KR960010950B1 - IL-1Ñß DERIVATIVES AND DRUGS - Google Patents
IL-1Ñß DERIVATIVES AND DRUGS Download PDFInfo
- Publication number
- KR960010950B1 KR960010950B1 KR1019870006925A KR870006925A KR960010950B1 KR 960010950 B1 KR960010950 B1 KR 960010950B1 KR 1019870006925 A KR1019870006925 A KR 1019870006925A KR 870006925 A KR870006925 A KR 870006925A KR 960010950 B1 KR960010950 B1 KR 960010950B1
- Authority
- KR
- South Korea
- Prior art keywords
- polypeptide
- activity
- amino acid
- cells
- gif
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
내용없음.None.
Description
제1도는 플라스미드 pcD-GIF-16 및 플라스미드 pcD-GIF-207의 cDNA의 제한효소지도를 나타내고;1 shows a restriction map of the cDNA of plasmid pcD-GIF-16 and plasmid pcD-GIF-207;
제2도는 플라스미드 pcD-GIF-207 및 플라스미드 pTMI으로부터 플라스미드 ptrpIL-1α-113이 구성되는 방법을 나타내는 도면이고;2 is a diagram showing how plasmid ptrpIL-1α-113 is constructed from plasmid pcD-GIF-207 and plasmid pTMI;
제3도는 항암활성 시험결과를 나타내고;3 shows anticancer activity test results;
제4도 및 제5도는 본 발명의 폴리펩티드의 CSF 생산 촉진효과를 시험하여 얻은 결과를 나타내고;4 and 5 show the results obtained by testing CSF production promoting effect of the polypeptide of the present invention;
제6도는 본 발명의 폴리펩티드의 소염효과를 시험하여 얻은 결과를 나타내고;6 shows the results obtained by testing the anti-inflammatory effect of the polypeptides of the present invention;
제7도는 본 발명 폴리펩티드의 방사선 상해 예방활성을 시험하여 얻은 결과를 나타내고;Figure 7 shows the results obtained by testing the radioactive injury prevention activity of the polypeptide of the present invention;
제8도는 본 발명 폴리펩티드의 기회주의적 감염예방 활성을 시험하여 얻은 결과를 나타낸다.8 shows the results obtained by testing the opportunistic prophylactic activity of polypeptides of the invention.
본 발명은 신규 폴리펩티드, 보다 상세히는 인터루킨-1α(이하 IL-1α로 칭함)의 신규 유도체 및 IL-1α의 의약적 용도 및 그의 신규 유도체에 관한 것이다.The present invention relates to novel derivatives of the novel polypeptides, more particularly interleukin-1α (hereinafter referred to as IL-1α) and the pharmaceutical uses of IL-1α and novel derivatives thereof.
제2차 국제 림포카인 연구회(The Second Imternational Lymphokine Worksh p)는, 인파구 활성인자(LAF), 유사분열 촉진 단백질, 헬퍼 피크-1(helper peak-1), T-세포 치환인자 Ⅲ(TRF-Ⅲ), T세포 치환인자 Mφ(TRFM), B-세포활성인자, B-세포분화인자 등으로 알려져왔던 생리활성 물질에 대해 통일된 명칭인 인터루킨-1(IL-1)을 채용하였다(Cellular Immunol., 48 433~~436(1979). 이 결정은 상기 생리활성물질을 서로 다른 물질로 구분할 수 없고 여러각도에서 해석된대로 생리활성이 여러가지로 표현된다는 이유를 근거로 한다.The Second Imternational Lymphokine Worksh p, apoptotic activator (LAF), mitosis promoting protein, helper peak-1, and T-cell substitution factor III (TRF) -III), T-cell substitution factor Mφ (TRFM), B-cell activator, B-cell differentiation factor, and the like, interleukin-1 (IL-1), the unified name for the physiologically active substance was adopted (Cellular Immunol., 48 433--436 (1979) This determination is based on the reason why the bioactive substances cannot be distinguished from one another and the physiological activity is expressed in various ways as interpreted at various angles.
그리고 IL-1이 T임파구 및 B임파구를 활성화하고, 인터루킨-2 및 항체의 생산을 증진시키는 활성을 갖고, 간조직에 작용하는 단백질합성을 증진시키고, 그리고 프로스타글라딘의 생산을 촉진하는 활성을 갖고 있다고 보고되었다(참조. Reviews of Infectious Disease, Vol. 6, No. 1, 51~59(1984), New England J. of Med., 311, 1413(1984)등).And IL-1 activates T lymphocytes and B lymphocytes, has the activity of enhancing the production of interleukin-2 and antibodies, promotes protein synthesis on liver tissue, and promotes the production of prostagladins (See Reviews of Infectious Disease, Vol. 6, No. 1, 51-59 (1984), New England J. of Med., 311, 1413 (1984), etc.).
IL-1 자체는 여전히 하나의 물질로 분류되어 있는데 비하여 LAF 활성을 갖는 폴리펩티드 또는 이의 전구체의 유전정보를 지정하는 두개의 서로 다른 유전자가 존재한다는 것은 최근에야 보고되었다(Proc. Natl. Acad. Sci., Vol. 81, 7907~7911(1984), Nature, Vol. 315, 641(1985), Nucleic Acid Research, Vol. 13(16), 5869(1985)).It has only recently been reported that IL-1 itself is still classified as one substance, whereas there are two different genes that specify the genetic information of a polypeptide or its precursor having LAF activity (Proc. Natl. Acad. Sci. , Vol. 81, 7907-7911 (1984), Nature, Vol. 315, 641 (1985), Nucleic Acid Research, Vol. 13 (16), 5869 (1985)).
상기 보고에 따르면, 유전자 재조합 기술에 의해 수득한 배양 상층액이 LAF 활성을 가짐이 발견되었고, 상기 발견으로, 하기 식(A)로 표시되는 폴리펩티드가 LAF 활성을 갖는 폴리펩티드이고 IL-1α라 명명하였다.According to the above report, it was found that the culture supernatant obtained by the genetic recombination technique had LAF activity, and by the above discovery, the polypeptide represented by the following formula (A) was a polypeptide having LAF activity and named IL-1α. .
그러나, 소위 IL-1으로 알려진 생리활성물질 뿐만 아니라 상기 활성물질을 균질로 분리 및 제조한 보고도 없고, 상기 균질물질의 생리활성에 대한 보고도 전혀없다.However, there are no reports of homogeneously separating and preparing the active substance as well as the bioactive substance known as IL-1, and there is no report on the physiological activity of the homogeneous substance.
본 발명자는 IL-1α의 균질물질에 대한 심도있는 연구를 하여 이 물질의 체법에 관한 기술을 이미 확립하고 그의 특성, 물리적성질 등을 밝혔다. 연구결과를 바탕으로 본 발명자는 또한 상기 식(A)의 폴리펩티드가 LAF 활성을 갖는 것을 확인하였다.The present inventors have conducted in-depth studies on the homogeneous substance of IL-1α, and have already established a technique regarding the body method of the substance and revealed its characteristics, physical properties, and the like. Based on the results of the study, the inventors also confirmed that the polypeptide of formula (A) has LAF activity.
그럼에도 불구하고, 폴리펩티드가 비록 보고된대로 생체 유전자에 해당한다 할지라도 물질자체로는 불안정하다.Nevertheless, although polypeptides correspond to biological genes as reported, they are unstable by themselves.
따라서, 본 발명의 목적은 식(A)와 아미노산 서열이 다르고, 물질자체로 더욱 안정하고 의약용에 적합한 특성을 갖는 신규 폴리펩티드(IL-1α 유도체)를 제공하는 것이다.Accordingly, an object of the present invention is to provide a novel polypeptide (IL-1α derivative) having a different amino acid sequence from formula (A), which is more stable in substance and suitable for medical use.
본 발명은 신규 IL-1α 유도체의 유전정보를 지정하는 유전자 및 상기 유전자를 사용하는 유전공학기술에 의해, IL-1α 유도체, 즉 폴리펩티드의 제법을 제공하는 것이다.The present invention provides a method for producing an IL-1α derivative, that is, a polypeptide by a gene designating genetic information of a novel IL-1α derivative and genetic engineering techniques using the gene.
그리고 본 발명은 IL-1α 그 자체의 새로운 의약용도를 제공하는 것이다.In addition, the present invention provides a novel medical use of IL-1α itself.
더욱 구체적으로는, 본 발명이 식(A)에서 36위치의 Asn 및 141위치의 Cys 중에서 선택된 최소한 하나의 아미노산잔기가 결핍되거나 또는 다른 아미노산으로 치환된 것으로 표시되는 인터루킨-1α의 변형된 아미노산서열을 갖는 폴리펩티드를 제공한다.More specifically, in the formula (A), the present invention provides a modified amino acid sequence of interleukin-1α, which is represented as lacking at least one amino acid residue selected from 36 positions of Asn and 141 positions of Cys or substituted with another amino acid. It provides a polypeptide having.
본 명세서에서 아미노산과 폴리펩티드는 IUPAC 및 IUPAC-IUB에 의해 추천된 규칙 또는 명명법 또는 공기기술 분야에서 통상적으로 사용되는 부호에 따라 부른다.Amino acids and polypeptides herein are referred to according to the conventions or nomenclature recommended by IUPAC and IUPAC-IUB or symbols commonly used in the art of air technology.
염기서열의 헥산도 같은 방법으로 표현된다.Hexanes of the base sequence are expressed in the same way.
본 발명의 IL-1α 유도체는 LAF 활성, 종양세포의 성장을 억제하는 활성(GIF 활성), 즉 종양세포의 성장을 특이적으로 억제하는 활성, 콜로니자극인자(CSF), 인터페론(IFN), 인터루킨-2(IL-2) 및 인터루킨-3(IL-3) 등과 같은 여러가지 시토카인의 생산을 촉진하는 활성, 즉 예를 들어 사람세포에 대하여 상기 시토카인의 생산을 크게 촉진하는 활성, 소염활성, 예를 들어 모델동물에 관절염을 투여하였을때 관절염의 진전을 효과적으로 억제하는 활성, 및 방사선에 의한 상해를 방지하는 활성, 즉 골수 이식중의 조직적인 방사능조사, 암치료를 위한 방사능조사 및 방사능사고로 생길 수 있는 생체질환 또는 심각한 부작용을 예방하는 활성을 갖는다. 따라서 균질의 본 발명에 의한 유도체는, 예를들어, 항체생산을 촉진하고 백신의 효과를 증진시키기 위한 면역체계 자극제, 항암제, CSF, IFN, IL-2 및 IL-3와 같은 시토카인의 생산촉진제, 소염제, 방사능병 방지제 및 다른 유사의약으로 대단히 유용하다. 특히 본 발명의 폴리펩티드는 대단히 안정한 물질인 특성을 갖고 독성이 낮다. 그리고 IL-1이 발열성이 있다고 알려져 있는 반면에 본 발명의 폴리펩티드는 상기의 부작용이 낮은 점이 탁월하다.IL-1α derivative of the present invention is LAF activity, activity to inhibit the growth of tumor cells (GIF activity), that is, activity to specifically inhibit the growth of tumor cells, colony stimulating factor (CSF), interferon (IFN), interleukin -2 (IL-2) and interleukin-3 (IL-3) and the like to promote the production of various cytokines, ie, to promote the production of the cytokine to human cells, for example, anti-inflammatory activity, such as For example, when arthritis is administered to a model animal, it may be effective in inhibiting the progression of arthritis, and in preventing an injury by radiation, that is, systematic radiation investigation during bone marrow transplantation, radiation investigation for cancer treatment, and radiation accident. It has activity to prevent any biological disease or serious side effects. Thus, the homogeneous derivatives of the present invention are, for example, immune system stimulants, anticancer agents, promoters of cytokines such as CSF, IFN, IL-2 and IL-3 for promoting antibody production and enhancing the effect of vaccines, It is very useful as an anti-inflammatory agent, an anti-radioactive agent and other similar medicines. In particular, the polypeptides of the present invention have properties that are very stable substances and have low toxicity. And while IL-1 is known to be pyrogenic, the polypeptide of the present invention is excellent in low side effects.
본 발명의 유도체는 CSF 생산 촉진제로 특히 유용하다. 사람에게 투여되면, 상기 유도체는 바이러스감염 또는 항원-항체반응의 가능성을 수반하지 않고 암을 화학적으로 또는 방사선으로 치료함으로 발생하는 골수의 결손에 의한 과립구 감소증을 효과적으로 치료한다(과립구 감소증 치료약). CSF 생산 촉진제는 또한 하기에 기술되는 제제에 의해 촉진되는 CSF 생산 활성에 의한 여러가지 질병을 예방하고 치료하는데도 사용할 수 있다. 예를 들어, CSF는 과립구 및 대식세포의 기능을 증진하도록 작용하여(Lopez, A. F. 등, J. Immunol., 131, 2983(1983) ; Handam, E. 등, J. Immunol., 122, 1134(1979) 및 Vadas, M. A. 등, J. Immunol., 130, 795(1983), 여러가지 질병의 예방 및 치료에 CSF의 임상적응이 예상된다. 마찬가지로, CSF 생산촉진제는 임상적응에 유용하다.The derivatives of the present invention are particularly useful as CSF production promoters. When administered to humans, the derivative effectively treats granulocytopenia due to bone marrow deficiency caused by chemical or radiation treatment of cancer without the possibility of viral infection or antigen-antibody reactions (a drug for reducing granulocytosis). CSF production promoters can also be used to prevent and treat various diseases due to CSF production activity promoted by the agents described below. CSF, for example, acts to enhance the function of granulocytes and macrophages (Lopez, AF et al., J. Immunol., 131, 2983 (1983); Handam, E. et al., J. Immunol., 122, 1134 ( 1979) and Vadas, MA, et al., J. Immunol., 130, 795 (1983), for the clinical adaptation of CSF to the prevention and treatment of various diseases.
최근에, 무해한 병원체가 병원성을 갖게 되면 생체방어능이 손상된 절충된 숙주는 소위 기회주의적인 감염 또는 말단감염을 겪는다는 것이 알려졌다. 임상적으로, 상기 감염은 수도모나스(Pseudomonas) 및 세라티아(Serratia)등의 그람-음성간균, 히피스 심플렉스 바이러스(HSV), 바리셀라-조스터 바이러스(Viricella-zoster virus, VZV) 및 시토메갈로바이러스(CMV) 등의 바이러스, 칸디다 알비칸스(candida albicans), 아스퍼질러스 푸미가투스(Aspergillus fumigatus) 및 노카르디아 아스테로이데아(nocardia asteroidea) 등의 진균, 뉴모시스티스 카리니이(Pneumocystis carinii) 및 톡소플라스마 곤디어(toxoplasma gondii) 등의 프로토조아 등에 기인한다. 현재 사용되는 항생제는 기회주의적인 감염에 완전히 효과적이지 못하기 때문에, 상기 감염에 대한 신규제약제의 개발연구가 요망되고 있다. 본 발명의유도체는 항암제가 투여될때 특히 자주 발생하는 기회주의적 감염의 예방 및 치료에 또한 유효하다. 예를들어, 급성 백혈병의 화학적 치료 및 골수이식중에 발생하는 여러가지 감염증, 즉 칸디도스증, 크립토코코스증, 아스퍼질러증, 접합균증, 크로모진균증, 바이러스감염, 사이토메갈로바이러스 폐렴 및 상기 감염증의 복합증 등을 치료 예방하는데 유용하다.Recently, it has been known that compromised hosts with impaired biodefense undergo a so-called opportunistic infection or terminal infection if the harmless pathogen becomes pathogenic. Clinically, the infection is Gram-negative bacillus such as Pseudomonas and Serratia, hippie simplex virus (HSV), viricella-zoster virus (VZV) and cytosine. Viruses such as megalovirus (CMV), fungi such as candida albicans, Aspergillus fumigatus and nocardia asteroidea, Pneumocystis carinii And protozoa such as toxoplasma gondii. Since the antibiotics currently used are not fully effective against opportunistic infections, research into the development of novel pharmaceuticals for such infections is desired. The derivatives of the present invention are also effective in the prevention and treatment of opportunistic infections, which often occur when the anticancer agent is administered. For example, various infections that occur during chemotherapy and bone marrow transplantation of acute leukemia, such as candidososis, cryptococcosis, aspergillosis, conjunctivitis, chromogenomycosis, viral infections, cytomegalovirus pneumonia and combinations of these infections It is useful for treating and preventing symptoms.
