JP2711430B2 - Interleukin-1α derivative - Google Patents

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a novel polypeptide,
More specifically, the present invention relates to a new derivative of interleukin 1α (IL-1α) and a method for producing the same .

[0002]

2. Description of the Related Art At the second international lymphokine workshop, the lymphocyte activator (Lymphocyte Actin
ivating Factor; LAF), mitogenic protein (Mitogenic Protein), helper peak-1 (Help
er peak-1), T-cell replacing factor
factor III (TRF-III), T-cell replacing fac
tor Mφ (TRFм)], B cell activating
Physiologically active substances that have been reported under names such as factor (B-cell activating factor) and B-cell differentiation factor (B-cell differentiation factor) are all unified into the name interleukin-1 (IL-1). [Cellular Immunol., 48 , 433-436].
(1979)]. This determination is based on the reason that each of the above-mentioned physiologically active substances cannot be distinguished as a substance, and merely expresses the physiological activity from different angles.

[0003] The above-mentioned IL-1 further activates, for example, T lymphocytes and B lymphocytes, has an action of increasing the production of interleukin 2 and an antibody, and acts on hepatocytes to regulate protein synthesis. Has been reported to have an effect of enhancing prostaglandin production, etc. [Reviews of Infectious Disease, Vol. 6, N
o. 1, 51-59 (1984), New England J. of M.
ed., 311 , 1413 (1984), etc.].

[0004] Although the substance of IL-1 as a substance is still unknown at present, the existence of a gene encoding a polypeptide having LAF activity or a precursor thereof has only recently been reported [Proc. .Natl.Aca
d.Sci., Vol. 81, 7907-7911 (1984), N
ature, Vol. 315, 641 (1985), Nucleic Aci
d Research, Vol. 13, (16), 5869 (198
5)].

[0005] According to the above, from the confirmation of the LAF activity of the culture supernatant obtained according to the gene recombination technique, the following formula (A)
Is estimated to be a polypeptide having LAF activity, and is referred to as "IL-1α".

[0006]

Embedded image

[0007] However, not only the above-mentioned active substances, but also physiologically active substances conventionally reported as so-called IL-1 have not been reported as being produced and isolated as homogeneous substances. There have been no reports on the physiological activities of such substances.

[0008]

SUMMARY OF THE INVENTION The present inventors have conducted intensive studies on IL-1α as a homogeneous substance, and as a result, have already established a manufacturing technique thereof and have properties and properties of the substance. Physiological activities were also clarified. Along with this research result, the present inventors have also confirmed that the polypeptide represented by the above formula (A) has LAF activity.

However, as described above, it has been surprisingly found that the polypeptide is unstable as a substance, although it corresponds to a gene in a living body.

Accordingly, an object of the present invention is to provide a novel polypeptide which has a different amino acid sequence from the polypeptide represented by the above formula (A), is more stable as a substance, and has properties suitable for pharmaceutical use. (IL-1α derivative).

[0011]

According to the present invention, in the amino acid sequence of IL-1α represented by the above formula (A), a modified amino acid in which Asn at position 36 is substituted with another amino acid.
Having a amino acid sequence, and Asn at position 36 and C at position 141
Modified amino acid in which ys is substituted with another amino acid
Having a feature selected from having an acid sequence;
IL-1α having an amino acid sequence of position Asn is substantially
IL-1α derivative, characterized in that
Wherein the other amino acid replacing Asn at position 36 is Asp.
Conductor, 36 position Asn and 141 position Cys are each other amino
Having a modified amino acid sequence substituted with an acid
The derivative, Asn at position 36 is Asp and Cys at position 141 is Ser.
Each of the above substituted derivatives, position 141 is Cys
The present invention provides a method for producing the above-mentioned derivatives, and derivatives thereof.

The designations of amino acids and polypeptides hereinbefore and hereinafter refer to IUPAC and IUPAC
-Abbreviations in IUB nomenclature or rules or abbreviations commonly used in the art are used, and the representation of nucleic acids in base sequences is the same.

The polypeptide of the present invention has, for example, LAF activity, tumor cell growth inhibitory activity, ie, an activity of specifically inhibiting the growth of tumor cells, CSF (Colony stimula).
tingfactor; colony stimulating factor), interferon (IFN), interleukin-2 (IL-2), interleukin-3 (IL-3) and other cytokine-promoting activities, ie, acting on human cells, for example. Activity to significantly promote the production of these cytokines, anti-inflammatory activity, especially activity to effectively suppress the progression of arthritis, for example, by administering to an arthritis model animal, radiation damage prevention effect, i.e., whole body irradiation during bone marrow transplantation, It has an effect of preventing or preventing biological damage or serious side effects at the time of radiation irradiation or radiation accident in cancer treatment and the like. Therefore, this is, for example, an immune system stimulant for promoting antibody production or enhancing the effect of vaccine, an antitumor agent, CSF, IL
-2, useful as pharmaceuticals such as cytokine production promoters such as IL-3, anti-inflammatory agents and radiation damage preventive agents. In particular, the polypeptide of the present invention has the characteristic of being extremely stable as a substance, and has low toxicity, and is also suitable as the above-mentioned drug in these respects. Although IL-1 is known to have pyrogenicity, the polypeptide of the present invention is also excellent in that such side effects are reduced.

The polypeptide of the present invention can be prepared by, for example,
When administered to humans as an F production promoter,
Cancers without the risk of infection or antigen-antibody reactions
Granulocytopenia due to bone marrow hypoplasia after chemotherapy or radiation therapy
Can be effectively recovered (granulocytopenia treatment drug). Also the book above
The CSF production promoter using the invention polypeptide is
Based on the original CSF production promoting action,
Can be effectively used as a preventive and therapeutic agent for various diseases.
You. For example, CSF has functions of granulocytes and macrophages.
[Lopez, A.F. et a
l.), J. Immunol.,131, 2983 (1983), Han
Dam et al. (Handam, E. et al.)122, 1134 (1
979) and Vadas, M.A. et al.13
0, 795 (1983)] to prevent and prevent various infectious diseases.
Is expected to have clinical application as a drug for
Production promoters can also be expected to have clinical applications.

[0015] In particular, so-called opportunistic infection or terminal, in which pathogens that have been harmless until now exhibit pathogenicity and are induced in individuals (compromised hosts) whose biological defense ability has been reduced or impaired in recent years. inf
Section) is a clinically problematic pathogen (causing bacteria)
Pseudomonas, Serrat
ia) and other gram-negative bacilli, Herpes simplex,
HSV), Varicella-zoster, V
ZV), Cytomegalovirus, CM
V) and other viruses, Candida albican
s), fungi such as Aspergillus (Aspergillus fumigatus) and Nocardia (Nocardia asteroidea), pneumocystis carinii, and Toxoplasma (Toxo).
Protozoa such as plasma gondii), and currently used antibiotics are unlikely to exert a sufficient effect on such pathogenic bacteria, and research and development of new drugs for the opportunistic infectious diseases are eagerly desired. The polypeptide of the present invention is also effective as a prophylactic and therapeutic agent for such opportunistic infections, in particular when administering anticancer drugs in which such opportunistic infections are frequently observed, i.e., during chemotherapy or bone marrow transplantation for acute leukemia. It is useful as a prophylactic and therapeutic agent for infectious diseases, such as complications such as gandidiasis, cryptococcosis, aspergillosis, zygomycosis, black fungus infection, viral infection, cytomegalovirus pneumonia, etc.

The anti-inflammatory agent containing the polypeptide of the present invention as an active ingredient is effective as an agent for preventing and treating arthritis and the like.

Furthermore, the polypeptide of the present invention has a tumor cell growth inhibitory activity (hereinafter referred to as "GIF activity") as measured by the method described in the Examples below, and is effective against various tumor cells. Exhibits the action of specifically suppressing their proliferation. Therefore, an antitumor agent containing the active ingredient as an active ingredient is advantageously used as a chemotherapeutic agent for cancer, particularly in remission enhancement therapy and remission maintenance therapy in combination with various antineoplastic agents.

