JPH0559701B2 - - Google Patents

Description

[Detailed description of the invention]

BACKGROUND OF THE INVENTION The present invention relates to a method for producing human lysozyme by genetic engineering using a chemically synthesized human lysozyme gene. Human lysozyme is present in human tears, saliva, nasal mucus,
Breasts, lymph glands, white blood cells, plasma, cartilage, lungs, kidneys,
It is an enzyme protein found in the spleen, liver, intestinal tract, parotid gland, skin, semen, urine of leukemia patients, etc.
It is known to have enzymatic activity as muramidase that hydrolyzes the β-1,4 bond between N-acetylglycosamine and N-acetylmuramic acid. It is also known that lysozyme derived from human milk consists of 130 amino acids shown in the sequence below (see, for example, Funatsu et al., "Lytic Enzyme", pp. 55-58, Kodansha Scientific (1977)).

【table】

[Table] Lysozyme has the effect of dissolving various bacteria, so it is used as a preservative for foods and medicines.
Lysozyme can be used alone or in combination with antibiotics as an antibacterial agent. It also has blood coagulation and hemostasis effects, anti-inflammatory effects, and sputum expulsion effects for people with respiratory diseases, so it can be used as a pharmaceutical for those patients. Human lysozyme can be isolated from human milk, urine, etc., but it is inefficient and impractical to meet the demands of industrial production for medical purposes. The present invention makes it possible to produce pure human lysozyme in large quantities at low cost using recombinant DNA technology. Recombinant using synthetic human lysozyme gene
The method for producing human lysozyme using DNA technology will be described in more detail later, but basically consists of the following steps. (1) Gene design (2) Chemical synthesis of the gene (3) Integration of the gene into an appropriate expression vector (4) Transformation of an appropriate host using the obtained recombinant plasmid (5) Transformation of the transformant Production and recovery of human lysozyme by culture In gene design, the nucleotide sequence of the corresponding gene (hereinafter referred to as the structural gene in the text) is determined from the amino acid sequence of human lysozyme.
For most amino acids, the corresponding genetic code (codon) is 2.
Since there are more than 130 amino acids, it is possible to consider an extremely large number of nucleotide sequences for a sequence consisting of 130 amino acids. Criteria for determining a desirable sequence from this large number of possibilities include, for example, codons that are frequently used in the host cell to be used, and structural genes. Appropriate restriction enzyme recognition sites are provided at both ends and inside the containing sequence to facilitate insertion into the plasmid and analysis, and to facilitate the assembly and ligation of gene fragments during the chemical synthesis process. The first step is to select codons to minimize unnecessary interactions between each component fragment, but these conditions may conflict, and it is necessary to arrive at the desired sequence by reasoning based on obvious logic. Rather than being able to
Various experimental verifications including trial and error are required. Now, once a desired structural gene has been designed and synthesized, there are two main methods for expressing it in host cells, which will be referred to as chimera expression method and direct expression method in this text. The chimera expression method here refers to creating a gene (called a chimera gene) by connecting the desired gene to the endogenous gene of the host (gene originally present in the host's wild strain), and There is a method of inserting a gene into an appropriate vector and then transforming the host for expression.The expressed product is produced in the form of a fusion of the corresponding endogenous polypeptide and the polypeptide encoded by the desired gene. (This is called a chimeric polypeptide). The chimera expression method uses the endogenous gene expression mechanism, so it is often possible to express a foreign gene relatively easily, but in order to isolate only the desired polypeptide, it is necessary to use a chimera polypeptide. It has the disadvantage that it requires chemical and enzymatic treatment to specifically cut out and purify the desired polypeptide, making the manufacturing process longer and more complicated. On the other hand, there is another expression method, the direct expression method.
Translation initiation signal (usually ATG) for the desired structural gene
A recombinant plasmid is created by inserting the resulting sequence into the appropriate position of the region controlling transcription and translation of the expression vector, and then the recombinant plasmid is used to transform and express the expression vector. Since the foreign polypeptide is produced as a single completed molecule, the production process is simpler and more practical than the chimera expression method. However, in the case of the direct expression method, in order to express the foreign gene efficiently, it is necessary to place the foreign gene at an appropriate position in the region that controls transcription and translation (hereinafter referred to as the 5' untranslated region) within the expression vector. However, the desired chemical structure (i.e., nucleotide sequence) of this untranslated region at the 5′ end not only differs greatly depending on the host cell such as E. coli and yeast, but also between the same host cell. It is becoming known that the structure of the untranslated region differs depending on the given structural gene, and it is difficult to predict the desired structure of the untranslated region for a given structural gene. This is accompanied by the difficulty of having to deeply investigate the structure. Furthermore, when direct expression is used to produce human lysozyme, which is originally a lytic enzyme, in microorganisms, it is possible that the recombinant may be lysed by the expressed human lysozyme. It was a place where there was a gap between concepts. Under these circumstances, the present inventors have made detailed improvements to the structural gene design, the untranslated region at the 5' end, host cells and their culture methods, etc., with the aim of producing human lysozyme by direct expression. As a result of repeated research, it was confirmed that human lysozyme can be directly expressed at high levels by using the human lysozyme gene, which is the compound of the present invention, and the present invention was completed. Structure of the Invention 1 Obtaining the Gene The human lysozyme gene of the present invention is obtained by a commonly used nucleotide synthesis method. Although various conditions may be considered depending on the host cell, the most commonly used E. coli (E.
coli) case is as follows. (1) Gene design Structural gene DNA is synthesized by selecting codons that meet the following conditions from among several codons that specify the amino acids that make up human lysozyme. (A) A region rich in G-C base pairs followed by A-T
Avoid consecutive regions rich in base pairs. (B) Ensure that each of the synthetic fragments described below does not have any undesired complementary sequences within or between molecules. In addition, in order to initiate and terminate translation, a translation initiation signal is added to the 5' end of the structural gene, and a translation termination signal is added to the 3' end. 5′ end untranslated region containing ribosome binding site (hereinafter referred to as SD sequence)
Synthesize the DNA of the 5' untranslated region containing the following conditions. (A) At an appropriate distance from the promoter
Make sure the SD array is placed. (B) The synthetic SD sequence has a nucleotide sequence that has a common base sequence with the naturally occurring SD sequence and has an appropriate length. (C) Place the translation initiation signal at an appropriate distance from the SD sequence. Entire gene The human lysozyme gene consists of a 5′ untranslated region containing the SD sequence and a structural gene containing translation initiation and termination signals. 'Have restriction enzyme recognition sequences at both ends. (B) One or more restriction enzyme recognition sequences are included in the gene to facilitate the search for transformants. (C) In order to make it possible to use only the structural gene portion starting from the translation start signal, a restriction enzyme recognition sequence is provided so that the gene can be cut just before the translation start signal. This is desirable. A specific example of a structural gene designed in this manner is a gene represented by the following nucleotide sequence formula (1), which can be expressed in E. coli by incorporating the gene into an appropriate expression vector. Nucleotide sequence formula (1)

