JPH05501799A - Fusion proteins, their preparation and uses - Google Patents

Abstract

Fusion proteins are obtained in high yields if a mixed oligonucleotide is constructed which codes for the ballast constituent of the fusion protein. The oligonucleotide mixture is introduced in a vector in such a manner that it is functionally linked to a regulatory region and to the structural gene for the desired protein. Appropriate host cells are transformed with the plasmid population obtained in this manner and the clones producing a high yield of coded fusion protein are selected.

Description

[Detailed description of the invention] Fusion proteins, their preparation and uses This application: U.S. Patent Application No. 0, a concurrent continuation of the application filed on August 29, 1989. This is a continuation-in-part application of No. 7/399.874.

field of invention The present invention relates to methods for producing fusion proteins and fusion tough proteins.

The present invention also provides various oligonucleotides and oligonucleotides constituting the fusion protein of the present invention. and amino acid sequences.

Background of the invention In the final product, in addition to the desired protein, undesired constituents or 7 stabilizers ( A protein that also has a ballast component is a fusion protein. It's called quality. When producing proteins through genetic engineering, the desired protein is It is directly expressed and can be degraded relatively quickly by host endogenous proteases. when the yield of the desired protein is reduced or becomes completely insufficient. In particular, they make use of intermediate step fusion proteins.

The size of the ballast component of the fusion protein depends on whether the fusion protein is insoluble or not. It is normal to choose such a method. This insolubility is due to the release of host endogenous proteases. Not only can they provide the desired protection, but they can also be easily separated from soluble cellular components. do. The proportion of the desired protein in the fusion protein is relatively small, i.e. It is generally accepted that cells produce a relatively large volume of "ballast".

Attempts have been made to prepare fusion proteins that contain short ballast constructs. for example, A fusion protein from the first 10 amino acids of β-galactonase and somatostatin A gene fusion encoding the protein was prepared. However, this short amino acid chain may not adequately protect the fusion protein from host endogenous proteases. clarified EUS-A 4 366 246.15 column, 2nd column].

From EP-A O290005 and 0292763, we A fusion protein consisting of a fragment of β-galactontase having the following amino acids: Know your ballast components. This fusion protein is either insoluble or (EP-A O290005).

The fusion protein may be one previously disclosed in the art or one that is protease resistant. Generating fusion proteins with desirable properties such as This often results in fusion proteins with many undesirable properties. . Therefore, protease resistance, proper folding, and separation from the desired protein Fusion proteins with attractive properties such as effective cleavage of ballast and Efficient methods for their preparation are required.

Summary of the invention The present invention relates to methods for preparing fusion proteins. Fusion protein of the invention The material contains the desired protein and ballast components. The method of the present invention Generate an oligonucleotide library (mixture) encoding the last construct. The mixed oligonucleotides (library) can be adjusted to region and the vector so as to be functionally linked to the structural gene encoding the desired protein. vector, and the resulting vector assembly forms the host cell. It is characterized by transformation. The fusion protein is then expressed in high yield. Select transformants.

The method of the invention further provides that the desired protein can be easily cleaved from the ballast composition. An oligonucleotide encoding an amino acid or group of amino acids that allows It includes punch lines. This cleavage can be either enzymatic or chemical.

The present invention also provides fusion proteins that are insoluble and can be easily made soluble. Oligonucleotides designed to guide the invention are also provided. Such fusion of the present invention The protein meets established requirements for protease resistance.

Furthermore, the oligonucleotides of the invention provide a ballast component of the desired protein. It can be designed so as not to interfere with folding.

Figure 1 and its successors Figures 1a and 1b show the known plasmid pH 154/25'' from plasmid pI NT40 The pathway to construct lNT4X is shown. Other structures can be easily identified from the drawings. And not shown.

Figure 2 shows a plus protein containing the complete HMGCoA reductase gene. Map of Mido pUH10.

Figures 3 and 3a show the plasmid p, containing the mini-proinsulin gene. The construction of IK4 is shown.

Detailed description of the invention The present invention provides a hybrid oligonucleotide encoding a ballast component of a fusion protein. Concerning a method for preparing a fusion protein, characterized in that it constructs an octide. do. The oligonucleotide is then co-coated with the regulatory region and the desired protein. into a vector so as to be operably linked to the structural gene it carries. This way The resulting plasmid collection is transformed into a suitable host cell and the encoded Select clones that produce the desired fusion protein in high yield.

Preferred embodiments of the present invention will be explained below.

Oligonucleotides can enzymatically cleave ballast components from desired proteins. At the 3°-terminus, an amino acid or amino acid group that is easily and preferably cleaved or cleaved is added. It is convenient to code it separately. Other implementation methods result in readily soluble The goal is to construct oligonucleotides that produce insoluble fusion proteins. Ingredients Physically, it encodes a ballast component that does not interfere with the desired protein folding. It is preferred to construct oligonucleotides that are

For practical reasons, construction of oligonucleotides encoding ballast components In the present invention, the ballast component is kept very short.

Fusion proteins, even with extremely short ballast components, Not only does it meet the exact requirements for tease resistance, but it also produces at a high expression rate. In addition, if necessary, an insoluble fusion protein can be easily made soluble. It was surprising that this was recognized. Next, the dissolved or soluble In this case, the short ballast constructs of the present invention stereochemically target the desired protein. Favorable conformation allows for proper folding, resulting in and can be easily separated from the ballast components.

If the desired protein is to be produced in the pro-form, the pro-protein is converted into a mature protein. The ballast structure can undergo cleavage at the same time as it transforms into protein. Just build a product. For example, in the case of insulin preparation, the ballast composition and It is sufficient if the C chain can be removed at the same time; in that case, side reactions that cause large losses may occur. A derivative of mature Insuwan is obtained which can be converted into insulin without any oxidation.

The short ballast constructs of the present invention are more effective than the normal signal sequences of proteins. It is short and does not interfere with the desired protein folding.

Therefore, it is necessary to remove it before the final processing step to obtain the mature protein. There is no need to

The oligonucleotide encoding the ballast construct has the formula ゛(D　CD)x [wherein D is A, G or T and X is 4-12, preferably 4-8] It is preferable that the DNA sequence (code strand) contains the following DNA sequence (coding strand).

Specifically, the above oligonucleotide has the formula: AT G (D CD) y (N　N　N　)z [in the formula, NNN] or different nucleotides, where 2 is 1-4 and y+z is 6-12, preferably or 6-10, and y is at least 4] chain). oligonucleotide formula %formula%() It is convenient to have the DNA sequence (code strand) shown in (especially the formula ATG GC W (DCD)4-1l CGW or preferably the formula.