In addition to the above-mentioned pharmaceutical uses, the polypeptide of the present invention can be used extremely effectively, for example, in the production of various useful cytokines from cell lines in vitro, based on its cytokine production promoting activity. The production of natural cytokines from such cell lines has attracted particular interest in cytokines that are glycoproteins,
Useful cytokines can be obtained efficiently and in large quantities.

In the IL-1α derivative of the present invention, Asn at position 36 of IL-1α represented by the formula (A) (or
Les and 141 of Cys with) other amino acids that may have rows substitutions
Is may be any α- amino acids constituting the human protein, Cys is able to form intermolecular bonds on the basis of the SH group, in view of this, the amino acid
Preferably, the amino acid is other than Cys. Particularly preferred are, for example, Asp in the case of Asn at position 36,
In the case of Cys at position 141, Ser can be exemplified.

The polypeptide of the present invention can be produced, for example, by a genetic engineering technique. That is, it can be produced by utilizing a gene encoding the specific polypeptide according to the present invention, integrating it into a vector of a microorganism, and replicating, transcribing and translating in the cells of the microorganism. This method is particularly advantageous in that mass production is possible.

The gene used in the above method can be totally synthesized by chemical synthesis of a nucleic acid according to a conventional method such as a phosphite triester method (Nature, 310 , 105 (1984)). However, it is convenient to use a gene encoding IL-1α or a precursor thereof, and the gene is modified into a nucleic acid sequence encoding the specific amino acid sequence according to a conventional method including the above-described chemical synthesis means. Can be manufactured more easily.

The gene encoding IL-1α or a precursor thereof is known (described), and we obtained the gene, and obtained IL-1α by genetic engineering using this gene.
Such a series of methods will be clarified in Reference Examples described later.

The above-mentioned manipulation for modifying the gene can be carried out according to a known method depending on the amino acid sequence of the target polypeptide (for example, Molecular engineering techniques include, for example, Molecular
Cloning, Cold Spring Harbor Laboratory (1982)
Is referenced). For example, conventional means such as treatment with various enzymes such as restriction enzymes, DNA ligase, polynucleotide kinase, DNA polymerase, etc., for the purpose of cutting, binding, phosphorylating DNA, etc., can be adopted, and these enzymes are easily commercially available. Available. The isolation and purification of the gene or nucleic acid in each operation may be performed according to a conventional method, for example, agarose electrophoresis. Further, the replication of the obtained gene may be performed according to a method using an ordinary vector, as described in part below. A DNA fragment encoding a desired amino acid sequence and a synthetic linker can be easily produced by the above-described chemical synthesis.

In the above, the codon itself corresponding to the desired amino acid is publicly known, and its selection may be arbitrarily determined, for example, according to a conventional method in consideration of the frequency of codon usage of the host to be used [Nucl. .Res., 9 , 43-74
(1981)]. In order to partially modify the codons of these nucleic acid sequences, for example, site-specific mutagenesis (Site-specific) using a primer consisting of a synthetic nucleotide encoding the desired modification of about 15 to 30 mer is performed in a conventional manner. Specific Mutagenesis) [Proc. N
atl. Aad. Sci., 81 , 5662-5666 (198
4)] and the like.

The desired gene obtained by the above-mentioned method can be obtained, for example, by a Maxam-Gilbert chemical modification method [Maxam-
Gilbert, Meth. Enzym., 65 , 499-560 (198
0)] or the dideoxynucleotide chain termination method using M13 phage [Messing, J. et al. and Vieira, J., Gene, 1
9 , 269-276 (1982)], and the like, and its base sequence can be determined and confirmed.

Specific examples of the above operation and method are described in Reference Examples and Examples below, but the method is not particularly limited, and any of various methods known in the art may be employed.

Thus, according to the present invention, there is also provided a novel gene encoding a polypeptide having the specific amino acid sequence described above (hereinafter, this gene is referred to as "gene of the present invention").

The polypeptide of the present invention can be produced using the above-mentioned specific gene (the gene of the present invention) according to a conventionally known general recombination technique. More specifically, a recombinant DNA capable of expressing the gene of the present invention in a host cell
May be introduced into a host cell for transformation, and the transformant may be cultured.

As the host cell, any of eukaryotes and prokaryotes can be used. The eukaryotic cells include cells such as vertebrates and yeast, and the vertebrate cells include, for example, monkey cells such as Cos cells (Y. Gluzma
n, Cell, 23 , 175-182 (1981)] and a dihydrofolate reductase-deficient strain of Chinese hamster ovary cells [G. Urlaub and LAChasin, Proc. Natl. Acad.
Sci., USA, 77 , 4216-4220 (1980)] and the like are often used, but are not limited thereto. Examples of vertebrate cell expression vectors include a promoter, RN, which is usually located upstream of the gene to be expressed.
Those having a splice site, polyadenylation site, transcription termination sequence and the like of A can be used, and may further have an origin of replication if necessary. An example of the expression vector is pSV carrying the early promoter of SV40.
2dhfr [S. Subramani, R. Mulligan and P. Berg, Mol. Ce
Ill. Biol., 1 (9) , 854-864], but is not limited thereto.

As eukaryotic microorganisms, yeasts are generally used, and among them, yeast belonging to the genus Saccharomyces can be advantageously used. Examples of expression vectors for eukaryotic microorganisms such as the yeast include pAM82 having a promoter for the acid phosphatase gene [A. Miyanohara et al., P.
roc.Natl.Acad.Sci., USA, 80 , 1-5 (1983)]
Etc. can be preferably used.

Escherichia coli and Bacillus subtilis are commonly used as prokaryotic hosts. In the present invention, for example, a plasmid vector capable of replicating in the host bacterium is used, and a promoter and an SD (Shine and Dalgarno) base sequence, as well as protein synthesis, are upstream of the gene so that the gene of the present invention can be expressed in the vector. An expression plasmid provided with ATG necessary for initiation can be used. Escherichia coli as the host bacterium includes Escherichia coli.
coli) K12 strain and the like, and the vector is generally pBR322, but is not limited thereto, and any of various known strains and vectors can be used. Examples of the promoter include a tryptophan promoter, a P _L promoter, a lac promoter, lpp
A promoter or the like can be used, and in any case, the gene of the present invention can be expressed.

The use of a tryptophan promoter as an example will be described in detail below. As an expression vector, a vector pT having a tryptophan promoter and an SD sequence is used.
M1 [Now Text Man, Metabolism, Vol. 22, 289 (198)
5)], the restriction enzyme C existing downstream of the SD sequence
A gene encoding a desired polypeptide to which ATG has been added may be ligated to the laI site, if necessary.

The expression system is not limited to the direct expression system, but may be a fusion protein expression system using, for example, β-galactonase or β-lactamase.

As a method for introducing the thus obtained expression vector into a host cell and transforming the same with a host cell, generally used methods, for example, collecting cells which are mainly in the logarithmic growth phase, treating with CaCl ₂ and spontaneously DNA Can be adopted in such a state that the vector is easily taken in. In the above method, as is generally known, in order to further improve the transformation efficiency, MgCl _{2 is used.}
And RbCl can also be made to coexist. Alternatively, a method of transforming a host cell into spheroplasts or protoplasts and then transforming the same can be employed.

The desired transformant thus obtained can be cultured according to a conventional method, and the culture produces and accumulates the desired polypeptide. The medium used for the culture may be any of various media commonly used for ordinary cell culture. Specific examples thereof include, for example, L medium,
Examples of the medium include an E medium, an M9 medium, and a medium to which various carbon sources, nitrogen sources, inorganic salts, vitamins, and the like, which are generally known, are added. When the tryptophan promoter is used, cultivation can be performed using, for example, an M9 minimal medium to which casamino acid is added so that the promoter works. An agent for enhancing the action of the tryptophan promoter, such as indoleacrylic acid, can be added at an appropriate time.

Purification and isolation of the target polypeptide, ie, the polypeptide of the present invention, from the culture containing the active substance thus obtained can be carried out according to a conventional method.
In extracting the polypeptide of the present invention from a host, it is more preferable to adopt mild conditions such as an osmotic pressure method from the viewpoint of maintaining the higher-order structure.

