JPS6322190A - Production of human lysozyme by expression of its gene - Google Patents

Abstract

PURPOSE:A microorganism which contains a specific human lysozyme gene, is transformed with a recombined plasmid, which proliferates in the host cells and products human lysozyme, is cultured to produce human lysozyme. CONSTITUTION:Human lysozyme gene which has, in the 5' terminal, the DNA segments coding the ribosome-binding site, another ribosome-binding site with a sequence that does not form hydrogen bonds at the start site of human lysozyme translation and the start site of human lysozyme translation, is expressed in the secondary structure of transcript mRNA. A microorganism producing human lysozyme, which has been transformed with recombinant plasmid that contains the gene, proliferates in the host cells and expresses human lysozyme is cultured in an appropriate medium to produce human lysozyme.

Description

DETAILED DESCRIPTION OF THE INVENTION Field of Industrial Application The present invention relates to a method for producing human lysozyme using a synthetic human lysozyme gene.

Prior Art and Problems Human lysozyme is an enzyme protein found in human tears, saliva, nasal mucus, breast, lymph glands, white blood cells, etc., and it hydrolyzes the β-1,4 bond of N-acetylmuramic acid. It is known to have enzymatic activity as muramidase. It is known that human milk-derived lysozyme consists of 130 amino acids shown in the sequence below. [For example, see Funatsu et al., "Lytic Enzyme," pp. 55-58, Kodansha Ltd. (1977)] Lys Val Phe Glu Arg Cys G
lu Leu Ala Arg ThrLeu Lys
Arg Leu Gly Met Asp Gly
Tyr Arg Glylie Ser Leu Al
a Asn Trp Met Cys Leu Ala
LysTrp Glu Ser Gly Tyr A
sn Thr Arg Ala Thr AsnTyr
Asn Ala Gly Asp Arg Ser
Thr Asp Tyr Glylle Phe Gl
n Ile Asn Ser Arg Tyr Trp
Cys AsnAsp Gly Lys Thr P
ro Gly Ala Val Asn Ala Cy
sHis Leu Ser Cys Ser
Ala Leu Leu Gin Asp
Asn11e Ala Asp Ala Val A
la Cys Ala Lys Arg ValVal
Arg Asp Pro Gln Gly Ile
Arg Ala Trp ValAla Trp
Arg Asn Arg Cys Gin
Asn Arg Asp ValArg Gin
Tyr Val Gin Gly Cys Gly
Va 1 human lysozyme has the effect of dissolving various bacteria, and is used as a preservative in foods, etc., and as an antibacterial agent in medicine.
It can be used as a non-allergic anti-inflammatory drug.

Human lysozyme can be isolated from human milk, urine, etc., but it is inefficient and impractical to meet the demands of industrial production for medical purposes.

A method for producing lysozyme by recombinant DNA technology using a synthetic human lysozyme gene is already known (Japanese Patent Application Laid-open No. 61-78383, Japanese Patent Application Laid-open No. 61-7838).
7).

Problems Solved by the Invention The purpose of the present invention is to produce pure zozyme inexpensively and in large quantities using recombinant DNA technology.

The present inventors conducted various studies on the structure of metsenger RNA with the aim of increasing translation activity, and the translation initiation codon (ATG
) and the ribosome binding site (also known as the Shine-Dalgarno region) form a secondary structure shown in Figure 1 in which no hydrogen bonds are formed with complementary bases, we have found that translational activity increases significantly.

When expressing the lysozyme gene in E. coli, codons must be selected in the non-N region of the lysozyme gene so that the AUG of the corresponding metsenger RNA does not hydrogen bond with the complementary base.

From this point of view, we compared the metsenger RNA shown in Figure 1.
A double-stranded DNA with the sequence shown below corresponding to the sequence was synthesized, combined with the remaining portion of the human lysozyme gene, and when expression was attempted under the λPL promoter, a significant increase in expression was observed.

Synthetic double-stranded DNA Means for solving the problem of ribosome binding site The present invention solves the problem of ribosome binding site (Shine-Dalgarno region) and translation initiation site in the secondary structure of transcript mRNA, which does not form hydrogen bonds with complementary bases. A DNA fragment that encodes the human lysozyme mRNA sequence that takes the structure, a human lysozyme gene with this DNA fragment attached to its 5' end, and a human lysozyme gene that has this DNA fragment at its 5' end and allows human lysozyme to be transferred into host cells. recombinant plasmid, expressed in
The present invention provides a microorganism that carries this recombinant plasmid and produces human lysozyme, and a method for producing human lysozyme, which is characterized by culturing this microorganism in an appropriate medium.

