JPH05502585A - Enhanced capture of target nucleic acids through the use of oligonucleotides covalently attached to polymers - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] Target nucleic acid detection improved by the use of oligonucleotides covalently attached to polymers capture Background of the invention 1. Technical field of invention The present invention provides for the detection of polynucleotide sequences using nucleic acid hybridization methods. Regarding the method for exiting. In particular, the present invention provides methods for targeting specific target nuclei contained in biological samples. Oligonucleotides covalently attached to the polymer to increase the rate and extent of acid capture Related to the use of cleotide. In a preferred method, the target nucleic acids in this sample are , a polynucleotide having multiple oligonucleotide sequences complementary to sequences in the target. Exposure to cleotide-capturing polymer. After capturing the target polynucleotide, this of polymers are immobilized (encapsulated) on a solid support via a ligand/receptor combination. chain).

2. Information disclosure Nucleic acid hybridization is a known and disclosed method for identifying nucleic acids. This is the way to be. Hybridization is based on base pairing of complementary nucleic acid strands . - When the terminal strand of nucleic acid is incubated in a suitable buffer, complementary base sequences The set of columns forms a stable double-stranded molecule. Whether or not such a pairing exists is well known in the industry. can be assayed by a variety of methods.

Most hybridization assays involve multiple steps, e.g. Dunn & Detailed information can be found in Hassell, Ce1l, Volume 12, pp. 23-26 (1977). It encompasses hybridization technology. Their assay is a sandwich-type It is.

Ranki et al., U.S. Patent Nos. 4,486,539 and 4,563,419 , a sandwich-type assay, first denaturing the nucleic acid; Thereafter, the end-strand nucleic acid is labeled with a nucleic acid and a radioactive isotope immobilized on a solid phase carrier. Details of assays that require a step of hybridization with a second nucleic acid identified are doing.

5 tabinsky in U.S. Pat. No. 4,751,177 (Amgen), targeting and an intermediate oligonucleotide that hybridizes to both sequences on the solid support. details on how to use the code.

U.S. Pat. No. 4,751.177 discloses a single target and solid support, respectively. details of a linker that has only complementary sequences. A similar linker is available in Europe Patent Application No. EPA 225.807. Various diagnostic tools Polymeric reagents for signal amplification in biochemistry are detailed (U.S. Pat. Nos. 4,687,732 and 4,152,411).

Summary of the invention The present invention provides a method for capturing target polynucleotides, comprising the following steps: (a) Complementarity capture covalently binding the ta target polynucleotide to the polymer contacting a polynucleotide, where the polymer is covalently attached to the capture having at least two copies of the polynucleotide); (b) If hybridization occurs between complementary polynucleotides ;and (C) sequestering the polymer on a solid surface.

Preferably, the polymer is water-soluble. Preferred water-soluble polymers include polio oxide, polyether, poly(ethyleneimine), acrylic polymer, vinyl selected from the group consisting of polyvinylpyrrolidone and polyvinylpyrrolidone. Most preferred point Limers include poly(ethyleneimine), polyallylamine and polyvinylamine. selected from the group consisting of The water-soluble polymer preferably has a molecular weight of about 600 to about 100,000 0 daltons, and most preferably about 10,000 to about 70,000 daltons. It has a molecular weight of Luton.

For solid-phase or mixed-phase nucleic acid hybridization assays, the polymer It may have a gantt attached to it. This ligand is fixed via a covalent bond. have the corresponding binding receptor bound to the phase support and therefore the above method It may further comprise attaching a water-soluble polymer to a solid support. all signa The process is detected in solution on or around the solid support. this The ligand is a polynucleotide probe, and the receptor Preferably, the polynucleotide is complementary to the polynucleotide.

The method optionally utilizes microbeads, whereby microbeads, water-soluble A ternary complex of the polynucleotide and the target polynucleotide is formed. Next, these 3 The component complex is sequestered or attached to a two-dimensional solid support. preferred microbiome beads are selected from the group consisting of magnetic beads and polystyrene/latex beads. Including things.

Further, the present invention provides a method for capturing a target polynucleotide, comprising the following steps: (a) attaching the target polynucleotide to a complementary protein that is covalently linked to the microbead; contact with a capture polynucleotide, where the microbead is covalently attached to it. (b) having at least two copies of the capture polynucleotide that are compatible; causing hybridization to occur between the complementary polynucleotides; (C) sequestering the microbeads on a solid surface; and (d) hybridization. Disclosed is a method comprising: detecting a motion.

Preferred microbeads include magnetic beads, Teflon beads, silica and polystyrene beads. selected from the group consisting of len/latex beads. This blockade is a complementary oligonuclease. The microbead preferably results from the formation of a duplex between leotides. More preferably, the particles have a particle size of about 0.5 to about 120 microns.

Disclosed herein are target polynucleotide separation polymers. this The polymer backbone has a molecular weight of about 600 to about 1000 Daltons. this molecule Preferably, the amount is about 10,000 to 70,000 Daltons. This chain is Preferably selected from the same polymers listed above, and furthermore poly(ethylene). (vinylamine), polyallyl and polyvinylamine. Delicious. The polymer backbone is shared by at least two solid support-complementary capture nucleic acids. Preferably, they are bonded. Preferred capture polynucleotides are about 15 to about 70 An oligonucleotide with an average length of one base per base.

The probes and methods of the invention can be used to detect target nucleic acids from any biological material. Although it can be used to detect bacterial and viral organisms, it has found special use in the detection of bacterial and viral organisms. It will be possible. The present invention can be used to detect one or more types of targets. preferable An embodiment is a multi-targeted dinobustinok, where the solid surface has multiple types of Used to capture the polymer that binds the target. these dinobuses Tinok has multiple independent regions to which the capture polymer can bind; to detect multiple targets, e.g. with a panel of infectious viruses or bacteria. It is designed with.

definition The term "microbead" refers to polymers containing crystals (e.g. silica) that are insoluble in water. therefore, they are separated from an aqueous solution by centrifugation (centrifugal force). Can be done. The term microbead also includes microspheres.

The term "polymer" herein refers to both water-soluble polymers and microbeads. refer to a person.

The term "polynucleotide" refers to both long and short probes; Polynucleotides are also referred to as oligonucleotides or oligos.

The term "sequestering" refers to the attachment of a capture polymer to a solid support with ligand/receptor binding. By combining, it typically refers to binding by forming a double strand of nucleic acids.

The term "solid support" refers to any surface that can be transferred from f4 to solution. and membranes, beads, microtiter wells, threads, plasti-tuxt lip or any surface to which a DNA probe can be immobilized. nothing.

drawing Figure 1 provides a picture of the target separation polymer in operation.

Figure 2 shows how high-quality polymers with and without “capture” or separation of polymers are used. Provides details of hybridization kinetics.

detailed description The present invention provides an improved method for performing nucleic acid hybridization assays. provide This improvement is useful for polymers to which multiple oligonucleotides are covalently attached. The method includes enhanced capture of target nucleic acids from solution. Regarding solid phase assays , the use of these polymers is necessary to immobilize target nucleic acids on solid supports. This dramatically reduces the time required for solid-phase support compared to assays that do not use this method. The amount of target nucleic acid immobilized on the body was increased. microbiota instead of water-soluble polymers can be substituted.