그리고, 본 발명의 폴리펩티드는 관절염 등의 예방 및 치료에 유효하고, 그러므로 소염제로 유용하다.In addition, the polypeptide of the present invention is effective for the prevention and treatment of arthritis and the like, and thus is useful as an anti-inflammatory agent.
본 발명의 폴리펩티드는 종양세포의 성장을 억제하는 활성(이하 GIF 활성이라 한다)을 갖는데, 이는 하기에 서술되는 방법으로 결정하고, 여러 종류의 종양세포에 특이적으로 작용하여 그의 성장을 억제한다. 따라서 본 발명 폴리펩티드를 활성성분으로 함유하는 항암조성물은 암치료제로 사용하기 유리하며, 특히 악성 종양치료를 위한 강화된 완화요법 및 완화유지요법용 여러가지 제제와 조합하여 사용하면 유리하다.The polypeptide of the present invention has an activity of inhibiting the growth of tumor cells (hereinafter referred to as GIF activity), which is determined by the method described below, and specifically acts on various kinds of tumor cells to inhibit their growth. Therefore, the anticancer composition containing the polypeptide of the present invention as an active ingredient is advantageous to be used as a cancer treatment agent, and especially in combination with various agents for enhanced palliative therapy and palliative maintenance for treating malignant tumors.
그리고, 상기 언급한 의약용도외에서, 본 발명의 폴리펩티드는 예를 들면, 그것들의 시토카인의 생산을 촉진하는 활성을 갖고 있어서 세포주로부터 여러가지 유용한 시토카인을 시험관에서 제조하는데 유용하다. 천연형의 시토카인, 특히 당단백질인 시토카인을 제조하는데 관심이 주어져왔다. 유용한 시토카인을 대량으로 효율적으로 생산할 수 있다.In addition to the above-mentioned pharmaceutical uses, the polypeptides of the present invention have an activity of promoting the production of their cytokines, for example, and are useful for producing various useful cytokines from cell lines in vitro. Attention has been directed to the production of natural cytokines, in particular cytokines, glycoproteins. Useful cytokines can be produced efficiently in large quantities.
본 연구는 IL-1α의 신규 생물학적 활성을 발견하였다.This study found new biological activity of IL-1α.
본 발명의 IL-1α는 GIF 활성 및 CSF 생산 촉진활성을 갖고, 이들 활성으로 상기한 여러가지 치료목적에 사용될 수 있다.IL-1α of the present invention has GIF activity and CSF production promoting activity, and these activities can be used for various therapeutic purposes described above.
본 발명의 폴리펩티드중에서 바람직한 것은 식(A)의 최소한 36위치의 Asn이 결핍되거나 다른 아미노산으로 치환된 아미노산 서열을 갖는 것이다. 36위치의 Asn 및 141위치의 Cys와 치환될 수 있는 아미노산은 생체 단백질을 구성하는 α-아미노산이면 어느 것이어도 좋다.Preferred among the polypeptides of the invention are those having an amino acid sequence deficient in at least 36 Asn of Formula (A) or substituted with another amino acid. The amino acid which may be substituted with Asn at position 36 and Cys at position 141 may be any of α-amino acids constituting a biological protein.
그러나 Cys가 SH기를 갖고 있어 분자내 또는 분자간 결합을 형성하기 쉬워서, Cys 이외의 아미노산이 바람직하다.However, since Cys has an SH group, it is easy to form intramolecular or intermolecular bonds, and amino acids other than Cys are preferable.
구체적으로는, 36위치의 Asn 치환용으로는 Asp이 바람직하고 141위치의 Cys 치환용으로는 Ser이 바람직하다.Specifically, Asp is preferable for the Asn substitution at the 36 position and Ser is preferable for the Cys substitution at the 141 position.
본 발명의 폴리펩티드는, 예를 들면, 본 발명의 특정 폴리펩티드의 유전정보를 지정하는 유전자를 사용한 유전자 조작기술에 의하여, 즉 상기 유전자를 미생물용 운반체에 넣고 미생물내에서 복제, 전사 및 전이를 수행하여 제조할 수 있다. 상기 방법은 대량생산이 용이하다는 점에서 유리하다.Polypeptides of the present invention, for example, by genetic engineering techniques using genes that specify the genetic information of the specific polypeptide of the present invention, that is to put the gene in a carrier for microorganisms to perform replication, transcription and transfer in the microorganisms It can manufacture. The method is advantageous in that mass production is easy.
본 방법에서 사용되는 유전자는 통상의 방법, 예를 들어 포스피트 트리에스테르법(Nature, 310, 105(1984))등으로 핵산을 화학 합성하여 전체를 합성할 수 있으나, IL-1α의 유전정보를 지정하는 유전자 또는 이의 전구체를 이용하는 것이 편리하다. 상기의 화학합성을 포함한 통상의 방법에 의해, 유전자는 상기의 특정한 아미노산 서열의 유전정보를 지정하는 헥산서열로 변형되고, 이에 의해 원하는 유전자가 쉽게 제조될 수 있다.Genes used in the present method can be synthesized by chemical synthesis of nucleic acids by conventional methods, for example, phosphite triester method (Nature, 310, 105 (1984)), but the genetic information of IL-1α It is convenient to use the gene or precursor thereof. By a conventional method including the above chemical synthesis, the gene is transformed into a hexane sequence which designates the genetic information of the specific amino acid sequence, thereby allowing the desired gene to be easily produced.
IL-1α의 유전정보를 지정하는 유전자 및 이의 전구체는 이미 알려져 있다. 본 발명자는 IL-1α의 유전정보를 지정하는 유전자를 수득하여 이 유전자를 사용한 유전자 조작으로 IL-1α를 제조하는데 성공하였다. 사용된 유전자 조작기술들은 하기의 참고예에 서술될 것이다.Genes that designate the genetic information of IL-1α and precursors thereof are already known. The present inventors have succeeded in producing IL-1α by obtaining a gene designating the genetic information of IL-1α and genetic manipulation using this gene. The genetic engineering techniques used will be described in the reference examples below.
상기에서 언급한 변형된 헥산(염기)서열은 공지방법에 의해 제조되고, 이는 원하는 폴리펩티드의 아미노산서열에 따라 수행한다(Molecular Cloning, Cold Spring Harbor Iaboratory)(1982)).The modified hexane (base) sequences mentioned above are prepared by known methods, which are performed according to the amino acid sequences of the desired polypeptide (Molecular Cloning, Cold Spring Harbor Iaboratory) (1982).
예를 들어, DNA의 절단, 접합, 인산화 등은 제한효소, DNA 리가제, 폴리뉴클레오티드키나제 및 DNA 폴리머라제 등의 상품으로 쉽게 구할 수 있는 효소의 처리를 포함하는 통상의 방법으로 수행할 수 있다. 상기 방법에 포함된 유전자 및 헥산의 분리 및 정제는 또한 통상의 방법, 예를 들어, 아가로스 겔 전기영동에 의해 수행한다. 조금후에 설명될 것이지만, 수득된 유전자는 통상의 운반체를 사용하여 복제한다. 원하는 아미노산서열 및 합성리커의 유전정보를 지정하는 DNA 단편은 상기 언급한 화학합성으로 쉽게 제조할 수 있다. 원하는 아미노산에 해당하고 상기 방법에서 사용될 코돈은 공지되어 있고 원하는 대로 선택되었다. 상기 목적을 위하여 통상의 방법, 예를 들어, 사용될 숙주의 코돈 사용빈도에 따라 사용될 수 있다(Nucl. Acids Res., 9, 43~73(1981)). 관련된 헥산서열내의 코돈을 변경시키기 위해, 부위 특이성 변이유발법(sirespecific mutafenesis: Proc. Natl. Acad. Sci., 81, 5662~5666(1984))이 통상대로 원하는 변형서열의 유전정보를 지정하는 약 15~30량체의 합성 올리고뉴클레오티드를 함유하는 개시제를 사용하여 수행한다.For example, DNA cleavage, conjugation, phosphorylation, and the like can be carried out by conventional methods including treatment of enzymes readily available with products such as restriction enzymes, DNA ligase, polynucleotide kinases and DNA polymerases. Isolation and purification of the genes and hexanes involved in the method is also carried out by conventional methods such as agarose gel electrophoresis. As will be explained later, the gene obtained is replicated using conventional carriers. DNA fragments specifying the desired amino acid sequence and genetic information of the synthetic liquor can be easily prepared by the above-mentioned chemical synthesis. The codons corresponding to the desired amino acids and to be used in the method are known and selected as desired. For this purpose, conventional methods may be used, for example, depending on the codon usage of the host to be used (Nucl. Acids Res., 9, 43-73 (1981)). In order to alter the codons in the relevant hexane sequences, site-specific mutafenesis (Proc. Natl. Acad. Sci., 81, 5662-5666 (1984)) is usually used to specify the genetic information of the desired modification sequence. It is carried out using an initiator containing 15-30 monomers of synthetic oligonucleotides.
상기 방법으로 수득한 원하는 유전자는 염기서열을, 예를들면 막삼-길버트 화학변형법(Meth. Enzym., 65, 499~560(1980)) 또는 N13파지를 사용하는 다이데옥시뉴클레오티드 연쇄종결법(Messing, J. 및 Viera, J., Gene, 19, 269~276(1982))으로 검사할 수 있다.The desired gene obtained by the above method may be a nucleotide sequence, for example, Mem. Enzym., 65, 499-560 (1980), or a dideoxynucleotide chain termination method using N13 phage. Messing, J. and Viera, J., Gene, 19, 269-276 (1982)).
상기 방법 및 그 과정은 하기 참고예 및 실시예에 서술될 것이나 구체적으로 제한하지 않고; 공지 기술분야의 모든 공지방법을 사용할 수 있다.The methods and procedures will be described in the following Reference Examples and Examples but are not specifically limited; All known methods in the art can be used.
상기와 같이 본 발명은 또한 상기 지정한 아미노산서열을 갖는 폴리펩티드의 유전정보를 지정하는 신규의 유전자(이 유전자를 이하 본 발명 유전자로 칭한다)를 제공한다.As described above, the present invention also provides a novel gene (hereinafter, referred to as the gene of the present invention) that designates the genetic information of the polypeptide having the designated amino acid sequence.
본 발명의 폴리펩티드는 본 발명 유전자를 사용한 통상의 유전자 제조합기술에 의해 제조할 수 있다. 더욱 구체적으로는, 본 발명 유전자를 숙주 세포내에서 발현시킬 수 있는 재조합 DNA를 제조하여 숙주세포를 형질전환시키고 형질전환제를 배양한다.The polypeptide of the present invention can be produced by conventional gene synthesis techniques using the gene of the present invention. More specifically, recombinant DNA capable of expressing the gene of the present invention in the host cell is prepared to transform the host cell and culture the transformant.
유용한 숙주는 진행 또는 무핵세포일 수 있다.Useful hosts can be advanced or nucleated cells.
진핵세포는 척추동물의 세포, 효모 등을 포함한다. 일반적으로 사용되는 척추동물 세포는 원숭이세포인 COS 세포(Y. Gluzman, Cell, 23 175~182(1981)), 챠이니즈 햄스터 난소세포의 디히드로폴레이트 리덕타재 결손주(G. Urlaub 및 L.A., Chasin, Proc. Natl. Acad. Sci., U.S.A., 77, 4216~4220(1980)) 등이나, 유용한 세포가 이것으로 제한되는 것은 아니다. 척추동물세포의 유용한 발현 운반체는 발현될 유전자의 상류에 위치한 프로모터, RNA 접합 부위, 폴리아데닐화부의, 전사종결서열 등을 갖는 것이다.Eukaryotic cells include cells of vertebrates, yeast, and the like. Commonly used vertebrate cells include monkey cells, COS cells (Y. Gluzman, Cell, 23 175-182 (1981)), dihydrofolate reductase defects of Chinese hamster ovary cells (G. Urlaub and LA, Chasin, Proc. Natl. Acad. Sci., USA, 77, 4216-4220 (1980)) and the like, but useful cells are not limited thereto. Useful expression carriers of vertebrate cells include promoters located upstream of the gene to be expressed, RNA conjugation sites, polyadenylation moieties, transcription termination sequences, and the like.
상기 운반체는 필요할때 복제 오리진을 가질 수 있다.The carrier may have a replication origin when needed.
유용한 발현 운반체의 예는 SV 40의 초기 프로모터를 갖는 pSV2dhfr(S. Subramani, R. Mulligan 및 P. Berg, Mol. cell. Biol., 1(9), 854~864)를 포함하니 그것으로 제한하지 않는다.Examples of useful expression carriers include, but are not limited to, pSV2dhfr (S. Subramani, R. Mulligan and P. Berg, Mol. Cell. Biol., 1 (9), 854-864) with an initial promoter of SV 40. Do not.
효모의 발현 운반체로 많이 사용되는 것의 예로는 산성 포스파타제 유전자의 프로모터를 갖는 pAM82(A. Miyanohara 등, Proc, Natl. Acad. Sic., U.S.A., 80, 1~5(1983)) 등을 포함한다.Examples of those commonly used as expression carriers of yeast include pAM82 (A. Miyanohara et al., Proc, Natl. Acad. Sic., U.S.A., 80, 1-5 (1983)) having a promoter of an acidic phosphatase gene.
이. 콜리 및 바실루스 서틸리스가 무핵 숙주세로로 널리 사용된다. 본 발명은, 예를 들어, 숙주세포내에서 복제할 수 있는 폴리스미드 운반체를 사용한다. 유전자를 운반체에서 발현시키기 위해, 프로코더 및 유전자의 상류에 SD(사인-달가르노) 염기서열 및 단백질합성 개시에 필요한 ATG를 갖는 발현 플라스미드를 사용할 수 있다. 널리 사용되는 이. 콜리 숙주는 이. 콜리 K12 균주이다. pBR322가 널리 사용되는 운반체이다. 그러나, 상기는 제한적이 아니고, 여러종류의 균주 및 운반체를 사용할 수 있다.this. Coli and Bacillus certilis are widely used as nucleus-free hosts. The present invention uses, for example, a polyimide carrier capable of replicating in a host cell. To express a gene in a carrier, an expression plasmid with SD (sine-dalgarno) sequences upstream of the promoter and gene and ATG necessary for initiation of protein synthesis can be used. Widely used teeth. Coli host Collie K12 strain. pBR322 is a widely used carrier. However, the above is not limiting, and various strains and carriers can be used.