In the secondary structure of the transcript mRNA provided by the present invention, the ribosome binding site (Shine-Dalgarno region) and translation initiation site are DNA fragments that provide an mRNA sequence in which the structure does not form hydrogen bonds with complementary bases. As a specific example, DNA having the following sequence can be mentioned.

5゛end CGTAAGTCAGTGAAAAAAACTTAG
GAGGGTTTTTAAATGAA3' is more preferable, 5' end CGTAAGTCAGTGAAAAAAACTTAG
GAGGGTTTTTAAATGAAAGTTTTCG
The 3' end of AACGTT can be mentioned.

The above double-stranded DNA having such a sequence can be synthesized as follows.

First, oligodeoxyribonucleotides named Cl-1 to Cl-4 are chemically synthesized as shown below.

Cll-1: 5' GATCCTAACGTAAGT
CAGTGAAAAAC3' Cll-2: 3' GATTGCATTCAGTC
ACTTTTTGAATCCTC5” CIT-3: 5°TTAGGAGGGTTTTTAA
ATGAAAGTTTTT 3' Cn-4: 3” CCAAAAAATTTACTTTTC
Methods for synthesizing each fragment of AAAAGC5' include a diester method, a triester method, and a phosphite method, and a solid phase method and a liquid phase method.

The synthesis of oligodeoxyribonucleotides named Cll-1 to Cll-4 was performed using a Model 380 DNA synthesizer [Applied Biosystems (Applied B) using the solid phase phosphaamidide method.
iosystems).

During the deprotection operation, chemically synthesized oligonucleotides can be separated and purified from other unreacted mixtures by high performance liquid chromatography (HPLC) using a reverse phase partition column using a stable lipophilic protecting group. Next, by removing the protective group and purifying it, the desired oligonucleotide can be obtained. The 5” side of the obtained Cn-2, CI[-3 fragments was phosphorylated using T4 polynucleotide kinase, and Cll-1, Cll-4 and T4D were phosphorylated using T4 polynucleotide kinase.
After binding with NA ligase, it was phosphorylated again using T4 polynucleotide kinase, and 5au was added to the 5° side shown above.
A double-stranded fragment having 3AI sites and a Taql site on the 3' side is synthesized.

The recombinant plasmid of the present invention can be constructed by ligating the DNA fragment thus obtained with the remaining portion of the human lysozyme gene and inserting it into an expression plasmid vector.

The human lysozyme gene used here is, for example,
JP 61-78383 or JP 61-7838
It can be synthesized by the method described in 7. In addition, as an expression plasmid vector, for example, pMYl2-6A
mp-1 can be used.

pMYl 2-6A2-6A is pMYl2-6 (e.g. Tsurimoto et al., Mo1. Gen.

Genet, 187 79-86 (1982)) and pBV234 (e.g. Ohtsubo et al., Gene
20 245-254 (1982)) as follows.

pBV234 was cut with PStl and a fragment of approximately 2.6 Kbp containing part of the ampicillin resistance gene was extracted, and pM
The ampicillin resistance gene is inserted into the Pstl cleavage site of Yl2-6 so as to be regenerated to obtain pMYl2 6Amp. After limited digestion of pMYl2-6Amp with BamHI, its sticky ends were repaired using DNA polymerase (Klenow fragment) and ligated with DNA ligase.
BamH1 contained in the DNA fragment derived from pBV234
pMYl2-6Amp-1 in which only the cleavage site has been deleted is obtained.

The following method can be mentioned as a specific example of recombinant plasmid construction of the present invention (the outline is shown in Fig. 2).
.

Recombinant plasmid pPL containing human lysozyme gene
HLY-1 (JP-A-61-78383, JP-A-6L-7
8387) with the restriction enzyme Taql, the obtained fragment containing the human lysozyme gene was isolated by a conventional method, the synthetic DNA shown above was ligated with T4 DNA ligase, the obtained fragment was digested with 5au3AI, mRNA obtained by transcription upstream of the 5° side of the human lysozyme gene
A synthetic fragment is constructed in which the translation initiation site and the Shine-Dalgarno region (SD region) are designed so that they do not form hydrogen bonds with complementary bases in the secondary structure.