In a typical nucleic acid hybridization assay using the sandwich method, Thus, three nucleotide sequences are included in this assay. typically on a solid support The binding capture probe serves as a means to capture the target nucleic acid. commonly played The target nucleic acid present in the syneresis solution serves as the nucleic acid whose presence or absence is assayed. Third, the Use a GNAR probe. Signal probes generally contain detectable substances, e.g. It is bound to a nuclear or radioactive isotope and serves as a signal for the presence or absence of the target nucleic acid. act as a means of The capture and signal probes are complementary to different sequences of the target nucleic acid. Complement. This sandwich assay consists of three species that hybridize to each other. It occurs when nucleic acids react with each other to form a three-layered structure, where this The capture and signal probes form a sand inch surrounding this target probe. It acts as a layer to protect the body.

In the present invention, the assay can be completed without the need to introduce any different steps into the assay. In order to increase the speed of hybridization, the fourth component of 2) is introduced. This first Component 4 is a polynucleotide binding polymer. The polymer is attached to a solid support. The means for binding can be any ligand/receptor combination, but Ligonucleotide duplex formation is preferred.

The oligonucleotides covalently attached to the polymer may be the same or different from each other. be able to. The point of the oligonucleotide that binds to the polymer is one oligonucleotide. If only the oligonucleotide sequence is shown, this sequence will be used for both the target and the solid support. will be combined with The only theoretical consideration is that the amount of capture polymer utilized Amount of polymer that can be captured by oligonucleotides on solid support It is important not to exceed.

A. Polymer The polymers of the invention are free in solution, and their relative motion is important for the capture of target nucleic acids. Maximize reaction rate. Once this target is bound to a polymer, the polymer This second step of binding (usually hybridization) to a solid support is a very fast reaction. It happens at a rapid pace. If this second step involves nucleic acid hybridization, If the hybridization is Utilizing complementary oligonucleotides (16-50 base pairs) and attaching single to solid support Utilization of multiple possible sites for hybridization of polymers in Becomes large. Figure 1 illustrates how this concept works in nucleic acid hybridization. not accomplish. These chemical compositions allow this polymer to capture this capture polynucleotide. important as long as it can be retained and does not inhibit the hybridization reaction. It is not a major factor. Two types of polymers are preferably utilized: water-soluble polymers and microbeads.

L, JJ Polymer Water-soluble polymers are limited by their ability to dissolve, and in all useful concentrations It is miscible with water or buffered aqueous solution. Water-soluble polymers are homo or hetero and polymers such as polyoxides, polyethers, polyesters, etc. Allylamine, poly(ethyleneimine), acrylic polymer, vinyl polymer -, polysancharide, modified starch, methyl- and hydroxypropyl-methyl Cellulose, hydroxyethylcellulose, carboxymethylcellulose, poly Vinyl alcohol, ethylene oxide polymer groups, polypeptides, polynucleotides and polyvinylpyrrolidone, or any other water-soluble biopolymer. It will be done. Poly(ethyleneimine), polyvinylamine, polyallylamine and crosslinking Oligo- or polynucleotides are preferred. The size range of water-soluble polymers is approximately It is between 600 and 100,000 Daltons.

A preferred range is about 10.000 to about 70.000 Daltons.

Units of water-soluble polymers are generally bonded by direct polymerization process or by coupling agent bonding. are connected to each other. Direct polymerization involves the formation of useful chemical groups or main groups in adjacent units. Causes interbonding of chain components. For example, oxidation Oxidative enzymes can be used to polymerize the monomer units by crosslinking. On the other hand, two Coupling agents derived from monovalent or polyvalent organic crosslinking agents can be Combines with main chain components. In this context, the term "coupling agent" refers to refers to a cage group, and the term crosslinker refers to a linkage moiety prior to attachment.

A preferred crosslinking agent can be represented by general formula I.

A-R’-E [N □ Reactive groups A, B and E of formula I are hydrogen, carboxylic acid group, acid halide, active group, respectively. esters, mixed anhydrides, imino esters, primary amines, aldehyde groups, loacylcarbonyl group, hydrazine group, acylhydrazide group, azide group or N- selected from maleimide groups. At least two of A, B and E are other than hydrogen be. Polyvalent crosslinkers having more than three reactive groups similar to A, B and E are also included in the present invention. Included in the range. These further reactive groups are from the above definitions of A, B and E respectively. and will be chosen.

R1 of 弐I has at least 2 carbon atoms and typically no more than 10 aliphatic of carbon atoms, cycloalkane group of 5-10 carbon atoms or at least 6 It is aromatic with carbon atoms.

The choice of the reactive group of formula I depends on the chemical group or backbone of the unit in the polymer to be linked. It will depend on the choice of ingredients. Various chemical groups or main chain components correspond to It will react with the appropriate reactive group(s). Amine group is carboxylic acid group, acid halo Genides, active esters, mixed anhydrides, acylimidazoles, N-(carbonyl Will react with oxy)imide groups, iminoesters, azide or aldehyde groups cormorant. Oxidized 1,2-diol groups (dialdehydes) are primary amines, hydrazine groups, It will react with dido or acyl hydrazide groups. The carboxylic acid group is a primary amine, It will react with hydrazide, azide or acyl hydrazide groups. Mercapta carboxylic acid groups, acid halides, active esters, mixed anhydrides, and acylimides. dazole, N-(carbonyloxy)imide, alpha-heter-unsaturated will react with chthons or maleimides. Carbon-hydrogen bond is tren to azide) would react. The reaction conditions are well known and preferred examples are given below. provide. Preferred monomer units are -C)-(CH-CH2)-; (CH CH2); NHCHz CHz 1-O-(CH2)-; -C-(CHz )-; may contain monosaccharides, amino acids or combinations thereof.

2. Microbeads On the other hand, target capture polymers can be microbeads. Microbeads are spherical and Contains both spherical and non-spherical water-insoluble structures.

The microbead composition may be similar or different from the water-soluble polymer. preferred Compositions include polystyrene, polystyrene/latex, silica, magnetic, Teflon or are other types of beads that have reactive groups on their surfaces. preferred The fine size is 0.5 to 120 microns. Preferred functional groups are carboxy, thio or amine. Furthermore, a compound containing the polymer compound described in (1) above would include beads coated thereby. Magnetic beads are US patented i 4,672,040, which is incorporated herein by reference. ing.

The surface of the microbeads can be modified by choosing appropriate monomers or by using appropriate reagents. can be activated by coating the beads with any microbeads The selection of reactive groups on the surface of this microbead determines the chemistry of the units that will be linked on the surface of the microbead. It will depend on the choice of groups or backbone components.

Various chemical groups or backbone components can be reacted with the corresponding reactive group(s) of formula There will be. Amine groups are carboxylic acid groups, acid halides, active esters, unmixed hydrate, acylimidazole, N-(carbonyloxy)imide group, iminoeste will react with azide, azide, or aldehyde groups. Oxidation l.

The 2-diol group (dialdehyde) is a primary amine, hydrazine group, azide or acyl group. will react with the hydrazide group. Active carboxy groups are primary amines, hydrazide It will react with do groups, azide or acyl hydrazide groups. The mercaptan group is Rubonic acid group, acid halide, active ester, mixed anhydride, acylimidazole or will react with N-(carbonyloxy)imide. The carbon-hydrogen bond is It will react with dido and tren).