사용할 수 있는 프로모터는 트립토판 포르모터, PL프로모터, lac 프로모터, lpp 프로모터 등이다. 상기 프로모터중의 어느 것을 사용하여도 유전자가 발현될 수 있다.Promoters that can be used are tryptophan formant, P L promoter, lac promoter, lpp promoter and the like. The gene can be expressed using any of the above promoters.
트립토판 프로모터가 사용된 경우의 방법을 서술하기 위하여, 트립토판 프로모터 및 SD 서열을 갖는 운반체 pTMI(후미오 이마모또, 다이샤, Vol. 22, 289(1965))를 발현 운반체로 사용한다. 본 발명의 원하는 폴리펩티드의 유전정보를 지정하고 ATG를 갖는 유전자는 필요하면 SD 서열의 하류에 존재하는 제한효소 ClaI 부위에 연결된다.To describe how the tryptophan promoter was used, the carrier pTMI (Trymi Imomato, Taisha, Vol. 22, 289 (1965)) with the tryptophan promoter and SD sequence was used as the expression carrier. Genes that specify the genetic information of the desired polypeptides of the present invention and which have an ATG are linked to restriction enzyme ClaI sites downstream of the SD sequence, if necessary.
부수적으로, 직접 발현체계 뿐만 아니라 융합 단백질 발현체계도 예를 들어, β-갈락토시다제, β-락타마제 등을 사용하여 이용할 수 있다.Incidentally, not only the direct expression system but also the fusion protein expression system can be used using, for example, β-galactosidase, β-lactamase and the like.
상기와 같이 수득한 발현 운반체를 숙주세포에 도입하고 통상의 방법으로 형질절환 시킨다. 예를 들어, 대수 성장기에 있는 세포를 수집하여 Cacl2로 처리하여 DNA를 쉽게 받아들이게 한다. 이에 의해 운반체가 세포에 도입된다. 상기 방법에서, 공지된 바와 같이, Mgcl2또는 RbCl을 함께 사용하여 형질전환 효율을 높일 수 있다.The expression carrier obtained as described above is introduced into a host cell and transformed by a conventional method. For example, cells in the logarithmic growth phase are collected and treated with Cacl 2 to facilitate DNA uptake. The carrier is thereby introduced into the cell. In this method, as is known, transformation efficiency may be increased by using Mgcl 2 or RbCl together.
세포는 형질전환전에 스피로플라스트 또는 프로토플라스트로 전환될 수 있다.The cells can be converted to spiroplasts or protoplasts before transformation.
상기와 같이 수득한 원하는 형질전환제는 통상의 방법으로 배양하여 원하는 폴리펩티드가 제조되고 축적된다.The desired transformant obtained as described above is cultured in a conventional manner to prepare and accumulate the desired polypeptide.
배양매질은 L 배지, E 배지, M9배지 등과 같은 일반적으로 상요되는 세포배양용이면 된다. 여러종류의 탄소원, 질소원, 무기염, 비타민 등은 공지된대로 상기 배지에 혼합한다. 트립토판 프로모터를 사용하면, 예를 들어, M9 최소배치를 카사미노산과 혼합하여 프로모터의 작용을 수행하도록 할 수 있다. 인돌아크릴산과 같은 화학약품이 트립토판 프로모터의 작용을 증진시키기 위해 배양의 적절한 단계에 배지에 가입될 수 있다.The culture medium may be any cell culture that is commonly required such as L medium, E medium, M9 medium and the like. Various carbon sources, nitrogen sources, inorganic salts, vitamins and the like are mixed in the medium as is known. Tryptophan promoters can be used to, for example, mix M9 minimal batches with casamino acids to perform the action of the promoter. Chemicals such as indole acrylic acid can be added to the medium at appropriate stages of culture to enhance the action of the tryptophan promoter.
본 발명의 원하는 폴리펩티드는 배양물로부터 분리하여 통상의 방법으로 정제할 수 있다. 폴리펩티드는 숙주로부터 삼투압 충격등과 같이 순한 조건에서 추출하여 그의 고차구조를 유지하는 것이 바람직하다.Desired polypeptides of the invention can be isolated from culture and purified by conventional methods. The polypeptide is preferably extracted from the host under mild conditions such as osmotic shock, etc., to maintain its higher order structure.
상기의 분리 또는 정제방법은 생물질로부터 단백질류 물질을 분리하는데 통상적으로 사용되는 것과 같은 방법으로 수행한다. 예를 들어, 원하는 폴리펩티드의 물리적 또는 화학적 성질을 이용하는 여러가지 과정을 사용할 수 있다(참조. Biological Data Book II pp. 1175~1259, 1판, 1차인쇄 1980. 6. 23 가부시끼가이샤 도오꼬가가구도진 출판). 유용한 과정의 예는 통상의 단백질, 침전제, 한외여과, 분자체 크로마토그래피(겔 여과), 액체 크로마토그래피, 원심분리, 전기영동, 친화도 크로마토그래피, 투석 및 상기 과정의 조합이다.The separation or purification method is carried out in the same manner as is commonly used to separate protein-like substances from biomass. For example, various processes can be used that take advantage of the physical or chemical properties of the desired polypeptide (see Biological Data Book II pp. 1175-1259, 1st edition, 1st Printing 1980. 23 23 1980 Dooku Family Co., Ltd.) Dojin Publishing). Examples of useful procedures are conventional proteins, precipitants, ultrafiltration, molecular sieve chromatography (gel filtration), liquid chromatography, centrifugation, electrophoresis, affinity chromatography, dialysis and combinations of these processes.
원하는 폴리펩티드는 부분적으로 정제된 상동액에서 분리한다. 부분정제는, 예를들어 단백질 침전제로서 아세톤, 메탄올, 에탄올, 프로판올 또는 디메틸포름아미드(DMF)와 같은 유기용매, 아세트산, 과염소산(PCA) 또는 트리클로로아세트산(TCA) 등의 산성 반응제 등을 사용하는 처리, 황산암모늄, 황산나트륨 또는 인산나트륨 등의 염석제를 사용한 처리 및/또는 투석막, 평막, 속이빈 섬유막(hollow fiber membrane)등을 사용한 한외여과로 수행한다.Desired polypeptides are separated from partially purified homogenates. Partial purification is performed using, for example, an organic solvent such as acetone, methanol, ethanol, propanol or dimethylformamide (DMF), an acidic reagent such as acetic acid, perchloric acid (PCA) or trichloroacetic acid (TCA) as a protein precipitant. Treatment is performed by treatment with a salting agent such as ammonium sulfate, sodium sulfate or sodium phosphate and / or ultrafiltration using a dialysis membrane, a flat membrane, a hollow fiber membrane or the like.
상기 처리는 통상의 조건에서 통상적으로 수행되는 것과 동일한 방법으로 수행한다.The treatment is carried out in the same manner as conventionally carried out under ordinary conditions.
상기와 같이 조악하게 정제된 산물을 겔여과하여 원하는 물질의 활성을 나타내는 분획을 수집한다. 유용한 겔여과제는 구체적으로 제한하지 않고, 덱스트란 겔, 폴리아크릴아미드겔, 아가로즈겔, 폴리아크릴아미드-아가로즈겔, 셀룰로오즈 등이 있다. 공업적으로 구입가능한 유용한 제외의 예는 세파덱스 G형, 세파덱스 LH형, 세파로스형, 세파크릴형(모두 파마시아 제품), 셀로핀(치쏘사) 바이오겔 P형, 바이오겔 A형(둘다 바이오-라드 랩사 제품), 울트로 겔-C(LKB), TSK-G형(도요소다공업사 제품)등이 있다.As described above, the crudely purified product is gel filtered to collect a fraction showing the activity of the desired substance. Useful gel filters are not particularly limited and include dextran gels, polyacrylamide gels, agarose gels, polyacrylamide-agarose gels, cellulose and the like. Examples of useful exclusions that are commercially available include Sephadex G, Sephadex LH, Sepharose, Sephacryl (all from Pharmacia), Cellopin (Chiso) Biogel P, and Biogel A (both) Bio-Rad Labs), Ultro Gel-C (LKB), and TSK-G type (made by Torea Industries, Inc.).
본 발명의 폴리펩티드는 분획으로부터 균일물질로 분리할 수 있는데, 예를 들어, 각 분획을 히드록시아파티드 컬럼을 사용한 친화도 크로마토그래피, DEAE의 이온교환 컬럼 크로마토그래피, CM 또는 SP법, 크로마토포거싱법, 역상 HPLC등 또는 상기 방법의 조합으로 수행할 수 있다.Polypeptides of the present invention can be separated from the fraction into homogeneous materials. For example, each fraction can be separated by affinity chromatography using a hydroxyapatite column, ion exchange column chromatography of DEAE, CM or SP method, chromatographic fogging method. , Reversed phase HPLC or the like, or a combination of the above methods.
크로마토코커싱법은 여러가지 공지방법으로 수행할 수 있다. 컬럼으로 사용할 수 있는 것은 예를 들면, PBE94(파마시아 파인 케미칼스)등, 출발 완충용액으로는, 예를 들면, 이미다졸-염산 등, 용출액으로는, 예를들어, 폴리비피74(파마시아 파인 케미칼스) 및 염산(pH 4.0)의 혼합물이다.Chromatography caulking can be carried out by various known methods. The column can be used as, for example, PBE94 (Pharmacia Fine Chemicals), etc., as a starting buffer, for example, imidazole hydrochloric acid, eluents, for example, polybipi 74 (Pharmacia Fine Chemicals) E) and hydrochloric acid (pH 4.0).
역상 HPLC는 예를 들어, C4하이포어 역상 HPLC컬럼(바이오-라드 라보라토리즈)등으로, 아세토니트릴, 트리플루오로아세트산(TFA), 물 등 또는 상기 용매의 혼합물을 용출액으로 하여 수행할 수 있다.Reverse phase HPLC can be carried out, for example, with a C 4 hypophoric reverse phase HPLC column (Bio-Rad Laboratories) or the like, using acetonitrile, trifluoroacetic acid (TFA), water or the like or a mixture of the solvents as an eluent. have.
상기 방법으로, 본 발명의 IL-1α 유동체(폴리펩티드)는 분리하여 수득할 수 있다. IL-1α의 유전정보를 지정하는 유전자는 유사한 유전자 재조합과정을 통하여 IL-1α를 제공할 수 있다.In this way, the IL-1α fluid (polypeptide) of the present invention can be obtained separately. Genes that specify genetic information of IL-1α may provide IL-1α through a similar gene recombination process.
IL-1α 및 본 발명에 의한 그의 유도체는, 앞에서 서술한대로 탁월한 약리활성을 갖고 있는데, 상기 언급한 의약용도의 유용한 제제로 제제화될 수 있다. 상기 위약제제의 예는 항체생산, 백신효과증진 및 면역결핍 치료용 면역자극제, 항암제, 시토카인 생산 촉진제, 소염제, 방사상해 예방 또는 치료제, 지회주의적 예방 또는 치료제 등을 포함한다. 상기 의약제제는 보통 약학적으로 유효한 본 발명 펩티드 또는 IL-1α 및 적절한 담체를 함유하는 약학 조성물의 형태로 제제화된다. 유용한 담체의 예는 원하는 형태의 약제제조에 일반적으로 사용되는 충진제, 확장제, 결합제, 흡습제, 전개제, 계면활성제 등의 희석제 및 부형제를 포함한다. 약학 조성물의 형태는 본 발명 폴리펩티드 또는 IL-1α를 유효하게 함유하는 한 특정한 것으로 한정되지 않으며, 예를 들면, 정제, 분말, 과립, 환약 또는 유사한 고체제제의 형태일 수 있다. 그러나, 통상적으로 상기 조성물은 용액, 현탄액, 유화액 등의 주상용일 수 있다. 한편으로는, 상기 조성물은 사용전에 적절한 운반체를 가입하여 액체로 만들 수 있는 건조물일 수 있다. 상기 언급한 약학 조성물은 통상의 방법으로 제조할 수 있다.IL-1α and its derivatives according to the present invention have excellent pharmacological activity as described above, and can be formulated into useful formulations for the aforementioned medical uses. Examples of the placebo agents include immune stimulants for antibody production, vaccine effect enhancement, and immunodeficiency treatment, anticancer agents, cytokine production promoters, anti-inflammatory agents, anti-injury prevention or therapeutic agents, branching prevention or treatment agents, and the like. Such pharmaceutical preparations are usually formulated in the form of a pharmaceutical composition containing a peptide or IL-1α of the present invention which is pharmaceutically effective and a suitable carrier. Examples of useful carriers include diluents and excipients commonly used in the manufacture of pharmaceuticals of the desired form, fillers, extenders, binders, absorbents, developing agents, surfactants and the like. The form of the pharmaceutical composition is not limited to a specific one so long as it effectively contains the polypeptide of the present invention or IL-1α, and may be, for example, in the form of tablets, powders, granules, pills or similar solid preparations. Typically, however, the composition may be for columnar use, such as solutions, suspensions, emulsions, and the like. On the one hand, the composition may be a dry matter which can be made liquid by adding a suitable carrier before use. The above-mentioned pharmaceutical composition can be prepared by conventional methods.
수득된 약학 조성물의 형태에 따라서, 조성물은 적절한 경로로 투여된다. 예를 들면, 주사용 조성물은 정맥주사, 근육주사, 피하주사, 복강주사로 투여된다. 고체 조성물은 경구 또는 장내로 투여된다. 조성물의 활성성분 함량 및 투여랴은 투여의 방법 및 형태, 사용목적, 환자의 증상 등에 따라 적절히 결정한다. 일반적으로는 1~약 80중량%의 활성성분을 약제에 함입시키고, 활성성분으로 계산해서 상기 제제를 성인 1일당 약 0.1㎍~약 10㎎으로 투여하는 것이 바람직하다. 상기 제제를 항상 한번에 투여 해야할 필요는 없고 3~4회로 분할하여 투여할 수 있다.Depending on the form of the pharmaceutical composition obtained, the composition is administered by appropriate route. For example, the injectable composition is administered intravenously, intramuscularly, subcutaneously, or intraperitoneally. Solid compositions are administered orally or enterally. The active ingredient content and administration of the composition are appropriately determined depending on the method and form of administration, the purpose of use, the symptoms of the patient, and the like. In general, it is preferable to incorporate 1 to about 80% by weight of the active ingredient into the medicament, and calculate the active ingredient to administer the preparation at about 0.1 μg to about 10 mg per adult. The agent need not always be administered at one time, but may be administered in three to four divided doses.
하기 실시예에서, 생리활성은 하기 방법으로 결정한다.In the following examples, physiological activity is determined by the following method.
(1) IL-1 활성의 결정.(1) Determination of IL-1 activity.
새앙쥐 C3H/HeJ 세포주의 흉선세포를 이용한 J. J. Oppenhein등의 방법(J. Immunol., 116, 1466(1976))에 의한 LAF 활성의 항으로 표현된다.It is expressed as the term of LAF activity by J. J. Oppenhein et al. (J. Immunol., 116, 1466 (1976)) using thymocytes of a young mouse C3H / HeJ cell line.
(2) GIF 활성의 결정.(2) Determination of GIF Activity.