The above-mentioned purification and isolation can be carried out, for example, according to various processing operations utilizing the physical and chemical properties of the polypeptide [for example, “Biochemical Database”.
II "pp1175-1259, 1st edition, 1st printing, 1980
June 20, 2003, issued by Tokyo Chemical Co., Ltd.). Specific examples of the method include treatment with a normal protein precipitant, ultrafiltration, molecular sieve chromatography (gel filtration), liquid chromatography, centrifugation, electrophoresis, affinity chromatography, dialysis Combinations of methods, methods, etc. can be adopted.

More specifically, the above operation can be performed, for example, as follows. That is, first, the target polypeptide is partially purified from the culture supernatant in advance. This partial purification is performed, for example, using an organic solvent such as acetone, methanol, ethanol, propanol, dimethylformamide (DMF), acetic acid, perchloric acid (PCA), or trichloroacetic acid (TCC).
A) treatment using an acid as a protein precipitant, treatment using a salting-out agent such as ammonium sulfate, sodium sulfate, sodium phosphate and / or ultrafiltration treatment using a dialysis membrane, a flat membrane, a hollow fiber membrane or the like. Done. The operation and conditions of each of these processes may be the same as those of a normal method of this kind.

Next, the crude product obtained above is subjected to gel filtration to obtain a fraction in which the activity of the target substance is recognized. The gel filtration agent used here is not particularly limited, and for example, any of dextran gel, polyacrylamide gel, agarose gel, polyacrylamide-agarose gel, cellulose and the like can be used. As a specific example of these, Sefadex G
Type, LH type, Cephaloose type, Cefacryl type (Pharmacia), Cellulofine (Chitsuso), Biogel P type, A type (Bio-Rad), Ultrogel (LKB), TS
Commercially available products such as KG type (Toyo Soda Co., Ltd.) can be exemplified.

For the polypeptide of interest, the active fraction obtained by the above gel filtration is subjected to ion exchange column chromatography such as affinity chromatography using a hydroxyapatite column, DEAE method, CM method, SP method and the like. , Chromatofocusing, reversed-phase high-performance liquid chromatography, or a combination of these operations, and can be isolated as a homogeneous substance.

The above-described chromatofocusing method can be carried out by various known methods. As a column, for example, P
BE94 (manufactured by Pharmacia), a starting buffer such as imidazole-hydrochloric acid, and an eluent such as Polybuffer 74 (manufactured by Pharmacia).
Hydrochloric acid (pH 4.0) or the like can be used.

The reversed-phase high-performance liquid chromatography is as follows:
For example C ₄ Haipoa reverse phase HPLC column - with (Bio Rad (Bio-Rad Laboratories)), etc., can be performed using acetonitrile, trifluoroacetic acid (TFA), a mixed solvent such as water, and this such as transfer agent . Thus, the polypeptide of the present invention can be isolated and obtained.

[0043]

[0044] The present invention polypeptide de obtained is the same as an active ingredient, it can be a useful pharmaceutical preparation for various medical applications mentioned above. The pharmaceutical formulations are usually prepared in the form of the present invention poly <br/> peptide are both suitable pharmaceutical formulation carrier formulated pharmaceutical composition. As the pharmaceutical carrier, any filler or diluent such as a filler, a bulking agent, a binder, a humectant, a disintegrant, a surfactant and the like which are generally used for preparing a pharmaceutical preparation according to the use form can be used. Can also be used. Form of the preparation composition, if this is a state comprising the present polypeptide de effectively, no particular limitation, such as tablets, powders, granules, may be filed with a solid agent such as pills, Usually, it is suitable to be in the form of injections such as solutions, suspensions and emulsions. It can also be a dry product which can be made liquid before use by adding an appropriate carrier. Any of these pharmaceutical compositions can be prepared according to a conventional method.

The obtained pharmaceutical preparation is administered by an appropriate route of administration according to the form of the pharmaceutical composition, for example, a pharmaceutical preparation in the form of an injection is administered intravenously, intramuscularly, subcutaneously, intradermally, intraperitoneally or the like. Pharmaceutical preparations in solid form can be administered orally or enterally. The amount of the active ingredient in the pharmaceutical preparation and the dosage of the preparation are appropriately selected depending on the administration method of the preparation, the administration form, the purpose of use, the symptoms of the patient to whom the preparation is applied, etc. The preparation is prepared in the form of a preparation containing about 1 to 80% by weight of the active ingredient, and this preparation is administered so that the amount of the active ingredient contained therein is about 0.1 μg to 10 mg per adult per day. Is desirable. The dose is 1 day
It does not need to be repeated but can be divided into 3 or 4 times a day.

[0046]

The present invention will be described below in more detail with reference to Reference Examples and Examples.

In the following examples, various physiological activities were measured by the following methods.

<Measurement of Activity> (1) Measurement of IL-1 Activity The method of JJ Oppenhein et al [J.
Immunol., 116, 1466 (1976)].
L measured using thymocytes of 3H / He J mice
Indicated by AF activity.

(2) Measurement of GIF activity 0.1 ml of a test solution diluted to various concentrations was added to a 96-well microplate (Corning), and then 2 × 10 ⁴ human melanoma cells A375 were added to each well. 0.1 ml of Eagles MEM suspension containing 10% FCS at a concentration of 0.1% was added, and a carbon dioxide incubator (manufactured by Nafco)
And culture for 4 days. After completion of the culture, 0.05 ml of 0.05% Neutral Red (Wako Pure Chemical Industries, Ltd.) is added to each well, and the cells are cultured at 37 ° C. for 2 hours. After removing the supernatant,
Wash wells gently by adding 0.3 ml of phosphate buffered saline to each well. After the washing solution was removed, each well was mixed with a monosodium phosphate-ethanol equivalent mixture 0.1 m
was shaken with a micromixer for several minutes, and the amount of the dye incorporated into the cells was measured using a 96-well microtitration plate photometer (Titer Check Multiscan, manufactured by Flow Laboratories). 5
Measure at 40 mμ to determine growth inhibitory activity. The reciprocal of the dilution ratio of the control group (control group) showing 50% inhibition of cell proliferation, that is, the test group showing half the absorbance measured value of the control group, was taken, and this was taken as the GIF activity. Unit. Thus, for example, if the GIF activity is 10 units, the test solution has an activity of inhibiting cell growth by 50% even after dilution 10-fold.

[0050]

[Reference Example 1] Cultured U937 cell human lymphohistiocytoma U937 cell (Ascenso, JLeta)
l., Blood, Vol. 57, p 170 (1981)].
4 × 10 ⁹ pieces of 12-O-tetradecanoylphorbol-13-acetate (TPA) (Pharmacia)
25 ng / ml, Concanavalin A (ConA) (Sigma) 10 μg / ml and 10% fetal calf serum (FCS)
Was added to an RPMI-1640 medium containing to prepare a cell suspension at a concentration of 4 × 10 ⁵ cells / ml.

Each 10 ml of the cell suspension was charged with a 9 c diameter.
m, and cultured in 5% carbon dioxide at 37 ° C. for 3 days. The culture supernatant is removed with an aspirator, and 10% FCS, bacterial lipopolysaccharide (LPS) (Difco 10 μg / ml, muramyl dipeptide (MDP) (Wako Pure Chemical Industries) 1 μg / ml
RPMI-1640 containing 1 ml / ml of TPA and 1 ng / ml of TPA
10 ml of the medium was dispensed into each dish. This medium was cultured in 5% carbon dioxide gas at 37 ° C. for 18 hours, and U937 cells attached to the bottom of the dish were used as a material for preparing mRNA.

Preparation of mRNA Extraction of RNA was performed using guanidinium / thermal phenol (guanidium).
idium / hot phenol) method [Feramisco, JR, et al.,
J. Biol. Chem., Vol. 257, p 11024 (198
2)] and guanidinium / cesium chloride (guanid
inlis / cesium chloride) method [Glisin, V., et al.,
Biochemistry, Vol. 13, p. 2633 (1974)].