ATG GCA (DCD), CGW [where W is A or T] It has been found that it is convenient to have the DNA sequence (coding strand) shown below.

The DN A motel arrangement described above fully satisfies these requirements.

The codon DCD codes for the amino acids serine, threonine and alanine. It therefore encodes a relatively hydrophilic protein chain.

Stop codons are eliminated and amino acid selection remains manageable. The following arrays are Particular preference is given to the ballast component in the case of the desired protein or proinsulin. ATG GCW (DCD)y' ACG CGW or teeth , to TG GCD (DCD) y’ ACG CGT2 Here, y “ is 3-6 , especially yo, which means 4-6.

The second codon GCD codes for alanine and is recognized by the restriction enzyme \col. Finishing sequences or previous regulatory sequences are terminated with a CC. last trip The one next to Let codes for threonine, along with the CGT codon for arginine. This is the recognition sequence for the restriction enzyme Mlu. As a result, this oligonucleotide can be easily and clearly introduced during gene construction.

The (NNN)z group in the 3' position separates the ballast component from the subsequent desired protein. An amino acid or amino acid group that can be separated simply and completely enzymatically. is being coded. When selecting nucleotides in this group, select between them or the desired nucleotides. Encodes a restriction enzyme cleavage site at the 3° end that can link protein structural genes. It is a good idea to choose as follows. Furthermore, the gene of the ballast composition of the present invention is normally The ATG start codon and if necessary the first Is it convenient to incorporate DCDhl) into the recognition sequence of the restriction enzyme? stomach.

The upper limit for Z is, on the one hand, due to the (enzymatic) cleavage of the resulting fusion protein. from the desired cleavage site of contains a codon encoding the amino acid sequence: Ile-Glu-Gly-krg. It becomes inclusive. It goes without saying that ballast components should be as small as possible. y and 2, especially since it must not interfere with the desired protein folding. The upper limit for the total number is generally twelve.

For convenience reasons, host organisms such as bacteria or yeast are used in genetic engineering methods. Which lower eukaryotic cells are preferred; higher organisms are not required. In this method, heterologous genetic The expression of the offspring depends on homologous regulatory regions, i.e. those native to the host or the host cell. Adjusted depending on what suits you. When expressing a prey peptide, The sequences are also often foreign to the host cell. In fact, this lack of "sequence harmony" ” often yields a variety of unexpected proteins. Main departure Since the light ballast arrangement is suitable for that environment, the selection method of the present invention DNA constructs characterized by sequence conformance J can be provided.

The start and end points of the ballast structure are set within this construct. That is, methionine or a starting point that allows for the desired separation of ballast constituents from the desired protein. The final amino acid or group of amino acids is the endpoint. For example, the desired protein If is proinsulin, then the bird that feeds arginine as the last codon It is convenient to choose the pret NNN (which allows for balance along with the removal of the C chain. Particularly advantageously, the components can be simultaneously divided. Naturally, the ballast configuration The terminus of the product is also an amino acid or group of amino acids that can be chemically cleaved, e.g. can be chlorinated, thereby allowing cleavage with bromide or chloride/an .

Intermediate amino acid sequences can be modified to avoid affecting the desired protein folding. It should be as short as possible. Furthermore, this chain should be relatively hydrophilic; This will promote the solubility of undissolved fusion proteins, and remains soluble. Stein residues prevent disulfide bridge formation This is not desirable as it may cause

DNA encoding the ballast component is synthesized in the form of mixed oligonucleotides be done. Immediately before the structural gene of the desired protein in a suitable expression plasmid and transform E. coli with the obtained scene bank. . This can be achieved by selecting bacterial clones producing the corresponding fusion protein. A suitable genetic construct can be obtained by the method.

As described above, the beginning and end of the nucleotide sequence encoding the ballast component However, the cleavage sites for certain restriction enzymes are considered to be merely exemplary. A Includes the TG initiation codon and subsequent nucleotide or appropriate amino acid codons. Examples of recognition sequences that may be included include restriction enzymes AflI[I, Ndel, N1aIII', N5pHI or 5tyI. In a preferred embodiment The arginine should be placed at the end of the ballast sequence, and the arginine Since there are six different codons for M'lul, , further suitable restriction enzymes can be found. That is, Nrul, AvrI I, AflllI, C1al or HaeII.

However, the 5science of Saiki (R, K,) et al. 239:4 According to "replication chain reaction (PCR)" according to 87-491.1988, restriction enzyme It is possible to save the effort of constructing a specific recognition site for the element, so it is possible to use it. It is also a good idea to do so.

DNA sequence: (DCD) The restriction on x is for convenience, which is e.g. Other codons such as glinone, proline, su/n, methionine or asparagine It is not something to be excluded.

The most efficient embodiment of this DNA sequence is the fusion protein, i.e. obtained by selecting a good operation for phosphorus-containing fusion proteins. Ru. This eliminates undesirable combinations of promoters, ballast sequences, and structural genes. regulatory sequences, ballast sequences and the desired protein as a result of the elimination of alignment. The most favorable combination of Good results can be obtained.

Unexpectedly, the gene of choice for the ballast construct of the present invention is E.

It has been observed that they do not always contain triplets that are favorable for E. coli. It was noticed. A for Thr, which is used least frequently by E. coli. It was found that CA codons are actually abundant in the selected sequences. It was. For example, the following amino acid sequence can be converted into a preferred codon name by E, col i. - When optimizing according to the sage (p, c, u, ,) (p, c, u, Aota (S,) et al.'s Nucleic Ac1ds Re5ear ch 1q (additional draft): r315, r316, r391, r402 (198g) ), an entirely different genetic construct than that obtained by the present invention has been obtained. It will probably fly (see table 1) Ala Thr Thr Thr Ser Thr Ala Thr Thr GCG A CCACCAGCACCGCG ACCACCp, c, u.

GCA ACA ACA TCA ACA GCA ACT ACG This invention For fusion proteins with insulin constructs, the initial starting point is 10 amino acids. It was a ballast composition with acid. DNA of the best producer sequence as a base to vary this sequence, thereby determining the relative expression Up to three amino acids can be deleted without significant loss of efficiency. I noticed that. This finding suggests that such short ballast proteins may be appropriate. This was surprising because it was unexpected, and not only that, but the fusion technology As the relative proportion of proinsulin in protein or ballast constituents decreases This is very convenient since it naturally increases.

The significance of ballast components in proteins is clear from the comparisons described below. be: Human proinsulin contains 86 amino acids. EP-Ao 290 005 fusion protein, a lower limit of 250 for the ballast composition. Taking amino acids, the fusion protein has 336 amino acids. However, only about 1/4 of the desired protein is present. Compared to this, The fusion protein of the present invention has only 7 amino acids as its last constituent. contains 93 amino acids, and proinsulin composition accounts for 92.5%. There is. If the desired protein has more amino acids than proinsulin, , the interaction between the ballast and the desired protein becomes even more convenient.