여러 농도로 희석된 시료용액 일부(0.1ml)를 96-웰 마이크로플레이트(96-well microplate, 코닝사제품)의 각 홈에 넣고, 인체 흑색종세포 A375를 2×204세포/ml의 양으로 함유한느 10% FCS의 이글리스 MEM현탄액 0.1ml을 각 홈에 넣은 후 CO2배양기(납코사)에서 4일간 배양한다. 배양후에 0.05ml의 0.05% 뉴트랄 레드(와꼬 쥰야꾸사)를 각 홈에 넣고, 37℃에서 2시간 반응시킨다. 상등액을 제거한 후, 0.3ml의 PBS(인산완충 식염수)를 각 홈에 부드럽게 부어 세척한다. 세척액을 제거한 후, 1염기성 인산나트륨 및 에탄올의 동량 혼합물 0.1ml을 각 홈에 넣고 미세 혼합기로 수분간 흔들어 준 후, 96-웰 미세 적정판용 광측정기(타이터 텍 멀티스캔, 플로우랩 제품)를 사용하여 540㎛의 흡광도로 세포에 흡수된 색소의 양을 측정하여 성장저해 활성을 결정한다. 대조군 세포성장의 50% 저해율을 나타내는 시험군, 즉 대조군에 측정된 흡광도의 1/2을 나타내는 시험군을 찾아낸다. 상기 시험군의 희석배율의 역수를 GIF 활성단위로 취한다. 따라서, 예를 들어 GIF 활성이 10단위이면, 시험용액은 10배 희석되어도 세포성장을 50%억제하는 활성을 갖는다.A portion of the sample solution diluted to different concentrations (0.1 ml) is placed in each groove of a 96-well microplate (Corning Corporation), and contains human melanoma A375 in an amount of 2 × 20 4 cells / ml. 0.1 ml of Eagle's MEM suspension of 10% FCS is placed in each groove and incubated in CO 2 incubator for 4 days. After incubation, 0.05 ml of 0.05% Neutral Red (Wako Junyakusa) was placed in each groove and allowed to react at 37 ° C for 2 hours. After removing the supernatant, 0.3 ml PBS (phosphate buffered saline) is poured gently into each groove and washed. After removing the wash solution, add 0.1 ml of the same mixture of basic sodium phosphate and ethanol into each groove, shake with a fine mixer for several minutes, and then use a photometer (Titertec MultiScan, Flow Lab) for 96-well microtiter plates. The growth inhibition activity is determined by measuring the amount of pigment absorbed into the cells by using an absorbance of 540 µm. A test group showing 50% inhibition of control cell growth, i.e., a test group showing half the absorbance measured in the control group, is found. The inverse of the dilution factor of the test group is taken as the GIF active unit. Thus, for example, if GIF activity is 10 units, the test solution has 50% inhibition of cell growth even when diluted 10-fold.
하기 도면을 참조예 및 실시예에 인용한다.The following figures are cited in the Reference Examples and Examples.
제1도는 플라스미드 pcD-GIF-16 및 플라스미드 pcD-GIF-207의 cDNA의 제한효소지도를 나타내고; 제2도는 플라스미드 pcD-GIF-207 및 플라스미드 pTMI으로부터 플라스미드 ptrpIL-1α113이 구성되는 방법을 나타내는 도면이고; 제3도는 항암활성 시험결과를 나타내고; 제4도 및 제5도는 본 발명의 폴리펩티드의 CSF 생산촉진효과를 시험하여 얻은 결과를 나타내고; 제6도는 본 발명 폴리펩티드의 소염효과를 시험하여 얻은 결과를 나타내고; 제7도는 본 발명 폴리펩티드의 방사선 상해 예방활성을 시험하여 얻은 결과를 나타내고; 제8도는 본 발명 폴리펩티드의 기회주의적 감염예방 활성을 시험하여 얻은 결과를 나타낸다.1 shows a restriction map of the cDNA of plasmid pcD-GIF-16 and plasmid pcD-GIF-207; 2 shows how plasmid ptrpIL-1α113 is constructed from plasmid pcD-GIF-207 and plasmid pTMI; 3 shows anticancer activity test results; 4 and 5 show the results obtained by testing the CSF production promoting effect of the polypeptide of the present invention; 6 shows the results obtained by testing the anti-inflammatory effect of the polypeptide of the present invention; Figure 7 shows the results obtained by testing the radioactive injury prevention activity of the polypeptide of the present invention; 8 shows the results obtained by testing the opportunistic prophylactic activity of polypeptides of the invention.
참고예 1Reference Example 1
(1) U937 세포의 예방(1) Prevention of U937 Cells
1.4×109의 인체 조직구 임파구 U397 세포(Ascenso, J. K. 등, Blood, Vol. 57, 170(1981)를 25ng/ml의 12-0-네트라데카노일포르볼-13-아세테이트(TPA, 파마시아제품), 10㎍/ml의 콘카나발린 A(ConA, 시그마제품) 및 10% FCS를 함유하는 RPMI-1640 배양액에 넣어 4×105세포/ml의 농도를 갖는 현탄액을 제조한다.1.4 × 10 9 human tissue lymphocyte lymphocytes U397 cells (Ascenso, JK et al., Blood, Vol. 57, 170 (1981) were added to 25ng / ml of 12-0-Niradecanoylphorball-13-acetate (TPA, Pharmacia). Product), 10 μg / ml Concanavalin A (ConA, Sigma) and 10% FCS in RPMI-1640 culture solution containing a suspension having a concentration of 4 × 10 5 cells / ml.
세포 현탄액을 각각 10ml씩 나누어 배양접시(Falcon 3003, 직경 9cm)에 담아, 5% 이산화탄소 기체내에서 37℃로 3일간 배양한다. 흡기기(aspirator)를 사용해 배양 상층액을 제거한 후, 세균유래 리포폴리사카라이드(LPS, Difco 사 제품) 10㎍/ml, 뮤라밀디펩티드(MDP, Wako Pure Chemical 사 제품) 1㎍/ml 및 TPA lng/ml를 함유한 PRMI-1640 배지 10ml를 각각의 접시에 담는다.10 ml each of the cell suspension is placed in a culture dish (
상기 배지로 5% 이산화탄소 기체내에서 37℃로 18시간 세포를 배양한다. 접시바닥에 부착한 U937 세포를 mRNA 제조용으로 사용한다.Incubate the cells for 18 hours at 37 ° C. in 5% carbon dioxide gas. U937 cells attached to the bottom of the dish are used for mRNA preparation.
(2) mRNA의 제조(2) preparation of mRNA
구아니디늄/은 페놀법(Feramisco, J. R. 등, J. Bio. Chem. Vol. 257, 11024(1982) 및 구 아니디늄/세슘클로라이드법(Glisin, V, 등, Biochemistry, Vol. 13, 2633(1974)을 조합하여 RNA를 추출한다.Guanidinium / silver phenol method (Feramisco, JR et al., J. Bio. Chem. Vol. 257, 11024 (1982) and guanidinium / cesium chloride method (Glisin, V, et al., Biochemistry, Vol. 13, 2633 ( 1974) is used to extract RNA.
공정(1)에 의해 배양된 U937 세포를 세척하기 위해, 상층액을 제거한 후에 PBS(-)용액 5ml로 디쉬를 씻는다. 그 다음 각 디쉬에 4M구아니딘 이소티오시아네이트 용액(Fluka 사 제품), 50mM 트리스-HCl(pH 7.6), 10mM EDTA 및 2% 소디움 라우로일 사르코시네이트를 1ml담고 세포를 용해시킨다. 용액을 고무찰자와 파스퇴르 피펫으로 세포용액 420ml를 수거하여, 60℃로 유지하고 18G 주사침을 통과시켜 염색체 DNA를 절단한다. 이어서, 60℃로 가열한 페놀을 용액과 동일한 양으로 용액에 부가하고, 혼합액을 18G 주사침으로 교반하여 보다 많이 절단한다. 혼합액에 0.1M 소디움 아세테이트-10mM 트리스-HCl(pH 7.4)-1mM EDTA 용액 210ml와 클로로포름-이소아밀알코올 혼합액(부피비 24:1) 420ml를 부가한다. 혼합액을 60℃에서 15분간 격력하게 교반한 후, 얼음으로 냉각시키고 4℃에서 20분간 3000r.p.m으로 원심분리한다.In order to wash the U937 cells cultured by the step (1), the dish is washed with 5 ml of PBS (-) solution after removing the supernatant. Each dish is then lysed with 1 ml of 4M guanidine isothiocyanate solution (Fluka), 50 mM Tris-HCl (pH 7.6), 10 mM EDTA and 2% sodium lauroyl sarcosinate. The solution was collected with a rubber stamper and Pasteur pipette, 420 ml of cell solution was collected, maintained at 60 ° C., and passed through an 18 G needle to cut chromosomal DNA. Subsequently, phenol heated to 60 ° C. is added to the solution in the same amount as the solution, and the mixed solution is stirred with an 18 G needle to cut more. To the mixture is added 210 ml of 0.1 M sodium acetate-10 mM Tris-HCl (pH 7.4) -1 mM EDTA solution and 420 ml of chloroform-isoamyl alcohol mixture (volume ratio 24: 1). The mixture is vigorously stirred at 60 ° C. for 15 minutes, then cooled with ice and centrifuged at 3000 r.p. m at 4 ° C. for 20 minutes.
수집된 수층에 수층의 2배량의 에탄올을 부가한다. 혼합액을 -70℃로 밤새 방치하면 조 RNA 침전물이 수득된다. 조 RNA를 6M 구아니딘 이소티오시아네이트 -5mM 소디움 시트레이트(pH 7.0)-0.1m β-메르캅토 에탄올-0.5% 소디움 라우로일 사르코시네이트 용액 48ml에 용해시킨다. 세슘클로라이드(19.2g)을 상기 용액에 용해시킨다. 생성된 용액중 7ml를 5.7M 세슘클로라이드-0.1M EDTA(pH 7.5) 4ml 위에 올려 놓는다. 혼합액을 25℃에서 20시간 31500r.p.m으로 원심분리(Beckman SW40Ti 로타사용)하여 RNA를 수집한다.Two times the amount of ethanol of the aqueous layer is added to the collected aqueous layer. The mixture is left at -70 [deg.] C. overnight to give crude RNA precipitate. The crude RNA is dissolved in 48 ml of 6M guanidine isothiocyanate-5 mM sodium citrate, pH 7.0-0.1m β-mercapto ethanol-0.5% sodium lauroyl sarcosinate solution. Cesium chloride (19.2 g) is dissolved in the solution. 7 ml of the resulting solution is placed on 4 ml of 5.7 M cesium chloride-0.1 M EDTA (pH 7.5). RNA is collected by centrifugation (using Beckman SW40Ti Rota) at 25 ° C. for 20 hours at 31500 r.p.m.
따라서 RNA 9.7mg이 수득된다.Thus, 9.7 mg of RNA is obtained.
RAN에서 mRNA를 수득하기 위해, RNA를 올리고(dT)-셀룰로오스(Collaborative Research Inc 사 제품) 컬럼 크로마토그래피한다. 흡착시키기 위해, 10mM 트리스-HCl(pH 7.5)-0.5M NaCl-1mM EDTA를 사용한다. 용리시키기 위해, 10mM 트리스-HCl(pH 7.5)-1mM EDTA를 사용한다.To obtain mRNA from RAN, RNA is subjected to column chromatography of oligo (dT) -cellulose (manufactured by Collaborative Research Inc.). To adsorb, 10 mM Tris-HCl (pH 7.5) -0.5M NaCl-1 mM EDTA is used. To elute, 10 mM Tris-HCl (pH 7.5) -1 mM EDTA is used.
결과적으로 mRNA 400㎍이 수득된다.As a result, 400 μg of mRNA is obtained.
(3)cDNA 도서관은 오까아마-버그법에 의해 제조되며, 이 방법에 의해 cDNA가 동물세포내에 발현될 수가 있다. cDNA 클로닝에 사용되는 dT 꼬리가 부착된 운반체 개시제는 플라스미드 pcDVl 로부터 제조되며, dG 꼬리-부착된 링커 DNA는 플라스미드 PL1로부터 제조되고, 각각 오까야마 등의 방법(Okayama, H. 및 P. Berg, Molecular and Celluar Biology, Vol., 3, p. 280(1983))에 의한다.(3) The cDNA library is produced by the Amazon-Bug method, and cDNA can be expressed in animal cells by this method. The dT tailed carrier initiators used for cDNA cloning are prepared from plasmid pcDVl and the dG tail-attached linker DNA is prepared from plasmid PL1, respectively (Okayama, H. and P. Berg, Molecular). and Celluar Biology, Vol., 3, p. 280 (1983)).
공정(2)에 의해 수득된 mRNA(15㎍)를 5mM 트리스-HCl(pH 7.5)-0.5mM EDTA(pH 7.5) 수용액 20μl에 용해시켜 65℃에서 5분간 이어 37℃에서 5분간 반응시킨다. 반응 혼합액의 전체량이 40μl이 되도록 맞추는데, 용액내에는 50mM 트리스-HCl(pH 8.3), 8mM MgCl2, 30mM KCl, 0.3mM 디티오트레이톨, dATP, dGTP, dCTP 및 dTTP를 각각 2mM 운반체 개시제 DNA 2.8㎍,RN 아제 억제제(Promega Biotech 사 제품) 60단위 및 역전사효소(Bio-Lad 사 제품) 40단위가 포함된다. 이어서 37℃에서 1시간 배양한다. 2μl의 0.5M EDTA(pH 7.5)와 2μl의 10% SDS를 가입하여 반응을 종결시키고 계속해서, 반응액을 페놀-클로로포름 추출 및 클로로포름 추출하여 추출물을 에탄올로 침전시키면 운반체 개시제 cDNA, mRNA가 수집된다.MRNA (15 μg) obtained by step (2) was dissolved in 20 μl of 5 mM Tris-HCl (pH 7.5) -0.5 mM EDTA (pH 7.5) aqueous solution and reacted at 65 ° C. for 5 minutes and then at 37 ° C. for 5 minutes. The total amount of the reaction mixture was adjusted to 40 μl, in which 50 mM Tris-HCl (pH 8.3), 8 mM MgCl 2 , 30 mM KCl, 0.3 mM dithiothreitol, dATP, dGTP, dCTP and dTTP were respectively added to the 2 mM carrier initiator DNA 2.8. 60 μg, RN agonist inhibitor (Promega Biotech) and 40 units of reverse transcriptase (Bio-Lad). Then incubate for 1 hour at 37 ℃. 2 μl of 0.5 M EDTA (pH 7.5) and 2 μl of 10% SDS were added to terminate the reaction. Subsequently, the reaction solution was extracted by phenol-chloroform extraction and chloroform extraction, and the extract was precipitated with ethanol to collect carrier initiator cDNA and mRNA. .