【table】

[Table] The nucleotide sequence of the untranslated region at the 5' end containing the ribosome binding site and the restriction enzyme recognition sequence at the 3' end containing the translation termination signal were added to the structural gene represented by the above nucleotide sequence formula (1). An example is the gene represented by the nucleotide sequence formula (2) below, which contains a translation start signal, a translation stop signal, and an SD sequence within itself, making it an expression vector that can be used in E. coli. There are fewer restrictions. The same gene can also be used, for example, in Cla
It is also possible to insert the vector into an appropriate expression vector by treating it with an appropriate restriction enzyme such as (see Table 1 below). Nucleotide sequence formula (2)

【table】

【table】

[Table] (2) Gene synthesis To synthesize the gene designed as above,
A method may be used in which both the + and - chains are divided into several fragments, which are chemically synthesized, and the respective fragments are linked. Each strand consists of 11 to 19 bases and is preferably divided into about 56 fragments, each of which overlaps by at least 6 bases. Fragment synthesis, purification, 5'-hydroxyl group phosphorylation, and fragment ligation can be performed according to methods known per se. For specific details, please refer to Examples below. 2. Preparation of recombinant plasmid (1) Introduction of the human lysozyme gene into a plasmid vector The human lysozyme gene synthesized as described above is transferred into a plasmid vector that can be propagated in the host or in a manner that can be propagated and expressed in the host. into the appropriate insertion site of a plasmid vector constructed as follows. The incorporation operation itself can be carried out according to conventional methods known in the field of molecular biology. For specific methods, please refer to Examples below. The propagation of the human lysozyme gene according to the present invention is carried out using pBR322, pAT153 (e.g. Twigg et al.
This can be carried out using various known plasmid vectors such as Nature, 283 , 216-218 (1980). Furthermore, isolation and purification of plasmid DNA can be carried out according to conventional methods known in the field of molecular biology. Direct expression of human lysozyme by the gene of the present invention can be achieved by using an appropriate method depending on the host cell, but in E. coli, the lac promoter (see, for example, Fuller, Gene, 19 , 48-54 (1982)), the trp promoter ( For example, Windass et al.
Nucleic Acids Res., 10 , 6839-6657
(1982)), the tac promoter (e.g.
Boyer et al., Proc. Natl. Acad. Sci. USA. 80 , 21
~25 (1983)), P promoters (e.g.
deHaseth et al., Nucleic Acids Res., 11 ,
773-787, (1983)), the P _L promoter (e.g. Derom et al., Gene, 17 , 45-54 (1982)
) and 1pp promoter (e.g.
Nakamura et al., EMBOJ 1 771-775 (1982)
), etc.) (e.g. Nakamura, Chemistry and Biology 20 47-58 (1982) and Maniatis et al. Molecular Cloning 403-433).
(1982)). One specific example of these expression vectors is
pMY12-6 Amp-1 and pSM240. pMY12-6 Amp-1 is pMY12-6 (e.g. Tsurimoto et al., Mol. Gen. Genet. 187 79~
86 (1982)) and pBV234 (e.g. Ohtsubo
et al., Gene 20 245-254 (1982)) as follows. Cut pBV234 with Pst, take out a 2.6Kbp fragment containing part of the ampicillin resistance gene, and insert it into the Pst cutting site of pMY12-6 so that the ampicillin resistance gene is regenerated.
Obtain pMY12-6Amp. pMY12−6AmP
After limited digestion with BamH, the sticky ends were repaired using DNA polymerase (Klenow fragment) and ligated with DMA ligase, resulting in pMY12 in which only the BamH cleavage site contained in the pBV23.4-derived DNA fragment was deleted.
-6Amp-1 is obtained. pSM240 is pDR540 (e.g. Russell et al.
Gene 20 231-248 (1982)) and pIN-
−A ₁ (e.g. Masui et al., Biotechnology 2 81
~85 (1984))),
Approximately 1.2 Kbp fragment containing the tac promoter between the BamH and Pst sites of pDR540 and pIN−−