Next, the DNA fragment obtained above is inserted into a suitable expression plasmid, such as pMYl2-6Amp-1 described above. An outline of a specific example is shown in FIG. In this case, about 4 ml containing the above-mentioned human lysozyme gene fragment
A 40 base fragment is separated by 5% polyacrylamide gel electrophoresis and inserted into the BamHI site of pMYl2-6Amp-1. The microorganism of the present invention that produces human lysozyme can be obtained by introducing the plasmid thus obtained into a suitable host such as Escherichia coli (eg, strain 294).

By culturing the transformant thus obtained in an appropriate medium, human lysozyme, which is the object of the present invention, can be efficiently produced.

The present invention will be explained in more detail with reference to Examples below.
The invention is not limited only to the following examples, but can be modified as usual in the technical field of the invention.

Example 1, Synthesis of DNA Fragments Fragments Cll-1 to Cn designed as shown above
-4 fragment using a Model 380 DNA synthesizer using the solid-phase phosphaamidide method [Applied Biosystems
Systems).

Nucleoside-loaded silica resin and four fully protected diisopropylphosphoramidites are commercially available from Applied Biosystems.
Stems) was used.

Details of the synthesis method are as follows.

Silica resin incorporating fully protected nucleosides (1
) The dimethoxytrityl (hereinafter referred to as D M T r ) protecting group at the 5′-position hydroxyl group was removed by treating the column with a dichloromethane solution containing trichloroacetic acid for 2 minutes at room temperature,
A silica resin (II) into which nucleosides were introduced was obtained.

Next, the fully protected diisopropylphosphoramidide (II[) was condensed for 3 minutes at room temperature in acetonitrile in the presence of tetrazole.

(I), (I[) and (III) are as follows.

0COCHZCHZCONHCHICHZCH2PP Nijirika Jugetsu 1. B=Abz, Gibu, Cbz, T(1
) = R1 dimethoxytrityl group (n) = R1: H (I[I3 B = Abz, Gibu, Cbz, T dimethylaminopyridine, silica resin ( The 5° hydroxyl group of II) was acetylated and oxidized for 1 minute with iodine in tetrahydrofuran containing lutidine and water to obtain a pentavalent phosphoric acid triester. A protected oligonucleotide fragment was synthesized by repeating dimethoxytritylation, condensation reaction, acetylation, and oxidation reaction. After the final condensation, the resin was treated with a dioxane solution of thiophenol containing triethylamine for 50 minutes to remove the phosphorus protecting group. The oligomer was removed from the resin by treatment with 309≦ammonia water for 1 hour.The recovered AIJ letmer was treated with 10 ml of 30% ammonia water at 55-60°C for 5 hours to deprotect the amino group of the base. , oligomers with dimethoxytrityl groups were eluted with a linear concentration gradient of acetonitrile in 0.1 molar triethylamine acetate buffer (pH 7,0) using a reversed-phase carrier (μm Bondapak C1B, manufactured by Waters) by high-performance liquid chromatography. The dimethoxytrityl group was then removed by treatment with 1 mJ of 80% acetic acid at room temperature for 20 minutes. The deprotected oligomer was purified by high performance liquid chromatography using a reversed phase carrier (YMC-pack AM-324).
Kurita Kogyo Co., Ltd.) was used for elution with a linear concentration gradient of acetonitrile in 0.1 molar triethylamine acetate buffer (pH 7°0).
DEAE-23W (manufactured by Toyo Soda Co., Ltd.) was used to purify Cn-1 to
C11-4 each 3.9.4.6.2.4.2.60
Obtained 260 units of D.

■ Human lysozyme expression plasmid p PLHLY
Construction of the above four synthetic oligonucleotides (CIf-1 to C
n-4) was annealed and then cloned.

First, 10 each of Cn-2 and Cn-3 fragments, 66 ljg
mM Tris-HCl (pH 7,5), 10 mM g C
II2.10 containing 1mM ATP, 1mM spermidine, 55 units T4 polynucleotide kinase (Takara Shuzo)
The mixture was reacted with 0 μl reaction solution at 37° C. for 1 hour to phosphorylate the 5° end.