B. Assay method The main application of this invention is in nucleic acid hybridization.

-a, the hybridization method includes the following steps: a) - terminal strand target polynucleotide; A leotide sequence or a denatured double-stranded polynucleotide target is combined with an appropriate base complement. b) contacting the target with a single-ended polynucleotide probe having the same properties as the target; including detecting the resulting polynucleotide duplex formed with the probe. It consists of A particularly useful routine hybridization method is that the sample nucleic acid is in situ), the polynucleotide target or polynucleotide If any of the probes is immobilized on a polymer (solid-phase hybridization) solution hybridization), and when all polynucleotide molecules are in solution (solution hybridization). (dization).

The particular hybridization format is not critical to the invention. conventional hybrida Improvements have been made in the ization method and new methods are being developed. , they can be easily applied to the present invention.

If the chosen system involves a solid support, this solid support may be a membrane-type solid support (two-dimensional solid support). phase supports), bead-type solid supports or other solid surfaces, e.g. -Can be well.

sequestration of the polymer is limited by nucleic acid hybridization; Must not be. Any adhesive/receptor combination may be substituted. These include , antibody/antigen, hormone/receptor, streptavidin/biotin combinations etc. will be included. Regarding blockade, any Gantt/receptor combination is , the rate of this sequestration depends on the solubility of the target into the oligonucleotide attached to the polymer. It would be better as long as it was slower than the rate of liquid hybridization.

For mixed phase assays using solid supports, preferred Gant/receptor pairs The combinations are complementary oligonucleotides. In particular, oligos attached to polymers Some or all of the nucleotide sequences may be oligonucleotides covalently attached to a solid support. It is also complementary to the nucleotide sequence (see Figure 1). Therefore, this polymer A double strand is formed with both the acid and the nucleic acid on the solid support.

Based on diffusive binding, the polymer binds the target nucleic acid in solution to the solid support. Hybridizes with faster reaction rates than the hybridizing polymer do. Therefore, the first step in this method is generally to attach the oligo on the polymer construct. Hybridization or capture of the target nucleic acid to nucleotides. 2nd stage transfer of the polymer (with or without captured target nucleic acid) to the solid support; This is the translational diffusion of Upon completion of this second hybridization phenomenon, this The target-containing complex is considered to be sequestered.

The overall rate of sequestration of the target nucleic acid onto the support is greatly increased using this method.

of hybridization of the target nucleic acid to the oligonucleotide on the polymer. Rates result from approximately theoretical solution reaction rates. The reason is that the port The remer is uniformly dispersed in the solution, and this capture oligonucleotide is Because it can be present in a concentration that allows this reaction to proceed depending on the reaction rate. It is. Hybridization and sequestration of polymers on solid supports requires translational diffusion of It is preferable to stir the mixture in the same state. This polymer met a solid support et al., this blockade is very fast, and the reason is that hybridization with low sequence complexity This is because only 10% of the difference occurs between the two complementary oligonucleotides.

This polymer can be made into a single molecule or multiple molecules (different molecules) through the chemicals detailed below. covalently conjugated with any of the oligonucleotides (having a nucleobase sequence) force to start. The desired polymers have more than two attached to each polymer. They typically have 1,000 or fewer oligonucleotides. to the polymer The sequence of the bound oligonucleotide is a target nucleic acid (e.g. rRNA, RNA, It is complementary to denatured plasmid DNA, denatured DNA, etc.).

If there is more than one type of oligonucleotide on this polymer, the solid support This creates multiple attachment points with oligonucleotides on the body and even on the target. It is also possible for polymers, therefore, this conjugation is possible with a single oligonucleotide. from a target nucleic acid that is directly retained or targeted to a solid support via binding. can also be stable.

Other methods combine microbeads (water-insoluble polymers) and water-soluble polymers. Ru. When combining water-soluble polymers and beads, both are used to transfer target nucleic acids to a solid support. May serve as an intermediate in capture. Preferably, the water-soluble polymer is The target is captured in sequence and the complex is then attached to microbeads. last' Next, this ternary complex is captured by a solid support. big beads and small beads Additional combinations of seeds and polymers are also useful. Such a combination consists of three components or The four-component conjugate will be presented prior to encapsulation on a facial support.

For solid-phase hybridization, polynucleotide molecules are immobilized on a solid phase. become The polynucleotide is attached to the solid phase either covalently or non-covalently. stomach. Non-covalent supports include nitrocellulose, nylon derivatives (i.e., Nytr an(TM) and fluorinated polyhydrocarbons. Both A bound support has a structure on its surface as a site for attachment of a suitable active polynucleotide. It comprises a material that has a reactive component that can act.

The solid support can be two-dimensional, e.g. a membrane, or a three-dimensional surface, e.g. magnetic or plastic. Stick beads, or reaction vessels, such as assays. In this method, the target A polynucleotide sequence complementary to a given sequence on a target polynucleotide molecule (capture immobilize the sequence) on a solid support. This immobilized polynucleotide sequence is A labeled polynucleotide sequence (sequence) that is complementary to another sequence of the target polynucleotide molecule. contacting the target sequence in the presence of the target sequence (one-step sequence) German assay), or after capture of the target sequence, subsequent hybridization with a signal sequence. Perform hybridization (two-step sand germanization). Sandwich In performing the second cent assay, the first cent capture bead is replaced with the second cent bead, Bind the target to the wall of a membrane, dipstick or microtiter well It can be used for

C. Hybridization conditions The particular hybridization technique is not critical to the invention. hybrida The ization technology is generally Nucleic Ac1d Hybridizati on, A Practical Approach, Hames, B, D , and Higgins, S. J. W., IRL Publishing, 1985.

Improvements have been made in hybridization techniques and they are readily available. Can be used.

The specific hybridization conditions are not critical and are subject to researcher preference and needs. It can be changed depending on the need. Various hybridization solutions are available. about 20-60% by volume, preferably 40% by volume of polar organic It comprises a solvent. General hybridization solution is about 30-60v/ v% formamide, about 0.05-IM sodium chloride, about 0.01-0. 1M buffer such as sodium citrate, Tris-HCI, PIPES, HEP E.S.

EPPS, about 0.05-0.5% of detergents, such as sodium dodecyl sulfate, and and 1.10mM EDTA, 0.01-5% Ficoll (approximately 300-500 Rodalton), 0.1-5% polyvinylpyrrolidone (approx. 250-500kda) l), as well as 0.01-10% bovine serum albumin. typical hive The redization solution contains about 0.1-5 mg/mL of unlabeled carrier nucleic acid, e.g. fragmented calf thymus or salmon sperm, DNA, and/or partially fragmented yeast RNA; and optionally about 0.5-2% w/v glycine. Other additives , for example, dextran sulfate and polystyrene sulfonic acid. lume extrusion agent) may also be included.

Various degrees of hybridization intensity are available.