It can be constructed by ligating an approximately 6.2 Kbp fragment containing the laci gene between the BamH and Pst sites of _A1 . Specifically, please refer to Examples and Drawing 2. (2) Determination of directionality The directionality of the human lysozyme gene incorporated into the plasmid is determined by using a restriction enzyme that recognizes a specific base sequence contained within the gene (e.g.
Cla, BStE, This can be done by analysis using commonly used methods such as gel electrophoresis. 8 Transformation (1) Host bacteria A specific example of E. coli host cells to be transformed using a recombinant plasmid incorporating the human lysozyme gene is E. coli C600 (e.g.
Nelson et al. Virology 108 338-350 (1981))
It is. Transformation with a recombinant plasmid incorporating the human lysozyme gene is not limited to the above-mentioned hosts, but can be used with various known E. coli
K-12 strain derivatives (e.g. Bachmann,
Bacteriol. Rev. 36 525-557 (1972)) can be used. Many of these E. coli K-12 strain derivatives have been approved by accredited microbial institutions, such as the American
It has been deposited at the Type Culture Collection (ATCC), where it can be sold (for example, see the ATCC catalog). Furthermore, as is known in the field of molecular biology, by selecting an appropriate vector, it is possible to select an appropriate host from a wider range of bacterial species. (2) Transformation The transformation operation itself can be performed according to conventional methods known in the field of molecular biology.
(e.g. Cohen et al., Rroc. Natl. Acad. Sci. USA
69 2110-2114 (1972) and Maniatis et al.
(See Molecular Cloning 249-253 (1982)). (3) Transformants A specific example of a transformant in E. coli is E.
coli C600 to pPLHLY-1 or pTCHLY
-1, and in the present invention, they are transformed with E. coliC600.
(pPLHLY-1), E.coliC600 (pTCHLY-
1). 4. Production of human lysozyme Human lysozyme is produced by culturing the transformant thus obtained according to conventional methods known in the fields of molecular biology and fermentation science. Expression of the human lysozyme gene can be achieved using in vitro cell-free protein synthesis systems (e.g. Zubay,
Methods in Enzymology 65 856 (1980)) and the Maxicell method (e.g. Sancar et al., J.
This can be confirmed using known methods such as Mol.Biol. 148 45 (1981). Human lysozyme can be synthesized using known radioimmunoassays (e.g. Yuzuriha et al. Chem.Pharm.Bull.27).
2802-2806 (1979) and Yuzuriha et al. Chem.
Pharm. Bull. 26 908-914 (1978)), enzyme activity assays (e.g. Sidhan et al., Agric. Biol.
Chem. 45 1817-1828 (1981) and Morsky
Anal.Biochem. 128 77-85 (1983)). In addition, the produced human lysozyme can be recovered and purified by appropriately combining conventional methods known in the fields of biochemistry and fermentation. For specific details, please refer to Examples below. Example Design of human lysozyme gene A gene with the base sequence shown in Table 1 below was designed. The design procedure is as follows. (1) Codon selection Codons for the human lysozyme structural gene are selected as shown in Table 1. (2) A translation initiation codon ATG is added to the 5′ end of the structural gene, and two translation stop codons (TAA) are added to the 3′ end.
and TGA). (3) Contains a sequence corresponding to the ribosome binding site of mRNA upstream of ATG, and at the same time contains a translation initiation cocoon.
Add the sequence GTTAGGAGTTTAATCG so that the Cla recognition sequence is placed immediately before ATG. (4) A sequence corresponding to the sticky end of the BamH recognition sequence is added to the 5' end, and a sequence corresponding to the sticky end of the Sau3A recognition sequence is added to the 3' end. The gene designed as described above has Cla, Taq, Bal, Hae, Mbo inside the structural gene.
, BstE, Msp, Hinf, Alu, Hpa,
Hph, Xba, Nar, Hinc, BstN,
It contains EcoR, Bbe, Hpa, Hga and Dde recognition sequences.

