffer (pH 8.0).

Example 2

(1) Preparation of Polypeptide I of the Present Invention:

Site-specific mutagenesis using the plasmid ptrpIL-1α-113 obtained in Reference Example 1 using a polypeptide I expression slammid (Proc. Natl. Acad. Sci., 81, 5662-5666 (1984); Science, 224, 1431 (1984), and polypeptide I is prepared in this plasmid as described below.

The M13 mp 11 phage carrier is used as a single strand DNA substrate. The EcoR I / BamH I DNA fragment was isolated from the plasmid ptrpIL-1α-113 and inserted into the M13 mp 11 phage (RF) at the EcoR I and BamH I restriction enzyme sites, thereby disconnection (SS) DNA (M13-IL-1α-113) To obtain and use it as a mutagenesis substrate.

The synthetic oligonucleotide [5 'ACTGGGTGAGCTTGGCAG-3' (initiator)] is phosphorylated with T4 polynucleotide kinase and hybridized with ss M13-IL-1α-113 DNA. Hybridizations are conjugated and reacted for 18 hours at 15 ° C. with DNA polymerase I (Clenow Fragment) and T4 DNA ligase in the presence of dNTPs.

The obtained DNA is introduced into JM 105 transformable cells and transformed. The resulting phage plaques (50 colonies) are inoculated onto nitro cellulose filter paper on agar plates and incubated at 37 ° C. for 18 hours. Filter paper containing clones is modified by alkali treatment in a conventional manner, dried, and baked at 80 ° C. for 2 hours. The filter paper is prehybridized and hybridized at room temperature with a ³² p tower needle prepared by labeling the initiator with ³² pr-ATP. The hybridized filter paper was washed for 10 minutes at room temperature with 6 × SSC buffer solution at 54 ° C. for 5 minutes, dried, and autoradiated for 18 hours at −70 ° C.

Among the five variant clones, M13-IL-1α-36D was selected as a representative clone to infect JM 105 and prepare ssDNA and RF DNA.

M13 large deoxynucleotide sequencing is performed on ss DNA to confirm the mutation of the gene.

RF DNA was prepared from JM 105, and then the EcoR I / BamH I fragment was cut and introduced into the expression plasmid in the same manner as in the reference example to obtain the desired polypeptide I expression plasmid (IL-1α-36D).

Using this plasmid, polypeptide I was expressed and purified (DEAE-HPLC showed a single GIF active peak) in the same manner as in Example 1 to obtain the desired polypeptide I having the following properties.

Inactive: about 1 × 10 ⁷ GIF units / mg protein.

Example 3

(1) Preparation of Polypeptides II and III of the Invention

The plasmid ptrpIL-1α-141S for expression of the polypeptide of the present invention corresponding to IL-1α in which the 141th amino acid (Cys) is substituted with Ser is prepared by the method of Example 2 using 5 ′ ACTGGGTGAGCTTGGAG-3 ′ as an initiator. .

Repeat the expression and purification procedure as in Example 1 with the plasmid. DEAE-HPLC reveals two GIF active peaks. The peak fraction is analyzed by the above method, and the peak fraction having a high retention time is identified by the polypeptide of the present invention (polypeptide III), ie, the IL-1α in which the 141st amino acid (Cys) is replaced with Ser.

According to the analysis, the other fraction corresponds to IL-1α in which the 36th amino acid (Asn) and the 141st amino acid (Cys) are substituted with Asp and Ser, respectively, as polypeptides of the present invention. This polypeptide is hereinafter referred to as polypeptide II.

Example 4

(1) Preparation of Polypeptide II of the Invention

Using the plasmid ptrpIL-1α-141S obtained in Example 3 and 5 'ATTCGAGCCCGATGATCAG-3' as an initiator, the plasmid ptrpIL-1α-141S for expression of the desired polypeptide II was prepared in the same manner as in Example 3. The plasmid is transformed into HB101 strain. This strain has been deposited with the Accession No. FERM BP-1295, name Escherichia coli HB101 / IL-1α-36D 141S, to the Japan Institute of Commerce, Industry and Technology. In addition, this strain was deposited with the accession number of KFCC-10375 to the Korean spawn association on June 2, 1097.

