JPH05199885A - Yeast ste11 homologous protein phosphorylation enzyme gene of solanaceae plant - Google Patents

Abstract

PURPOSE:To provide the STE11 homologous protein phosphorylation enzyme gene of a Solanaceae plant, a plasmid containing the enzyme, and a transformant holding the same. CONSTITUTION:A protein phosphorylation enzyme gene STE11 exhibiting the property homologous with the protein phosphorylation enzymatic gene STE11 of a yeast is collected from a Solanaceae plant, while a tobacco protein phosphorylation gene fragment CA7 is employed as a probe. Thereby, the production of a plasmid holding the gene and a transformant holding the plasmid permits to artificially control the generation of a gene relating to the differentiation, elongation and growth of a plant by the inhibition or activation of the protein phosphorylation enzyme and to control the yield, shape, etc., of the crop.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to yeast ST of a Solanaceae plant.
The present invention relates to a gene encoding an E11 homolog protein kinase, a plasmid containing the gene, and a transformant carrying the gene.

[0002]

2. Description of the Related Art Plants respond to external stimuli such as chemical substances such as plant hormones such as auxin and cytokinin, stress such as high temperature, drought and injury, and various responses such as differentiation, dedifferentiation, growth and elongation. Indicates. If it is possible to artificially control the response of these plants to stimuli, for example, it is possible to perform molecular breeding on crops with high yields, drought-resistant crops, and the like. However, the conventional techniques could not control the signal transduction until the response of the plant to these stimuli.

[0003]

On the other hand, in animals and yeasts, the intracellular signal transduction mechanism is becoming clear. In animal cells, receptors on the cell membrane receive stimuli from the outside world, and after mediated by some proteins, they activate certain protein kinases, which phosphorylate other proteins. In addition, a signal is transmitted throughout the cell by a series of cascades in which the following specific proteins are phosphorylated. Thus, in yeast and animals, protein phosphorylation plays an important role in intracellular signal transduction. In plants as well, it is known that proteins that are phosphorylated in response to auxin exist in the cell membrane or nucleus, and that elicitors cause phosphorylation of membrane proteins.
The present inventors considered that there may be a gene encoding a protein kinase having an important function in the process of reaching a response such as differentiation, dedifferentiation, proliferation, elongation, etc. in plants. Therefore, we have already synthesized a part of the base sequence deduced from the amino acid sequence conserved in protein kinases in the catalytic region of protein kinases in animals and yeasts, and used this as a primer for the culture of tobacco cells. Polymerase chain reaction (PCR) was performed using the cDNA as a template to isolate a gene fragment CA7 considered to be a part of protein kinase (Sakano, Muranaka, Moribe, Machida, Japan Plant Physiology Society 1
991 Annual Meeting Lecture Collection, p. 74). Therefore, it was confirmed that it was necessary to isolate the protein kinase enzyme in plants, convincing that there was a protein kinase enzyme corresponding to gene fragment CA7.

[0004]

[Means for Solving the Problems] As a result of diligent efforts to obtain a protein kinase gene for the purpose of artificially controlling signal transduction in plants, the present inventors have found that yeast STE11 homolog protein phosphorylation. We succeeded in cloning the enzyme gene and determining its nucleotide and amino acid sequences.

[0005]

The yeast STE11 homolog protein phosphatase gene obtained in the present invention is expressed in a transformant to produce the enzyme, and an inhibitor of the catalytic reaction of the enzyme or a catalytic reaction It can now be used in the accelerator development process. By inhibiting or accelerating the enzyme, it has become possible to artificially control gene expression involved in plant differentiation, elongation, proliferation, etc., and control crop yield, morphology, and the like. Furthermore, by introducing the gene obtained by the present invention or a gene sequence complementary thereto into a higher plant to express it, artificially control the gene expression involved in plant differentiation, elongation, and proliferation, and thereby improve the yield of crops. , It became possible to control the form and so on.

The present invention will be described in detail below. A first object of the present invention is to provide a gene encoding a yeast STE11 homolog protein kinase. A preferred gene is a gene encoding the following amino acid sequence.

[0007]

[SEQ ID NO: 1]

More preferred are the genes represented by the following nucleotide sequences.

[SEQ ID NO: 2]

A second object of the present invention is to provide a plasmid containing a gene encoding the yeast STE11 homolog protein phosphorylating enzyme. A preferred plasmid is a plasmid prepared by cloning the above gene into pBLUESCRIPT (Stratagene). Further, a third object of the present invention is to provide a transformant carrying a plasmid containing a gene encoding a yeast STE11 homolog protein phosphorylating enzyme.