수집된 운반체 개시제 cDNA:mRNA를 140mM 소듐 카코딜레이트, 30mM 트리스-HCl(pH 6.8), 1mM CaCl2, 0.1mM 디티오트레이톨, 폴리 A 0.3㎍, 66μM dCTP 및 말단 데옥시뉴클레오티딜 전이효소(Pharmacia 사 제품) 38단위를 함유하는 반응 혼합액 30μl내에서 5분동안 37℃로 반응시킨 후, 0.5M EDTA(pH 7.5) 1.5μl와 10% SDS 1.5μl를 혼합액에 가입하여 반응을 종결시킨다. 혼합액을 페놀-클로로포름 추출 및 클로로포름 추출하여 추출물을 에탄올로 침전시키면 올리고 dC 꼬리가 부착된 cDNA, mRNA-운반체 개시제가 수득된다.The collected carrier initiator cDNA: mRNA was collected from 140 mM sodium cacodylate, 30 mM Tris-HCl, pH 6.8, 1 mM CaCl 2 , 0.1 mM dithiothreitol, poly A 0.3 μg, 66 μM dCTP and terminal deoxynucleotidyl transferase (Pharmacia Co., Ltd.) After reaction at 37 ° C. for 5 minutes in 30 μl of a reaction mixture containing 38 units, 1.5 μl of 0.5 M EDTA (pH 7.5) and 1.5 μl of 10% SDS are added to the mixture to terminate the reaction. The mixture was extracted with phenol-chloroform extraction and chloroform extraction to precipitate the extract with ethanol to obtain cDNA, mRNA-carrier initiator with oligo dC tail.
수집된 헥산을 7mM 트리스-HCl(pH 7.5), 7mM MgCl1, 60mM NaCl, 100g/ml 闇혈청 알부민 및 제구한효소 힌드Ⅲ(Nippon gene 사 제품) 12단위를 함유한느 반응 혼합액 20μl내에서 90분간 37℃로 반응시킨다. 계속해서 0.5M EDT(pH 7.5)1μl와 10% SDS 1μl를 혼합액에 가입하여 반응을 종결시킨 후, 이어 페놀-클로로포름 및 이어 클로로포름으로 추출하고 에탄올로 침전시키면 Hind Ⅲ로 절단된 올리고 dc 꼬리가 부착된 cDNA:mRNA-운반체 개시제가 수집된다. 생성물을 10mM 트리스-HCl(pH 7.5)-1mM EDTA(pH 7.5)(TE(pH 7.5))10μl내에 용해시킨다. 이 용액중 1μl를 상기의 TE(pH 7.5), 0.1M NaCl 및 올리고 dG 꼬리가 부착된 링커 DNA(14ng)으로 구성된 반응 혼합액 10μl내에서 배양하는데, 처음에는 65℃에서 2분간, 이후에는 42℃에서 30분간 배양한다. 그후 혼합액을 0℃로 냉각시킨다.The collected hexanes were added to 90 mM in 20 μl of a reaction mixture containing 7 mM Tris-HCl (pH 7.5), 7 mM MgCl 1 , 60 mM NaCl, 100 g / ml 闇 serum albumin and 12 units of purified enzyme Hind III (manufactured by Nippon gene). The reaction is carried out at 37 ° C for minutes. Subsequently, 1 μl of 0.5 M EDT (pH 7.5) and 1 μl of 10% SDS were added to the mixture to terminate the reaction, followed by extraction with phenol-chloroform and then chloroform, followed by precipitation with ethanol. CDNA: mRNA-carrier initiators are collected. The product is dissolved in 10 μl of 10 mM Tris-HCl (pH 7.5) -1 mM EDTA (pH 7.5) (TE (pH 7.5)). 1 μl of this solution is incubated in 10 μl of the reaction mixture consisting of TE (pH 7.5), 0.1 M NaCl and linker DNA (14 ng) with oligo dG tail, initially at 65 ° C. for 2 minutes, then at 42 ° C. Incubate for 30 minutes at. The mixture is then cooled to 0 ° C.
반응혼합액을 100μl로 맞추는데, 용액내에는 20mM 트리스-HCl(pH 7.5), 4mM MgCl2, 10mM(NH4)2SO, 0.1M KDl, 50㎍/ml 소혈청 알부민, 0.1mM β-NAD(니코틴아미드-아데닌-디뉴클레오티드, Pharmacia 사 제품) 및 이, 콜리 DNA 리가제(Pthrmacia 사 제품) 0.6㎍이 포함된다. 이어 12℃에서 밤새 배양한다. 반응 혼합액에 dATP, dGTP, dCTP 및 dTTP를 각각 40μM 및 -NAD 0.15mM를 부가한다. 또한 이. 콜리 DNA 리가제 0.4㎍, 이. 콜리 DNA 폴리머라제 I(Boehringer Mannheim 사 제품) 및 이. 콜리 RN 아제 H(Pharmacia 사 제품) 1단위를 부가하고, 혼합액을 12℃에서 1시간 이어 25℃에서 1시간동안 배양한다.Adjust the reaction mixture to 100 μl, in the
결과적으로 cDNA 도서관(약 21000 클론 함유)이 수득된다.As a result, a cDNA library (containing about 21000 clones) is obtained.
(4) 원숭이 COS-1 세포의 감염(4) Infection of Monkey COS-1 Cells
상기 공정(3)에 의해 수득된 cDNA 도서관을 평균 약 70클론을 포함하는 군으로 각각 나눈다. 각각의 군으로부터 플라스미드 DNA를 알칼리 용해법(Molecular Cloning-A 실험서, Cold Spring Harbor Laboratory, 1982, p. 368)에 의해 배양된 원숭이 세포, COS-1세포(Gluzman, Y., Cell, Vol. 23, p. 175(1981)를 전이감염용으로 상기에서 각 군으로 부터 제조된 플라스미드 DNA를 사용하여 감염시킨다. 전이감염은 DEAE-덱스트린법(Yokota, T. 등, Proc. Natl. Acad. Sci. U.S.A. Vol. 81, p. 1070(1984)에 의해 수행된다. 보다 상세히 설명하면, 트립신으로 처리된 COS-1세포를 10%FCS를 함유한 RPMI-1640 배지내에 현탁시켜 농도를 1×106세포/ml로 맞춘다. 계속해서, 현탁액중 500μl를 10%FCS를 함유한 2ml의 RPMI-1640 배지를 함유하는 각각의 웰 플레이트(well plate)의 6개홈에 넣는다. 세포를 37℃에서 배양한 후, 상층액을 제거하고, 세포를 혈청이 없는 배지로 세척하고, 10㎍/ml의 플라스미드 DNA, 0.4㎍/ml의 DETE-덱스트린(Pharmacia 사 제품), 50mM 트리스-HCl(pH 7.4) 및 10% FCS를 함유한 RPMI-1640 메디움 1ml를 각각의 홈에 넣은 후, 37℃에서 4.5시간동안 배양한다. 그후, 상층액을 제거하고, 세포를 혈청이 없는 배지로 세척하여 150μM클로로킨(Sigma 사 제품)과 10%FCS를 함유한 RPMI-1640 배지 2ml를 각각의 홈에 넣은 후, 37℃에서 3시간 동안 배양한다. 상층액을 제거하고, 세로를 혈청이 없는 배지로 세척한 후 각각의 홈내에 있는 세포에 10% FCS를 함유한 RPMI-1640 배지 3ml를 부가하여 37℃에서 72시간 동안 배양한다. 상층액을 수집한 후, 10% FCS를 함유한 RPMI-1640 배지 2ml를 각각의 홈에 넣은 후, 동결-융해 순환을 2번 한다. 그후 세포 추출물을 수집한다. 배양 상층액과 세포 추출물의 GIF 활성도를 조사한다.The cDNA libraries obtained by the above process (3) are each divided into groups containing an average of about 70 clones. Plasmid DNA from each group was cultured by monkey lysis (Molecular Cloning-A test book, Cold Spring Harbor Laboratory, 1982, p. 368), COS-1 cells (Gluzman, Y., Cell, Vol. 23). , p. 175 (1981) for infectious infection using plasmid DNA prepared from each group above The transfection was carried out using the DEAE-dextrin method (Yokota, T. et al., Proc. Natl. Acad. Sci. USA Vol. 81, p. 1070 (1984) In more detail, trypsin-treated COS-1 cells were suspended in RPMI-1640 medium containing 10% FCS so that the concentration was 1 × 10 6 cells. / μl. Then, 500 μl of the suspension is placed in 6 wells of each well plate containing 2 ml of RPMI-1640 medium containing 10% FCS, and the cells are incubated at 37 ° C. Supernatant was removed, cells were washed with serum free medium, 10 μg / ml plasmid DNA, 0.4 μg / ml DETE-dextrin (Pharm) 1 ml of RPMI-1640 medium containing 50 mM Tris-HCl (pH 7.4) and 10% FCS into each groove, and incubated for 4.5 hours at 37 ° C. Then, the supernatant was removed, The cells were washed with medium without serum, and 2 ml of RPMI-1640 medium containing 150 μM chlorokin (manufactured by Sigma) and 10% FCS were placed in each groove, and then incubated for 3 hours at 37 ° C. After washing the media with serum-free medium, 3 ml of RPMI-1640 medium containing 10% FCS was added to the cells in each groove and incubated for 72 hours at 37 ° C. After the supernatant was collected, 10% 2 ml of RPMI-1640 medium containing FCS is placed in each groove, followed by two freeze-thaw cycles, after which cell extracts are collected GIF activity of the culture supernatant and cell extracts are examined.
GIF 활성도를 나타내는 군을 각각 10클론씩 24군으로 나누고, 이를 사용하여 상기와 동일한 공정을 반복하여 GIF활성도를 결정한다. GIF 활성도를 나타내는 군내의 클론이 GIF 활성도를 나타내는 클론임을 확인하기 위해서 상기와 동일한 공정을 반복한다.The group representing GIF activity was divided into 24 groups of 10 clones, respectively, and the same process was repeated to determine GIF activity. The same process as above is repeated to confirm that the clone in the group showing GIF activity is a clone showing GIF activity.
결과적으로, 2종류의 클론, 즉 pcD-GIF-16 및 pcD-GIF-207이 수득된다.As a result, two kinds of clones are obtained, namely pcD-GIF-16 and pcD-GIF-207.
표 1은 상기 클론의 GIF 활성도(GIF 단위/ml)를 나타낸다.Table 1 shows the GIF activity (GIF units / ml) of the clones.
(5) 클론의 분석(5) analysis of clones
제1도는 플라스미드 pcD-GIF-16 및 플라스미드 pcD-GIF-207의 cDNA의 제한효소 지도를 보여준다.Figure 1 shows the restriction map of the cDNA of plasmid pcD-GIF-16 and plasmid pcD-GIF-207.
상기 플라스미드 각각의 cDNA의 염기서열을 염기-특이성 화학적 변형법(Methods in Enzymology, Vol. 65, 499(1980) 및 M13 피지운반체를 사용하는 디데옥시 연쇄 종견법(Proc. Natl. Acad. Sci., U.S.A., Vol74, 5463(1977))[Gene, Vol. 19, 269(1982)]으로 결정한다.The base sequence of each cDNA of each of the plasmids was determined by basee-specific chemical modification (Methods in Enzymology, Vol. 65, 499 (1980) and Mide sebum carrier (Decoxy chain detection method (Proc. Natl. Acad. Sci., USA, Vol 74, 5463 (1977)) and Gene, Vol. 19, 269 (1982).
결과적으로, pcD-GIF-207의 cDNA는 마치(March등, Nature, Vol. 315, 641(1985))등이 보고한 IL-1α의 코딩지역의 cDNA와 동일함을 알았다.As a result, it was found that the cDNA of pcD-GIF-207 was the same as the cDNA of the coding region of IL-1α reported by March et al., Nature, Vol. 315, 641 (1985).
IL-1α의 전구체 단백질의 유전정보를 지정하는 cDNA를 갖는 폴라스미드 pcD-GIF-207을 함유하는 이.콜리 균주 x1776은 일본국 통상산업성 공업기술원 미생물 공업기술 연구소에 수탁번호 FERM BP 1294, 에스캐리키아콜리 x1776/pcD-GIF-207라는 명칭으로 기탁되었다. 또한, 이 균주는 1987년 6월 2일로 한국종균회협회에 KFCC-10374의 수탁변번호로 기탁되었다.E. coli strain x1776 containing plasmid pcD-GIF-207 having cDNA specifying the genetic information of the precursor protein of IL-1α was assigned the accession number FERM BP 1294, S. Was deposited under the name Carrickia coli x1776 / pcD-GIF-207. In addition, this strain was deposited on June 2, 1987, with the accession number of KFCC-10374 to the Korean Society of Seedling Association.
(6) 폴리펩티드의 발현 및 제조(6) Expression and Preparation of Polypeptides
상기 플라스미드 pcD-GIF-207을 제한효소 HindIII 및 HincII로 절단하고, 아가로즈 겔에 전기 영동하여 약 0.66kb HindIII-HincII DNA 단편을 분리 정제하고, 제한효소 Alu I으로 처리하여 약 0.5-kb Alu I-Hinc II DNA 단편을 분리하여 수득한다.The plasmid pcD-GIF-207 was digested with restriction enzymes HindIII and HincII, electrophoresed on agarose gel to isolate and purify about 0.66 kb HindIII-HincII DNA fragment, and treated with restriction enzyme Alu I to treat about 0.5-kb Alu I -Hinc II DNA fragments are obtained by isolation.
다음에, 합성 올리고뉴클레오티드(5′ CGATAATGTGTCAGCACCTTTTAG 3′ 및 5′ CTAAAAGGTGCTGACATTAT 3′)을 5′ 말단에서 T4 폴릴뉴크레오티드 키나제로 힌산화시키고 상기에서 수득한 Alu I-Hinc II DNA 단편과 T4 DNA 리가제로 접합시킨다. 접합된 제한효소 Cla I으로 절단되고 아라로즈 겔에 전기영동하여 약 0.54-kb Cla I-Cla I DNA 단편을 분리 및 정제한다.Next, the synthetic oligonucleotides (5 ′
한편으로, 플라스미드 pTMI(후미오 이마모또, 다이시(대시) Vol. 22 289(1985)를 제한효소 Cla I으로 절단하고, 송아지창자 알칼리 포스피타제(CIAP)와 반응시킨후 앞에서 제조한 약 0.54-kb Cla I-Cla I -Cla I DNA 단편과 T4 DNA 리가제로 결합하여 목적으로 하는 폴리펩티드의 발현 플라스미드 ptrpIL-1α-113을 수득한다.On the other hand, the plasmid pTMI (Fumio Imamoto, Daishi Vol. 22 289 (1985)) was digested with restriction enzyme Cla I, reacted with calf intestinal alkali phosphatase (CIAP) and then prepared about 0.54- kb Cla I-Cla I -Cla I DNA fragments were combined with T4 DNA ligase to obtain the expression plasmid ptrpIL-1α-113 of the desired polypeptide.
상기 플라스미드를 이. 콜리 HB101에 형질전환시키고, 비등법에 의해 수득된 플라스미드 DNA의 절단 단편의 크기를 분석하여 목적하는 형질전환체를 선별한다.The plasmid to E. coli. Coli HB101 is transformed and the desired transformants are selected by analyzing the size of the cut fragments of the plasmid DNA obtained by boiling.
제2도는 상기 방법을 도식적으로 보여준다.2 diagrammatically shows the method.
플라스미드 ptrpIL-1α-113을 선택된 형질전환체에서 추출하여 이.콜리 W3110에 형질전환하여, 이.콜리 W3110/ptrpIL-1α-113을 수득한다.The plasmid ptrpIL-1α-113 is extracted from a selected transformant and transformed into E. coli W3110 to obtain E. coli W3110 / ptrpIL-1α-113.