In only one preferred embodiment of the invention, proinsulin is used as the desired protein. It is said in several places that there is. However, the present invention allows for much larger fusion proteins. For example, human 3-hydroxy-3-methylgluta Fusion protein with the active domain of Ryl-coenzyme A-reductase (HMG) Quality is exemplified. This protein contains 461 amino acids. this The encoding gene is known, for example, from EP-A 292 803.

Having herein described the invention generally, the same may be understood by reference to the following examples. be more easily understood. However, they are merely for illustrating the invention. These are not intended to limit the present invention unless otherwise specified.

Example 1 If you do not decline the fee for constructing a scene bank and selecting clones with high expression, All media were from Maniatis (T.), Frltsch, Molecular Clonin, E., F., and Sambrook, J. g, Co1d Spring F [arbar Laboratory (19 82). TP medium is composed of M9CA medium, but gel The content of kohl and casamino acids is 0.4% each. Unless otherwise specified, all The medium contains 50 μghQ ampicillin. The growth rate of bacteria during fermentation is 6 Determined by measuring the optical density (OD) of the culture at 00 nm. data - Centage means weight unless other data is reported.

The starting material is the plasmid pH154 known from EP-A O211299. /, 25” (Figure 1) (which is incorporated herein by reference). The plasmid contains the trp-promoter and the antibiotic ampinlin (Amp). A fusion protein gene (D'-protein) linked to a resistance gene for resistance to Contains loin). This fusion protein gene is derived from E. coli Contains a fragment of trpD-protein (D') and sarproinsulin (proin). encodes a fusion protein with From the genetic structure of this plasmid, the fusion The polycistronic I+1R encodes both a synthetic protein and a resistance gene product. NA is obtained. In order to suppress excessive production of resistance gene products, first ( Commercially available) trp-transcription terminus sequence (trpTer) (2) was added to the above two Introduce between structural genes. To do so, open the plasmid with EcoRI and Fill in the protruding ends with Talenow polymerase.

The resulting blunt-ended DNA fragment was ligated with the terminator sequence (2) below. , plasmid piNT12 (Figure 1-(3)).

5°AGCCCGCCTAATGAGCGGCTTTTTTT3°3’TC GGGCGGATTACTCGCCCGAAAAAAAAA5° (2) Departure plastic Sumido pH154/25 enrichment contains the cleavage site of Pvul enzyme in the Amp gene and the t The carboxy-terminal region of the rpD-fragment contains a Hindln cleavage site. subordinate Therefore, these two cleavage sites also contain pINT121m. Pv+d and Two fragments were obtained by cutting the plasmid (Figure 1-(3)) with HindIII. One of them contains the proinsulin gene (Figure 1-(4)) . Contains Ncol and Hindnl restriction cleavage sites in place of the D'-proine gene. Same as (3) except that it has the γ-interferon gene (Ifn) The plasmid pGATTP (Fig. 1a-(5)) constructed using Pvu[ and a fragment containing the promoter region by cutting with HindDI (Fig. 1a-(6)) isolate.

This fragment (6) was ligated with the fragment (4) obtained from (3), and the plasmid plNT40 (Fig. 1a-(7) was obtained. It was treated with Ncol and MluI, and the γ-interactive A small fragment containing the remainder of the feron gene was excised. Large fragment (Fig. 1 b-(8)) is linked with mixed oligonucleotide (9) 5’CATGGCDDCDDCDDDCDDCDD(,DDCDA3’3°CGH HGHHGHHHGHHHGHGHGHTGCGC5° (9) In the formula 5, D is A , G or T, and H means a complementary nucleotide]. This results in a plus A collection of cells (sheet bank) pINT4X was obtained (Fig. 1b-(10)).

The mixture oligonucleotides of the invention can be obtained by methods well known to those skilled in the art. Can be done.

Mixed nucleotide (9) is synthetic mixed nucleotide (9a) TTCGGGTAC CGHHGHHHGHHHGHGHGHGHHTGCGCAG5゜TTGCCC ATGGC3' (9a) was filled in with Frenow polymerase, MluI and Ne By cutting at o, (9a) is obtained.

E. coli WS 3110 strain was transformed with the plasmid assembly (10), and the obtained Plate the collected bacteria on LB agar plates. The six bacterial clones obtained were injected into The ability to produce fusion proteins with surin constructs is tested. For this purpose For this purpose, an overnight culture of clones was prepared in LB medium, and 10 μQ of the culture was added to TP. Medium 10. ! Mix with 5mQ and shake at 37°C. When 0D600=1 , the culture was adjusted to 20 μg/mQ 3-β-indolylacrylic acid (IAA). 10011 (!) of an aqueous solution of Gelcol 40Rg was added, and the resulting preparation was diluted with 37 Shake for an additional 3 hours at °C. A 60D equivalent culture was then removed and containing Collect the bacteria by centrifugation and add test buffer [37.5mM , 5,7M urea, 1% b/v) S D S and 4% (v/v) 2-mercap Resuspend in 300 μρ of ethanol J. The resulting suspension was warmed for 5 min and ultrasonicated. Wave treatment for 2 seconds to reduce the viscosity, then the sample was subjected to electrophoresis on a 5DS-gel. I put it on. Bacteria that produce the fusion protein have a molecular weight of 10.350 D. One can expect a protein band that p, one of the clones It is clear that lNT41 (Table 1) produces a relatively large amount of appropriate proteins. The remaining clones do not show formation of such proteins.

Immunoblot experiments using insulin-specific antibodies revealed that plNT41 It has been confirmed that the protein encoded by It was.

Table 1 lists the DNA and amino acid ballast components for many plasmid constructs. The acid sequence is shown. Specifically, Table 1 shows that in the plNT41 fusion protein Figure 2 shows the DNA and amino acid sequences of the ballast components.