【table】

【table】

[Table] Chemical synthesis of fragments The human lysozyme gene designed as described above was divided into 56 fragments shown in Table 2 and synthesized. These oligonucleotide fragments can be prepared using known methods (e.g., Itakura et al., Nucleic. Acids).
Res. 10 1755 (1982)). A commercially available polystyrene resin with a crosslinking degree of 1% into which nucleosides were introduced was used from Patchem. Completely protected dinucleotides can be prepared using commercially available Nippon Zeon Co., Yamasa Co., Ltd. or by known methods (e.g.
Gait et al., Nucleic Acids Res 9 1691 (1981)
I used one that I synthesized myself according to (see). The method for synthesizing an oligonucleotide fragment will be described below for the synthesis of pentadecanucleotide GpApTpCpCpGpTpTpApGpGpApGpTpT. 4 μmol of fully protected thymidine was added to 40 mg of polystyrene resin bound via a linker in methylene chloride:isopropanol (85:1) containing 1M zinc bromide.
15, v/v) 1 ml of the solution for 30 seconds at a time until the red color of dimethoxytrityl cation almost disappears.
The dimethoxytrityl protecting group of the 5' hydroxyl group was removed by treating from 1 to 7 times. Next, 25 mg of the completely protected dinucleotide GpTp (hereinafter abbreviated without protecting groups) was treated with 2 ml of triethylamine:pyridine (1:1, v/v) solution at room temperature for 1 hour to form a cyanoethyl 3'-terminal phosphate. After removing the group and removing water by azeotroping with pyridine,
2,4,6-trimethylbenzenesulfonyl-3
- Anhydrous pyridine in the presence of 30 mg of nitrotriazolide
It was condensed with thymidine introduced into the above polystyrene resin in 0.2 ml at 40°C for 30 minutes. After washing the resin with 2 ml of pyridine, pyridine-acetic anhydride (9:
1, v/v) solution to acetylate the 5'-hydroxyl group of unreacted thymidine. As a fully protected dinucleotide below
GpAp, ApGp, TpTp, CpGp, TpCp and
A protected pentadecamer was synthesized by sequentially using 25 mg of each GpAp and repeating dedimethoxytritylation and condensation reactions. After the final condensation, the resin was washed with 2 ml of pyridine, and then added with 1 ml of 90% pyridine water containing 0.5 M pyridine aldoxime and tetramethylguanidine at 40°C for 1 hour.
The oligomers were separated from the resin by treatment for 28 days.
By treating with 3 ml of % ammonia water at 60°C for 4 hours, a pentadecamer was obtained in which all but the dimethoxytrityl group at the 5' end were deprotected. The same pentadecamer was analyzed using high-performance liquid chromatography using a reversed-phase carrier (Cosmosil 5C18: manufactured by Hanui Chemical Co., Ltd.).
Purification was carried out by elution with a linear gradient of acetonitrile in 0.1M acetic acid-triethylamine buffer (PH6.5). After concentrating the above purified liquid to about 500μ by distillation under reduced pressure, glacial acetic acid was added to give a final concentration of 80%.
The dimethoxytrityl group was removed by treatment at room temperature for 15 minutes. This was purified by high performance liquid chromatography as described above to obtain a completely deprotected pentadecamer with 10 OD260 units. The other 55 fragments shown in Table 2 were synthesized in a similar manner.