After the reaction solution was extracted with a phenol:chloroform mixture, DNA was recovered by ethanol precipitation. This C■-2, C1
5 μg of 1-3 fragment and 4 pg of untreated Cll-1, Cm-4 fragment were mixed in 66 mM 1-Lis hydrochloric acid (pH 7.5), 1
0mM MgCf2.1mMATP.

200μ containing 1mM spermidine and 17B0 units of T4 ligase (Takara Shuzo)! The reaction was carried out in the reaction solution at 16°C overnight. The combined product of cm-t to Cm-4 fragments produced by the reaction was extracted with a mixture of phenol and chloroform, and then recovered as approximately 10 μg of purified DNA fragments by ethanol precipitation.

Next, in order to link this fragment to the human lysozyme gene, the following steps were performed.

Consensus SD? The 418 bp human lysozyme gene having the +i region was transferred to the above expression vector pMY1 for E. coli.
pPLHLY-1 incorporated into 2-6A2-6A (JP-A-61-'78383, or JP-A-61-78387)
220μg of 10mM
) Liss hydrochloric acid (pH 7,5), 10mM MgCl,
In the presence of 2,50mM NaCl, 1mM DTT, 640 units of restriction enzyme Taql was added and incubated in 800μl at 65°C for 1 hour.
The fragments of 662 tl) produced by the reaction were separated by 5% polyacrylamide gel electrophoresis, the gel containing the bound substance was cut out, the bound substance was electrophoretically eluted, concentrated with butanol, and extracted with a phenol:chloroform mixture. Thereafter, about 10 μg of DNA was recovered by ethanol precipitation. 6. Add 1 μg of this DNA and 2.5 μg of any Cll-1 to C1-4 conjugate to 66 mM) lithium-hydrochloric acid (pH 7.5).
6mMMgCj! , °, 10mM DTT, 1mM ATP
, in the presence of 350 units of T4 DNA ligase in a 30 μl reaction solution at 16° C. overnight.

The conjugate generated in this reaction was dissolved in 10mM Tris-HCl (pH 7).
,5) ,50mM NaCl,10m,MMg(1!,
, 1mM DTT, and 30 units of restriction enzyme 5au3AI in the presence of 4Ottl at 37°C for 20 hours and cleaved. After extracting the reaction solution with a mixture of phenol and chloroform,
DNA was recovered by ethanol precipitation. 20μ of this fragment
The mixture was reacted with 5.5 units of T4 polynucleotide kinase at 37° C. for 1 hour under the conditions described above to phosphorylate all 5′ ends. This 439 bp was separated and recovered by 5% polyacryamide gel electrophoresis. The entire human lysozyme gene, including the synthetic oligonucleotides mentioned above, is present in this fragment. This DNA fragment is inserted into the expression vector f) MY12 6Amp-1 for E. coli to create a plasmid pPLHLY-2 to express human lysozyme in E. coli.
was built.

First, pMYl 2-6A2-6A was mixed with 50mM) lithium-hydrochloric acid (pH 7.5), 100mM NaCl, 10mMg
cJ2.1mM DTT, 60 units of restriction enzyme BamHI
In the presence of, 60pl! The mixture was reacted for 12 hours at 37°C. After collecting DNA by ethanol precipitation, 10 μl in 60 μl
65 with 2 units of bacterial alkaline phosphatase in the presence of 1 mM EDTA)
The mixture was treated at °C for 11 hours to remove the 5' terminal phosphoric acid group.

Thereafter, after extraction with phenol and a phenol:chloroform mixture, DNA was recovered by ethanol precipitation.

0.1 μg of this vector and which 439M fragment are 20
The reaction was carried out overnight at 16°C with a reaction solution containing 350 units of T4 DNA ligase in μl. This reaction solution was used to transform E. coli strain 294 which had been treated with calcium.

Ampicillin-resistant bacteria were cultured on agar medium containing 50 mg/l ampicillin (Log/j! Polypeptone, 5 g/l yeast extract, 5 g/II.

Selected on NaCl, 1,5% agar). Plasmid DNA was extracted from the resulting colonies by the alkaline method (Molec
ular Cloning (19B2) CtlS)
After extraction and purification by E. coli 294 (pPLl (L
Y-2) strain was adjusted.