As conditions for hybridization become more strained, stable duplexes The degree of complementarity between probe and target for formation is greater. The degree of tension is determined by temperature , ionic strength, inclusion of polar organic solvents, etc. For example, profit The temperature used is usually in the range of about 20" to 90°C, generally in the range of 25 to 75°C. Probably. The tension of hybridization is determined by the ionic strength and concentration of formamide. Hybridization solution through operating the degree within the range of 20-50% It can also be suitably changed by changing the polarity of.

at a temperature and time appropriate for the particular hybridization solution utilized. After hybridization, the probe-target hybrid is Place the plastic or filter support into this hybridization solution. It is then introduced into a wash solution that typically contains reagents similar to those provided. this These reagents can be at similar concentrations to the hybridization medium, but more They are usually at lower concentrations if aggressive wash conditions are desired. This branch The time the support is held in the cleaning solution can vary from several minutes to several hours or longer. I can do it.

Either this hybridization or this washing medium is under tension. Can be done. After appropriate strain washing, the appropriate hybridization complexes are now labeled. can be detected according to the nature of the object.

D. Labeling and detection Various labels may be used as advantageous hybridizing porter groups derived from the present invention. work. Reporter groups, as used herein, can be measured or detected. having physical or chemical properties. Detectability is determined by color change, luminescence, fluorescence or emission. Reporter groups that act by virtue of properties such as radioactivity or as ligand recognition sites Obtained by the ability of the tap.

The probe can be used in one of several ways commonly used in the industry. can be labeled by General methods of detection 3H, ’2sl, 35S , “Cmataha’” P mark th 7” o 7” etc. This is the use of Raffy. Other reporter groups include fluorescent material, chemiluminum, Antibodies labeled with sensitizing agents and enzymes are included. On the other hand, the probe Labels, such as fluorescent substances, chemiluminescent agents, enzymes and enzyme substrates, can be directly conjugated. It can also be made into a jugate. On the other hand, these components can be combined into ligand-antiligand complexes. conjugation, e.g. conjugated to a label or via an antibody reactive with Gant. Direct coupling may also be possible. The choice of label depends on the required sensitivity, probe and depends on the ease of conjugation, stability conditions and the means utilized.

The choice of label determines how the label is incorporated into the probe. radiation activity Sex probes generally contain commercially available nucleotides containing the desired radioactive isotope. made using

This radioactive nucleotide can be used, for example, by nick translation, to The addition of a radioactive base to the 3' end of the probe by transferase results in release. in the presence of radioactive dNTPs to the Flenow fragment of DNA polymerase. Therefore, by copying the M13 plasmid with a specific insert, synthesizes RNA from a template using RNA polymerase in the presence of radioactive rNTPs. A can be integrated into the probe by transcription.

Non-isotopic probes have a signal (e.g. fluorescent, chemiluminescent or (enzyme) or by conjugation with a ligand. Can be indirectly labeled. For example, covalently attaching a ligand molecule to this probe . This ligand is then inherently detectable or a detectable signal, e.g. For example, either an enzyme or a receptor covalently bound to an optically reactive compound. – combine with molecules. A wide range of ligands and antiligands (receptors) It can be changed. If the ligand has a natural "antiligand", i.e. If the targets are, for example, biotin, thyroxine and cortisol, they cannot be labeled. It can be used in conjunction with a moistened natural resistor. On the other hand, any hubten or antigen The compounds can be used in combination with appropriately labeled antibodies.

The enzymes of interest as reporter groups are mainly hydrolases, especially phosphaters. enzyme, esterase, urease and glycosidase, or oxidoreductase , especially peroxidase. Fluorescent compounds include fluorescein and its derivatives. Conductors, rhodamine and its derivatives, dansyl, umbelliferone, etc.

Chemilumi♀sensor contains luciferin, luminol and 1.2 dioxecone. included.

The amount of labeled probe present in the hybridization complex varies over a wide range. It can be changed. Generally, probes are prepared in large molar excess over the amount of labeled nucleic acid. The probe may be used to increase the rate at which the probe binds to the target DNA. Dew.

For example, if the label is radioactive, the bound hybridization The surface of the support with the composite substrate is exposed to an X-ray film. The sign is fluorescent $ In the case of lJ quality, this sample must first be irradiated with light of a specific wavelength. Detected by The sample absorbs this light and then the different wavelengths are detected. emit light. If this label is an enzyme, this sample must contain an appropriate substrate for this enzyme. Detected by incubation with The signal generated is a colored sediment. soluble substances with precipitates, colors or fluorescence, or high luminescence or It can be a photon produced by chemiluminescence.

Detection of hybridization complexes involves targeting and targeting complexes that generate signals. may require conjugation in duplex with a probe polynucleotide or nucleic acid . In general, such interactions between binding Gant and antiligand, e.g. - Conjugated probe and anti-ligan conjugated with signal occurs through an interaction between

The label also allows indirect detection of hybridization complexes. example For example, if the label is a hapten or an antigen, this sample may be suitable for use with antibodies. Therefore, it can be detected. In such systems, the signal is transmitted by a fluorescent substance on the enzyme molecule. conjugation to an antibody or, in some cases, to a radioactive label. This occurs due to

E. Conjugation of capture polynucleotide to polymer ■Functionalization of capture oligonucleotides Create a capture polynucleotide using any of the polymers mentioned above according to the chemistry below. It can also be combined with

DNA probes can be chemically synthesized using commercially available methods and equipment. It is preferable that For example, solid phase phosphoramidites ite) method to prepare short probes of 15-50 bases and the molecular weight Can exhibit less than 16,000 Daltons. Herein, these porine The nucleotide is referred to as a [class probe or oligonucleotide]. (Carut hers, etc.

al,,Cold Spring Harbor Symp.

Quant, Biol, 47:411-418. 1982, and Adams , eL a 1. , J., Am., Chem., S.;

c, 105:661. 1983) When synthesizing probes for specific targets, the choice of nucleotide sequence determines the specificity of the test. decide. For example, by comparing DNA sequences from several virus isolations. can select either type-specific or genus-specific virus detection sequences. Wear. DNA iI region and sequence comparisons can be performed using commercially available computers. - This can be achieved using a program.

Preferred capture nucleic acids for use in the present invention are synthetic oligonucleotides of 20 to 100 bases. It is de. During synthesis, the 5'-hydronucleotide of the oligonucleotide is It can be attached to a xyl group. Activation used as starting material for the present invention Oligonucleotides can be derived from several methods. primary amine Reagents for attaching primary linker arms to end groups are commercially available. first Amines are the preferred group for coupling to heterobifunctional reagents, and hexyl amines are Bonding by a bonding system is preferred. Starting materials suitable for use in the present invention include PCT U.S. Patent No. 861012 Res. , 15:3131 (1987); Nucl, Ac1ds Res. , 15:2891 (1987); and Nuc l. Ac1ds Res. , 14 Near 985 (1986).

In detail, the following chemical formula, i.e. (In the above formula, A is poly or oligonucleotide, and n and m are 2 to 12. , X is NH or NH C:O (C Hz), %NH, and (where Y is a thiol-reactive moiety). Gonucleotides are used. The oligonucleotide has about 9 to 50 bases, preferably The length can range from about 15 to 30 bases, with only the 5'-hydroxyl attached. Requires qualification for Preferred thiol-reactive sites are alpha-haloas. syl, alpha or beta unsaturated carbonyl, or alpha or beta unsaturated carbonyl; is a heter-unsaturated lactone. Attachment of thiol-reactive substituents to primary amines International Patent Application No. 089106701 issued on July 27, 1989 ( In particular, please refer to pages 4 to 8). Incorporate as a reference. The most preferred thiol-reactive moieties are alpha Roacetamidobenzoyl and 4-(N-maleimidomethyl)cyclohexane- 1-carbonyl. Preferred halogens are iodine and bromine. Thiol anti The responsive oligonucleotide is called an activation oligonucleotide.