Table 1 12 3 4 5 6 7 8 9 1Q 11pxNT★☆☆☆☆Sac☆☆☆☆ Sac★☆☆☆Touge☆-1-------------☆☆A 69d, 72d Example 2 To detect additional suitable loans, Helfman, D., M., et al. Law CProc, Nat 1. Acad, Sc i, U, S, A , 80:31-35.1983i. For this purpose, 40μm/ - A TP-agar medium, which is a medium further containing IAA, is used. 15 to use 2 minutes beforehand, cover the agar surface of the flat plate with a 2cm thick layer of agar (7). Place a nitrocellulose filter on top and then transform on top of that filter Place the freshly prepared cells. Incubate at 37°C to grow bacterial colonies. A copy is made from the filter, and bacteria from the original filter are lysed. Ta. To do this, place the filter in a dryer under an atmosphere of chloroform for 15 minutes. 1 μg/x (iDNase I and 40 μg/x ρ lysozyme). Immune buffer containing [50mM) Lis pH 75, l 50mM NaCL 5 mM Mg (, L, and 3% (w/v) BSS for 6 hours at room temperature. Wash buffer: vOmM Tris pH 7.5 and and 150 mM NaCl] twice for 5 minutes. Then the obtained fill Incubate the samples overnight at 3°C in immunobuffer containing insulin-specific antibodies. Protein A-Horsadino The ink was incubated for 1 hour in an immunobuffer containing the Nyuberoxidase conjugate. Cells with bound antibodies were removed by washing again with wash buffer for 5 min. Visualization was done by color reaction. Some of the 500 colonies also contain the fusion protein. The clones prNT42 and plNT43, which are producing high quality in extremely large quantities, are identical. It was discovered by DNA obtained by sequencing and amino acids derived from it The acid sequences are also shown in Table 1.

Example 3 Preparation of plasmid pI NT41d Plasmid pINT41 contains the origin of replication, the trp-promoter, and the enzyme N5. Nonessential DNA flanked by p(7524)1 cleavage sites Contains a region. To remove this region, plasmid plNT41 was transferred to N5 p(7524)1, the larger fragment was isolated and religated. to this From this, plasmid prNT41d was obtained. Its DNA sequence is shown in Table 2.

Table 2 DNA sequence G of plasmid pl NT41d Example 4 pl NT41d-Fusion Protein Fermentation and Brosenosong (1) Fermentation pi From E.coli W311C) transformed with NT41d, in LB medium Prepare shaking cultures. Then, 15 μQ of this culture at OD' = 2 was added to TP medium 1 57L and ferment the resulting suspension at 37°C for 16 hours. Then this At the time point, the culture with ○D = 13 was adjusted to 20 μg/ff (IAA, and the final concentration of the fermentation was After another 5 hours, add a 50% (W/V) maltose solution at a speed of 100xj2 until the /hr continuous pump infusion. This method results in 0D=17.5. at the end Then collect the bacteria by centrifugation.

(11) Disruption of cells: Dissolve the obtained cells in disruption buffer [10mM] pH 8 , 0.5mM EDTA] 400*Q, and placed in a French press (French press). hpress) to destroy it. The insulin-containing fusion protein was then injected into 2 Concentrate by centrifugation at 3,500G for 30 minutes and disintegrate slowly. fI? & to order. to this This gives 1'34 g of precipitate (wet material).

(iii) Sulfite decomposition: Precipitate (wet material) obtained in (ii) 12.5 g was stirred at 35°C in 8M urea solution Q125mQ. After stirring for 30 minutes, The pH of the resulting solution was adjusted to pH 9.5 with hydroxide l-I) rum solution, and sulfite was added. It was reacted with 1 g of sodium. After stirring for an additional 30 min at 35°C, tetrathione 0.25 g of sodium chloride was added and the resulting mixture was stirred again for 30 minutes at 35°C. do.

(iv) DEAE = anion exchange chromatography: obtained in (iii) Wash the water with buffer A [50a + M glycine, pH 9,0] 250y, Q. Fractogel 8TSKDEAE-650 (kana) diluted and equilibrated with buffer A. Chromatography column consisting of ram capacity 130iQ, column diameter 26xx) Put it in. After washing with buffer A, buffer A and buffer B [50 pH 9, 0, 3M urea and IMNaC (3 each consisting of 250 x 12 salt groups) Fusion protein-8-sulfonate was eluted with a flow rate of 3 μm/min using a gradient. let

Fractions containing fusion protein-8-sulfonate are then combined.

(v) Folding and enzymatic cleavage 2 Fold the combined fractions obtained in (iv) above. Refolding buffer [50mM glycine, pH 10.7] and volume ratio 1+9 at 4°C. and ascorbyl per liter of the dilution obtained, with gentle stirring. Add 410 zg of phosphoric acid and 165 μQ of 2-mercaptoethanol at 4°C. p After correcting the H value to 10.5, stirring is continued for an additional 4 hours at 46C. Then, N-(2-hydroxyethyl)-piperazine-N″-2-ethane sulfonic acid ( HEPES) solids to 24 g of final concentrate per batch. here pH8 Digest the mixture with trypton at 25°C. During the reaction, the fermentation in the digestion mixture The elementary concentration is 80 μg/L. The course of cleavage is followed analytically by RP-HPLC. . After 2 hours, 130 μg of soybean tryptic inhibitor was added to stop the digestion reaction. Just make it stop.

By HPLC, 19.8 zg of G-Arg insulin was obtained from the mixture of (iii). Formation is observed. Identification of this cleavage product is accomplished by protein sequencing and reference materials. Comparison is performed by HPLC. G-Arg insulin was chromatographed by known methods. It can be purified by chromatography and converted to insulin by carboxypeptidase B can be exchanged.

Plasmid pINT60 allows the insulin precursor, which contains only 9 amino acids, to be No ballast array is obtained. To construct this plasmid, plasmid pl NT40 is cut with Nco and MluI and the resulting vector fragment is isolated. Next and oligonucleotide In5u15: TTCGGGTACCGTTGTTGTAGTTTGAGTTGCGCAG 5 'TTGCCCATGGC3゜ is synthesized, loaded with Tarenow polymerase, and further cleaved with the two enzymes mentioned above.

Next, the obtained DNA fragment was ligated with the above vector fragment to create plasmid pINT Get 60.

Table 1 lists the DNA and amino acid sequences of the ballast components of this fusion protein. It shows.

Construction of plasmid plNT67d Plasmid pr NT67d has the codon at position 9 of the ballast sequence excised. It is a derivative of piNT41d, which has been This is 9 pieces like pINT60. This is why an insulin precursor having a ballast sequence of amino acids can be obtained. H Using the method of O, S, N, et al. [Gene 77:51-59.1989], Build it. For this purpose, plasmid pINT41d and two oligonucleotides Using the octide pair, first perform two separate PCRs: TIR: 5°-CTG AAA TGA GCT GTT GAC-3° and DTR8: 5'-CACAAA TCG AGT TGCTGT TGA TGT TGT-3' or DTR9: 5'-ACA GCA ACT CGA TTT GTG AA CCAG CAC-3' and 1nsull: 5°-TCA TGT TTG ACA GCT TAT C AT-3' This yields two fragments that are partially complementary to each other; When annealed to each other, it is similar to pI NT 41d, which does not have the amino acid at position 9. It encodes an insulin precursor. To do this, we need these two pieces together and perform another PCR with oligonucleotides TIR and In5ull. Ta. The DNA fragment obtained by this method was injected using Neo and 5alI. The structural gene for the phosphorus precursor is released and purified. Then plasmid pINT4 1d was also cut with these two enzymes, the vector fragment was purified, and then the PCR-derived It was ligated with the structural gene fragment to obtain plasmid prNT67d.