The yeast STE11 homolog protein phosphatase gene of the present invention can be obtained from the solanaceous plant, for example, Nicotiana tabacum tobacco. CDNA prepared by synthesizing mRNA prepared from tobacco cultured cells by reverse transcriptase is incorporated into a phage vector such as lambda gt10 or a plasmid vector such as pBR and pUC to prepare a cDNA library. This library is screened using the gene sequence corresponding to the catalytic region of protein kinase as a probe to obtain the protein kinase gene. The cDNA obtained by selection can be confirmed to be a protein kinase enzyme by determining its nucleotide sequence. A transformant that produces a protein kinase by introducing the recombinant plasmid thus prepared into an appropriate host cell, for example, microbial cells such as Escherichia coli and yeast, or animal cells or plant cells Can be manufactured. E. coli,
A method for introducing DNA into yeast, animal cells or the like is in accordance with a known method, and for example, use of CaCl ₂ -treated competent cells, electroporation method, protoplast method, calcium phosphate method and the like can be used. In addition to this, it is possible to use an expression vector suitable for each host cell, and various expression vectors for E. coli are commercially available. GAL1 for expression in yeast
-GAL10 promoter, ADH promoter, PG
An expression vector containing a K promoter or the like can be used, and an expression vector containing an SV40 promoter can be used for expression in animal cells.

Further, the recombinant plasmid can be directly introduced into the plant cells by a known method using the electroporation method, the particle gun method or the like. The introduced gene is integrated into the plant chromosome and replicates and propagates as a part of the plant gene.
Moreover, the gene of interest can be obtained by a known method (for example, M.
Berma, Nucleic Acid Research, 12
Vol., Pp. 8711-8721, 1984) and incorporating it into a binary vector such as pBI101 and introducing it into Agrobacterium tumefaciens such as LBA4404 strain to introduce Agrobacterium into plant roots, stems, leaves, etc. A transformed plant can be obtained by infecting a tissue and introducing a gene. The introduced gene is introduced into the plant chromosome and replicates and grows in plant cells. Binary vectors are commercially available, pBI1
01, pBI221, etc. can be used. Agrobacterium tumefaciens LBA4404 strain is also commercially available. For expression in plant cells, constitutively expressed promoters such as the cauliflower mosaic 35S promoter, promoters of par gene specifically expressed in organs such as roots, and rab, lea, em induced by plant hormone abscisic acid. And the like, and a promoter of phenylalanine ammonia-lyase gene induced by injury treatment and the like can be used.

[0012]

The present invention will be described in more detail with reference to the following examples. It is needless to say that the present invention is not limited to the following examples, and ordinary modifications can be made in the technical field of the present invention. Example Preparation of cDNA Library Tobacco cultured cells BY-2 were shake-cultured in 100 ml of LS medium (Linsmaier and Skood, 1965) supplemented with 2 μg / ml of 2,4-dichlorophenoxyacetic acid at 26 ° C. for 1 week. Each material was obtained by subculturing 1/100 amount. MRNA having poly (A) was prepared from the cells on the 5th day of culture by a conventional method. Prepared mRNA
CDNA synthesis from S. aureus followed the method of Gubler and Hoffman. That is, first, an oligo (dT) primer was annealed to the poly A tail of poly (A) RNA, and then reverse transcriptase (Superscript R, manufactured by BRL Inc.).
First strand cDNA complementary to poly (A) RNA was synthesized by NaseH-). Next, a nick and a gap were made in the RNA chain using RNase H of Escherichia coli (Takara Shuzo). Using the resulting RNA fragment as a primer, E. coli DNA polymerase I (Takara Shuzo)
The RNA strands of the RNA / DNA hybrid were sequentially replaced with DNA strands by the above method, and then treated with T4 DNA polymerase (Takara Shuzo) to synthesize double-stranded cDNA having blunt ends. 1 μg of double-stranded DNA synthesized in this way
, Using T4 DNA ligase (Takara Shuzo), EcoRI-N
The otI-BamHI adapter (Takara Shuzo) was connected. Finally, double-stranded DNA (30 ng) with an adapter ligated
Escherichia coli C600 was prepared by in vitro packaging with Lambda gt10 (2 μg) cleaved with EcoRI by a conventional method.
A library consisting of 800,000 lambda plaques was prepared using the hf1 strain as a host.