Alternatively, attach the oligonucleotide to a blocked amine at its 3' end. Can be modified with linker arms containing groups. This is a conjugate or by performing DNA synthesis on a solid support containing nucleotides. It can be achieved. After removal from the solid support, it contains a single 3' terminal ribonucleotide. A DNA oligonucleotide having the following properties is obtained. For example, 1) ribonucleo 2) oxidizing the tido-cis-glycol with periodic acid and The nucleotide is treated with, for example, butanediamine to generate a Schiff base, and and 3) treatment with sodium borohydride or anoborohydride followed by condensation. Stable reducing Schiff that leaves one amine free for conjugation Linker arms containing claimed nuclear amines by generating base derivatives It can be modified with rPractice and Theory of Enzyme rmmunoassaysJP, Tijssen, pp, 23 7, Elsevier 5science Publishers B, V, Am sterdam, before or after preparation on a Netherlands DNA synthesizer DNA bases can also be modified to render them reactive with thiols. post-synthesis method natural nucleic acids (DNA and RNA) and molecularly cloned nucleic acids, and Synthetic nucleic acids can be modified to

In the case of cytosine, a more nuclear amine is attached to the 4-position of the cytosine by various chemistries. do. Amines can be treated with hydrazine to generate N-4-aminocytosine. (Sverdlov, E. D., et al. .

FEBS Letters, 62. P, 212. Feb.

1976). This reaction is catalyzed by bisulfite. Instead, diaminoal Amine is added to the 4-position by a bisulfite-catalyzed transamination reaction in which can is added to the 4-position. can be added (Shapiro and Weisgras, Bioc hem, and Biophys, Res, Comm, 40:839,197 0).

Adding a nuclear amine to the 4-position of cytosine using a bifunctional semicarbazide It is also possible (Hayatsu and Ukita, Biochemica l　andBiochemical　Re5earch　Communicat ions, 14:19B, 1964), then have a free amino group in the oligo. The base is alpha- or beta-unsaturated carbonyl or alpha-halo. N-hydroxysuccinimide, a carboxylic acid derivative substituted with a carbonyl group, etc. Thiol reactivity results from the reaction of the (NH3) ester and the nuclear amine.

substituted with alpha- or beta-unsaturated carbonyl or alpha-haloacyl For the reaction of converted carboxylic acid derivatives with NHS esters, nuclear amines are added at other positions. Other nucleobases can also be used. For example, terminal deoxynucleotide In a reaction using otidyltransferase, 5-(N-(7-aminehexyl) )-1-acylamide]-2'-deoxyuridine-5'-triphosphate It can be added to the 5' end of the oligonucleotide (rMolecular "Cloning, A Laboratory Manual" T, Mani atis, et al, eds.

Cold Spring Harbor Laborat.

ry, p, 148. 1982).

A preferred method of chemical immobilization of oligonucleotides is achieved by the following steps: be done. An oligomer with an amine tethered to a reagent with two different functional groups covalently attach the oligonucleotide. These bifunctional reagents are typically N- It has hydroxysuccinimidyl (NHS) ester, which is the first functional group. It is amine-reactive as a secondary functional group and thiol-reactive as a second functional group. N.H. The S ester acylates the free amine at the 5' end of the oligonucleotide. So The acylation conditions are well known and highly selective. adenine and cytosi The exocyclic amine of the ring is not nuclear and does not readily react with the NHS ester. Ori After acylation to the oligonucleotide, the thiol-reactive functional group becomes a free sulfhydryl. It can be used for conjugation with surfaces containing groups.

Oligonucleotides with a tethered nuclear amine attached to the 5' end were compared to can be derivatized with such thiol-reactive groups by simple chemistry. Ru. For example, N-succinimidyl (4-iodoacetyl) aminobenzoate ( SIAB) is added to the aqueous oligonucleotide solution in a 10-100 fold molar excess.

The pH is buffered between about 6-9 and the temperature is about 20°C to 30°C.

After a reaction time of approximately 30-90 minutes, excess unreacted reagents are removed by exclusion gel filtration. .

Preferred thiol-reactive sites are alpha haloacyl compounds or alpha - or beta-unsaturated carbonyl compounds. Thiol-reactive groups include Reimide, pyridyl sulfide, active halogen, alpha or heter unsaturated Japanese lactones and the like may be included. Active halogens are typically alpha-halogens. It is le. Useful halogens include chlorine, bromine, iodine, and fluorine. , iodine and bromine are preferred. Reagents useful in the present invention include Pierce Chem It can be purchased from ical Co., Rockroad, rL. As an example, N- Succinimidyl 4-(iodoacetamide) Henshade (S IAB), and and sulfosuccinimidyl (4-iodoacetamide) benzoate (sulfo-5 IAB).

2. Polymer functionalization The polymer surfaces of the present invention contain thiol-reactive linked oligonucleotides as described below. Preferably, it is modified with a sulfhydryl group for subsequent reaction with hydrogen. preferred An alternative method is to use a disulfide derivative containing a nuclear amine involved in the conjugation. Modify the polymer or surface with a conductor and then thiolize the activated oligonucleotide. treatment with dithiothreitol, for example, to covalently bond reactive moieties to the surface. This is a method for reducing disulfide groups to monothiols.

Several polymers are available for modification. Preferred water-soluble polymers include, for example polyoxide, polyether, poly(ethyleneimine), acrylic polymer, Includes vinyl polymers and polyvinylpyrrolidine. poly(ethyleneimide) Most preferred are polyvinylamine), polyallylamine, and polyvinylamine. beads below Can be modified on the surface of: Sephadex, agarose, polystyrene beads, Teflon beads, polystyrene/latex beads, latex beads , or activated carboxylates, sulfonates, phosphates, or similar Any bead or microsphere having an activatable group.

The polymer can comprise a substrate and a reactive surface of the materials described above. capture The need for reactive sites to covalently attach polynucleotides limits surface selection However, the substrate may be the same as or different from the surface. If different, the substrate is It can be virtually any inert composition.

For example, either porous or non-porous with pre-activated surfaces or amine-type sites of silica particles can be used.

These silica particles are commercially available.

The following chemical moieties can be attached to the polymer surface: any aminoalkyl or disulfide (for the bonding of the surface any mercaptan (for modification), any mercaptan (for attachment of oligonucleotides) the aminothiol alcohol, and the aryl (for oligonucleotide conjugation) disulfide, aminoaryl disulfide, or aminoalkylaryl disulfide.

Organic residues are not a critical feature of the invention. Thiol ether or thiol linkage There is virtually no restriction on the substituents as long as the ability to maintain the bond is preserved.

Polystyrene, polystyrene/latex, latex or (activated calcium) For any other polymer structure (having a boxy group), J, V, 5taros et al.