Table 1 shows the nucleotide and amino acid sequences of the ballast region of plasmid pr. Construction of NT68d Like plasmid pi NT67d, plasmid ptNT68d has a ballast arrangement. Plasmid plNT in which two amino acid codons at positions 8 and 9 of the sequence are deleted It is a truncated derivative of 41d. Therefore, this allows for roses with only 8 amino acids. An insulin precursor having a strike sequence is obtained. The operations already described in Example 6 Its construction is carried out by the T IR: 5'-CTG AAA TGA GCT GTT GAC-3' and DTRIO: 5'-CACAAA TCG TGCTGT TGA TGT TGT TGC-3゜or DTRII: 5°-TCA ACA GCA CGA TTT GTG AA CCAG CAC-3゜and In5ull 5°-TCA TGT TTG ACA GCT TAT CA T-3゜The nucleotide and amino acid sequences of this ballast region are shown in Table 1. Midopi NT69d also contains three amino acids at positions 7, 8, and 9 of the ballast sequence. A truncated derivative of plasmid plNT41d with a deleted codon. Therefore , this results in a pre-insulin protein with a ballast sequence having only 7 amino acids. A precursor is obtained. Again, its construction is carried out by the operations already described in Example 6. but using the following two oligonucleotide pairs:

TIR: 5°-CTG AAA TGA GCT GTT GAC-3° and DTR12: 5°-CACAAA TCG TGT TGA TGT TGT TGCCAT-3゜or DTR13: 5°-ACA TCA ACA CGA TTT GTG AA CCAG CAC-3' and In5ull: 5°-TCA TGT TTG ACA GCT TAT C AT-3' The nucleotide and amino acid sequences of this ballast region are shown in Table 1. Sumid pTNT72d is a protein that starts from the first codon encoding the amino acid arginine. Induction of plasmid pINT69d lacking the entire C-peptide gene region outside It is the body. This therefore results in a "mi" with arginine residues instead of the C-chain. "Niproinsulin derivative" is obtained. Plasmid pr NT69d as a starting point It is constructed using the operations described in Example 6, but with the following two options: Using oligonucleotide pairs TIR: 5’-CTG AAA TGA GCT GTT GAC-3” and Beauty In5u28: 5’-GAT GCCGCG GOT CTT GGG TGT-3° or In5u27: 5'-AAG ACCCGCGGCATCGTG GAG- 3′ and In5all: 5’-TCA TGT TTG ACA GCT TAT CAT-3' plasmid plNT73d contains the insulin precursor gene continuously. It is a derivative of plasmid plNT69d (Example 8) which is arranged twice. subordinate Therefore, this plasmid has a polycistronic mR that can double the yield. Form NA. Using plasmid pl NT69d, it was extracted by PCR reaction. Perform the construction using the following two oligonucleotides: In5u29: 5'-CTA GTA CTCGAG TTCAC-3' as well as In5ull: 5-TCA TGT TTG ACA GCT TAT CA T-3゜This allows the 5° end region to have a cleavage site for the enzyme Xhol, and the 3° end region to The region of the insulin precursor gene has a 5alI cleavage site and appropriate A fragment containing the bosome binding site is obtained. These two enzymes Cut and purify. Plasmid pINT69d was then linearized with 5alI. The two DNA ends generated are dephosphorylated with phosphatase (derived from calf intestine). , and ligated with the fragment obtained by PCR reaction to obtain plasmid plNT73d.

Plasmid plNT72d (Example 9) was similarly modified to Plasmid plNT88d and pl NT89d is obtained in the same way.

Example 11 Construction of plasmid I NT41d The starting plasmid pRUD3 has a structure similar to that of the plasmid pGATTP. ing. However, the plasmid contains Ec instead of the trp-promoter region. tac-promoter flanked by cleavage sites for oRI and Nco enzymes - Contains a region. This plasmid was cut with EcoRI to expose the cleavage site. Fill in the ends with Talenow polymerase. Then, cut with Nco and Isolate the promoter fragment.

The trp-promoter of plasmid plNT41d is PvuII and Nc.

Flanked by enzymatic cleavage sites. This plasmid becomes Pvu■ Since it further contains a cleavage site for P, it is completely cleaved with Ncol, but P vufl cuts only partially. Then, from the subsequent fragments obtained, A vector fragment in which only the motor region is deleted is isolated. Next, add this to tac- Ligate with the promoter fragment to obtain plasmid plNT41d.

Plasmid pPL-λ (available from Pharmacia) It has a promoter region. This region has the nucleotide sequence: 5'-GATCTCTCACCTACCAAAC^^T-3' and Frankin by 5°-AGCTAACTGACAGGAG^^TCC-3° is being logged.

The promoter region containing the cleavage sites for EcoRI and Nco enzymes was further furanized. oligonucleotide LPL3: 5'-ATGAATTCG ATCTCTCACCTACCAAACAAT-3' and LPL4・5”-TTGCCATGGGGATTCTCCTGTCAGTTTA Prepare GCT-3'. Using these oligonucleotides and pPL-lambda PCR was performed, and the obtained promoter fragment was cut with EcoRf and Neo. isolate Next, the plasmid plNL41d was also cut with Lanoenzyme, and then the plasmid plNL41d was The subsequent vector fragment without promoter is called λ-PL-promoter fragment. Ligate to obtain plasmid pL41c.

Located between the resistance gene and the fusion protein gene in plasmid pL41c trp-transcription terminator is used in E. coli strains suitable for fermentation (e.g., E. coli). oli N4830-1) is not valid. Therefore, polinstronic mRNA A and thus a large amount of resistance gene product are formed during fermentation. This side reaction To prevent this, the trp-terminator sequence was Replace the terminator with a valid terminator sequence. Plasmid pANGMA is a plasmid prNT41d or has a structure similar to prNT41d or is a substitute for the fusion protein gene. the an7ogenin gene and the rr instead of the trp-terminator sequence. nB-terminator sequence (commercially available from Pharma) (obtained from Sumid pKK223-3). Pvul’ this plasmid and 5alI and isolate the fragment containing the rrnB-terminator. . Next, plasmid 1) L41c was also cut with these two enzymes to extract the insulin residue. The fragment containing the gene is isolated.