Protein phosphatase cDNA clone
Of screening tobacco protein phosphorylation enzyme gene fragment CA7 (Banno, village, Moribe, Machida, Japan Society of Plant Physiologists 1991 Annual Meeting Abstracts, page 74) was carried out plaque hybridization as a probe. That is, E. coli C600hf1 was infected with 800,000 cDNA library phages, the formed plaques were transferred to a nylon filter, and the gene fragment CA7 was hybridized with a probe labeled by the multiprime method at 65 ° C. overnight. In this way, the result of the primary screening, 1
Three positive signals were obtained. Further, secondary and tertiary screening was performed to isolate a phage clone having a 3.8 kb insertion site.

Determination of the nucleotide sequence of the cDNA insert,
And determination of amino acid sequence of protein kinase The nucleotide sequence of the cDNA insertion site 3.8 kb was determined. The positive phage clone was designated as pBLUESCRIPT.
It was cloned into SK-chain (Stratagene) to obtain a plasmid. The plasmid and a plasmid obtained by subcloning the plasmid into pBLUESCRIPT SK-chain (Stratagene) were used as pBLUE
Using the sequence of SCRIPT as a primer, 7-deaza d
The nucleotide sequence was determined by the dideoxy method using GTP and Sequenase (UBC). From the determined nucleotide sequence, it was revealed to constitute a protein consisting of 690 amino acids. This protein is found in yeast STE11 in the protein kinase catalytic domain.
And 47% of amino acids are completely the same, and yeast STE11
It was found to be a homologous protein kinase.