【table】

【table】

[Table] Phosphorylation and fragment ligation reaction Table 1 shows the 56 chemically synthesized fragments mentioned above.
As shown in Figure 1, it is divided into nine blocks A to I, each block is connected, and then (A to C), (D to F)
After connecting each block of and (G to I), (A
-C), (D-F) and (G-I) blocks were ligated to synthesize the entire human lysozyme gene. 56
54 fragments excluding HLY-1 and HLY-56 at both ends of the
The hydroxyl group at the 5' end of each block was phosphorylated, followed by a ligation reaction. Details of the phosphorylation and ligation reactions for block A in Table 1 are as follows. A mixture of 2 μg of each of the 8 phosphorylated fragments (HLY-2 to HLY-9) was added.
8.4 units of _T4 polynucleotide kinase, 35pmol
[γ- ^32p ]ATP (2900Ci/mmol), 1mM spermidine, 50mM dithiothreitol (abbreviated as DTT), _100mMgCl2 , 500mMTris-HCl (PH
7.5) and in a 70μ reaction solution containing 1mM EDTA.
It was incubated at 37°C for 60 minutes. then 10 at 65℃
After incubation for a minute, the mixture was cooled on ice. Add 2μg of fragment HLY-1
Add 1MTris-Hcl (PH7.5) and 1MMgCl ₂ to 20mMTris-HCl (PH7.5) and 10mMMgCl ₂ , incubate at 65℃ for 10 minutes, and then incubate at 37℃ for 30 minutes.
The mixture was further left at room temperature (approximately 25°C) for 20 minutes. Next, ATP and DTT were added to 0.4mM and 10mM, respectively.
After incubation at 11°C for 10 minutes, 22 units of T4 ligase was added and allowed to react at 11°C for 12 hours for ligation. After the reaction was completed, phenol extraction and ethanol precipitation were performed to recover the DNA, which was dissolved in 50μ of TE buffer (10mM Tris-HCl PH7.5, 1mMEDTA) and stored at -20°C. Similarly, block B from HLY-10 to HLY-14, block C from HLY-15 to HLY-18,
Block D from HLY-19 to HLY-22, HLY
Block E from −23~HLY-26, HLY-27~
Block F from HLY-31, HLY-32 to HLY
Block G was synthesized from -38, block H from HLY-39 to HLY-47, and block H from HLY-48 to HLY-56. Half of each of the ligation reaction products of blocks A, B, and C (25μ) was mixed and recovered by ethanol precipitation, and then reacted at 11°C for 12 hours in a reaction solution with the same composition as that used for the ligation reaction of block A. Ta. The products were separated by 15% polyacrylamide gel electrophoresis to obtain the desired blocks (A to C). Similarly, block (D~
F) from blocks G to I.
was synthesized. Next, blocks (A~C), (D~F) and (G~
I) was mixed and reacted for 17 hours at 11°C in a reaction solution with the same composition as that used for the ligation reaction of block A to obtain a full-length gene. The ligation reaction mixture containing this full-length gene was used as it was in the ligation reaction with the vector. Cloning 10μg of plasmid pBR322 in 10mM Tris-HCl
(PH7.5), 50mM NaCl, 10mMgCl ₂ and 50 units of restriction enzyme BamH in a 50μ reaction solution containing 37
After incubation at ℃ for 2 hours, phenol extraction and ethanol precipitation were performed. Mix 3.5 μg of this DNA with half of the ligation reaction mixture containing the aforementioned HLY full-length gene, and add 20 mM Tris.
−HClPH7.5, _10mMgCl2 , 0.4mMATP,
The reaction was carried out at 11°C for 13 hours in a 200μ reaction solution containing 10mMDTT and 13 units of T4 DNA ligase. Next, E. coli C600 strain was transformed using this reaction solution, resulting in ampicillin resistance (40 μg/ml),