In order to wash the U937 cells cultured above, after removing the culture supernatant, each of the dishes was rinsed with 5 ml of a PBS (-) solution.
ml of a 4M-guanidine / isothiocyanate mixed solution [4M-guanidine isothiocyanate (Fluka), 50 mM Tris-HCl (pH 7.6), 10 mM
EDTA, 2% sodium lauroyl sarcosinate] was added to lyse the cells. The lysate was collected with a rubber policeman and a Pasteur pipet to obtain 420 ml of a cell lysate. Keep this solution at 60 ° C.
By passing through an injection needle, the chromosomal DNA was sheared, and then an equal amount of phenol kept at 60 ° C was added.
The solution was further mixed with an 8G injection needle and sheared. Next, 210 ml of 0.1 M sodium acetate-10 mM Tris-HCl (pH 7.4) -1 mM EDTA solution was added to this mixture.
And 420 ml of a mixed solution of chloroform-isoamyl alcohol (24: 1 by volume), and while maintaining the temperature at 60 ° C,
Stir vigorously for 15 minutes. After cooling the mixture on ice, 3000 rp
m, and centrifuged at 4 ° C. for 20 minutes to collect an aqueous layer. 2 for water layer
Volume of ethanol and left overnight at -70 ° C.
An NA precipitate was obtained. The crude RNA was treated with 6 M guanidine isothiocyanate-5 mM sodium citrate (pH 7.
0) -0.1 M β-mercaptoethanol-0.5% dissolved in 48 ml of sodium lauroyl sarcosinate solution, and 19.2 g of cesium chloride was added and dissolved. Next, 5.7 M cesium chloride-
Overlay 4 ml of 0.1 M EDTA (pH 7.5)
25 ° C, 315 with Beckman SW40Ti rotor
The RNA was collected by centrifugation at 00 rpm for 20 hours.

The amount of the RNA thus obtained was 9.7 mg.

Next, in order to obtain mRNA from the RNA obtained above, oligo (dT) -cellulose (Collaborative Research, Inc.
Column chromatography). Adsorption was performed with 10 mM Tris-HCl (pH 7.5) -0.
The elution was performed with 5 M NaCl-1 mM EDTA, and elution was performed with 10 mM Tris-HCl (pH 7.5) -1 mM EDT.
A.

As a result, the obtained mRNA was 400 μm.
g.

Preparation of cDNA Library Preparation of the cDNA library is performed as follows.
Can be expressed in animal cells.
ama-Berg) method. That is, the vector primer to which the dT chain is added for cDNA cloning is obtained from the plasmid pCDV1, and the linker DNA to which the dG chain is added is obtained from the plasmid pL1 by the method of Okayama et al. [Okayama, H. and P. Berg., Molecular an
d CellularBiology., Vol. 3, p. 280 (198
3)].

Next, 15 μg of the mRNA obtained above was added to 5
mM Tris-HCl (pH 7.5)-0.5 mM EDT
A (pH 7.5) solution in 20 μl
After incubation for 5 minutes at 37 ° C. for 5 minutes, the reaction solution (40 μl in total volume) was added to 50 mM Tris-HCl (pH
8.3), 8 mM MgCl ₂ , 30 mM KCl,
0.3 mM dithiothreitol, 2 mM each dATP,
dGTP, dCTP and dTTP, 2.8 μg of vector primer DNA, RNase inhibitor (Promega
It was adjusted to 60 units of Biotech (manufactured by Biotech) and 40 units of reverse transcriptase (manufactured by Bio-Rad), and incubated at 37 ° C for 1 hour.
7.5) The reaction was stopped by adding 2 μl and 2 μl of 10% SDS. Thereafter, phenol / chloroform extraction and chloroform extraction were performed, and vector / primer cDNA: mRNA was recovered as an ethanol precipitate.

The recovered vector / primer cDN
A: mRNA was converted to 140 mM sodium cacodylate, 3
0 mM Tris HCl (pH 6.8), 1 mM CaCl
_2. Incubate at 37 ° C. for 5 minutes in 30 μl of a reaction solution containing 0.1 mM dithiothreitol, 0.3 μg poly (A), 66 μM dCTP, and 38 units of terminal deoxynucleotidyltransferase (Pharmacia). 0.5M EDTA (pH
7.5) The reaction was stopped by adding 1.5 μl and 1.5 μl of 10% SDS, followed by phenol / chloroform extraction and chloroform extraction, and the oligo dC chain-added cDNA: mRNA-vector / primer was recovered as an ethanol precipitate.

[0060] The recovered nucleic acid was added to 7 mM Tris HC.
1 (pH 7.5), 7 mM MgCl ₂ , 60 mM Na
Cl, 100 μg / ml bovine serum albumin and 12 units of restriction enzyme Hind III (Nippon Gene) in a 20 μl reaction at 37 ° C. for 90 minutes, then 1 μl and 10 μl of 0.5 M EDTA (pH 7.5). The reaction was stopped by adding 1 μl of% SDS. After that, phenol / chloroform extraction and chloroform extraction were performed, and as a result of ethanol precipitation, HindIII-degraded oligo dC chain-added cDNA: mRNA-vector / primer was recovered. This was added to 10 mM Tris HCl (p
H7.5) -1 mM EDTA (pH 7.5) (TE
(PH 7.5)). One of these
The above TE (pH 7.5), 0.1 M N
Linker DNA1 to which aCl and oligo dC chain are added
Incubate at 65 ° C. for 2 minutes in 10 μl of 4 ng reaction solution, then incubate at 42 ° C. for 30 minutes, and then cool to 0 ° C.

The above reaction solution was further treated with 20 mM Tris-HCl.
(PH 7.5), 4 mM MgCl ₂ , 10 mM (NH
₄ ) ₂ SO ₄ , 0.1 M KCl, 50 μg / ml bovine serum albumin, 0.1 mM β-NAD (nicotinamide adenine dinucleotide, manufactured by Pharmacia) and 0.6 μg of Escherichia coli DNA ligase (Pharmacia) Was adjusted to 100 μl, and the mixture was incubated at 12 ° C. overnight. In this reaction solution, each of dATP, dGTP, dCTP and dTTP was adjusted to 40 μM, and β-NAD was adjusted to 0.15 m.
M, and 0.4 μg of Escherichia coli DNA ligase, Escherichia coli DN
4.6 units of A polymerase I (manufactured by Boehringer Mannheim) and 1 unit of Escherichia coli RNase H (manufactured by Pharmacia) were added, and the mixture was incubated at 12 ° C for 1 hour and then at 25 ° C for 1 hour.

Using the reaction solution obtained above, Escherichia coli HB101 strain was transformed. As competent cells of Escherichia coli HB101 strain,
Bethesda Research Laboratories
earch Laboratories: BRL)
The above transformation was performed according to the manual of L company.

Thus, approximately 21,000 cDNs
The A library was obtained.

Transfection into monkey COS-1 cells The cDNA library obtained above was divided into groups with an average of 70 clones per group, and plasmid DNA was prepared from each group.

The plasmid DNA was prepared by the alkaline lysis method (Mo
lecular Cloning-A Laboratory Manual, Cold Spring H
arbor Laboratory, 1982, p. 368).

The plasmid DNA thus prepared from each group was used for each COS-1 cell of monkey culture cells [Gluzman, Y., Cell, Vol. 23, p175 (198)
1) Transfection was performed. The transfusion was carried out according to the DEAE-dextran method [Yokot
a, T. et al., Proc. Natl. Acad. Sci., USA., Vol. 8, p.
1070 (1984)]. That is, COS-1 cells were treated with trypsin to provide RPMI-16 containing 10% FCS.
After suspending the cells in 40 medium and adjusting the number of cells to 1 × 10 ⁶ cells / ml, 2 cells of RPMI-1640 medium containing 10% FCS were added.
500 μl each in a 6-well plate containing ml / well
1 was dispensed. After culturing overnight at 37 ° C., the supernatant was removed, the cells were washed with a serum-free medium, 10 μg / ml plasmid DNA, 0.4 mg / ml DEAE-dextran (Pharmacia), 50 mM Tris HCl (pH
RPMI-1640 medium containing 7.4) and 10% FCS was added at 1 ml / well, and cultured at 37 ° C. for 4.5 hours. Thereafter, the supernatant was removed, the cells were washed with a serum-free medium, and 150 μM chloroquine (manufactured by Sigma) and 10 μM
2 ml / well of RPMI-1640 medium containing% FCS was added, and the cells were further cultured at 37 ° C. for 3 hours. Remove the supernatant,
After washing the cells with a serum-free medium, RPMI-1640 medium containing 10% FCS was added at 3 ml / well, and the cells were added.
The cells were cultured at 7 ° C for 72 hours. After collecting the supernatant, 10% F
2 ml / well of an RPMI-1640 medium containing CS was added, and freeze-thawing was repeated twice to collect a cell extract. GIF activity was measured for the culture supernatant and the cell extract.