This Escherichia coli 294 (pPLHLY-2) was deposited with the Institute of Microbial Technology, Agency of Industrial Science and Technology (Huikou Research Institute Bacteria Deposit No. 884).
No. 2).

On the other hand, a recombinant plasmid pP was constructed by inserting the human lysozyme gene having a consensus SD region into the 13-mHI site of pMY12-6Amp-1 using the same operation.
Similarly, LHLY-1 was introduced into E. coli 294 and E. coli 29
4 (pPLHLY-1) strain was prepared. After culturing each of these transformants, the collected cells were subjected to radioimmunoassay using Western blotting to +2J
- Quantified by protein-A.

E. coli 294 (pPLHLY-2) strain and E. coli 29
4 (pPLHLY-1) strain in 100ml 1L medium (10
G/A polypeptone, 5 g/l yeast extract, 5 g/l N a C1, 50 mg/l ampicillin) was cultured with shaking at 30°C, and 1.5 g/l was added every 2 hours from the time when an OD of 6°, 0.2 was reached. 5 ml culture fluid was sampled.

The collected bacterial cells were quantified by the following method. First, culture solution 1
．． 5 ml of bacterial cells were incubated with three different amounts of standard lysozyme using the Laemmli method (Laemmli method).
, Nature227.680 (1970
)) 1/10 volumes were separated by 15% 5DS-polyacrylamide gel electrophoresis.

Next, transfer buffer (25mM), 19
2mM glycine, pH 8, 3, 15% Me○H, 0, 1
Proteins in the gel were transferred to a nitrocellulose membrane (%5DS).
(S&5BA85) (4°C,
30V, 12L? while). Nitrocellulose membrane is
After reacting for 1 hour at 37°C in PBS buffer (phosphate buffer solution) containing 2% BSA (bovine serum albumin) and blocking the part where protein was not adsorbed, 0.05% T was added.
Ween20 and lysozyme antibody (Midori Juji) were added and reacted at 37°C for 3 hours. PBST (0,05%Tw
After washing with PBS containing een20), TBST containing 2% BSA (50mM) Lisbanfuy-pH8,0,0
, 9% NaCl, 0,05% Tween 20), 1'
I-Protin A 10μC1 (manufactured by Amarjam) and 3
The reaction was carried out at 7°C for 70 minutes.

After washing with TBST, autoradiography was performed14
．． The band corresponding to Dalton 7 was cut out and the amount of radioactivity was measured using a T-counter.

Escherichia coli-derived lysozyme was quantified based on a calibration curve prepared using three different amounts of standard lysozyme. Figure 3 shows the quantification of lysozyme in E. coli over time using this method. In the case of pPLHLY-1, an expression level of 35 g/ml culture was observed after 6 hours, whereas in the case of pPLHLY-2, an expression level of up to 68 μg/ml culture was observed after 8 hours.

Effects of the Invention As shown in Figure 5, pPLHLY-2 and pPLHLY-1 differ only in the base sequence from the SD sequence to the ATG codon of the human lysozyme gene, so the expression of human lysozyme depends on the region derived from this synthetic NA. It is clear that

[Brief explanation of drawings]

FIG. 1 is a diagram showing the ribosome binding site and translation initiation site of human lysozyme mRNA obtained by transcription of the human lysozyme gene from a plasmid containing the synthetic NA fragment of the present invention. FIG. 2 is a diagram schematically showing the recombinant plasmid pPLHLY-2 of the present invention containing the human lysozyme gene and its construction. FIG. 3 is a diagram showing the amount of human lysozyme expressed by E. coli 294 (pPL'HLY-2) and E. coli 294 (pPLHLY-1) strains. FIG. 4 is a diagram comparing the structures of pPLHLY-2 and pPLHLY-1. Complete diagram 1 U-A-G-U-U-U-U-C-O-A-A-C-G-U ``'UA-UGUGAA'' Figure 3 Expression time of human lysozyme

Claims (20)