A transformant sensitive to tetracycline (10 μg/ml) was obtained. Plasmids from these transformants
After preparing the DNA and analyzing the restriction enzyme cleavage pattern, we created a recombinant plasmid (hereinafter referred to as pHLY) in which the synthetic human lysozyme gene was inserted into the BamH site of pBR322 as shown in Figure 1.
-1) was selected. Recombinant plasmid pHLY-1 was transformed into Sau 3A,
Fragments of 418 bp, 559 bp, and 205 bp were isolated by treatment with BamH/Hind and BamH/Xba and 8% polyacrylamide gel electrophoresis, respectively. Maximize each nucleotide sequence
-Gilbert method (e.g. Maxam et al., Proc. Natl.
Acad.Sci.USA 74 560 (1977)) analysis revealed that the Sau3A 418 bp fragment of pHLY-1 had the planned nucleotide sequence shown in Table 1. Preparation of expression vector pSM240 15μg of plasmid pDR540 10mM Tris-HCPH7.4, 50mMNaCl,
10mMgSO ₄ , 1mMDTT, 50 units of restriction enzyme
50μ containing BamH and 50 units of restriction enzyme Pst
After reacting for 2 hours at 37°C in the reaction solution described above, 1% agarose gel electrophoresis was performed, and a fragment of about 1.2 Kbp containing the tac promoter was recovered. 18 μg of plasmid PIN-A ₁ was treated in exactly the same manner as above to recover a fragment of approximately 6.2 Kbp containing lac. Approximately 1.2Kbp fragment containing the above tac promoter
160ng and 200ng of approximately 6.2Kbp fragment containing lac
20mM Tris−HClPH7.6, _10mMgCl2 ,
Ligation was performed at 16° C. for 15 hours in a 20μ reaction solution containing 10mMDTT, 5mMATP and 3 units of T ₄ DNA ligase. Next, E. coli strain 294 was transformed using this reaction solution to obtain a transformant resistant to ampicillin (50 g/ml). Plasmid DNA was prepared from these transformants, and the restriction enzyme cleavage pattern was analyzed to select transformants containing the expression vector pSM240 as shown in FIG. 2. Creation of recombinant for expression 120 μg of plasmid pMY12-6Amp
10mM Tris−HClPH7.5, 50mMNaCl,
After incubation at 37° C. for 2 hours in a 40μ reaction solution containing 10mMgCl ₂ - and 40 units of restriction enzyme BamH, ethanol precipitation was performed. Plasmid PHHLY-1 25μg to 10mMTris-
Synthesis of 418bp was performed by incubation at 37℃ for 2 hours in a 100μ reaction solution containing HClPH7.5, 100mM NaCl, 10mMgCl ₂ and 64 units of restriction enzyme Sau3A, followed by 5% polyacrylamide gel electrophoresis.
The HLY gene was recovered. pMY12−6Amp above
-1 0.2μg and 1.1μg of HLY gene in 66mMTris
-HClPH7.5, _10mMgCl2 , 10mMDTT,
Contains 3mMATP and 1.5 units of T4 DNA ligase
The reaction was carried out in a 20μ reaction solution at 15°C for 14 hours. Next, E. coli C600 strain was transformed using this reaction solution to obtain ampicillin-resistant (80 μg/mg) transformants. Plasmid DNA was prepared from these transformants, and the restriction enzyme cleavage pattern was analyzed to create a recombinant plasmid pPLHLY- as shown in Figure 3.
Transformants containing 1 were selected. This transformant was transformed into E.coliC600 (PLHLY-1).
was named. Using plasmid pSM240, insert the HLY gene into the BamH site in exactly the same manner as above, and create E.
coliC600 strain was transformed. Transformants containing the recombinant plasmid pTCHLY-1 as shown in FIG. 3 were selected in the same manner as above. This transformant was transformed into E.coliC600 (pTCHLY-1).