AnaIyt’rcal Biochemistry 156:220-222 (1986) procedure is used. In an aqueous buffer with pH 5.0-5.5 , 100,000 to 1,00o, ooo molar excess of 1-ethyl-3-(3-dietyl) thylaminopropyl) carbodiimide (EDC) or other carboxyl activated Place the beads in the reagent for 2 minutes at 20°C to 30°C. Then excess and unused The EDC of the reaction is removed by filtration or centrifugation of the beads. The activation key The enzyme is added to an amine-incompatible buffer, such as sodium borate, sodium phosphate, at a pH of about 7-9. aminoalkyl disulfide or amino in sodium carbonate or sodium carbonate. Alkyl mercaptan, preferably cystamine or cysteamine (2-amino ethanethiol) and react for 1 to 24 hours. .

After a suitable washing step, followed by centrifugation or filtration, a reducing agent e.g. Conjugate using M dithiothreitol or dithioerythritol. Reduces the disulfide of cystamine to sulfhydryl. At the last stage, the system When using amines, the beads do not require a reduction step.

3. Conjugation of activated oligonucleotide to thiolated polymer surface Maximum oligonucleotide binding of the modified polymer structure after conjugation and optimization Using 2 to 100 times more activated oligonucleotide than the combined volume of polymer The thiolated surface is reacted with an activated oligonucleotide.

After conjugating the polymer structure surface with a capture DNA probe, a large excess of free Sulfhydryl groups may be present. to the covalently linked capture oligonucleotide. The ratio of these remaining sulfhydryl groups ranges from 10:1 to 1,000,000:1. can be surrounded by The presence of these excess thiol groups results in R-3H groups (R is The second surface of the polymer structure by selective chemical bonding (which is either chemical functionality) allows modification of This chemical bond is irreversible (e.g., reaction with maleimide derivatives). reversible (e.g. by formation of disulfide bonds) It may be.

The ability to perform secondary modifications on the surface of a polymer structure allows for various desired modifications on the polymer structure. important for achieving surface properties.

a, The thiolated surface is subjected to a second conjugation step by treatment of free bonds. provides a chemical means of irreversible modification in Such sulfhydryl compounds ugation includes surface charge, hydrophobicity, hydrophilicity, color, reflectance, transmittance, porosity, Coefficient of friction, porosity, electrical conductivity, and heat capacity can be modified. Thiolated surfaces can also be Integrating proteins, nucleic acids, antibodies, antigens, or other important macromolecules into polymeric structures Means are also provided to enable reverse binding. Such modified surfaces are solid Rate of hybridization of target nucleic acid to capture probe on surface support and occurs upon detection of hybridized labeled probes. It is important in reducing the level of non-specific hackground.

b. In contrast to the irreversible modification just described, thiolated surfaces also Formation of disulfide bonds between desired reagents (e.g., formation of surface-3-3-R bonds) ) also presents a chemical means of reversible modification in the second conjugation step. provide Such conjugation reduces the surface transmittance, Ff! Friction coefficient, pores The rate, conductivity, and heat capacity can be modified. Thiolated surfaces can also be used to target specific proteins. reversibly attach proteins, nucleic acids, antibodies, antigens, or other important macromolecules to polymer structures It also provides a means to do so. These types of sites are serves as a receptor, ligand, or substrate in the Can stand.

Example Example 1 provides general methods and materials.

Examples 2, 3, and 4 with and without target capture polymer Compare the rate and extent of specific sequestration of target nucleic acids. The results show that the sensitivity of the blockade ( This indicates that the degree of did.

Example 1. General methods and materials solutions and buffers Filtration washing (FW) was performed using 0.09M sodium chloride, 50mM Tris-HCl ( pH 7.6), 25mM EDTA; SDS/FW is FW and 0.1% Sodium dodecyl sulfate (SDS); Horseradish peroxidase (HR) P)i! The solution is 0.1M sodium citrate (pH 5.5), 0.5mg/ml 4-methoxy-1-naphthol, 0. 02mg/ml 3-methyl-2-ben zo-thiazolinone hydrazone, and 0.0135% hydrogen peroxide; alkaline Phosphatase (AP) 4’l solution 1 mM S-bromo-4-chloro andoyl-3-phosphate, 1. mM Nitroblue Tetrazolium, and TM NZ (100mMh Lis HCI (pH 8,5), 100mM NaC], 50 0.01% Tween in mM MgCIz, and 0.1mM ZnCIz) 20; lysis solution was 3M guanidinium thiocyanate, 2% N-lau Loylsarcosine (Sarkosyl), 50mMh Li-HCl (pH 7,6), 25mM EDTA.

material a, oligonucleotide Bacteroides gingiva (Bacteroides gingiva) i s) 1.6 Two types of oligos complementary to two different regions of S liposome RNA Nucleotides were synthesized on an Applied Biosystems DNA synthesizer model 380B. did.

The sequences of all oligonucleotides described below are listed in Table 1.

b. Poly(ethyleneimine) is produced by Polysciences. Warrington, PA).

Preparation of iodoacetamidobenzoylated oligonucleotides = 10-11000 u's 5'-terminal amine-linked oligonucleotide (PU9A) or 5'-terminal amine Complementary (denoted “'C”) oligonucleotide (UP9A' “C”) was added to excess N-succinimidyl 4-(iodoacetamido)-benzoate (SIAB) , in an alkaline (preferably pH 8,0) buffer at 18°C to 25°C for 30 Allowed to react for ~120 minutes. Unreacted S IAB is treated with NAP25 (Pharmacia) was removed by size exclusion chromatography using a ram.

Preparation of facepiece support: 16 cm2 of N)rtran pieces in O,LM sodium borate at pH 8.3. Incubated with 10 ml of 5 mg/ml iminothiolane. ink bath The duration is 30 minutes at ambient temperature. Menpuran, as mentioned above, with sodium borate Wash with 5 changes of buffer and determine the presence and determination of introduced sulfhydryl groups. Amounts were determined using 5,5-dithio-bis(2-nitrobenzoic acid). then , the derivatized menplan was cut into 0.28 cm” disks and 0.1 M Washed once with sodium borate buffer. rAB-oligonucleotides as described above. and mixed with Memran Disc.

0.1 M Sodium Borate containing 1.0 mg of IAB-oligonucleotide Immerse 300 Membrane disks in 2 liters of buffer solution and incubate at constant temperature in a dark room. The reaction was allowed to proceed for 16 hours at room temperature with stirring. .

The disks were then washed sequentially with 0.1M sodium borate and SDS/FW. Purified. 0.1-1.2 micrograms of oligonucle per filter disc leotide bound. The filter was then washed with O, LM boric acid nanoparticles at pH 8.3. Unreacted by treatment with 50 mg/n11 iodoacetamide in The sulfhydryl group of was capped. The filter is then further coated with sodium borate. and SDS/FW.

Preparation of poly(ethyleneimine)-oligonucleotide polymers: a, thiolation: poly(ethyleneimine) (Polysciences, Warring ton, 50 μl of a 30% aqueous solution of PE vinyl (molecular weight 10.000) manufactured by PA. , O, LM sodium borate at pH:3 containing 50 mg of iminothiolane 250 microrinds were added and mixed for 1 hour at ambient temperature.