실시예 1Example 1
(1) 형질전환체의 배양(1) culturing transformants
참고예 1,(56)에서 수득한 형질전환체(이. 콜리 W3110/ptrpIL-1α-113)dmf 50㎍/ml이 임피실린 및 20㎍/ml의 L-트립토판을 함유하는 LB배지(1% 트립톤, 0.5% 이스트 익스트랙트 및 0.5% NaCl)10ml로 37℃에서 교반하여 하룻밤 배양한다. 배양물 8ml로, 50㎍/ml의 임피실린 및 1% 카사미노산을 함유하는 M9 최소배지(0.6% KHPO, 0.05% NaCl, 0.1% NHCl, 2mM MgSO, 0.2% 글루코오즈 및 0.1mM CaCl) 400ml을 접종하여 37℃에서 9시간 배양한다. 수득한 이. 콜리 세포를 10ml의 1M Na2HPO4에 현탁시키고 냉장실에서 하룻밤 방치한 후 10mM 트리스-HCl 완충용액(pH 8.0)으로 2일간 투석한다.The transformant (E. coli W3110 / ptrpIL-1α-113) dmf 50 μg / ml obtained in Reference Examples 1 and 56 contained LB tryptophan containing 1 mg / ml L-tryptophan (1%). Incubate overnight at 37 ° C. with 10 ml of tryptone, 0.5% yeast extract and 0.5% NaCl). With 8 ml of culture, 400 ml of M9 medium (0.6% KHPO, 0.05% NaCl, 0.1% NHCl, 2 mM MgSO, 0.2% Glucose and 0.1 mM CaCl) containing 50 μg / ml of impicillin and 1% casamino acid Inoculate and incubate at 37 ° C. for 9 hours. Obtained tooth. Coli cells are suspended in 10 ml of 1
투석물을 원심분리하여 침전물과 상층액으로 분리한다. 상층액은 28ml 수득되고 7.3×107 단위의 CIF 활성을 갖는 것으로 발견되었다.The dialysate is centrifuged to separate the precipitate and the supernatant. The supernatant was obtained with 28 ml and had a CIF activity of 7.3 × 10 7 units.
(2) 폴리펩티드의 정제(2) Purification of Polypeptides
상기 과정(1)에서 수득한 상층액 2ml을 하기 조건에서 울트로크롬 GTi(ULTROCHROM GTi, LKB) 크로마토그래피 시스템을 사용한 이온교환 HPLC로 정제한다.2 ml of the supernatant obtained in the above procedure (1) was purified by ion exchange HPLC using an ULTROCHROM GTi (LKB) chromatography system under the following conditions.
컬럼 : TSK 겔 DEAE-5PW(7.5×75mm, 도요소다사 제품)Column: TSK gel DEAE-5PW (7.5 × 75mm, manufactured by Torea Corp.)
용리액 A : 20mM 트리스-HCl 완충용액(pH 8.0)Eluent A: 20 mM Tris-HCl buffer (pH 8.0)
용리액 B : 0.5M NaCl 함유 20mM 트리스-HCl 완충용액(pH 8.0)Eluent B: 20 mM Tris-HCl buffer solution containing 0.5 M NaCl (pH 8.0)
유속 : 1ml/분Flow rate: 1ml / min
분획 부피 : 1ml/분/시험관Fraction Volume: 1ml / min / Test Tube
구배프로필 :Draft Profile:
시간(분) %B% B% B
0 00 0
5 05 0
65 6065 60
70 10070 100
80 10080 100
85 085 0
100 0100 0
DEAE-HPLC를 거치면 두개의 GIF-활성분획, 즉, 체류시간 26~28분의 분획(이하 분획 1이라 한다)및 체류시간 32.5~34.5분의 분획(히아 분획 2라 한다)를 얻는다.DEAE-HPLC yields two GIF-active fractions, namely a fraction with a residence time of 26 to 28 minutes (hereinafter referred to as fraction 1) and a fraction with a residence time of 32.5 to 34.5 minutes (called hyal fraction 2).
상기의 두개 분획을 DEAE-HPLC 및 겔여과 HPLC하여 분획 1 및 2를 정제 상태로 수득한다.The two fractions are subjected to DEAE-HPLC and gelfiltration HPLC to give
분리된 GIF-활성분획이 상기와 같이 수득되었기 때문에, 상기 분획을 하기와 같이 시험하여 확인한다.Since the separated GIF-active fraction was obtained as above, the fraction was tested and confirmed as follows.
(3) SDS 폴리아크릴아미드 겔 전기영동(SDS-PAGE)(3) SDS polyacrylamide gel electrophoresis (SDS-PAGE)
분획 1 또는 2를 U.K. 라엠리의 방법(U.K. Laemmli; Nature, 277 680(1970)에 따라 하기 조건에서 SDS-PAGE를 수행한다.
시편 : 분획 1 또는 2를 완전히 건조시킨 후, 라엠리 시료 완충용액(완충용액 부피의 1/20 양의 2-메르캅토 에탄올 함유(2ME ))으로 용해하고 100℃에서 4분간 처리.Specimen: After complete drying of
겔 : 15% 폴리아크릴아미드, 두께 : 1.5mm.Gel: 15% polyacrylamide, thickness: 1.5 mm.
기구 : 프로테안(PROTEAN), 바이오-라드제품.Organization: PROTEAN, Bio-Rad.
전기영동 : 일정전류 40mA, 2시간.Electrophoresis: 40mA, 2 hours constant current.
전기영동한 겔을 실버 스테인 키트(바이오-라드)로 염색한다. 결과로, 분획 1 및 2는 각각 약 18.3kd의 분자량에 단일 띠로 이동하는데, 이는 유전자로 계산한 18kd의 분자량에 거의 일치한다.Electrophoretic gels are stained with silver stain kit (Bio-Rad). As a result,
(4) 등전접속(IEF)(4) Isoelectric connection (IEF)
분획 1 및 2를 3.5~9.5pH 범위의 암폴린 PAG 판(LKB) 및 모델 1415(바이오-라드)를 사용하여 하기 조건으로 IEF를 수행한다.
시편 : 분획 1의 PBS 용액을 2일 방치한 것 및 2주일 방치한 것.Specimen: PBS solution of
분획 2의 PBS 용액을 2일 방치한 것 및 2주일 방치한 것.The PBS solution of
PBS 용액 : 대조 및 하기 표지 단백질(pl 표지 단백질)의 모두 5레인.PBS solution: 5 lanes of both control and the following labeled protein (pl labeled protein).
표지단백질 : 아밀로글루코시다제(3.50)Label protein: amyloglucosidase (3.50)
콩 트립신 억제제(4.55)Soy trypsin inhibitor (4.55)
β-락토글로불린 A(5.20)β-lactoglobulin A (5.20)
소 카르보닉 안히드라제 B(5.85)Bovine Carbonic Anhydrase B (5.85)
인체 카르보닉 안히드라제 B(6.55)Human carbonic anhydrase B (6.55)
말 미오글로빈-산성 띠(6.85)Horse myoglobin-acid strips (6.85)
말 미오글로빈-염기성 띠(7.35)Horse Myoglobin-Basic Strap (7.35)
렌틸 렉틴-산성 띠(8.15)Lentil Lectin-Acid Strip (8.15)
렌틸 렉틴-중성 띠(8.45)Lentil Lectin-Neutral Strip (8.45)
렌틸 렉틴-염기성 띠(8.65)Lentil Lectin-Base Band (8.65)
트립시노겐(9.30)Trypsinogen (9.30)
전극용액 : 양극용액=1M HPOElectrode solution: Anode solution = 1M HPO
음극용액=1M NaOHCathode solution = 1 M NaOH
전기영동 : 정전력 1W/cm 겔 넓이, 10℃로 냉각, 90분.Electrophoresis: electrostatic power 1W / cm gel width, cooled to 10 ℃, 90 minutes.
염색 : 실버 스테인 키트 사용.Dyeing: using silver stain kit.
전기 영동한 겔을 1cm 간격으로 잘라서 1ml의 증류수로 2일간 교반하여 추출한다. 전기영동 후의 pH값을 측정하여 등전점을 계산한다.The electrophoresis gel was cut at 1 cm intervals and extracted by stirring for 2 days with 1 ml of distilled water. The isoelectric point is calculated by measuring the pH value after electrophoresis.
분획 2의 등전점은 약 5.0으로 나타났고, 5.0에서 단일 띠로 이동한다. 분획 1은 약 5.2 및 5.0의 등전점을 갖고 두개의 띠로 이동한다.The isoelectric point of
(5) 아미노산 조성(5) amino acid composition
분획 1 및 2 각각을(30μl) 12mm×120mm의 벽이 두껍고 단단한 파이렉스 유리 시험관의 바닥에 주의하여 넣고, 수산화나트륨 덩어리를 함유한 건조기에서 감압건조한다. 50μl의 4N 메탄-술폰산(0.2% 3-(2-아미노에틸)인돌 함유, 피어스 제조)을 시험관내의 건조된 시편에 가하고, 시험관의 공기를 0.1~0.2mmHg로 1분간 빼내고 마개를 막는다. 시편을 118℃에서 24시간 이상의 기간동안 가열기내에서 가수분해한다. 시험관의 마개를 열고, 46μl의 4N 수산화나트륨으로 혼합물을 중화하고 시트르산 완충용액으로 희석하여 450μl를 만든다.
시편 용액 250μl를 아미노산 분석기(모델 835, 히다찌사 제품)를 사용한 아미노산 분석에 사용한다. 분리된 아미노산은 0-프탈알데히드법으로 검출하고 순정아미노산을 사용하여 만든 검정곡선으로 정량한다.250 μl of the specimen solution is used for amino acid analysis using an amino acid analyzer (Model 835, product of Hitachi). The isolated amino acid is detected by the 0-phthalaldehyde method and quantified by a calibration curve made using pure amino acid.
표 2는 Phe(10몰)을 기준으로 구성 아미노산의 몰비를 나타낸다. 상기 분석 조건에서는 Pro 및 Cys는 검출되지 않는다.Table 2 shows the molar ratios of constituent amino acids based on Phe (10 moles). Pro and Cys are not detected under the assay conditions.
표 2TABLE 2
(6) 아미노산 서열(6) amino acid sequence
분획 1 및 2(150μl) 각각을 서열분석기(모델 470A, 어플라이드 바이오시스템스사)로 분석한다. 생성된 PTH-아미노산 각각을 100~50μl의 33% 아세토니트릴수용액으로 적절히 희석하고, 희석액중 5μl를 크로마토그래피 컬럼에 워터스 710B의 자동시료 주입기로 주입한다. 크로마토그래피 시스템은 백크만 모델 112펌프 2개가 모델 421조절기로 작동한다. 사용한 컬럼은 규격이 2mm×250mm이고 울트로스피어 ODS-5㎛로 충전된 것으로 컬럼 가열기로 55℃로 유지한다. 유속은 0.3ml/분이다. 20mM 소디움 아세테이트 및 아세토니트릴의 혼합물이 구배 용리에 사용하였다. 흡광도는 269nm에서 측정한다. 45분간 분석을 수행한다.
40회 분석한 결과 두 분획이 하기 서열의 36번째 아미노산을 제외하고는 동일한 아미노산 서열이 같다는 것을 알았다.Analysis of 40 times revealed that the two fractions were identical except for the 36th amino acid of the following sequence.
분획 1의 36번째 아미노산(상기식의 X)은 Asn이고 이는 유전자 서열로부터 예측할 수 있고, 분획 2는 Asp이다.The 36th amino acid of fraction 1 (X in the formula) is Asn, which can be predicted from the gene sequence, and
분획 1이 식(A)의 폴리펩티드, 즉 IL-1α이고, 분획 2는 IL-1α의 36번째 아미노산이 Asp으로 치환된 본 발명의 유도체임을 알 수 있다. 상기한 본 발명의 폴리펩티드를 폴리펩티드 I이라 한다.It can be seen that
IL-1α는 물질 자체로는 불안정하고 트리스-HCl 완충용액(pH 8.0)에 존재하면 더욱 안정한 폴리펩티드 I으로 일부가 전환됨이 발견되었다.It was found that IL-1α is unstable by the substance itself and partially converts to more stable polypeptide I when present in Tris-HCl buffer (pH 8.0).
실시예 2Example 2
(1) 본 발명의 폴리펩티드 I의 제조 :(1) Preparation of Polypeptide I of the Present Invention:
폴리펩티드 I 발현 슬라스미드를 참고예 1에서 수득한 플라스미드 ptrpIL-1α-113을 사용하여 부위-특이성 변이유발법(Proc. Natl. Acad. Sci., 81, 5662-5666(1984) ; Science, 224, 1431(1984)으로 제조하고, 폴리펩티드 I은 하기 서술된 대로 상기 플라스미드에서 제조한다.Site-specific mutagenesis using the plasmid ptrpIL-1α-113 obtained in Reference Example 1 using a polypeptide I expression slammid (Proc. Natl. Acad. Sci., 81, 5662-5666 (1984); Science, 224, 1431 (1984), and polypeptide I is prepared in this plasmid as described below.
M13 mp 11파지 운반체는 단선 DNA 기판으로 사용된다. EcoR I/BamH I DNA 단편을 플라스미드 ptrpIL-1α-113에서 분리하고 EcoR I 및 BamH I 제한효소 부위에 M13 mp 11 파지(RF)에 끼워 넣어 단선(SS) DNA(M13-IL-1α-113)을 얻고, 이를 변이유발 기판으로 사용한다.The
합성 올리고 뉴클레오티드[5′ ACTGGGTGAGCTTGGCAG-3′(개시제)]를 T4 폴리뉴클레오티드 키나제로 인산화하고 ss M13-IL-1α-113 DNA로 혼성화한다. 혼성화물을 접합시키고 dNTPs 존재하에서 DNA 폴리머라제 I(클레노우 단편) 및 T4 DNA 리가제로 15℃에서 18시간 반응시킨다.The synthetic oligonucleotide [5 'ACTGGGTGAGCTTGGCAG-3' (initiator)] is phosphorylated with T4 polynucleotide kinase and hybridized with ss M13-IL-1α-113 DNA. Hybridizations are conjugated and reacted for 18 hours at 15 ° C. with DNA polymerase I (Clenow Fragment) and T4 DNA ligase in the presence of dNTPs.
수득된 DNA를 JM 105 형질전환 가능 세포에 도입하여 형질전환시킨다. 생성된 파지 플라크(50콜로니)를 한천 평판 상에서 니트로 셀룰로오즈 여과지에 접종하고 37℃에서 18시간 배양한다. 클론을 함유하는 여과지를 통상의 방법으로 알칼리 처리하여 변성시키고, 건조시킨 후 80℃에서 2시간 굽는다. 여과지를, 개시제를32p-r-ATP로 표지하여 제조한32p 탑침으로 상온에서 전혼성화 및 혼성화한다. 혼성화된 여과지를 상온에서 10분 그런 후에 54℃에서 5분간 6×SSC 완충용액으로 세척하고, 건조시킨 후에 -70℃에서 18시간동안 자동방사선 사진을 찍는다.The obtained DNA is introduced into JM 105 transformable cells and transformed. The resulting phage plaques (50 colonies) are inoculated onto nitro cellulose filter paper on agar plates and incubated at 37 ° C. for 18 hours. Filter paper containing clones is modified by alkali treatment in a conventional manner, dried, and baked at 80 ° C. for 2 hours. The filter paper is prehybridized and hybridized at room temperature with a 32 p tower needle prepared by labeling the initiator with 32 pr-ATP. The hybridized filter paper was washed for 10 minutes at room temperature with 6 × SSC buffer solution at 54 ° C. for 5 minutes, dried, and autoradiated for 18 hours at −70 ° C.