It was named. Expression of human lysozyme gene Expression of the human lysozyme gene was confirmed by the following method. (i) Method using an in vitro cell-free protein synthesis system The cell-free protein synthesis system and labeled amino acids were PROKARYOTIC DNA-DIRECTED TRANSLATION KIT and L-[ ³⁵ S]-methionine manufactured by Amersham, respectively, and the method was as described in the procedure manual. It was carried out as follows. Solution 2 7.5μ, Solution 3 3μ and L-
[ ³⁵ S]-Methionine (33 μCi) was mixed, and pMY12- as teleplate DNA was added to this mixture.
6Amp-1 ([D], [E]) or pPLHLY-1
2.5 μg of ([B], [C]) was added, and Solution 5 was added so that the total amount was 25 μg. Samples without DNA added at the same time ([F])
was also prepared as a control. Next, add 15μ of the solution and incubate at 28℃ ([C], [E]) or 42℃ ([B], [D], [F]) for 60 minutes, then add 75μ of the solution and incubate for another 5 minutes.
℃ or 42℃. After the reaction was completed, the reaction mixture was cooled on ice and mixed with a molecular weight marker ([A]) according to the method of Laemmli (Laemmli, Nature 227 680 (1970)).
15% SDS-polyacrylamide gel electrophoresis and autoradiography were performed, and the results are shown in Figure 4. As shown in Figure 4, only when pPLHLY-1 was used as the template DNA, a protein band of approximately 14.7 K Daltons, which is considered to be the human lysozyme gene product, was detected. Furthermore, the intensity of this band was significantly increased when the reaction was performed at 42°C compared to when the reaction was performed at 28°C, and it was considered to be a product under the control of the temperature-inducible PL promoter. (ii) Maxicell method Transformation of E. coli CSR603 strain was performed according to a known conventional method (Horiuchi, Cell Engineering 2 832 (1988)), and the transformant was cultured at 30°C. E.coliCSR603 (pMY12-6Amp-1) ([A],
[B]) and E.coliCSR603 (pPLHLY-1)
([C], [D]) were cultured overnight at 28°C in 5 ml of K medium containing 60 μg/ml ampicillin (M9 medium containing 1% casamino acid and 0.1 μg/ml thiamine). This culture solution was added to 50 ml of K medium and cultured at 28°C to grow to OD ₆₆₀ =0.2. 20 of each culture
Transfer ml each to two sterilized petri dishes, and while gently stirring, place at a distance of 70 cm directly under an ultraviolet lamp (Toshiba 15W) for 7 seconds ([B], [D]) or 15 seconds ([A], [C]). ) irradiated. After irradiation, the culture solution was transferred to a 200 ml Erlenmeyer flask and cultured at 28°C for 2 hours. cycloserine
The cells were added to a concentration of 100 μg/ml and cultured at 28° C. for 15 hours, followed by centrifugation at 2500 rpm for 10 minutes to collect the bacteria. The bacterial cells were washed twice with 5 ml of Hershey salt, suspended in 5 ml of Hershey medium, and cultured at 28°C for 1 hour. Add L-[ ³⁵ S]-methionine to 50 μCi/ml and incubate at 42°C for 1 hour, then at 15 Krpm, 10
Bacteria were collected by centrifugation for 1 minute. This was subjected to 15% SDS-polyacrylamide gel electrophoresis and autoradiography together with a molecular weight marker ([E]) according to the method of Laemmli, and the results are shown in Figure 5. As shown in Figure 5, E.coli CSR603
A protein band of approximately 14.7 K daltons, which is considered to be a human lysozyme gene product, was detected only in (pPLHLY-1).