The group showing the GIF activity was divided into 24 groups of 10 clones / group, and the same operation was performed as described above. The GIF activity was measured, and for the group showing the activity, and for each clone in the group, By carrying out the same operation as described above, a clone showing GIF activity was identified.

Thus, pcD-GIF-16 and pcD-GIF-16
Two types of GIF-207 clones were obtained.

Table 1 shows the GIF activity (GIF units / ml) of these clones.

Table 1 Clone culture supernatant cell extract pcD-GIF-16 48.3 120.7 pcD-GIF-207 62.6 196.9 pcDV1 (control) Analysis of 0 clone Plasmid pcD-GIF-16 And pcD-GIF-20
FIG. 1 shows a restriction enzyme map of cDNA No. 7.

In addition, the nucleotide sequence of the cDNA of the above-mentioned was modified by a base-specific chemical modification method [Methods in Enzymology, Vol.
499 (1980)] and the phage M13 vector [Ge
ne, Vol. 19, p. 269 (1982)] using dideoxy chain termination [Proc. Natl. Aca
d. Sci., USA, Vol. 74, p 5463 (1977)].

As a result, the cDNA of pcD-GIF-207 was obtained from IL-1α [Carl JM
arch et al., Nature, Vol. 315, p 641 (198
5)] was confirmed to be the same as the cDNA sequence of the translation region.

A strain in which the plasmid pcD-GIF-207 having the cDNA encoding the IL-1α precursor protein was retained in Escherichia coli 1776 strain was transmitted to Escherichia coli 17
No. 76 / pcD-GIF-207 "and deposited as Microtechnical Laboratory No. 1294 (FERM BP 1294).

Expression and Production of Polypeptide The above plasmid pcD-GIF-207 was replaced with the restriction enzyme Hin.
After cleavage with dIII and HincII, about 0.66 kb
Was isolated and purified by agarose gel electrophoresis. This DNA fragment was further digested with the restriction enzyme Alu I to obtain about 0.5
A kb Alu I-Hinc II DNA fragment was isolated in a similar manner.

Next, a synthetic oligonucleotide [5'CG
ATAATGTCAGCACCTTTTTAG 3 'and
5 'CTAAAAGGGTGCTGACATTAT 3']
Are phosphorylated with T4 polynucleotide kinase, ligated to the Alu I-Hinc II DNA fragment obtained above using T4 DNA ligase, and then cleaved with restriction enzyme Cla I. Approximately 0.54 kb Cla I-Cla IDN after agarose gel electrophoresis.
The A fragment was isolated and purified.

On the other hand, the plasmid pTMI [Konbunko, Metabolism, Vol. 22, 289 (1985)] was replaced with the restriction enzyme Cla.
I and digested with calf intestinal alkaline phosphatase (CIAP;
calfintestine alkaline phosphatase), and then the previously prepared Cla I-Cla IDN of about 0.54 kb was prepared.
A fragment and the plasmid p trp IL-1α-1 for expression of the polypeptide of interest ligated with T4 DNA ligase.
13 was obtained.

The plasmid was transformed into Escherichia coli H
B101, and transform the desired transformant into plasmid D obtained by the boiling method.
The selection was made by analyzing the size of the fragments cut by the restriction enzyme of NA.

FIG. 2 shows the above outline.

From the transformant obtained above, plasmid p trp IL-1α-113 was extracted, transformed into Escherichia coli W3110, and transformed into Escherichia coli W3110 / p.
trp IL-1α-113 was obtained.

[0080]

Embodiment 1 (1) Culture of transformants The transformant obtained in Reference Example 1 (Escherichia coli W
3110 / ptrp IL-1α-113)
50 μg / ml and L-tryptophan 20 μg / m
medium containing 1% tryptone, 0.5% yeast
In 10 ml of 0.5% NaCl) at 37 ° C. overnight
After culturing with shaking, 8 ml of this was added to 50 μg / ml ampicillin.
Medium containing 1% casamino acid and 1% casamino acid (0.6% Na
_TwoHPO _Four, 0.3% KH_TwoPO_Four, 0.05% NaC
1, 0.1% NH_FourCl, 2 mM MgSO_Four, 0.2%
Glucose and 0.1 mM CaCl_Two) In 400ml
And cultured with shaking at 37 ° C. 9 hours later E. coli
1M Na_TwoHPO_FourSuspend in 10ml and put in cold room overnight
After standing, 10 mM Tris HCl buffer (pH 8.
0) was dialyzed for 2 days.

The obtained dialysate was centrifuged to separate a supernatant and a precipitate. The resulting supernatant was 28 ml and GI
The F activity was 7.3 × 10 ⁷ units.

(2) Purification of polypeptide 2 ml of the supernatant obtained in the above (1) was subjected to ion-exchange chromatography (DEAE-HPLC) using a GTi Ultrachrome High Performance Liquid Chromatography System (manufactured by LKB). Was purified under the following conditions.

Column: TSK gel DEAE-5PW
(7.5 × 75 mm, manufactured by Toyo Soda Co., Ltd.) Eluent A: 20 mM Tris HCl buffer (pH 8.0) Eluent B: 20 mM Tris HC containing 0.5 M NaCl
1 buffer (pH 8.0) Flow rate: 1 ml / min Fraction volume: 1 ml / min / tube As a result of the DEAE-HPLC, the GIF active fraction was found to have a retention time of 26 to 28 minutes and a retention time of 32.5 to 34.5.
It was recognized in two places. Hereinafter, the active fraction of 26 to 28 minutes is referred to as "fraction 1", and the fraction of 32.5 to 34.5 minutes is referred to as "fraction 2".

For each of the above fractions, the DEA
E-HPLC and high performance gel chromatography were performed to obtain pure fraction 1 and fraction 2, respectively.

As described above, GIF active fractions were obtained separately, and the following confirmation tests were performed on them.

(3) SDS polyacrylamide gel electrophoresis (SDS-PAGE) The method of Laemmli, UK [Nature, 277 , 680 (19)
70)], the SDS- of the above fractions 1 and 2
PAGE was performed. The conditions are as follows.

Sample: The above fraction 1 or 2 was dried and dissolved in a Laemery sample buffer [containing 1/20 volume of 2-mercaptoethanol (2ME ⁺ )] and treated at 100 ° C. for 4 minutes.

Gel: A 15% polyacrylamide gel having a thickness of 1.5 mm was used.

Electrophoresis apparatus: Bio-Rad
The company's Protean was used.

Electrophoresis conditions: Electrophoresis was performed at a constant current of 40 mA for 2 hours.

The gel after the electrophoresis was stained using Silver stain kit (Bio-Rad). As a result, both fractions 1 and 2 were approximately 1
It migrated as a single band at 8.3k, and almost coincided with the molecular weight of 18k predicted from the gene.

(4) Isoelectric Focusing (IEF) The isoelectric focusing of the above fractions 1 and 2 was performed on an amphorine PAG plate (L, pH 3.5 to 9.5).
KB) and Model 1415 (Bio-Rad). The conditions are as follows.

Sample: PBS of fraction 1 obtained above
A total of 5 lanes of a solution left for 2 days, a solution left for 2 weeks, a solution of fraction 2 obtained above in PBS for 2 weeks, a control PBS solution and the following marker protein (pI marker protein) were used. used.