[Sequence Listing] SEQ ID NO: 1 Sequence length: 690 Sequence type: Amino acid Topology: Linear Sequence type: Peptide sequence Met Gln Asp Phe Ile Gly Ser Val Arg Arg Ser Leu Val Phe Lys 1 5 10 15 Gln Ser Gly Asp Phe Asp Thr Gly Ala Ala Gly Val Gly Ser Gly 20 25 30 Phe Gly Gly Phe Val Glu Lys Leu Gly Ser Ser Ile Arg Lys Ser 35 40 45 Ser Ile Gly Ile Phe Ser Lys Ala His Val Pro Ala Leu Pro Ser 50 55 60 Ile Ser Lys Ala Glu Leu Pro Ala Lys Ala Arg Lys Asp Asp Thr 65 70 75 Pro Pro Ile Arg Trp Arg Lys Gly Glu Met Ile Gly Cys Gly Ala 80 85 90 Phe Gly Arg Val Tyr Met Gly Met Asn Val Asp Ser Gly Glu Leu 95 100 105 Leu Ala Ile Lys Glu Val Ser Ile Ala Met Asn Gly Ala Ser Arg 110 115 120 Glu Arg Ala Gln Ala His Val Arg Glu Leu Glu Glu Glu Val Asn 125 130 135 Leu Leu Lys Asn Leu Ser His Pro Asn Ile Val Arg Tyr Leu Gly 140 145 150 Thr Ala Arg Glu Ala Gly Ser Leu Asn Ile Leu Leu Glu Phe Val 155 160 165 Pro Gly Gly Ser Ile Ser Ser Leu Leu Gly Lys Phe Gly Ser Phe 170 175 18 0 Pro Glu Ser Val Ile Arg Met Tyr Thr Lys Gln Leu Leu Leu Gly 185 190 195 Leu Glu Tyr Leu His Lys Asn Gly Ile Met His Arg Asp Ile Lys 200 205 210 Gly Ala Asn Ile Leu Val Asp Asn Lys Gly Cys Ile Lys Leu Ala 215 220 225 Asp Phe Gly Ala Ser Lys Lys Val Val Glu Leu Ala Thr Met Thr 230 235 240 Gly Ala Lys Ser Met Lys Gly Thr Pro Tyr Trp Met Ala Pro Glu 245 250 255 Val Ile Leu Gln Thr Gly His Ser Phe Ser Ala Asp Ile Trp Ser 260 265 270 Val Gly Cys Thr Ile Ile Glu Met Ala Thr Gly Lys Pro Pro Trp 275 280 285 Ser Gln Gln Tyr Gln Glu Val Ala Ala Leu Phe His Ile Gly Thr 290 295 300 Thr Lys Ser His Pro Pro Ile Pro Glu His Leu Ser Ala Glu Ser 305 310 315 Lys Asp Phe Leu Leu Lys Cys Leu Gln Lys Glu Pro His Leu Arg 320 325 330 His Ser Ala Ser Asn Leu Leu Gln His Pro Phe Val Thr Ala Glu 335 340 345 His Gln Glu Ala Arg Pro Phe Leu Arg Ser Ser Phe Met Gly Asn 350 355 360 Pro Glu Asn Met Ala Ala Gln Arg Met Asp Val Arg Thr Ser Ile 365 370 375 Ile Pro Asp Met Arg Ala Ser Cys Asn Gly Leu Lys Asp Val Cys 3 80 385 390 Gly Val Ser Ala Val Arg Cys Ser Thr Val Tyr Pro Glu Asn Ser 395 400 405 Leu Gly Lys Glu Ser Leu Trp Lys Leu Gly Asn Ser Asp Asp Asp 410 415 420 Met Cys Gln Met Asp Asn Asp Asp Phe Met Phe Gly Ala Ser Val 425 430 435 Lys Cys Ser Ser Asp Leu His Ser Pro Ala Asn Tyr Lys Ser Phe 440 445 450 Asn Pro Met Cys Glu Pro Asp Asn Asp Trp Pro Cys Lys Phe Asp 455 460 465 Glu Ser Pro Glu Leu Thr Lys Ser Gln Ala Asn Leu His Tyr Asp 470 475 480 Gln Ala Thr Ile Lys Pro Thr Asn Asn Pro Ile Met Ser Tyr Lys 485 490 495 Glu Asp Leu Ala Phe Thr Phe Pro Ser Gly Gln Ser Ala Ala Glu 500 505 510 Asp Asp Asp Glu Leu Thr Glu Ser Lys Ile Arg Ala Phe Leu Asp 515 520 525 Glu Lys Ala Met Asp Leu Lys Lys Leu Gln Thr Pro Leu Tyr Glu 530 535 540 Gly Phe Tyr Asn Ser Leu Asn Val Ser Ser Thr Pro Ser Pro Val 545 550 555 Gly Thr Gly Asn Lys Glu Asn Val Pro Ser Asn Ile Asn Leu Pro 560 565 570 Pro Lys Ser Arg Ser Pro Lys Arg Met Leu Ser Arg Arg Leu Ser 575 580 585 Thr Ala Ile Glu Gly Ala Cys Ala Pro Ser Pro Val Thr H is Ser 590 595 600 Lys Arg Ile Ser Asn Ile Gly Gly Leu Asn Gly Glu Ala Ile Gln 605 610 615 Glu Ala Gln Leu Pro Arg His Asn Glu Trp Lys Asp Leu Leu Gly 620 625 630 Ser Gln Arg Glu Ala Val Asn Ser Ser Phe Ser Glu Arg Gln Arg 635 640 645 Arg Trp Lys Glu Glu Leu Asp Glu Glu Leu Gln Arg Lys Arg Glu 650 655 660 Ile Met Arg Gln Ala Val Asn Leu Ser Pro Pro Lys Asp Pro Ile 665 670 675 Leu Asn Arg Cys Arg Ser Lys Ser Arg Phe Ala Ser Pro Gly Arg 680 685 690 SEQ ID NO: 2 Sequence Length: 2073 Sequence