The plasmid was used to repeat the same expression and purification as in Example 1 to obtain the desired polypeptide II of the present invention.

SDS-PAGE indicates that the polypeptide has a molecular weight of about 18 kd. The other isoelectric point (PI) was found to be about 5.0 by the IEF.

Polypeptides II and III are inactive (GIF activity) equivalent to polypeptide I.

Pharmaceutical test example 1

(1) GIF active and LAF active

GIF activity of the polypeptides of the invention has been described above, and the LAF activity of polypeptides I, II and III is compared with GIF activity.

The polypeptide of the present invention is tested as follows.

(2) anticancer activity test

Tumor cells (200,000), Met A are transplanted intradermal into each BALB / C mice (day 0). On days 7 and 8 after transplantation, the amount of polypeptide I per dose 0.3, 1 or 3 μg is administered to the tumor site of the rats of the first experiment.

Seven horses are in one group. The control group is administered in a manner with solvent (1% juvenile serum).

The test results are shown in FIG. 3, where the date elapsed after inoculation of the tumor cells is shown in abscissa, and the weight of the tumor in mg. The control group is indicated by the curve (1), the group to which 0.3 μg of polypeptide I was administered was the curve (2), the group to which 1 μg of polypeptide I was administered was the curve (3), and the group to which 3 μg of polypeptide I was administered Is represented by the curve (4). Tumor weights are expressed as mean ± standard deviation (SD). * Indicates P0.05 in Student T-Nest ** table indicates P0.01

(3) CSF production promotion effect test

(3) -1. The following test is performed using cell line U-373MG (ATCC HTB17, glioma, glioma, human).

The cell line was placed at 2 × 10 ⁵ cells / ml in Eagle's MEM medium (Eagle's MEM Nisisa) containing 10% FCS (GIBCO), no MEM-essential amino acids (Flow) and MEM sodium pyruvate (Flow). Suspension to concentration. The polypeptide I to be tested is joined to the suspension at various concentrations. Each mixture is incubated 24 hours at 37 ° C. in a CO ₂ incubator.

Culture supernatant is collected and produced and the amount of CSF accumulated in the supernatant is measured using a murine bone marrow cell (Lewis, I.C. et al., J. Immunol, 128, 168 (1982)).

The results are shown in FIG. Here, concentration (ng / ml) of polypeptide I is shown on the horizontal axis, and CSF activity (unit / ml, ^x10-2 ) is shown on the vertical axis.

(3) -2. The following animal tests are performed to demonstrate that polypeptide I, when administered in vivo, exhibits activity to promote CSF production in vivo.

Normal amounts of polypeptide I are injected intravenously in BALB / C (purchased from the Laboratory Animal Society of Shizuoka Prefecture, Japan). Blood is collected 8 hours after administration and the CSF activity is tested as in (3) -1 above. As a control, human serum albumin (HSA) is administered to the test control in the same manner.

The results are shown in Table 5. The amount of polypeptide I or HSA administered (μg / cub) is on the horizontal axis and CSF activity (units / ml serum, ^x10-3 ) is on the vertical axis.

(4) anti-inflammatory effect test

The following test is carried out according to the method of Wonter et al. (Proc. Soc. Exptl. Biol. Med., 111, 544-547 (1962)).

Six- to eight-week-old male rats (Spraque d'Aurley, Nippon Hicks River, Inc.) were grouped into groups of 6-8 by weight one day prior to testing. A suspension of 1% carrageenan (a marine colloid product) in saline. It is a salt-induced drug, and the foot is poured by subcutaneous injection of 0.1 ml into the right rear sole. To evaluate the degree of swelling, the plantar volume is measured using a pletismometer (Ugo-Vasile) at regular intervals before and after injection. The percentage of pre-injection of increased volume due to injection is calculated as% swelling.