<Marker protein> Amyloglucosidase (3.50), soybean trypsin inhibitor (4.
55), β-lactoglobulin A (5.20), bovine
Bovine carbonic anhylas
drase) B (5.85), human carbonic anhydrase B (6.5)
5), equine myoglobin-acidic band (hors
e myoglobin-acidic band) (6.85), horse myoglobin-basic band (horse myoglobin-basic)
band) (7.35), lentil lectin-acidic band (8.1)
5), lentil lectin-middle band (lentil lec
tin-middle band) (8.45), lentil lectin-basic band
(8.65) and trypsinogen (9.30).

Electrode solution: Anolyte solution = 1M H ₃ PO ₄ Catholyte solution = 1M NaOH Electrophoresis conditions: Constant power 1 W / cm Gel width and cooling for 90 minutes (1
(0 ° C.).

Staining: Staining was performed with a Silverstein kit.

After the above electrophoresis, the gel was sliced at intervals of 1 cm, extracted by shaking with 1 ml of distilled water (2 days), the pH was measured, and the isoelectric point was calculated.

As a result, the isoelectric point (p
I) was about 5.0 and migrated as a single band at this position. Fraction 1 has an isoelectric point of about 5.
It ran as two bands at 2 and about 5.0.

(5) Amino acid composition 30 μl of each of the above fractions 1 and 2 was placed in a 12 mm
It was carefully placed in the bottom of a thick 120 mm thick Pyrex test tube made of Pyrex, and dried under reduced pressure with a desiccator containing sodium hydroxide particles. 4N- into test tube containing dried sample
Methanesulfonic acid [containing 0.2% 3- (2-aminoethyl) indole, manufactured by Pierce]
1 was added thereto, degassed at 0.1 to 0.2 mmHg for 1 minute, and then sealed under reduced pressure. The hydrolysis was performed in a heater at 118 ° C. for 24 hours. After opening the tube, neutralize with 46 μl of 4N-sodium hydroxide and 450 μl with citrate buffer for dilution.
And

The amino acid analysis was performed by injecting 250 μl of the above sample solution using an amino acid analyzer (Hitachi 835 analyzer manufactured by Hitachi, Ltd.). The separated amino acids were detected by the orthophthalaldehyde method. The quantification was performed using a calibration curve prepared with standard amino acids analyzed before and after the sample.

The results are shown in Table 2 below in terms of the molar ratio of each amino acid, based on Phe (10 mol). still,
Under the above analysis conditions, Pro and Cys cannot be measured.

[0102] (6) Amino acid sequence 150 μl of each of the above fractions 1 and 2 was analyzed using a protein sequencer (Model 470A) manufactured by Applied Biosystems. The resulting PTH-amino acid was replaced with 100% to 50 μl of 33% acetonitrile aqueous solution.
And 5 μl thereof was injected with a Waters 710B type autosampler. The Chromatography system operated two Betzmann 112 pumps with a 421 controller. The column used was 2 mm x 250 mm packed with Ultra Air ODS-5 µm, and was kept at 55 ° C with a column heater. The flow rate is 0.
3 ml / min, using a mixed solution of 20 mM sodium acetate and acetonitrile, separated by a gradient elution method,
Monitored at 269 nm. The analysis was for 45 minutes.

As a result of analysis for 40 cycles, both amino acid sequences were identical except for the 36th amino acid.
Each was as follows.

Ser-Ala-Pro-Phe-Ser-Phe-L
eu-Ser-Asn-Val-Lys-Tyr-Asn-Phe-Met
-Arg-Ile-Ile-Lys-Tyr-Glu-Phe-Ile-
Leu-Asn-Asp-Ala-Leu-Asn-Gln-Ser-I
The 36th amino acid (X above) of le-Ile-Arg-Ala-X-Asp-Gln-Tyr-Leu fraction 1 is
The amino acid predicted from the gene sequence, that is, Asn, that of fraction 2 was Asp.

As described above, fraction 1 is the polypeptide represented by the above formula (A), ie, IL-1α, whereas fraction 2 is obtained by substituting the 36th amino acid of IL-1α with Asp. Was confirmed to be the polypeptide of the present invention. Hereinafter, the polypeptide of the present invention is referred to as “polypeptide I”.

It was noted that the above-mentioned IL-1α lacked material stability, and was changed to a partially more stable polypeptide I, for example, even in a Tris-HCl buffer (pH 8.0).

Example 2 (1) Production of polypeptide I of the present invention Site-Specific Mutagenesis (Proc.) Using plasmid p trp IL-1α-113 obtained in Reference Example 1. Nat.Acad.Sc
i., 81 , 5662-5666 (1984)], a plasmid for expressing polypeptide I was obtained, and polypeptide I was produced therefrom as follows.

That is, the M13mp11 phage vector was
Used as single-stranded (ss) DNA template. First, EcoRI / BamHI was obtained from plasmid p trp IL-1α-113.
The DNA fragment was excised and cloned into the M13mp11 phage (RF) EcoRI and BamHI restriction enzyme sites, and the single-stranded (ss) DNA (M13-
IL-1α-113) was obtained, and this was used as a template for mitogenesis.

Synthetic oligonucleotide [5'-ACTG
GGTGAGCTTTGCAG-3 '(primer)]
Is phosphorylated with T4 polynucleotide kinase, which is hybridized with ssM13-IL-1α-113 DNA, and after annealing, in the presence of dNTPs, DNA polymerase I (Klenow fragment) and T4 DNA
Each was treated with ligase and incubated at 15 ° C. for 18 hours.

The obtained DNA was transformed into JM105 competent cells, and the resulting colonies were inoculated on an agar plate with 50 colonies and cultured at 37 ° C. for 18 hours. The filter containing the grown colonies was alkali-denatured by a conventional method, dried, and baked at 80 ° C. for 2 hours. After pre-hybridizing this filter, the filter and the 5 '
³² and P-gamma-ATP in labeled ³² P- Purobe and hybridized at room temperature. The hybridized filter was washed with a 6 × ssc buffer at room temperature for 10 minutes, then at 54 ° C. for 5 minutes, dried, and dried at −70 ° C. for 1 minute.
Autoradiography was performed for 8 hours.

As a representative of the 5 mutated clones,
13-IL-1α-36D was selected, infected with JM105, and cultured to prepare ssDNA and RFDNA.

The mutation of the target gene was confirmed by M13 dideoxythiain termination sequencing of the ssDNA obtained above.

From the RF DNA grown on JM105,
An EcoRI / BamHI fragment was prepared and inserted into an expression plasmid in the same manner as in the above Reference Example to obtain a desired polypeptide I expression plasmid (IL-1α-36D).

Using this plasmid, polypeptide I was expressed in the same manner as in Example 1 and purified.
AE-HPLC gave a single GIF activity peak) to obtain the desired polypeptide I exhibiting the above physical properties. Its specific activity is about 1 × 10 ⁷ GIF units / m
g protein.

[0115]

Example 3 (1) Production of Polypeptides II and III of the Present Invention In Example 2, 5'-ACTGGGG was used as a primer.
Similarly, using TGAGCTTGGCAG-3 ', the 141st amino acid (Cys) of IL-1α was changed to S
Thus, p trp IL-1α-141S, which is a plasmid for expressing the polypeptide of the present invention, substituted with er, was obtained.

Expression and purification were carried out in the same manner as in Example 1 using the plasmid, and as a result, DEAE-
Two peaks of GIF activity were obtained by HPLC.

As a result of the same analysis,
The peak fraction with the earlier retention time is
The polypeptide predicted from the gene sequence, ie, IL-1
It was confirmed that the polypeptide was the polypeptide of the present invention (polypeptide III) in which the 141st amino acid (Cys) of α was substituted with Ser.

Further, as a result of the same analysis, the other peak fraction showed that the 36th amino acid (A
sn) and the 141st amino acid (Cys) were identified as polypeptides of the present invention substituted with Asp and Ser, respectively. Hereinafter, this polypeptide is referred to as “polypeptide I.
I ".

Example 4 (1) Production of Polypeptide II of the Present Invention Using the plasmid p trp IL-1α-141S prepared in Example 3 in the same manner as in Example 3, 5′-ATTCGAGCCGATGATCAG was used as a primer. −
By using 3 ', a plasmid p trp IL-1α-36D.141S for expressing the desired polypeptide II was obtained.