[Claims] (1) In the secondary structure of the transcript mRNA, the 5' end has a DNA fragment encoding the ribosome binding site and human lysozyme translation initiation site in a sequence in which the ribosome binding site and human lysozyme translation initiation site do not form hydrogen bonds. human lysozyme gene (2) The human lysozyme gene according to claim 1, in which the DNA fragment encoding the ribosome binding site and human lysozyme translation initiation site has the following base sequence: [There is a gene sequence] (In the above DNA sequence, The underlined ATG represents the translation initiation codon, and the region downstream from this codon represents a part of the DNA sequence encoding human lysozyme. The underlined AGGAGG represents the ribosome binding site) (3) The human lysozyme gene according to claim 2, wherein the DNA fragment has the following base sequence: [There is a gene sequence] (In the above DNA sequence, the underlined ATG represents the translation start codon. , downstream of the codon represents a part of the DNA sequence encoding human lysozyme) (4) [There is a gene sequence] DNA base sequence represented by (5) [There is a gene sequence] DNA base sequence represented by (6) DNA specified by the following DNA sequence: [There is a gene sequence] (7) In the secondary structure of the transcript mRNA, the 5' end has a DNA fragment encoding the ribosome binding site and human lysozyme translation initiation site in a sequence in which the ribosome binding site and the human lysozyme translation initiation site do not form hydrogen bonds. A recombinant plasmid containing the human lysozyme gene that grows in host cells and expresses human lysozyme. (8) The plasmid according to claim 7, wherein the DNA fragment encoding the ribosome binding site and the human lysozyme translation initiation site has the following base sequence: [There is a gene sequence] (In the above DNA sequence, the underlined The attached ATG represents the translation initiation codon, and the region downstream from this codon represents a part of the DNA sequence encoding human lysozyme) (9) The plasmid according to claim 8, wherein the DNA fragment has the following base sequence [contains a gene sequence] (In the above DNA sequence, the underlined ATG represents a translation initiation codon; The downstream part represents part of the DNA sequence encoding human lysozyme) (10) The plasmid according to claim 7 which is pPLHLY-2 (11) In the secondary structure of the transcript mRNA, the DNA fragment encoding the ribosome binding site and human lysozyme translation initiation site in a sequence in which the ribosome binding site and the translation initiation site of human lysozyme do not form hydrogen bonds is
A microorganism that produces human lysozyme by being transformed with a recombinant plasmid that contains the human lysozyme gene at the end, grows in host cells, and expresses human lysozyme. (12) Escherichia coli (E
．． The microorganism according to claim 11, which is (13) The microorganism according to claim 11 or 12, wherein the DNA fragment encoding the ribosome binding site and human lysozyme translation initiation site has the following base sequence [there is a gene sequence] (in the above DNA sequence) , the underlined ATG represents the translation initiation codon, and the region downstream from this codon represents a part of the DNA sequence encoding human lysozyme) (14) The microorganism according to claim 11 or 12, wherein the DNA fragment has the following base sequence: [There is a gene sequence] (In the above DNA sequence, the underlined ATG is a translation initiation codon. and the downstream part of the codon represents a part of the DNA sequence encoding human lysozyme) (15) The microorganism according to claim 11, which is Escherichia coli 294 (pPLHLY-2) strain. (16) In the secondary structure of the transcript mRNA, the DNA fragment encoding the ribosome binding site and the translation initiation site of human lysozyme is a sequence in which the ribosome binding site and the translation initiation site of human lysozyme do not form hydrogen bonds.
A method for producing human lysozyme, which comprises culturing in a suitable medium a microorganism that is transformed with a recombinant plasmid that contains the human lysozyme gene at the end and that is transformed with a recombinant plasmid that expresses human lysozyme in a host cell. (17) The production method according to claim 16, wherein the microorganism is E. coli belonging to the genus Escherichia. (18) The production method according to claim 16 or 17, wherein the DNA fragment encoding the ribosome binding site and the human lysozyme translation initiation site has the following base sequence [there is a gene sequence] (In the above DNA sequence , the underlined ATG represents the translation initiation codon, and the region downstream from this codon represents a part of the DNA sequence encoding human lysozyme) (19) The production method according to claim 16 or 17, wherein the DNA fragment has the following base sequence [there is a gene sequence] (In the above DNA sequence, the underlined ATG indicates the translation start codon. (The part downstream from the codon represents a part of the DNA sequence encoding human lysozyme) (20) The method according to claim 17, wherein the microorganism is Escherichia coli 294 (pPLHLY-2) strain.