The thiolated polymer was then dissolved in G in sodium borate buffer of ptis, 3 Purified by exclusion chromatography using -25 Cephadenx, and The number of introduced thiol groups is reduced using 5,5'-dithio-bis(2-nitrobenzoic acid). Determined by titration.

b. 500-5000 mic using the heterotrifunctional cross-linking reagent 5IAB described above. A program of 8 gl oligonucleotides was derived. Purified oligonucleotide was concentrated using butanol and then brought to near-dryness under reduced pressure to remove the remaining butanol. removed. 100-200 μl of N-methyl- Add pyrrolidone and then add 5 μl of thiolated polymer to the oligonucleotide solution. Rimmer was added and the solution was mixed vigorously for 1-18 hours. CF-250ka Contained by HPLC exclusion chromatography using HPLC (Dupont). The jugate was purified. Concentrate the polymer and add 0.01M Tris 10. OI M EDTAlo, 2% (V/V) mercaptoethanol, and 50% glycero It was stored at -20°C in a refrigerator. Gel analysis is performed using 5 to 15 oligos per polymer. It showed that the nucleotides were bound together.

Example 2. PEl-oligonucleotide conjugates in colorimetric assays Amplification of Bg rRNA capture using this example. with BglC-oligonucleotides captured and covalently immobilized. Bgl-oligonucleotide hybridized to Nyt, ran solid support Utilizing the use of a 10,000 MW PEI polymer conjugated to

1 in 100 microliters at 19°C using 3M GnSCN lysis solution. ×1011 cell Act 1nobac i 11us actinomyce tem comitans (Aa), Bacteriodes gingiva lis (Bg), Bacteriodes intermediuS (Bi) , Eikenella corod613 (Bc), Fusobacteri um nucleatum (Fn), Wolinella rec L a (W r). The samples were then heated to 65°C for 5-10 minutes. Bakte Biotinylation complementary to the conserved region (signal probe) of Ria163 rRNA Add 24-mer oligonucleotide probe to 100 nanograms per ml. to the final concentration of

Add Bgl-10K PEI conjugate to one solution to a final concentration of 1 ml. icrogram/sign I (based on oligonucleotide concentration). Total cell number lXl0” Aa.

Bi, Ek, Fn, and W' and PEJ-oligonucleotide' conjugates dilutions with or without and containing biotinylated signal oligo. Five-fold serial dilutions of the lysate were prepared using the following agents. The solution is then converted into lu g BglC or 8gl specific oligonucleotide probe (capture probe) 10 at ambient temperature with a nytran disk to which is covalently fixed. Incubated for minutes. Rotating platform for incubation The container was gently shaken using a shaker.

The solid support is then washed with SDS/FW at ambient temperature, followed by SDS/FW. Strepavidin/Horserradish Beroxy in FW Incubate with Dase (SA/HRP) conjugate 10 ng/ml did.

The solid support was then washed with SDS/FW, FW, and the filter was then washed with Incubate with the HRP substrate solution described in 1 to generate an insoluble product. The presence of peroxidase was determined by The result is In hybridization, the use of capture amplification polymers yields 3 x 105 cells were detected, whereas 8 x 106 cells were detected without amplification polymer.

Hackground levels did not increase with the use of amplification polymers. Aa, Bi .

Controls with Ek and Wr present and no Bg showed no color development; The capture of g was specific.

Example 3. Target capture as an intermediate in sequestering target nucleic acids on solid supports Determination of the rate and extent of enhanced capture of target nucleic acids using capture polymers This example uses a polymer/origin as an intermediate in the hybridization procedure. on a solid support with or without oligonucleotide conjugates. The rate and extent of sequestering the target nucleic acid (16srRNA) is described.

The experiment captured 163Bg rRNA and covalently immobilized U Highlighted on a nytran solid support with P9A'"C per-oligonucleotide. UP9A-oligonucleotide (for 16S bacterial rRNA) 70.OO conjugated to the “generic oligonucleotide probe” of O? jW Utilizing the use of PEI polymer.

100°C at 19°C using 3M GnSCN lysis solution. ichlorinotl volume Lyse 10' Bg cells in the cell and heat to 65°C for 5 to 10 minutes. Ta. Complementary to the hypervariable region (signal probe) of bacterial 16S rRNA 32P24-mer oligonucleotide probe (specific activity 5X10'cρm/mic gram) was added to give a final concentration of 10 nanograms/m+. one siri Add the liquid LIPOa-70K PEI conjugate to the water and add the final concentration. The concentration was 1 microgram/ml (based on oligonucleotide concentration). each Seven duplicate time points were used for the reaction rate curves. Then, the solution was mixed with U P9a or IJP9aC-specific oligonucleotide probe (capture probe) with a nytran disk covalently immobilized with 1 microgram Incubate at temperatures of 0° 5.1.0, 15, 30.45, and 60 minutes.

During incubation, samples were gently tapped as described above.

The solid support was then washed five times with SDS/FW at ambient temperature and bound. The radioactivity released was monitored by scintillation counting.

The results are shown in FIG. Two reaction rates with and without polymer A comparison of the degree distributions shows that the rate of reactions involving intermediate polymers increases by a factor of 10 to 25. Moreover, it showed that the degree of reaction at 60 minutes had increased approximately 20 times. There is. Thus, using PEI/oligonucleotide conjugates, intermediate Approximately 2 of the levels achieved in 1 hour without using target capture polymers as a body Double levels of target nucleic acid sequestration are achieved in 5 minutes.

Table 11 Selected oligonucleotides , Distribution 1 rRNA negative UP9A 5'CTGCTGCCTCCCGTAGGAGT3' 338-35 78g-585'CCGATGCTTATTCTTTACGGTACAT3'4 75-5058g-IB 5’ CAATACTCGTATCGCCCGTTAT TC3' 450-475HPV 114 5' AAATGCGGTGTCA GII; AAAACCAAA3'RPV 115 5' CCACCTAGAA TCTGTACCAGCATT3'Example 4. Complementary to single strand of target double stranded DNA Capture amplification of denatured double-stranded DNA using a standard capture polymer. 24-mer oligo complementary to human papillomavirus sequence contained in Sumid DNA 70. with nucleotides. Modified duplex using OOOM-PEI polymer Increases the rate and extent of capture of DNA onto a solid support.

The sequences for this example are listed in Table 1. P32-dAT using T4 kinase 0.29 micrograms of HPV 115' “C” end-labeled with P oligonucleotide (“C” is the HPV 115 oligonucleotide listed in Table 1) 50, 75 or 100 nanograms (7) HPV 1 15-70K PEI Bo IJ? -; PBR322 containing HPV serotype 16 genome 1 x 109 copies of plasmid (DNA complementary to various (HPV) genomes) Prepared from recombinant insert in PBluescript cloning vector [That is, pHPV-16 is inserted into the BamHI restriction site of Bluescript This is the genome sequence of human vapillomavirus type 16, which has been introduced into Japan]. p blues Crypto■\ has 21 unique restrictions on the pUC polylinker of pBS (Sat/-) The 2.95 kb core obtained by converting the synthetic polylinker containing the site colony producing phagemid ) containing 0.6 M NaCl 1,90 mM. Tris, pu=s, o, 10a+M EDTA, 0°5% SDS, 30 % deionized formamide (hybridization solution). Next (total volume of 100 microliters) was heated at 90°C for 5 minutes in a water bath. Closed. This solution was then incubated at 20°C for 4 hours, at which point the high Stop the hybridization reaction and remove the solid support (filter). was removed from the solution.

The filters were then washed twice with the hybridization solution described above, followed by SDS. /FW three times. Then, using liquid scintillation counting, filter were monitored for radioactivity. Table 2 shows the l1kb HPV16-containing plasmid. Describe the degree of capture of the fish.