The above plasmid p trp IL-1α-36D
-141S is held by the HB101 strain, and this is sent to the microfabrication laboratory as "Escherichia coli HB101 / IL-1α-3".
No. 1295 (FERM BP1295).

Using the plasmid, expression and purification were carried out in the same manner as in Example 1 to obtain the desired polypeptide II of the present invention.
I got

The molecular weight was confirmed to be about 18 kd by SDS-PAGE. In addition, the isoelectric point (pI) of the product by IEF was about 5.0. Specific activity of polypeptides II and III (GIF activity)
Was equivalent to polypeptide I.

[0123]

[Pharmacological Test Example 1] GIF activity and LAF activity The GIF activity of the polypeptide of the present invention is as described above, and all of polypeptides I, II and III exhibit LAF activity almost equivalent to the GIF activity. Indicated.

Further, the following test was conducted on the polypeptide of the present invention.

Anti-tumor effect 200,000 cells of tumor cells female A (Meth A)
LB / c mice were intradermally inoculated (id) (day 0).
Then, on days 7 and 8, the polypeptide I.
3, 1 or 3 μg / mouse was administered once intratumorally in experimental animals.

Each of the seven experimental animals was used as one test group. In the control group, only the solvent (1% mouse serum) was similarly administered.

FIG. 3 shows the test results. In the figure, the horizontal axis represents the number of days (days) after tumor cell inoculation, and the vertical axis represents tumor weight (m
g), wherein curve (1) represents the control group, curve (2) represents the group administered with 0.3 μg of polypeptide I, curve (3) represents the group administered with 1 μg of polypeptide I, and curve (4) represents the group The 3 μg administration groups of polypeptide I are shown. The tumor weight is shown as a mean (mean) ± standard deviation (SD).
* Is P <0.05 in Student's T-test
And ** indicates P <0.01.

CSF production promoting effect test-1 cell line U-373MG [ATCC HTB17,
Glioblastoma, Astrocytoma, Human].

That is, first, 2 × 10 ⁵ cells / m 2
10% fetal bovine serum (GIBCO
Eagle's ME with MEM non-essential amino acids (Flow) and MEM sodium pyruvate (Flow)
M medium (Nissui).

[0130] Polypeptide I was added to the above cell suspension at various concentrations, and the mixture was placed in a carbon dioxide incubator at 37 ° C.
For 24 hours, and each culture supernatant was collected, and the amount of CSF produced and accumulated in the culture supernatant was measured using mouse myeloma cells [Lewis, ICet al., J. Immunol., 12
8 , 168 (1982)].

FIG. 4 shows the obtained results. In the figure, the horizontal axis represents the concentration of polypeptide I (ng / ml), and the vertical axis represents the CSF activity (unit / ml, × 10 ^-2 ).

-2 The following experiment was conducted to test whether polypeptide I was administered to a living body to exert an in vivo CSF production enhancing effect.

Specifically, various amounts of polypeptide I were subcutaneously administered to normal mice (BALB / c mice, purchased from Shizuoka Prefectural Experimental Animal Cooperative). Eight hours after the administration, blood was collected from each experimental animal, and the CSF activity in the serum was determined as described above.
As in the case of -1, measurement was performed using mouse myeloma cells.
As a control, a group administered with human serum albumin (HSA) was prepared and subjected to the same test.

The results are shown in FIG. In the figure, the horizontal axis represents the polypeptide I dose or the HSA dose (both μ and
g / mouse) and the vertical axis indicates CSF activity (unit / ml serum,
× 10 ^-3 ).

Anti-inflammatory test The method of Winter et al. [Proc. Soc. Exptl. Biol.
Med., 111 , 544-547 (1962)].

That is, male rats (Spraque Da) of 6 to 8 weeks of age
(Wley strain, Charles River Japan) was used in groups of 6 to 8 animals per group based on body weight on the day before the experiment. Using carrageenin (made by Marine Colloid) as a proinflammatory agent suspended in physiological saline at a concentration of 1%, 0.1 ml was injected subcutaneously into the right hind footpad of the rat to induce foot edema. I let it. To assess paw edema, the right hind footpad volume was measured with a plethysmometer (plethy
smometer, Ugo-Vasile). The edema rate (swelling rate)
%).

The test substance was dissolved and diluted in Dulbecco's phosphate buffered saline, and 0.1 ml was injected into the back skin of the rat one hour before injection of the proinflammatory agent. As a control group, a solvent administration group was prepared and subjected to the same experiment.

The results are shown in FIG. In the figure, the horizontal axis indicates the time (hr) after administration of the proinflammatory agent, and the vertical axis indicates the edema rate (%). In the figure, curve (1) represents the control group, curve (2) represents the group administered with 0.1 μg of polypeptide I, curve (3) represents the group administered with 1 μg of polypeptide I, and curve (4) represents the polypeptide The 10 μg administration group of I is shown.

Radiation Injury Prevention Effect Test BALB / c mice (9 weeks old) were intraperitoneally injected with 1 μg / mouse or 0.3 μg / mouse of polypeptide I 20 hours before irradiation with a lethal dose of X-rays. .

Using an X-ray irradiator (MBR-1505R, Hitachi Medical Co., Ltd.), the mice were whole-body irradiated with 850 X-rays of X-rays, and thereafter their survival was confirmed every day. In addition, a PBS administration group was set as a control.

The results are shown in FIG. In the figure, the horizontal axis is X
The number of days after irradiation (days), the ordinate indicates the survival rate (%) of the test animals, the curve (1) indicates the group administered with 1 μg of the polypeptide I, and the curve (2) indicates the 0. 0 g of the polypeptide I. The 3 μg administration group and the curve (3) show the control group, respectively.

FIG. 7 shows that in the control group, all the animals died on the 18th day after X-ray irradiation, whereas the polypeptide I
In the administration group, the effect of preventing radiation damage was observed depending on the dose. In particular, in the 1 μg administration group, it was confirmed that about 80% of the groups were prevented from death due to radiation damage and survived.

Opportunistic Infection Protection Effect Test The following tests were performed using the susceptible model mice.

(1) Male ICR mice (6 weeks old) were used as test animals (7 mice per group). On the first day, 100 mg / kg of 5-fluorouracil (5-Fu, manufactured by Kyowa Hakko) was used. It was administered intravenously. On the second, fourth and sixth day,
1 μg / mouse of polypeptide I was subcutaneously administered, and on the seventh day, a predetermined amount of Pseudomonas aeruginosa E-2 was intraperitoneally administered for infection. On the 10th day, the number of surviving test animals was counted to determine the survival rate (%).

The results are shown in FIGS. 8 (1) to (3).

FIG. 8 (1) shows the results of the above experimental group, FIG. 8 (2) shows the results of the control group to which the polypeptide I was not administered (only 5-Fu was administered), and FIG. Is 5-F
The results of the control group to which neither u nor polypeptide I was administered are shown, respectively.

In FIG. 8, the ordinate represents the survival rate (%), and the abscissa represents the groups A to E employing the following doses of Pseudomonas aeruginosa.

Group A: 19000 bacterial counts / mouse administered group B group: 3800 bacterial counts / mouse administered group C: 750 bacterial counts / mouse administered group D group: 150 bacterial counts / mouse administered group E group: 30 bacterial counts / Mouse administration group F group: 6 bacteria count / mouse administration group CSF production promoting effect test of IL-1α As a CSF producing strain, human lung cell-derived strain HFL-1 (Hu
The following tests were performed using man Embryonic Lung Fibroblasts (ATCC registered cell line No. CCL-153).

[0149] First, the HFL-1 cells such that the cell concentration of 2 × 10 ⁵ cells / ml, 10% fetal bovine serum pressurized hamster 12K culture [Ham, RG, Proc.
Sci., 53 , 288 (1965)]. Next, IL-1α prepared in the above Example 1 adjusted to various concentrations was added to the above cell suspension, and 37% was added in a carbon dioxide incubator.
At 24 ° C. for 24 hours, 48 hours and 72 hours, collecting the respective culture supernatants, and producing and accumulating CSF in the respective culture supernatants.
The amount was measured using mouse bone marrow cells [Lews, IC
et al., J. Immunol, 128 , 168 (1982)].