The material to be tested is dissolved in Dulbecco's PBS, 0.1 ml of which is injected into the rat's back 1 hour prior to pro-inflammatory injection. The control is injected with a solvent.

The results are shown in Table 6, in which the elapsed time (hours) after the pro-inflammatory agent injection is shown on the horizontal axis, and the percent swelling on the vertical axis. In the plot, the control is indicated by curve (1), 0.1 μg polypeptide by curve (2), 1 μg polypeptide I by curve (3), and 10 μg polypeptide I by curve (4).

(5) Radiation injury prevention effect test

Either 1 μg or 0.3 μg of polypeptide I is administered to the peritoneal cavity of each of the ninth-week-old BALB / C mice and 20 hours later the lethal dose of X-rays is irradiated.

The young rats are x-rayed (MBR-1505R, manufactured by Hitachi Medico Co., Ltd.) and systematically examined for the amount of 850 roentgens, and their survival is checked daily. PBS is administered to the control group.

In Fig. 7, the number of days after irradiation is represented by the horizontal axis and the survival rate (%) is represented by the vertical axis. The group to which 1 μg of polypeptide I was administered is represented by curve (1), the group to which 0.3 μg of polypeptide I was administered to curve (2), and the control group is represented by curve (3).

FIG. 7 shows that all the mice in the control group died all 18 days after X-ray irradiation, whereas polypeptide I was effective in preventing radiation injury depending on the dose. It can be seen that about 80% of the groups administered 1 μg of polypeptide I survive death from radiation injury.

(6) Opportunistic Infection Prevention Effect Test

The following test is performed using a model muzzle. On the fourth day, 100 mg / kg of 5-fluorouracil (5-Fu, Kyowahikosa) is injected intravenously into 6-week-old male rat ICR strains (7 per group). On days 2, 4 and 6, polypeptide I of the invention is injected subcutaneously in an amount of 1 μg / cub. On the 7th day, a certain amount of Pseudomonas aeruginosa E-2 is injected into the abdominal cavity of a young mouse and infected. The survival rate (%) is calculated by counting the number of surviving animals on day 10.

The results are given in (1) to (3) of FIG. FIG. 8 (1) shows the results obtained in the group treated as above, and FIG. 8 (2) shows the results obtained in the control group administered with only 5-Fu without the polypeptide I. FIG. ) Shows the results obtained in a control group in which neither polypeptide I nor 5-Fu were administered. In Fig. 8, the survival rate (%) is indicated on the vertical axis, and the A ~ F group given the following amount monas on the horizontal axis.

Military cell number / young rat

A 19,000

B 3,800

C 750

D 150

E 30

F 6

(7) CSF production promoting effect test of IL-1α

The following tests are performed using pulmonary fibroblasts of the fetus producing CSF (HFL-1, cell line registered under ATCL as CCL-153).

HFL-1 cells are suspended in a rat cell 12K culture containing 10% FCS (Ham, RG Proc. Natl. Acad. Sci., 53, 288 (1965) at a concentration of 2 × 10 ⁵ cells / ml.

The IL-1α obtained in Example 1 is joined to the cell suspension at various concentrations. Each mixture is incubated at 37 ° C. for 24, 48 or 72 hours in a CO ₂ incubator. The culture supernatant is collected and the amount of CSF produced and accumulated in the supernatant is measured using a murine bone marrow cell (Lewis, IC et al., J. Immunol., 128, 168 (1982)).

The results are shown in Table 3 below.

The results show that joining L-1α promotes CSF production in HFL-1α cell lines.

(8) Method for producing cytokine in animal cells

HSB-2 C5B2 cells (J. Immunol., 131, 1682-1689 (1982)) are incubated 24 hours in the presence of 0.01% PHA-P and various polypeptides II in amounts of 2 × 10 ⁵ cells / groove. IL-2 activity of the collected supernatants is measured by Smith's method using IL-2 of the murine rat T cells (CTLL2) (KA Smith et al., J. Immunol., 120, 2027 (1978)). The results are shown in Table 4 below.