상기 5개의 변이클론 중에서 M13-IL-1α-36D가 대표적 클론으로 선별되어, JM 105를 감염시키고 ssDNA 및 RF DNA를 제조한다.Among the five variant clones, M13-IL-1α-36D was selected as a representative clone to infect JM 105 and prepare ssDNA and RF DNA.
ss DNA에 대해 M13 대데옥시뉴클레오티드 서열 분석을 행하여 상기 유전자의 변이를 확인한다.M13 large deoxynucleotide sequencing is performed on ss DNA to confirm the mutation of the gene.
JM 105로부터 RF DNA를 제조하고, 이어서 EcoR I/BamH I 단편을 잘라내어, 상기 참고예와 같은 방식으로 발현 플라스미드에 도입하여 목적하는 폴리펩티드 I 발현 플라스미드(IL-1α-36D)를 수득한다.RF DNA was prepared from JM 105, and then the EcoR I / BamH I fragment was cut and introduced into the expression plasmid in the same manner as in the reference example to obtain the desired polypeptide I expression plasmid (IL-1α-36D).
이 플라스미드를 사용하여, 실시예 1에서와 같은 방법으로 폴리펩티드 I을 발현시키고, 정제(DEAE-HPLC하면 단일의 GIF 활성피크가 나타난다)하여 하기 특성을 갖는 목적의 폴리펩티드 I을 수득한다.Using this plasmid, polypeptide I was expressed and purified (DEAE-HPLC showed a single GIF active peak) in the same manner as in Example 1 to obtain the desired polypeptide I having the following properties.
비활성 : 약 1×107GIF 단위/mg 단백질.Inactive: about 1 × 10 7 GIF units / mg protein.
실시예 3Example 3
(1) 본 발명 폴리펩티드 II 및 Ⅲ의 제조(1) Preparation of Polypeptides II and III of the Invention
141번째 아미노산(Cys)가 Ser으로 치환된 IL-1α에 해당되는 본 발명의 폴리펩티드의 발현용 플라스미드 ptrpIL-1α-141S는 5′ ACTGGGTGAGCTTGGAG-3′를 개시제로 사용하여 실시예 2의 방법으로 제조한다.The plasmid ptrpIL-1α-141S for expression of the polypeptide of the present invention corresponding to IL-1α in which the 141th amino acid (Cys) is substituted with Ser is prepared by the method of Example 2 using 5 ′ ACTGGGTGAGCTTGGAG-3 ′ as an initiator. .
상기 플라스미드로 실시예 1에서와 같이 발현 및 정제 과정을 반복한다. DEAE-HPLC하면 GIF 활성피크가 2개 나타난다. 피크 분획을 상기 방법으로 분석하고, 체류시간이 빠른 피크분획이 유전자 서열에서 기대되는 본 발명의 폴리펩티드(폴리펩티드 Ⅲ), 즉 141번째 아미노산(Cys)가 Ser으로 치환된 IL-1α로 확인한다.Repeat the expression and purification procedure as in Example 1 with the plasmid. DEAE-HPLC reveals two GIF active peaks. The peak fraction is analyzed by the above method, and the peak fraction having a high retention time is identified by the polypeptide of the present invention (polypeptide III), ie, the IL-1α in which the 141st amino acid (Cys) is replaced with Ser.
분석에 의하면 다른 분획은 본 발명의 폴리펩티드로서 36번째 아미노산(Asn) 및 141번째 아미노산(Cys)이 각각 Asp 및 Ser으로 치환된 IL-1α에 해당한다. 이 폴리펩티드는 이하 폴리펩티드 II로 명한다.According to the analysis, the other fraction corresponds to IL-1α in which the 36th amino acid (Asn) and the 141st amino acid (Cys) are substituted with Asp and Ser, respectively, as polypeptides of the present invention. This polypeptide is hereinafter referred to as polypeptide II.
실시예 4Example 4
(1) 본 발명 폴리펩티드 II의 제조(1) Preparation of Polypeptide II of the Invention
실시예 3에서 수득한 플라스미드 ptrpIL-1α-141S를 사용하고 5′ ATTCGAGCCCGATGATCAG-3′를 개시제로 하여 실시예 3에서와 같은 방법으로 목적하는 폴리펩티드 II의 발현용 플라스미드 ptrpIL-1α-141S를 제조한다. 상기 플라스미드를 HB101이 균주에 형질전환한다. 이 균주는 일본국 통상 산업성 공업기술원 미생물 공업기술 연구소에 수탁번호 FERM BP-1295, 명칭 에스케리키아콜리 HB101/IL-1α-36D 141S로 기탁되어 있다. 또한, 이 균주는 1097년 6월 2일자로 한국 종균협회에 KFCC-10375의 수탁번호로 기탁되었다.Using the plasmid ptrpIL-1α-141S obtained in Example 3 and 5 'ATTCGAGCCCGATGATCAG-3' as an initiator, the plasmid ptrpIL-1α-141S for expression of the desired polypeptide II was prepared in the same manner as in Example 3. The plasmid is transformed into HB101 strain. This strain has been deposited with the Accession No. FERM BP-1295, name Escherichia coli HB101 / IL-1α-36D 141S, to the Japan Institute of Commerce, Industry and Technology. In addition, this strain was deposited with the accession number of KFCC-10375 to the Korean spawn association on June 2, 1097.
상기 플라스미드를 사용하여 실시예 1에서와 같은 발현 및 정제과정을 반복하여 본 발명의 목적하는 폴리펩티드 II를 수득한다.The plasmid was used to repeat the same expression and purification as in Example 1 to obtain the desired polypeptide II of the present invention.
SDS-PAGE는 상기 폴리펩티드가 분자량이 약 18kd임을 지적한다. 그외 등전점(PI)는 IEF에 의해 약 5.0으로 발견되었다.SDS-PAGE indicates that the polypeptide has a molecular weight of about 18 kd. The other isoelectric point (PI) was found to be about 5.0 by the IEF.
폴리펩티드 II 및 III는 비활성(GIF 활성)이 폴리펩티드 I과 동등하다.Polypeptides II and III are inactive (GIF activity) equivalent to polypeptide I.
약제 시험예 1Pharmaceutical test example 1
(1) GIF 활성 및 LAF 활성(1) GIF active and LAF active
본 발명 폴리펩티드의 GIF 활성은 전에 서술하였고, 폴리펩티드 I, II 및 III의 LAF 활성을 GIF 활성과 비교한다.GIF activity of the polypeptides of the invention has been described above, and the LAF activity of polypeptides I, II and III is compared with GIF activity.
본 발명의 폴리펩티드를 하기와 같이 시험한다.The polypeptide of the present invention is tested as follows.
(2) 항암 활성시험(2) anticancer activity test
종양세포(200,000), 메트 A를 BALB/C 새앙쥐(0일) 각각에 피내이식한다. 이식후, 7일 및 8일째에, 첫번째 실험의 새앙쥐의 종양부위에 폴리펩티드 I을 1마리당 0.3, 1 또는 3㎍의 양을 투여한다.Tumor cells (200,000), Met A are transplanted intradermal into each BALB / C mice (day 0). On
7마리를 1군으로 한다. 대조군에는 용매(1% 새앙쥐 혈청)를 갖는 방식으로 투여한다.Seven horses are in one group. The control group is administered in a manner with solvent (1% juvenile serum).
시험결과를 제3도에 나타내고, 여기에서는 종양세포 접종후 경과한 날짜가 횡좌표로, 종양의 중량(mg)이 종좌표로 나타낸다. 대조군은 곡선(1)로 표시되고, 0.3㎍의 폴리펩티드 I을 투여한 군은 곡선(2), 1㎍의 폴리펩티드 I을 투여한 군은 곡선(3), 그리고 3㎍의 폴리펩티드 I을 투여한 군은 곡선(4)로 표시된다. 종양의 중량은 평균±표준편차(SD)로 표시된다. *는 스튜던트 T-네스트에서 P0.05임을 **표는 P0.01임을 나타낸다.The test results are shown in FIG. 3, where the date elapsed after inoculation of the tumor cells is shown in abscissa, and the weight of the tumor in mg. The control group is indicated by the curve (1), the group to which 0.3 μg of polypeptide I was administered was the curve (2), the group to which 1 μg of polypeptide I was administered was the curve (3), and the group to which 3 μg of polypeptide I was administered Is represented by the curve (4). Tumor weights are expressed as mean ± standard deviation (SD). * Indicates P0.05 in Student T-Nest ** table indicates P0.01
(3) CSF 생산 촉진 효과 시험(3) CSF production promotion effect test
(3)-1. 세포주 U-373MG(ATCC HTB17, 신경교아세포종, 신경교성세포종, 사람)를 사용하여 하기 시험을 수행한다.(3) -1. The following test is performed using cell line U-373MG (ATCC HTB17, glioma, glioma, human).
상기 세포주를 10% FCS(GIBCO), MEM-필수아미노산 없음(Flow) 및 MEM 소디움 피루베이트(Flow)를 함유한 이글스 MEM 배지(Eagle′s MEM 니쓰이사 제품)에 2×105세포/ml의 농도로 현탁시킨다. 시험할 폴리펩티드 I을 여러가지 농도로 현탁액에 가입한다. 각 혼합물을 CO2배양기에서 37℃로 24시간 배양한다.The cell line was placed at 2 × 10 5 cells / ml in Eagle's MEM medium (Eagle's MEM Nisisa) containing 10% FCS (GIBCO), no MEM-essential amino acids (Flow) and MEM sodium pyruvate (Flow). Suspension to concentration. The polypeptide I to be tested is joined to the suspension at various concentrations. Each mixture is incubated 24 hours at 37 ° C. in a CO 2 incubator.
배양 상층액을 수집하여 생산되어 상층액에 축적된 CSF의 양을 새앙쥐 골수세포를 사용하여 측정한다(Lewis, I.C.등, J. Immunol, 128, 168(1982)).Culture supernatant is collected and produced and the amount of CSF accumulated in the supernatant is measured using a murine bone marrow cell (Lewis, I.C. et al., J. Immunol, 128, 168 (1982)).
결과를 제4도에 나타낸다. 여기에서 폴리펩티드 I의 농도(ng/ml)를 횡축에, CSF 활성(단위/ml, ×10-2)을 종축에 나타낸다.The results are shown in FIG. Here, concentration (ng / ml) of polypeptide I is shown on the horizontal axis, and CSF activity (unit / ml, x10-2 ) is shown on the vertical axis.
(3)-2. 폴리펩티드 I이 생체에 투여되면 생체내에서 CSF 생산을 촉진하는 활성을 나타냄을 실증하기 위해 하기의 동물시험을 수행한다.(3) -2. The following animal tests are performed to demonstrate that polypeptide I, when administered in vivo, exhibits activity to promote CSF production in vivo.
정상의 새앙쥐(BALB/C, 일본국 시즈오까현의 실험동물협회에서 구입)에 여러가지 양의 폴리펩티드 I을 정맥주사한다. 투여후 8시간만에 혈액을 채취하여 상기 (3)-1에서와 같이 CSF 활성을 검사한다. 대조로서 인체 혈청알부민(HSA)를 같은 방법으로 시험 대조군에 투여한다.Normal amounts of polypeptide I are injected intravenously in BALB / C (purchased from the Laboratory Animal Society of Shizuoka Prefecture, Japan). Blood is collected 8 hours after administration and the CSF activity is tested as in (3) -1 above. As a control, human serum albumin (HSA) is administered to the test control in the same manner.
결과를 표 5에 나타낸다. 투여된 폴리펩티드 I 또는 HSA의 양(㎍/새앙쥐)은 횡축에 CSF 활성(단위/ml 혈청, ×10-3)은 종축에 나타낸다.The results are shown in Table 5. The amount of polypeptide I or HSA administered (μg / cub) is on the horizontal axis and CSF activity (units / ml serum, x10-3 ) is on the vertical axis.
(4) 소염효과시험(4) anti-inflammatory effect test
원터등의 방법(Proc. Soc. Exptl. Biol. Med., 111, 544-547(1962))에 따라 하기 시험을 수행한다.The following test is carried out according to the method of Wonter et al. (Proc. Soc. Exptl. Biol. Med., 111, 544-547 (1962)).
6-~8-주생 수컷 쥐(스프라쿠에 다울레이주, 니뽄 챨스 리버사)를 시험 하루전에 체중에 따라 6~8마리의 군으로 분류한다. 식염수내 1% 카라기난(마린 콜로이드 산물)의 현탄액으로 염중유발제로, 오른쪽 뒷 발바닥에 0.1ml의 피하주사하여 발을 붓게한다. 붓는 정도를 평가하기 위해, 주사전후의 일정기간에 플레티스모미터(Ugo-Vasile 제품)을 사용하여 발바닥부피를 측정한다. 주사로 인하여 증가된 부피의 주사전의 값에 대한 비율을 팽윤%로 계산한다.Six- to eight-week-old male rats (Spraque d'Aurley, Nippon Hicks River, Inc.) were grouped into groups of 6-8 by weight one day prior to testing. A suspension of 1% carrageenan (a marine colloid product) in saline. It is a salt-induced drug, and the foot is poured by subcutaneous injection of 0.1 ml into the right rear sole. To evaluate the degree of swelling, the plantar volume is measured using a pletismometer (Ugo-Vasile) at regular intervals before and after injection. The percentage of pre-injection of increased volume due to injection is calculated as% swelling.
시험할 물질을 둘베코의 PBS에 용해시켜, 그중 0.1ml을 염증유발제 주사 1시간 전에 쥐의 등에 주사한다. 대조군에는 용매를 주사한다.The material to be tested is dissolved in Dulbecco's PBS, 0.1 ml of which is injected into the rat's
결과는 표 6에 나타내는데, 염증유발제 주사후 경과시간(시간)을 횡축에, 팽윤%를 종축에 나타낸다. 상기 도표에서, 대조군은 곡선(1), 0.1㎍의 폴리펩티드는 곡선(2), 1㎍의 폴리펩티드 I은 곡선(3), 그리고 10㎍의 폴리펩티드 I은 곡선(4)로 표시된다.The results are shown in Table 6, in which the elapsed time (hours) after the pro-inflammatory agent injection is shown on the horizontal axis, and the percent swelling on the vertical axis. In the plot, the control is indicated by curve (1), 0.1 μg polypeptide by curve (2), 1 μg polypeptide I by curve (3), and 10 μg polypeptide I by curve (4).
(5)방사선 상해 예방효과 시험(5) Radiation injury prevention effect test
1㎍ 또는 0.3㎍의 폴리펩티드 I을 9주생 BALB/C 새앙쥐 각각의 복강에 투여하고 20시간 후에 치사량의 X-선을 조사한다.Either 1 μg or 0.3 μg of polypeptide I is administered to the peritoneal cavity of each of the ninth-week-old BALB / C mice and 20 hours later the lethal dose of X-rays is irradiated.