No polymer 1014 3% 50ng 33087 86% 75ng 24147 63% 1100n 28939 75% 1) The cpm of total available target in each reaction was 38°000 cpm. Ta. Polymer has only one complementary oligonucleotide on a significant single strand Therefore, it was assumed that only 1/2 of the total input cpm was available for capture.

Therefore, the use of a capture polymer allows sequestration of 1 lkb denatured plasmid DNA. , demonstrated an average of 25-fold increase in DNA capture over direct capture on a solid support. It was done.

FIG.-1 FIG-2 international search report

Claims (1)

[Claims] 1. (a) a complementary capture polynucleotide covalently attached to a polymer and a target polymer; contacting the polynucleotide (provided that the polymer is (1) Water-soluble polymers or microbeads coated with water-soluble polymers. the law of nature; (2) at least two capture polynucleotides covalently bonded to the polymer; (3) exhibits mobility in solution); (b) hybridization between the target polynucleotide and the capture polynucleotide; dization (wherein the mobility of the polymer in solution is increased) amplifying hybridization); and (c) sequestering said polymer on a solid surface; How to improve your catch of flatheads. 2. Amplification of hybridization using polymers can be achieved using polymer-free hybridization. Compared to hybridization, 10 minutes of hybridization is approximately 10 2. The method of claim 1, wherein the increase is ~25 times. 3. The solid surface has an oligonucleotide complementary to the capture polynucleotide that is covalently attached to the solid surface. 2. The method of claim 1, comprising a oligonucleotide. 4. The polymer may be polyoxide, polyether, poly(ethyleneimine), Acrylic polymer, vinyl polymer, polyallyl polymer, polysaccharide from polynucleotides, polynucleotides, polypeptides, and polyvinylpyrrolidine polymers. 2. The method of claim 1, wherein the method is selected from the group consisting of: 5. The polymer is poly(ethyleneimine), polyallylamine, polyvinyl 5. The method of claim 4, wherein the method is selected from the group consisting of amines, and polypeptides. . 6. The microbeads are cross-linked dextran microbeads, agarose microbeads, Clobeads, polystyrene microbeads, polytetrafluoroethylene microphones Robbies, polystyrene/latex microbeads, silica microbeads, Magnetic microbeads or activated carboxylates, sulfonates, phosphates or microspheres or microbeads with similar activating groups. , the method according to claim 1. 7. 5. The microbeads have a diameter of about 0.5 to about 120 microns. The method described in Box 1. 8. The water-soluble polymer has a molecular weight of about 600 to about 100,000 Daltons. , the method according to claim 1. 9. The water-soluble polymer has a molecular weight of about 10,000 to about 70,000 Daltons. 9. The method according to claim 8. 10. The solid surface is a two-dimensional solid support, a bead-type solid support, a microtire Claim 1 which is a tarwell, string or plastic strip. Method described. 11. The solid surface may be a nitrocellulose support, a derivatized nylon support, or a fluoride support. Fluorinated polyhydrocarbon supports, membranes, nylon disks, magnetic beads, plastics Stick beads, polytetrafluoroethylene beads, polystyrene beads, Consists of listyrene/latex beads, latex beads, and silica support 11. The method of claim 10, wherein the method is selected from the group. 12. (a) a complementary capture polynucleotide covalently attached to a polymer and a target contacting with a polynucleotide (provided that the polymer is (1) Water-soluble polymers or microbeads coated with water-soluble polymers. the law of nature; (2) at least two capture polynucleotides covalently bonded to the polymer; Has pee; (3) The ligand portion of the ligand/receptor conjugate bound to the polymer is have; and (4) exhibits mobility in solution); (b) hybridization between the target polynucleotide and the capture polynucleotide; dization (wherein the mobility of the polymer in solution is increased) amplifying hybridization); and (c) binding the receptor portion of the ligand/receptor conjugate to the polymer; sequestering the target polynucleotide on a solid surface with How to improve. 13. Polymer-based hybridization amplification is polymer-free. Claim 12: about a 10-25 fold increase compared to hybridization Method described. 14. The polymer is polyoxide, polyether, poly(ethyleneimine) , acrylic polymer, vinyl polymer, polyallyl polymer, polysacchara polynucleotides, polynucleotides, polypeptides, and polyvinylpyrrolidine polymers. 13. The method of claim 12, wherein the method is selected from the group consisting of: 15. The polymer may be poly(ethyleneimine), polyallylamine, polyvinylamine, etc. of claim 14, wherein the polypeptide is selected from the group consisting of Method. 16. The microbeads are cross-linked dextran microbeads, agarose microbeads, microbeads, polystyrene microbeads, polytetrafluoroethylene microbeads Clobeads, polystyrene/latex microbeads, silica microbeads , magnetic microbeads, or activated carboxylates, sulfonates, and phosphates. microspheres or microbeads with a similar activating group. 13. The method according to claim 12. 17. 5. The microbeads of claim 1, wherein the microbeads have a diameter of about 0.5 to about 120 microns. The method according to range 12. 18. The water-soluble polymer has a molecular weight of about 600 to about 100,000 Daltons. 13. The method according to claim 12. 19. The water-soluble polymer has a molecular weight of about 10,000 to about 70,000 Daltons. 19. The method according to claim 18, comprising: 20. The solid surface is a two-dimensional solid support, a bead-type solid support, a microtire Claim 1 which is a tarwell, string or plastic strip. The method described in 2. 21. The solid surface may be a nitrocellulose support, a derivatized nylon support, or a fluoride support. Fluorinated polyhydrocarbon supports, membranes, nylon disks, magnetic beads, plastics Stick beads, Teflon beads, polystyrene beads, polystyrene/latex selected from the group consisting of x beads, latex beads, and silica supports; The method according to claim 20. 22. The ligand/receptor conjugate may be antigen/antibody, hormone/hormone receptor receptor, biotin/streptavidin, or biotin/avidin. The method according to claim 12. 23. Contains water-soluble polymers or microbeads coated with water-soluble polymers. a target polynucleotide capture composition comprising has at least two copies of the capture polynucleotide bound thereto; the target polynucleotide, wherein the mer or microbead exhibits mobility in solution; Capture composition. 24. The polymer is polyoxide, polyether, poly(ethyleneimine) , acrylic polymer, vinyl polymer, polyallyl polymer, polysacchara polynucleotides, polynucleotides, polypeptides, and polyvinylpyrrolidine polymers. 24. The target polynucleotide capture composition of claim 23 selected from the group consisting of thing. 25. The polymer may be poly(ethyleneimine), polyallylamine, polyvinylamine, etc. 25, wherein the polypeptide is selected from the group consisting of Target polynucleotide capture composition. 26. The polymer is water soluble and has a molecular weight of about 600 to about 100,000. 25. The target polynucleotide capture composition of claim 24, having a Dalton. 27. the polymer has a molecular weight of about 10,000 to about 70,000 Daltons , the target polynucleotide capture composition of claim 26. 28. the capture polynucleotide is about 15 to about 70 nucleotides in length; 24. The target polynucleotide capture composition of claim 23. 29. The polymer triggers the ligand/receptor conjugate bound to it. 24. The target polynucleotide capture composition according to claim 23, which has a target polynucleotide portion.