The results show that using the polypeptide of the present invention, animal cells efficiently produce cytokines.

The amount of the polypeptide of the present invention used in the above method may be very small, usually about 10 ng / ml, and satisfactory results can be obtained, and the use of the polypeptide facilitates purification of the induced cytokines.

(a) When cytokines are produced in animal cells, the polypeptides of the invention used for production induction must be stable in structure and bound to IL-1 receptors on the cell surface under dominant conditions. More specifically, the polypeptide of the present invention must bind to an IL-1 receptor to deliver a signal necessary for cytokine production to the cell.

Therefore, the following test is performed by linking the polypeptide of the present invention to the IL-1 receptor of fibroblasts.

Balb / 3T3 cells (colon A31: ATCC, CCL-163, 1 × 10) cultured almost uniformly in 6-groove plates Cells / groove) 50000cpm / groove IL pre-incubated for 24 hours at 37 ° C. in I-labeled IL-1β (SEGAGAKU (Biochemistry) 58, No. 8, 840 (1986); European Patent 1187991) and 10% FCS added D-MEM React at 20 ° C. with 20 ng / ml of −1β or polypeptide II. The reaction mixture is extracted with a Pasteur pipette and the supernatant is removed by gently washing the cells with 1 ml of D-MEM with 10% FCS. After the washing procedure was repeated twice, the cells were lysed with 1 m of a 1% SDS and 0.2 N NaOH mixture, and the radioactivity (bound radioactivity) of this solution and the radioactivity of the solution used for cell washing were measured by gamma-counter. Used I-labeled IL-1β is prepared and purified by Bolton and Hunter's method (Biochem. J., 133, 529 (1973)).

Inactivity: at least 250 μCi / μg protein.

Table 5 shows the results.

Wherein A is the radioactivity bound in the absence of unmarked polypeptide I.

B: Experimental value of missing radioactivity.

C: Radioactivity adsorbed specifically to the platen.

The index indicates the binding activity of IL-1β or polypeptide II coexisted with the IL-1 receptor. Incidentally, it is known that IL-1α and IL-1β are common to IL-1 receptors.

Table 5 shows that polypeptide II possesses satisfactory binding capacity to IL-1 receptors even under cytokine induced-producing conditions and is therefore useful for such uses.

Preparation Example 1

Count as GIF active, 1 × 10 Phosphorus albumin (HSA) was added to the saline solution of polypeptide I in unit / ml at a concentration of 0.5%, filtered (0.22 μm vaccinated paper), and 1 ml of each vial was sterilized and lyophilized with an injectable preparation. .

The formulation is dissolved in 1 ml distilled water and used for injection.

Claims (13)

A polypeptide having an amino acid sequence of IL-1α represented by formula (A) which lacks at least one of Asn at position 36 and Cys at position 141 in the formula (A), or is substituted with another amino acid:

The polypeptide of claim 1, wherein the Asn at position 36 has an amino acid sequence of formula (A) substituted with an amino acid of formula (A) substituted with Asp. The polypeptide of claim 1, wherein the Asn at position 36 has the amino acid sequence of Formula (A) substituted with Asp. The polypeptide of claim 1, wherein the amino acid sequence of formula (A) wherein Asn at position 36 and Cys at position 141 are substituted with Asp and Ser, respectively. A gene encoding a polypeptide as defined in claim 1. A vector containing a gene as defined in claim 5. A microorganism containing a vector as defined in claim 6. A pharmaceutical composition comprising a pharmacologically effective amount of a polypeptide as defined in claim 1 and a pharmaceutical adjuvant. The pharmaceutical composition according to claim 8, which is a composition for immune stimulation. The pharmaceutical composition according to claim 8, which is a composition for treating malignant tumors. The pharmaceutical composition according to claim 8, which is a composition for promoting cytokine production. The pharmaceutical composition according to claim 8, which is a composition for treating inflammation. The pharmaceutical composition according to claim 8, which is a composition for preventing or treating radiation injury.

Images