The two isolated fragments are then ligated to obtain plasmid pL41d.

★ Absolutely 14” Construction of plasmid pI NrLI To prepare plasmids commonly used for expression of fusion proteins, Replacement of proinsulin gene in lasmid plNT4id with polylinker sequence Ru. This gene is flanked by cleavage sites for the Mluf and 5ail enzymes. has been done. Therefore, this plasmid was cut with these two enzymes, and the vector – Isolate the fragment. This is then linked to the following two synthetic oligonucleotides: and obtain plasmid plNTL/I.

-EstE ACCZ EcoRX KpnxBazarSph Engineering Unpa x PstX HLndXXX (5alI).

The gene encoding HMGCoA-reductase in plNTLI (active drive Insertion and fusion protein expression of HMG’CoA- The DNA and amino acid sequences of the reductase gene are shown. EP-A 0 HMG C known from 292 803 (incorporated herein by reference) The synthetic gene for oA-reductase consists of Leu and Val amino acids at positions 3 and 4. It contains a BstE II cleavage site within the region (see Table 3). Xb a) An overhanging sequence corresponding to the enzyme is present at the end of the gene (non-coding region within the region). The corresponding cleavage site within the polylinker of plasmid pINTLI is within the same reading frame. These two parts are separate (hard).

Plasmid pUH10 contains the complete HMG gene ( Contains HMG fragments I, ■, ■, and ■). Construction of pUHIO (Figure 2) EP-A O292803 (incorporated herein by reference). ). Briefly, the gene fragment HMG I is subcloned into HMG ■. In order to further construct the complete gene, specific plasmids are prepared. These programs Lasmids are commercially available vectors pUc18, pUc19 and M13mp18. or derived from M13mp19, but whose polylinker region is Replaced by the corresponding new synthetic polylinker:

These new plasmids, in contrast to the pUC and M13mp plasmids, are restricted The advantage of being able to clone a DNA fragment with an overhanging sequence for the enzyme Neo It has points. Furthermore, Neo, EcoRI.

The recognition sequences for the HindI[[, BamHI and XbaI cleavage sites are completely It is contained exactly in the vector present in the HMG gene, and its This facilitates subsequent cloning and construction of this gene. Therefore, genetic The child fragment HMCI can be subcloned into the new plasmid HMG IV. Wear. After amplifying the resulting gene fragments, they are combined to obtain the complete gene. (see below).

a. Preparation of a vector with DNA sequence similarity The DNA sequence ① is prepared by a conventional method. can be done. Commercially available plasmid pUc18 (or pUc19, M1 3a+p1B or M13mp19) with the restriction enzyme E co according to the manufacturer's instructions. RI/H1ndI[I opens the ring. Electrolyze the digestion mixture on a 1% agarose gel. Fractionate by electrophoresis. Plasmi visualized by ethidium bromide staining The hand is excised and eluted from the agarose by electrophoresis. In this way The remaining 20 fmol of the obtained plasmid was transformed into DNA corresponding to the DNA sequence ■. Ligate with 200 fmol of the fragment overnight at room temperature.

This will make the new Ronning Hector psU18 (or psU19, M13m US18 or M13mUS19) is obtained. In contrast to commercially available starting plasmids The new plasmid obtained contains the restriction enzyme Nc.

It can be cut with Inserted through EcoRI and HindI [I cleavage sites The polylinker that is added destroys these pre-existing cleavage sites, so Restriction enzymes EcoRI and HindnI also restrict these plasmids only once. disconnect.

b Preparation of hybrid plasmid containing gene fragments HMG I to HMG IV i) Plasmid containing gene fragment HMG I as described in Example 15(a) above Cut plasmid psU18 with restriction enzymes EcoRI and Nco as follows. The ring is opened and ligated with previously phosphorylated gene fragment I.

100) Plasmid gene sub-fragment HM G containing gene fragment HMG II -1, ll-2 and ll-3 were plasmided with EcoRI/Mlul. , Mlul / Bs5HI I or Bs5HII / Hind [[ restriction enzyme The gene fragments HMG ll-1, HMG ll-2 or HM Isolate G It-3. Next, the obtained fragment was purified by Eco by a known method. Ligate with plasmid psU18 opened with RI/H1ndIII .

111) Plasmid gene sub-fragment HMG containing gene fragment HMGIIJ [[-1 and lll-3 plasmids were digested with restriction enzyme E coRI/H1 Digested with ndI[I and then cut with 5au961 to generate the gene fragment HMG [[- 1 or cut with BamHI/Ban1I to obtain the gene fragment HMG Isolate m-3. These fragments were combined with HMGm-2 fragment into H1ndDI/ B: Insert into plasmid psU18 which has been opened with amHI.

iv) Plasmid gene sub-fragment HMG I containing gene fragment HMGIV Plasmids containing V-(1+2) and ■-(3÷4) were treated with restriction enzyme E, respectively. coRI/B ring-opened with amHI and EcoRI/Xba+, obtained Electrophoresis of gene fragments HMG IV-(1+2) and HMG IV-(3+4) Purify by EcoRI is then cleaved with S1 nuclease as follows. BamHI/Xbal-opened psU with previously destroyed cleavage site The resulting fragment is ligated into the 18 plasmid. Additional AA in DNA sequence■ A hybrid plasmid is obtained that still contains the TT nucleotide sequence. At this point The resulting hybrid plasmid was opened by digestion with the restriction enzyme EcoRI and The exposed AATT end is removed with 81 nuclease.

For this purpose, 1 μg of plasmid was added to 200 mM NaCρ after EcoRI digestion. and 50mM sodium acetate containing 1mM zinc chloride) Lamb buffer (pH 4,5) Incubate with 2 units of S1 nucleic acid at 20°C for 30 minutes. profit The resulting plasmid is recircularized via blunt ends by known methods. gene cut A hybrid plasmid containing the fragment ■ is prepared manually.

c. Construction of hybrid plasmid pUH10 containing DNA sequence V The hybrid plasmid containing the fragment was opened with EcoRI/Hindlll and the corresponding Hybrid plasmid EcoRI/Hind [[obtained by restriction enzyme digestion] Connect with fragment HMG U. Then, the obtained plasmid was transformed into H1ndlII/ B Fragment H that can be obtained from the corresponding plasmid using amHI Connect with MG I [. Next, the plasmid thus obtained was transferred to BamHr /Xbal to open the circle and transform the corresponding plasmid into BayaHI/X, baI It is ligated with the fragment HMGTV obtained by digestion. Complete H corresponding to DNA sequence sequence A hybrid plasmid pUH1o containing the MG gene is obtained. Figure 2 shows pU This is a map schematically representing Hlo, roriJ and rA p'J are pUc1 The orientation of the remaining plasmid corresponding to 8 is shown.