Type: Nucleic Acid Number of Strands: Double Strand Sequence Type: Genomic DNA Sequence ATGCAGGATT TCATCGGCTC CGTTCGCCGA TCTCTGGTTT TCAAGCAGTC CGGAGCGCTGCCGGT CGGCAGCGGA TTCGGAGGCT TCGTTGAGAA ACTAGGTTCG 120 AGCATTCGCA AATCGAGTAT TGGAATCTTC TCGAAAGCTC ATGTTCCTGC TCTTCCGTCT 180 ATTTCTAAAG CTGAGCTGCC CGCGAAGGCTGG TGGACTAGCTGAC TCTGAC TCTGACTGATGAGAGTTAGCT 240AGGAAAGGTGG 240 AGGAAAGGTG ATGG TGCTTCGAGA 360 GAGCGAGCAC AAGCTCATGT TAGAGAGCTT GAGGAAGAAG TGAATCTATT GAAGAATCTC 420 TCCCATCCCA ACATAGTGAG ATATTTGGGA ACTGCAAGAG AGGCAGGATC ATTAAATATA 480 TTGTTGGAAT TTGTTCCTGG TGGCTCAATC TCGTCACTTT TGGGAAAATT TGGATCCTTC 540 CCTGAATCTG TTATAAGAAT GTACACCAAG CAATTGTTAT TAGGGTTGGA ATACTTGCAT 600 AAGAATGGGA TTATGCACAG AGATATTAAG GGAGCAAACA TACTTGTTGA CAATAAAGGT 660 TGCATTAAAC TTGCTGATTT CGGTGCATCC AAGAAGGTTG TTGAATTGGC TACTATGACT 720 GGTGCCAAGT CAATGAAGGG TACTCCATAC TGGATGGCTC CCGAAGTCAT TCTGCAGACT 780 GGCCATAGCT TCTCTGCTGA CATATGGAGT GTCGGATGCA CTATTATCGA AATGGCTACA 840 GGAAAACCTC CTTGGAGCCA GCAGTATCAG GAGGTTGCTG CTCTCTTCCA TATAGGGACA 900 ACCAAATCCC ATCCCCCCAT CCCAGAGCAT CTTTCTGCTG AATCAAAGGA CTTCCTATTA 960 AAATGTTTGC AGAAGGAACC GCACCTGAGG CATTCTGCAT CAAATTTGCT TCAGCATCCA 1020 TTTGTTACAG CAGAACATCA GGAAGCTCGC CCTTTTCTTC GCTCATCCTT TATGGGAAAC 1080 CCCGAAAACA TGGCGGCGCA AAGGATGGAT GTTAGGACCT CAATCATTCC TGATATGAGA 1140 GCTTCCTGCA ATGGTTTGAA AGATGTTTGT GGTGTTAGCG CTGTGAGGTG CTCCACTGTA 1 200 TATCCCGAGA ATTCCTTAGG GAAAGAGTCA CTCTGGAAAC TAGGAAACTC TGATGATGAC 1260 ATGTGCCAGA TGGATAATGA TGATTTTATG TTTGGTGCAT CTGTGAAATG CAGTTCAGAT 1320 TTGCATTCTC CTGCTAATTA TAAGAGTTTT AATCCTATGT GTGAACCTGA TAACGATTGG 1380 CCATGCAAAT TTGATGAAAG TCCCGAGTTG ACGAAAAGTC AAGCAAACCT GCATTATGAT 1440 CAAGCAACTA TTAAGCCCAC TAATAACCCC ATCATGTCAT ACAAGGAGGA TCTTGCTTTC 1500 ACATTTCCAA GTGGGCAATC TGCAGCCGAG GATGATGATG AATTGACAGA GTCTAAAATT 1560 AGGGCATTCC TTGATGAAAA GGCAATGGAC TTGAAGAAGC TGCAAACACC ACTATATGAA 1620 GGATTCTACA ATTCCTTGAA TGTTTCCAGC ACACCGAGTC CCGTTGGCAC TGGGAACAAG 1680 GAAAATGTTC CAAGTAACAT AAACTTACCA CCAAAAAGCA GGTCACCAAA ACGTATGCTT 1740 AGCAGAAGGC TCTCTACTGC CATTGAAGGT GCTTGTGCTC CCAGCCCAGT GACTCATTCC 1800 AAGCGAATAT CAAATATTGG TGGCCTAAAT GGTGAAGCTA TTCAGGAAGC TCAGTTGCCG 1860 AGGCATAATG AATGGAAAGA TCTTCTTGGT TCTCAACGTG AAGCAGTTAA TTCAAGCTTC 1920 TCTGAGAGGC AAAGAAGGTG GAAAGAAGAG CTTGATGAAG AGTTGCAAAG GAAACGAGAG 1980 ATTATGCGTC AGGCAGTCAA CTTATCACCA CCAAAGGATC CAATTCTAAA TCGATGTAGA 2040 AG TAAATCAA GGTTTGCATC TCCTGGAAGA TAA 2073

Continuation of the front page (51) Int.Cl. ⁵ Identification number Reference number within the agency FI technical display location C12N 5/10 15/70 15/81 15/84 // (C12N 1/19 C12R 1: 645) (C12N 1 / 21 C12R 1:19) (C12N 5/10 C12R 1:91)

Claims (9)

[Claims] 1. A solanaceous plant yeast STE11 homolog protein phosphatase gene 2. The gene according to claim 1, which encodes the following amino acid sequence: embedded image SEQ ID NO: 1 3. The gene according to claim 1, characterized by being represented by the following nucleotide sequence: 4. A plasmid containing the yeast STE11 homolog protein phosphatase gene of solanaceous plants. 5. A transformant carrying a plasmid containing a yeast STE11 homolog protein phosphatase gene of a solanaceous plant. 6. The transformant according to claim 5, which is a microorganism. 7. The transformant according to claim 6, which is Escherichia coli. 8. The method according to claim 6, which is a yeast strain.
Described transformant 9. The transformant according to claim 5, which is a plant.