[Brief explanation of drawings]

Figure 1 is a diagram showing the cloning of a synthetic human lysozyme gene. Figure 2 is the expression vector
FIG. 3 is a diagram showing a method for creating pSM240. Figure 3 shows the expression recombinant plasmid pPLHLY-1 and
It is a figure showing the production method of pTCHLY-1. Figures 4 and 5 are electrophoretic diagrams showing the expression of the human lysozyme gene.

Claims (1)

[Scope of Claims] 1. An appropriate insertion site of a plasmid vector that can be propagated in the intended host cell and that enables transcription and translation of the inserted gene is represented by the following nucleotide sequence, which is chemically synthesized. A recombinant plasmid that can be propagated and expressed in the host cell is created by inserting the human lysozyme gene containing the structural gene, and the host cell is transformed and the resulting transformant is cultured in an appropriate medium. A method for producing human lysozyme, which comprises recovering the human lysozyme protein produced. [Table] [Table] 2. Claim 1, wherein the human lysozyme gene is a human lysozyme gene having a translation initiation signal ATG and two translation termination signals TAATGA at the 5' and 3' ends of the structural gene, respectively. The described method for producing human lysozyme. 3 The human lysozyme gene contains a sequence corresponding to the ribosome binding site upstream of the structural gene, and at the same time, a restriction enzyme Cla recognition sequence is placed immediately before the translation initiation signal, and a restriction enzyme Sau3A recognition sequence is placed at the 5' end.
GATCCGTTAGGAGTTTAATCGATG contains a translation termination signal downstream and a restriction enzyme at the 3' end.
Sequence where Sau3A recognition sequence is located
The method for producing human lysozyme according to claim 1, which is a human lysozyme gene having TAATGATC. 4. The method for producing human lysozyme according to claim 1, wherein the host cell is Esherichia coli belonging to the genus Esherichia. 5. The method for producing human lysozyme according to claim 2, wherein the host cell is Esherichia coli belonging to the genus Esherichia. 6. The method for producing human lysozyme according to claim 3, wherein the host cell is Esherichia coli belonging to the genus Esherichia. 7. The method for producing human lysozyme according to claim 6, wherein the plasmid vector is a plasmid vector containing the P _L promoter of λ phage. 8 Plasmid vector is pMY12-6Amp-1
The method for producing human lysozyme according to claim 7. 9. The method for producing human lysozyme according to claim 8, wherein the plasmid vector is pPLHLY-1. 10 Claim 6, wherein the plasmid vector is a plasmid vector containing a tac promoter
Method for producing human lysozyme as described in Section 1. 11. The method for producing human lysozyme according to claim 10, wherein the plasmid vector is pSM240. 12. The method for producing human lysozyme according to claim 11, wherein the plasmid vector is pTCHLY-1.