새앙쥐는 X-선 조사기(MBR-1505R, 히다찌 메디코사 제품)로 850뢴트겐의 양을 조직적으로 조사한 후 생존을 매일 검산한다. 대조군에는 PBS를 투여한다.The young rats are x-rayed (MBR-1505R, manufactured by Hitachi Medico Co., Ltd.) and systematically examined for the amount of 850 roentgens, and their survival is checked daily. PBS is administered to the control group.
결과를 제7도에서, 조사후 경과일 수는 횡축으로, 생존비율(%)은 종축으로 하여 나타낸다. 1㎍의 폴리펩티드 I이 투여된 군은 곡선(1), 0.3㎍의 폴리펩티드 I이 투여된 군은 곡선(2), 그리고 대조군은 곡선(3)으로 표현된다.In Fig. 7, the number of days after irradiation is represented by the horizontal axis and the survival rate (%) is represented by the vertical axis. The group to which 1 μg of polypeptide I was administered is represented by curve (1), the group to which 0.3 μg of polypeptide I was administered to curve (2), and the control group is represented by curve (3).
제7도는 대조군의 모든 새앙쥐는 X-선 조사후 18일만에 모두 죽은 반면에, 폴리펩티드 I은 투여량에 따라 방사선 상해의 예방에 유효함을 보여준다. 1㎍의 폴리펩티드 I이 투여된 군의 약 80%가 방사선 상해로 인한 죽음으로부터 살아남음을 알 수 있다.FIG. 7 shows that all the mice in the control group died all 18 days after X-ray irradiation, whereas polypeptide I was effective in preventing radiation injury depending on the dose. It can be seen that about 80% of the groups administered 1 μg of polypeptide I survive death from radiation injury.
(6) 기회주의적 감염예방 효과시험(6) Opportunistic Infection Prevention Effect Test
모델 새앙쥐를 사용하여 하기 시험을 수행한다. 쟨째날, 100mg/kg의 5-플루오로우라실(5-Fu, 교와히꼬사 제품)을 6주생 수컷 새앙쥐 ICR주(각 군당 7마리)에 정맥주사한다. 제2,4 및 6일에, 본 발명의 폴리펩티드 I을 새앙쥐에게 1㎍/새앙쥐의 양으로 피하주사한다. 7일째 되는날, 수도모나스 아에루게노사 E-2의 일정량을 새앙쥐의 복강에 주사하여 감염시킨다. 제10일에 생존한 동물의 수를 새어 생존율(%)을 계산한다.The following test is performed using a model muzzle. On the fourth day, 100 mg / kg of 5-fluorouracil (5-Fu, Kyowahikosa) is injected intravenously into 6-week-old male rat ICR strains (7 per group). On
결과는 제8도의 (1)~(3)에 주어진다. 제8도 (1)은 상기와 같이 처리한 군에서 수득한 결과를, 제8도 (2)는 폴리펩티드 I은 투여되지 않고 5-Fu만 투여된 대조군에서 수득한 결과를, 제8도 (3)은 폴리펩티드 I과 5-Fu이 둘다 투여되지 않은 대조군에서 수득한 결과를 나타낸다. 제8도에서 생존비율(%)은 종축에, 하기량의 수도모나스가 주어진 A~F군은 횡축에 표시한다.The results are given in (1) to (3) of FIG. FIG. 8 (1) shows the results obtained in the group treated as above, and FIG. 8 (2) shows the results obtained in the control group administered with only 5-Fu without the polypeptide I. FIG. ) Shows the results obtained in a control group in which neither polypeptide I nor 5-Fu were administered. In Fig. 8, the survival rate (%) is indicated on the vertical axis, and the A ~ F group given the following amount monas on the horizontal axis.
군 세포수/새앙쥐Military cell number / young rat
A 19,000A 19,000
B 3,800B 3,800
C 750C 750
D 150D 150
E 30E 30
F 6F 6
(7) IL-1α의 CSF 생산 촉진효과 시험(7) CSF production promoting effect test of IL-1α
CSF를 생산하는 태아의 폐 섬유아세포(HFL-1, ATCC에 제CCL-153호로 등록된 세포주)를 사용하여 하기 시험을 수행한다.The following tests are performed using pulmonary fibroblasts of the fetus producing CSF (HFL-1, cell line registered under ATCL as CCL-153).
10% FCS를 함유하는 쥐세포 12K 배양물(Ham, R.G. Proc. Natl. Acad. Sci., 53, 288(1965)에 HFL-1 세포를 2×105세포/ml의 농도로 현탁시킨다.HFL-1 cells are suspended in a rat cell 12K culture containing 10% FCS (Ham, RG Proc. Natl. Acad. Sci., 53, 288 (1965) at a concentration of 2 × 10 5 cells / ml.
실시예 1에서 수득한 IL-1α를 여러 농도로 세포 현탁액에 가입한다. 각각의 혼합물을 CO2배양기에서 37℃로 24,48 또는 72시간 배양한다. 배양 상층액을 수집하여, 생산되어 상층액에 축적된 CSF의 양을 새앙쥐 골수 세포를 사용(Lewis, I.C.등, J. Immunol., 128, 168(1982))하여 측정한다.The IL-1α obtained in Example 1 is joined to the cell suspension at various concentrations. Each mixture is incubated at 37 ° C. for 24, 48 or 72 hours in a CO 2 incubator. The culture supernatant is collected and the amount of CSF produced and accumulated in the supernatant is measured using a murine bone marrow cell (Lewis, IC et al., J. Immunol., 128, 168 (1982)).
결과를 하기의 표 3에 나타낸다.The results are shown in Table 3 below.
상기 결과에 L-1α를 가입하면 HFL-1α 세포주의 CSF 생산이 촉진됨을 보여준다.The results show that joining L-1α promotes CSF production in HFL-1α cell lines.
(8) 동물세포에서 시토카인을 제조하는 방법(8) Method for producing cytokine in animal cells
HSB-2 C5B2 세포(J. Immunol., 131, 1682-1689(1982))를 2×105세포/홈의 양으로 0.01% PHA-P 및 여러가지 폴리펩티드 II의 존재하에서 24시간 배양한다. 수집된 상층액의 IL-2 활성을 새앙쥐 T세포(CTLL2)의 IL-2를 사용하는 스미스의 방법(K.A. Smith등, J. Immunol., 120, 2027(1978))으로 측정한다. 결과는 하기 표 4에 나타낸다.HSB-2 C5B2 cells (J. Immunol., 131, 1682-1689 (1982)) are incubated 24 hours in the presence of 0.01% PHA-P and various polypeptides II in amounts of 2 × 10 5 cells / groove. IL-2 activity of the collected supernatants is measured by Smith's method using IL-2 of the murine rat T cells (CTLL2) (KA Smith et al., J. Immunol., 120, 2027 (1978)). The results are shown in Table 4 below.
상기 결과는 본 발명의 폴리펩티드를 사용하면 동물세포가 시토카인을 효율적으로 생산하게 됨을 보여준다.The results show that using the polypeptide of the present invention, animal cells efficiently produce cytokines.
상기 방법에 사용되는 본 발명의 폴리펩티드의 양은 매우 작아도 되고, 보통은 약 10ng/ml로서, 만족할만한 결과를 얻을 수 있고, 상기 폴리펩티드를 사용하면 유도된 시토카인의 정제가 용이하다.The amount of the polypeptide of the present invention used in the above method may be very small, usually about 10 ng / ml, and satisfactory results can be obtained, and the use of the polypeptide facilitates purification of the induced cytokines.
(a) 동물세포에서 시토카인이 생산되면, 생산 유도용으로 사용되는 본 발명의 폴리펩티드는 반드시 지배적 조건하에서 구조가 안정하고 세포 표면의 IL-1 수용기에 결합되어야 한다. 더욱 구체적으로는, 본 발명 폴리펩티드가 IL-1수용기에 결합하여 시토카인 생산에 필요한 신호를 세포에 전달해야 한다.(a) When cytokines are produced in animal cells, the polypeptides of the invention used for production induction must be stable in structure and bound to IL-1 receptors on the cell surface under dominant conditions. More specifically, the polypeptide of the present invention must bind to an IL-1 receptor to deliver a signal necessary for cytokine production to the cell.
따라서, 하기 시험을 본 발명 폴리펩티드를 섬유아세포의 IL-1 수용기에 연결하여 수행한다.Therefore, the following test is performed by linking the polypeptide of the present invention to the IL-1 receptor of fibroblasts.
6-홈 플레이트에 거의 균일하게 배양된 Balb/3T3 세포(클론 A31 : ATCC, CCL-163, 1×10 세포/홈)을 50000cpm/홈의 I-표지된 IL-1β(세이가가꾸(생화학) 58, No. 8, 840(1986) ; 유럽특허 제187991호) 및 10% FCS 첨가된 D-MEM에서 37℃로 24시간 전배양한 IL-1β 또는 폴리펩티드 II의 20ng/ml와 4℃에서 반응시킨다. 반응 혼합액을 파스퇴르 피펫으로 뽑아내고, 10% FCS가 첨가된 D-MEM 1ml로 세포를 부드럽게 세척하여 상등액을 제거한다. 세척과정을 2회 반복한 후, 1% SDS 및 0.2N NaOH 혼합물 1m로 세포를 용해시키고, 이 용액의 방사능(결합된 방사능) 및 세포 세척에 사용된 용액의 방사능을 감마-계수기로 측정한다. 사용된 I-표지된 IL-1β는 볼튼 및 헌터의 방법(Biochem. J., 133, 529(1973))으로 제조 및 정제한다.Balb / 3T3 cells (colon A31: ATCC, CCL-163, 1 × 10) cultured almost uniformly in 6-groove plates Cells / groove) 50000cpm / groove IL pre-incubated for 24 hours at 37 ° C. in I-labeled IL-1β (SEGAGAKU (Biochemistry) 58, No. 8, 840 (1986); European Patent 1187991) and 10% FCS added D-MEM React at 20 ° C. with 20 ng / ml of −1β or polypeptide II. The reaction mixture is extracted with a Pasteur pipette and the supernatant is removed by gently washing the cells with 1 ml of D-MEM with 10% FCS. After the washing procedure was repeated twice, the cells were lysed with 1 m of a 1% SDS and 0.2 N NaOH mixture, and the radioactivity (bound radioactivity) of this solution and the radioactivity of the solution used for cell washing were measured by gamma-counter. Used I-labeled IL-1β is prepared and purified by Bolton and Hunter's method (Biochem. J., 133, 529 (1973)).
비활성 : 최소한 250μCi/㎍ 단백질.Inactivity: at least 250 μCi / μg protein.
표 5에 결과를 나타낸다.Table 5 shows the results.
상기 식에서 A : 표시되지 않은 폴리펩티드 I의 부재시 결합된 방사능.Wherein A is the radioactivity bound in the absence of unmarked polypeptide I.
B : 결하된 방사능의 실험치.B: Experimental value of missing radioactivity.
C : 플레이토에 특이적으로 흡착된 방사능.C: Radioactivity adsorbed specifically to the platen.
상기 지수는 IL-1 수용기에 함께 존재하는 IL-1β 또는 폴리펩티드 II의 결합활성을 나타낸다. 부수적으로, IL-1α 및 IL-1β가 IL-1 수용기에 대하여 공통임은 공지되어 있다.The index indicates the binding activity of IL-1β or polypeptide II coexisted with the IL-1 receptor. Incidentally, it is known that IL-1α and IL-1β are common to IL-1 receptors.
표 5는 폴리펩티드 II가 시토카인 유발-생산 조건하에서도 IL-1 수용기에 대한 만족스러운 결합능을 보유함을 나타내고, 따라서 상기한 용도에 유용하다.Table 5 shows that polypeptide II possesses satisfactory binding capacity to IL-1 receptors even under cytokine induced-producing conditions and is therefore useful for such uses.
제조예 1Preparation Example 1
GIF 활성으로 계산하여, 1×10 단위/ml의 폴리펩티드 I의 식염수 용액에 인혈청 알부민(HSA)을 0.5%의 농도로 가입하고 여과(0.22㎛ 닥여과지)하여, 멸균상태로 각 바이알당 1ml끽 넣고, 주사용 제제로 동결건조한다.Count as GIF active, 1 × 10 Phosphorus albumin (HSA) was added to the saline solution of polypeptide I in unit / ml at a concentration of 0.5%, filtered (0.22 μm vaccinated paper), and 1 ml of each vial was sterilized and lyophilized with an injectable preparation. .
상기 제제는 1ml 증류수에 용해하여 주사용으로 사용된다.The formulation is dissolved in 1 ml distilled water and used for injection.
Claims (13)
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU69933/87 | 1987-03-10 | ||
AU69933/87A AU595864B2 (en) | 1986-03-14 | 1987-03-10 | Il-1 alpha derivatives and drugs |
Publications (2)
Publication Number | Publication Date |
---|---|
KR880011336A KR880011336A (en) | 1988-10-27 |
KR960010950B1 true KR960010950B1 (en) | 1996-08-14 |
Family
ID=3753316
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1019870006925A KR960010950B1 (en) | 1987-03-10 | 1987-07-01 | IL-1Ñß DERIVATIVES AND DRUGS |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR960010950B1 (en) |
-
1987
- 1987-07-01 KR KR1019870006925A patent/KR960010950B1/en not_active IP Right Cessation
Also Published As
Publication number | Publication date |
---|---|
KR880011336A (en) | 1988-10-27 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR950000886B1 (en) | IL-1Ñß DERIVATIVES AND DRUGS | |
JP2515308B2 (en) | Human immune interferon | |
KR20130091346A (en) | Polypeptides derived from il-2 having agonist activity, for the therapy of cancer and chronic infections | |
EP0237967B1 (en) | IL-1 beta derivatives and drugs | |
EP0098862A1 (en) | Interferon-alpha 76 | |
EP0098863A1 (en) | Interferon-alpha 61 | |
EP0099389A1 (en) | Interferon-alpha 54 | |
KR960008010B1 (en) | IL-1Ñß DERIVATIVES AND MEDICAMENT FOR TREATING THROMBOCYTOPENIA | |
KR960010950B1 (en) | IL-1Ñß DERIVATIVES AND DRUGS | |
AU595864B2 (en) | Il-1 alpha derivatives and drugs | |
US5847098A (en) | DNA encoding interleukin IL-1β mutant | |
JP2711430B2 (en) | Interleukin-1α derivative | |
EP0456842A1 (en) | Medicinal application of m-csf | |
JPH0649656B2 (en) | Thrombocytopenia treatment | |
KR970011308B1 (en) | Interlukin-1-beta derivs, coding dna, vector, transformant and pharmaceutical compositions | |
US6107465A (en) | IL-1β and derivatives thereof and drugs | |
JPH06219964A (en) | Antitumor agent | |
KR960003376B1 (en) | Medicament for treating thrombocytopenia | |
JP2608023B2 (en) | Interleukin-1β derivative and pharmaceutical | |
JPH1072365A (en) | Pharmaceutical preparation | |
JPH09118633A (en) | Pharmaceutical preparation | |
KR0139095B1 (en) | Novel cytokine | |
JP2753695B2 (en) | Interleukin-1β derivative and pharmaceutical | |
Schoub, BD,* Lyons, SF,* Crespi, M.,* Chiu, M.-N.* & Lomnitzer | Laboratory evaluation of commercial interferon preparations | |
JPH02167298A (en) | Interleukin-1alpha derivative |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
G160 | Decision to publish patent application | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant | ||
LAPS | Lapse due to unpaid annual fee |