Table 3 shows the results.

[0151] According to the above results, the addition of IL-1α resulted in HFL
It is evident that the CSF production of the -1 cell line is enhanced as compared to the absence thereof.

Methods for producing cytokines from animal cells Various concentrations of polypeptide II and 0.01% PHA-P
In the presence of HBS-2C5B2 cells [J. Immunol., 13
1 , 1682-1689 (1985)] to 2 × 10 ⁵
Cells were cultured in cells / well. The supernatant after 24 hours of culturing was collected, and its IL-2 activity was measured for IL-2 dependent mouse T cells (CTLL) according to the method of KASmith et al.
2) [J. Immunol., 120 , 2027]
(1978)]. The results are shown in Table 4 below.

Table 4 Concentration of polypeptide II (ng / ml) IL-2 activity (cpm × 10 ⁻³ ) average (n = 5) 0 0.4 0.0005 0.4 0.005 0.60 than .05 2.1 0.5 3.2 5 3.5 50 3.9 500 the results shown in 3.8 above, the use of the present invention polypeptide, the production of natural cytokines from animal cells efficiently It turns out that it can be done.

When the polypeptide of the present invention is applied to such a method, a very small amount, usually 10 ng / ml, is used.
A degree of use is sufficient and also facilitates the process of purification of the induced cytokines.

When producing cytokines from animal cells, the polypeptide of the present invention used to induce production is structurally stable under the conditions, and IL-
It is essential to bind to one receptor. That is, it is important that the polypeptide of the present invention binds to the IL-1 receptor and transmits a signal necessary for cytokine production into cells.

Therefore, the following test was performed for binding to the IL-1 receptor on fibroblasts.

On a 6-well plate, almost uniform on one side
Balb / 3T3 cells (clone A31:
ATCC, CCL-163, 1 × 10⁶cells / well)
To ¹²⁵I-labeled IL-1β [Biochemical No. 58,8;
p840 (1986); EPO18791]].
000cpm / well and D-MEM with 10% FCS in advance
20 ng / incubated for 24 hours at 37 ° C in
Add IL-1β or polypeptide II at 4 ° C.
I responded. Remove the reaction mixture with Pasteur pipet and remove 10%
Add 1 ml of F-CS-added D-MEM, gently wash and remove supernatant.
I was After repeating this washing operation twice, 1 ml of 1% S
DS, solubilize cells with 0.2N NaOH, lysate
And radioactivity in the lysate from which the wells were washed
(Emissivity) was measured with a γ-counter.

The above-mentioned ¹²⁵ I-labeled IL-1β was obtained by the method of Bolton and Hunter [Biochem.
Produced and purified according to J., 133 , 529 (1973) (specific activity: 250 μCi / μg protein or more).

The results obtained are shown in Table 5 below.

[0160] In the table, the stopping power (%) was determined by the following equation.

Binding ability (%) = (AC) / (AB) × 100 where A is the radioactivity bound in the absence of unlabeled polypeptide I, B is non-specific for the plate The radioactivity adsorbed on the column indicates the actually measured radioactivity.

Such an index indicates the binding ability of IL-1β or polypeptide II to the IL-1 receptor.
It is known that the IL-1β receptor is common to IL-1α and IL-β.

From the above Table 5, it can be seen that polypeptide II is extremely preferable for such an application without reducing the binding force to IL-1 receptor even under conditions of cytokine-induced production.

[0164]

Formulation Example 1 Human serum albumin (HSA) was added to a physiological saline solution of polypeptide I having a GIF activity of 1 × 10 ⁷ units / ml so as to have a concentration of 0.5%, followed by filtration (0.22 μm membrane). After that, the solution was aseptically dispensed in 1 ml portions into vials and freeze-dried to prepare a preparation for injection.

The preparation thus obtained is used by dissolving it in 1 ml of distilled water for injection at the time of use.

[Brief description of the drawings]

FIG. 1. Plasmid pcD-GIF-16 and plasmid
3 shows a restriction map of pcD-GF-207 cDNA.

FIG. 2: Plasmid pcD-GIF-207 and plasmid
1 shows a schematic diagram for constructing plasmid p trp IL-1α-113 from pTM1.

FIG. 3 shows the results of an antitumor effect test.

FIG. 4 shows the results of a CSF production promoting effect test.

FIG. 5 shows the results of a CSF production promoting effect test.

FIG. 6 shows the results of an anti-inflammatory test.

FIG. 7 shows the results of a radiation damage prevention action test.

FIG. 8 shows the results of an opportunistic infection protective effect test.

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁶ Identification number Agency reference number FI Technical display location C12N 15/09 ZNA A61K 37/02 AED C12P 21/02 9282-4B C12N 15/00 ZNAA // ( C12P 21/02 C12R 1:19) (31) Priority claim number Japanese Patent Application No. 61-200323 (32) Priority date August 27, 1986 (33) Priority claim country Japan (JP) No. FERM BP-1294 Microorganism accession number FERM BP-1295 (72) Inventor Kazuyoshi Kawai 130-2 Miho, Miho, Matsumo-cho, Itano-gun, Tokushima Pref. Town Kagasuno 1090-18 (72) Inventor Seiji Ishii 39-46 Satoyoshi, Sumiyoshi, Aizumi-cho, Itano-gun, Tokushima Prefecture (72) Inventor Yasuo Yanagihara 891 Omatsu, Kawauchi-cho, Tokushima City, Tokushima Prefecture 6 (72) inventor Yoshikatsu Hirai Tokushima Prefecture Itano-gun, Kitajima-cho, Shinkirai Jie Furukawa 5 49 (56) Reference NATURE 315, ~20! (1985) P.A. 641-647 PROC. NATL. ACAD. SCI. USA 81 (1984) p. 7807− 7911

Claims (1)

(57) [Claims] Formula 1 In At a amino acid sequence of interleukin -1α represented, modified to replace the 36-position Asn with another amino acid
Having an amino acid sequence , and Asn and 141 at position 36
Modified amino acids in which each Cys is substituted with another amino acid
And the having the features selected from having amino acid sequence
Interloy having an amino acid sequence in which position 36 is Asn
An interleukin-1α derivative substantially free of quin-1α. 2. The interleukin-1α derivative according to claim 1, wherein the other amino acid replacing Asn at position 36 is Asp . 3. The interleukin-1α derivative according to claim 1, which has a modified amino acid sequence in which Asn at position 36 and Cys at position 141 are each substituted with another amino acid. 4.36 position Asn is by Asp, 141 of claim 3 Cys has the amino acid sequence modified are location <br/> conversion respectively Ser
2. The interleukin-1α derivative according to 1. 5. The interlo according to claim 2, wherein position 141 is Cys.
Ikin-1α derivative. 6. Formula 2 In the amino acid sequence of interleukin-1α represented by
In this, it was modified by replacing Asn at position 36 with another amino acid.
Encoding the amino acid sequence, and Asn 36 and 1
Modified by substituting Cys at position 41 with another amino acid
Has the characteristics selected from encoding the amino acid sequence
Host cells with interleukin-1α derivative gene
Transform, cultivate the transformant, and produce
I obtained by recovering the leukin-1α derivative
Interleukin-1α derivatives . 7. Asn at position 36 is Asp and position 141 at Cys is Ser
In which the altered amino acid sequence is replaced
Claims obtained using a tarleukin-1α derivative gene
Item 7. The interleukin-1α derivative according to item 6 . 8. Formula 3 In At a amino acid sequence of interleukin -1α represented, modified to replace the 36-position Asn with another amino acid
Encoding the amino acid sequence , and Asn 36 and 1
The # 41 Cys are each modified was replaced with another amino acid
Has the characteristics selected from encoding the amino acid sequence
A method for producing an interleukin-1α derivative, comprising transforming a host cell with an interleukin-1α derivative gene, culturing the transformant, and collecting the produced interleukin-1α derivative. 9.36 position Asn is by Asp, inn position 141 Cys encodes an amino acid sequence modified are location <br/> conversion respectively Ser
The method for producing an interleukin-1α derivative according to claim 6 , wherein the gene for a tarleukin-1α derivative is used.