Cut pINTLI with BstEII and Xbal, isolate the large fragment, On the other hand, plasmid pUH10 (Fig. 2) was digested with the same enzyme, and the plasmid-derived If you have isolated fragments that contain most of the DNA sequence sequences, you can combine these two fragments. After concatenation, the first eight addresses of the ballast array of pIN"r41d (Table 1) The amino acid is preceded by alkynine, followed by HMGCo starting from Leu3. The fusion protein is followed by the structural gene of the active domain of A-reductase. A food plasmid is obtained. For comparison, the two initial plasmids were transformed into Nco and XbaI enzyme and ligated the corresponding fragments together, starting at the start codon. immediately followed by a plasmid encoding the active domain of HMGCoA-reductase. (The DNA sequence of EP-A O292803 is the same as that of EP-A O292803. See Table 3. ).

Expression of the encoded protein is performed according to Example 4. After disrupting the cells, centrifuge By this, the expected protein of about 55 kDa in the supernatant was subjected to gel electrophoresis. more recognized. Here, the fusion protein band represents the directly expressed protein. It has stronger strength than wood. Aliquots of 100 μe of supernatant were undiluted, 1:10 and 1:100 dilution, respectively, for the formation of metbutonate. I tested it. For further comparison, the fusion protein of Example 4 (proinsulin The fusion protein with the protein composition is tested. At any of these three concentrations I can't see if it's active even if it's there. Fusion protein with HMG CoA-reductase component The protein showed the greatest activity at all three dilutions, with the product of direct expression at the highest concentration. It shows a gradually changing activity depending on the degree of This means that the fusion protein This shows that expression is at least 100 times better.

Core a 3 deficiency ψbe ((No.? Foot.

48　f　＜Q = Scarcity = Shi...

−←　Older　■ U　←　＜−υ ri0ri 5L. . ... -I+=7 ←← Tomi 9 = ro -(leek uu) ζL), JCJ −υ Bow E Tamayo Omiji 5 pieces -5. .

Engineering u　+JCJ　:l:CJ z:i yoyo=poor α←　ψlj　:+( C1) + scarcity ′: i issue Loop 7 ′U　′″　3 deficiency ==. l-□ 0←Ro　0""nibujin ~ Engineering (rMI-← to>U tυ 37-　 One to 38 -( Stagnation = υ 27　＜o　″′← force←　I　　：l← engineering u ff1c puto TS deficiency υIs tll (uυ −←　−υ　−←　＃人 zI+ −← egh h← Yodo 2 - (T←uLj Bu Il: 1tcJ 5 (50 >t3. h:! :: Jin − to −← to rumors −← ″＋　Koji　3　z　z I+a ward υfu← 工＜　1＋（：小　−← 0JCJ Rort<　01l11+ :jtJF’l(1+. 工.■−〇−ト Example 16 Plasmid pi NT41d was cleaved with Ml u' I and 5al I, and the large Isolate the fragments. The plasmid PIK4 shown in Figure 3a contains only arginine. Construction of this plasmid containing the gene for the C chain: mini-proinsulin. has already been published in EP-A 0,347,781 (herein incorporated by reference). Are listed. Briefly, the commercially available plasmid pUC19 was The ring was opened with restriction enzymes KpnI and PstI, and the large fragment (Figure 3-(L)) was reduced to 0.8%. Strength [Seap'1aque] Separate with gel. this fragment , T4 DN using DN A synthesized according to Table 4 (Figure 3-(2)) React with A ligase. Table 4 shows the sequence of the migene fragment 1'KI. , Table 5 shows the sequence of the gene fragment IKII.

This ligation mixture was then combined with competent E. coli 79102 cells. I hate inky. The resulting transformation mixture was treated with 20 mg/ρ ampi/phosphorus. Plate on containing IPTG/X gal plates.

Plasmid DNA was isolated from the resulting white colonies and subjected to restriction analysis and DNA alignment. Characterize by column analysis. The desired plasmid is named plKl (Figure 3).

Therefore, DN A (Figure 3-(5)) in Table 5 can be changed to Pstl and HindlI It is ligated into pUc19 (Figure 3-(4)) which has been ring-opened with T. This will cause the plastic Obtain Sumid plK2 (Figure 3).

DN A sequences (2) and (5) of Figure 3 according to Tables 4 and 5 on a plasmid. Reisolated from pIK1 and pTK2, using Kpnl and HindlI [ It is ligated to the ring-opened pUc19 (Fig. 3 (7)). In this way, the modified Plasmid p[K3 is obtained encoding the insulin sequence (Fig. 3).

Open the plasmid pIK3 with Mlul and SpeI and isolate the large fragment. (Figure 3a-(9). It is added via a codon and replaces the codon for the first seven amino acids of the A chain. , and also a DNA sequence with added codons for amino acids 8 and 9 of this chain (I O): Connect with. In this way, we coded for human miniproinsulin. 4 is obtained on the plasmid p+ (Fig. 3a).

In Tables 4 and 5, the B- and A-chains of the insulin molecule are These are the individual ones indicated by no acids. The coding region of the gene fragment IKI [ Next, there is a 5a11 cleavage site that can be used for subsequent constructions.

Plasmid pIK4 was cut with Hpal and 5all to create “mini-proinsulin”. ” is isolated. This gene was extracted from the large pINT41d above. Fragment and link with the following synthetic NA sequence ・[3+ (Thr) Arg Met Gly Arg PheCG CGT ATG G GCC (1; T TTCGTTA TACCCG GCA AAG CAA (M lu! ) (Hpa I) This allows the ballast array (Table 1, row 1) to be changed to Met-G 1y-A rg precedes the amino acid sequence, and the amino acid sequence is the amino acid sequence of “mini-proinsulin”. Plasmid pB70 was obtained which encodes a fusion protein preceded by a amino acid sequence. It will be done.

Table 4 Gene fragment IKI (2) Cτ Ding T’G GACAAG ACA ττCGTτ Enter ACCAA CAC TTCTGT　GGT　TCT　CACCAT　(4^　AACCTG　TTC TCT　AACCAA　TTG　GT-GTG　ACACA　CCA　A(J GTG<−−−−−−−−−−−−−−−−−−−−−−−−−−−−−1− 1−−−−−−−−−−−−−−7=−−−−−−−−−−−−−>(Kpn engineering) Hpa! 5Q 5Q 70 80 90 TTG GTC to AA GCG TTC; TACTTG GTT TGT GT　GAG　CCT　GCT　TTCTTCAACCACCTT　CGCAA Enter CATG AACCAA ACA CCA CTCGCA CCA AA AG<　−−−−−−−−−−−−−−−−−−−−−−−−−−− −−−−−−−−−−−−−−3−−−−−−−−−−−−83゜ τhr　Arg　Lys　Gly　Se’l:　Leuloo　110　120 TACACT CCA AAG ACG CGT MG GC, T TCT C TG CAATG↑A GGT TTC [TTCCCA M; A GMlu engineering (Pet engineering) Table 5 Gene fragment IK II (5) in Lys Arg Gly G) JkG CGT CGT 8TCGTT G input AC input TGT TCT 8CT 8GτAτCT'GT τCTACGTCTTCGCA CCA T AG CAA CTT GTT ACA ACA TGA Engineering ΔTAG 8C A ACA (Pg SE) Sp@E F1 170 180 Yu90 200 210TTCTACCAG CTG CAA Input AC77ICTCT Input ACTCA TACTCG Input CCCAτ CGA AACATG GTCGACCTT TTCATG ACA Ding T ACT ACT AGCT (, to GTA CCT TCG A (H on ncH) Example 17 By using the oligonucleotides described below, plNT96d is obtained from p[NT90d in the same manner.

The asterisk indicates a hooded amino acid in the same ballast composition as pl NT41d. Ru.

The Arg codon or M at the end of the ballast component and within the “mini C chain” plNT92 replaces the codon of plasmid pINT. 72d encodes a double mutation in the insulin derivative encoded by ing. Therefore, the expressed preproduct can be cleaved with noan bromide.

p engineering NT90d: ******cNsA* (mutant of p l NT 59d ) T engineering R: 5’-CTGAAATGAGCTGTTGAC-3 and Engineering n5u50: 5’-TGCCGAATTTCCTGTTGATGTT GTTGC-3' or Engineering n5u49: 5’-GGAAAATTCGGCACGATTTrGTGA ACCAG-3'pINT91d: ＊＊＊＊＊＊GNSA* (p(NT 7 2d] Mutant) T-engineer: 5'-CTGAAATGAGCTGTTGAC-3 'as well as Engineering nsu 50: 5’-TGCCGAATTTCCTGTTGATGT TGTTGC-3' or Engineering n5u49: 5’-GGAAAATTCGGCACGATTTGTGA ACCAG-3' and Engineering n5ull = 5’ -TCATGTTrGACAGCTTATCAT- 3’p engineering fr92d: (double mutant of p I N T 72 d) engineering n5 u56: 5'-TCGACCATGGCAACAACATCAJkCAATG TrTGTG-3 and Engineering n5u5B = 5’-GATGCCCATGGTCTT-3’ or Engineering n5u57: 5'-AAGACCATGGGCATC-3' and Engineering nsu　11:　5　　-TCATGTTTGACAGCrTATCAT- 3’Kan NT93d: ☆★☆☆☆☆ (mutant of plNT68d) engineering n5u53 :　5　　-ACCATGGCAACAACATCAACAAACGATT TGTG-3' and ■n5ull: 5’ -TCATGTTTGACAGCTTATCAT- 3’p engineering NT94d: *★* Pass☆ (mutant of plNT68d) engineering n5u54: 5'-ACCATGGCMCAACATCMACCACGATI'rGTG -3〆and Engineering n5ull: 5’ -TCATGTTTGACAGCTTATCAT- 3'p NT95d: sac☆sac★sac (mutant of pINT68d) ■n su 55: 5’-TCGACCATGGCAACAACATCAACAAT GCGATTTGTG -3〆and Engineering n5ull: 5’ -TCATGTTTGACAGCTTATCAT- 3’p engineering NT96d: ☆☆★★☆★ (variant of plNT68d) engineering n su7 1:　5　　-ACCATGGCAACAACATCAACAGGACGAT TTGTG-3' and Engineering n5u1.1:　5　　-TCATGTTTGACAGCTTATCAT- 3’XbaI FIG.2 international search report 1sImmleMIAeka-+1*, PCTri/11590106840

Claims (18)

[Claims] 1. Method for preparing fusion proteins containing desired proteins and ballast components And, (a) constructing a mixed oligonucleotide encoding the ballast construct; (b) the mixed oligonucleotide contains the regulatory region and the structural gene of the desired protein; inserting the mixed oligonucleotide into a vector such that it is operably linked to a child; (c) transforming the resulting vector assembly into host cells, and (d) transforming the fusion protein into host cells. One or more clones expressing large amounts of protein are transformed into A method characterized by selecting from the body. 2. The oligonucleotide facilitates extraction of the desired protein from the ballast construct. encodes at its 3' end a coding chain of amino acids or groups of amino acids that can be cleaved into 2. The method according to claim 1, wherein: 3. 3. The method of claim 2, wherein said cleavage is enzymatic cleavage. 4. The oligonucleotide is directed to a soluble or easily solubilized fusion protein. 2. The method of claim 1, wherein the method of designing an ocide. 5. the ballast components do not interfere with the desired protein folding. 2. The method of claim 1, wherein the oligonucleotide is designed. 6. The oligonucleotide sequence: (DCD)x A DNA sequence represented by [wherein D is A, G or T, and x is 4 to 12] 2. A method according to claim 1, comprising a sequence (cipher chain). 7. 7. The method of claim 6, wherein x is from 4 to 8. 8. The oligonucleotide has the sequence: ATG(DCD)y(NNN)z [In the formula, N is the same or different nuclease that is other than a stop codon as NNN] otide, z is 1 to 4, y+z is 6 to 12, and y is at least is also 4]. 9. 9. The method of claim 8, wherein y+z is from 6 to 10. 10. 9. The method of claim 8, wherein y is from 5 to 8 and z is 1. 11. The oligonucleotide has the sequence: ATG GCW (DCD) 4-8CGW [In the formula, W is A or T] The method according to claim 6, having a sequence (code chain) shown in . 12. The oligonucleotide has the sequence: ATGGCA(DCD)4-7CGW 12. The method according to claim 11, having the sequence shown in . 13. the desired protein is proinsulin; the oligonucleotide (coding strand) but ATG GCW(DCD)y' ACG CGW or ATG GCD(DCD)y' ACG CGT [wherein D is A, G or T, W is A or T, and y' is 3 to 6] ] The method according to claim 1. 14. 14. The method of claim 13, wherein y' is from 4 to 6. 15. 3. The method of claim 2, wherein the desired protein is proinsulin. 16. Claim that proinsulin has a different C chain from human proinsulin The method according to item 15. 17. The C region gene is designed such that the C chain can be excised along with the ballast component. 17. The method of claim 16. 18. 18. The method according to claim 17, wherein the C chain is composed of arginine.