JPH04502261A - Stable mammalian cell line expressing aromatase - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] 7. MCF-7 cells, BT-20 cells or HBL-100 cells, claim 6. The human breast cancer cell described in 6.

8. Activity of aromatase expressed by the cell defined in claim 4.5 or 6. human aromatase by measuring the extent to which a known amount of an inhibitor inhibits Screening methods for inhibitors.

Specification Stable Mammalian Cell Lines Expressing Aromatase This application was filed on October 2, 1989. This is a continuation of US Patent Application No. 07/422°904 filed on the 8th.

field of invention The present invention relates to mammalian cells expressing aromatase (a roma t a se ). Regarding the cell line. The cell line of the present invention has aromatase useful as a cancer therapeutic agent. Useful for screening for inhibitors.

Background of the invention Aromatase converts C-19 androgenes to C-18 nystrodiene steroids. It is a catalyst for the formation of Nistrogien plays a central role in the development of breast cancer aromatase inhibitors are useful in the treatment of breast cancer.

Currently, screening for aromatase inhibitors generally involves in vitro O method is used. Such studies have used partially purified aromatase preparations. It can be done for. Taniguchi, H, et al., Anal, Bi See Ochem, 181:167-171 (1989). such a person data may not reflect the activity of the drug in healthy cells.

Methods using animal tissues expressing aromatase are also known. For example, diene Schenke 1, A, H, et al., J, 5teroid Bioche m.

33:125-131 (1989). These tissues produce aromatase very much Expressed at low levels, requiring long incubation times for enzyme assays Requires. Furthermore, tissue specimens are usually heterogeneous. Therefore, the difference between experiments It is difficult to compare data. Aromatase was known to be expressed in yeast . Pompon, D, et al. Molecular Endocrin Science 3:1477-1487 (1989). However, yeast The model is not preferred for screening drugs for humans.

A reliable and rapid method for initial screening of aromatase inhibitors. The need for a fast method is clear. Such methods include high levels of aromat requires a stable mammalian cell line containing enzymes. Corbin.

C, J, et al., Proc, Natl, Acad, Sci, USA, 85:8948 -8952 (1988) in mammalian CoS cells by a transient expression method. reported the expression of human aromatase cDNA. This enzyme lasts for a very short time Corbin cells are impractical for screening breast cancer therapeutics because they only express It is useful.

Summary of the invention The present invention provides high-level aromatase inhibitors useful for initial screening of aromatase inhibitors. Provides a stable #militare cell line containing lomatase. Aromatase activity is healthy Since it is measured using cells, it is possible to evaluate the efficiency of inhibitor uptake. It is. Effects on cell proliferation in the presence and absence of inhibitors This can be clarified by comparing the proliferation rates.

More specifically, the present invention relates to the construction of an expression plasmid containing an aromatase cDNA, and and transformed with such a plasmid expressing a functional aromatase protein. including mammalian cells. Aromatase expression products are those present in the human placenta has substantially the same enzymatic properties as

The expressed enzyme has the same Michaelis-Menten constant (Km) as the wild-type enzyme; Efficiently binds to endogenous NADPH-cytochrome P450 reductase. Ru. The activity of the expressed enzyme is similar to that reported in the literature, with Ki values similar to those reported in the literature. Inhibited by matase inhibitors. Therefore, important aspects of the invention include: , aromatase inhibitor as a therapeutic agent, especially for treating nistrogien-dependent breast cancer. It also includes methods for screening targets.

Detailed description of the invention Two full-length human candy aromatase cDNA clones, rAro, were derived from human placenta c DNA library was synthesized with aromatase cDNA probe and human aromatase. Screen with oligonucleotide probes for sequences derived from genomic clones It was isolated by Construct an expression plasmid containing the aromatase cDNA clone. Built. This enzyme was expressed at high levels in transformed mammalian cell lines. . The expressed enzyme activity was determined by 4-hydroxy, a known aromatase inhibitor. Androstenedione (4-hydroxyandros tened 1on) e) was inhibited.

The transformed cell line is assayed for aromatase inhibition using known assay methods. Useful for screening Such assays are It is possible to perform this directly on cultured cells without purifying the enzyme.

Drawing description Figure 1 shows the nucleotide sequence and predicted amino acid of cDNA clone Aro 2. Indicates an array. The peptide sequence data shows that the Aro 2 clone is human placental aromata. This confirms that the code encodes the Peptides determined by microsequencing The area corresponding to C is underlined.

FIG. 2 shows aroma compounds useful for expressing aromatase in mammalian cell lines. The structure of the pHβ-Aro expression plasmid pHβ-Aro is shown.

Figure 3 shows the alloprotein expressed in CHO cells transformed with the plasmid of Figure 2. Matase has activity that follows normal Michaelis-Menten kinetics Show that.

Figure 4 shows the alloprotein expressed in CHO cells transformed with the plasmid of Figure 2. Showing that matase is inhibited by 4-hydroxyandrostenedione .

Cloning and analysis of Aro2 Cloning and cloning of aromatase cDNA, Aro2, containing the full-length coding region Details of the method and analysis are given by Pompon, D. et al. S. cereviche, Molecular Endocrinology (Saccharomyc) es cerevisiae, Molecular Endocrinol.

gy), 3:1477-1487 (1989). Expression of Human Placental Ar .

matase) J. The contents of this document are also included in this specification. shall be.

Design and construction of aromatase expression plasmid AroX17 Generally speaking, constitutive or stable gene expression occurs when the transformed DNA is safe within the cell. points to be maintained constant and sufficient for further biochemical and biophysical analyses. It offers an advantage in that it is possible to isolate the expressed protein.

The yeast S. cerevisiae is known to contain mammalian genes, especially cytochrome P-45O. is a useful host for the expression of 8. This is because this yeast cell has a microsomal membrane. , cytochrome P-450 reductase and cytochrome b5; This is because membrane incorporation and catalyst stability are possible. Gene expression in yeast can be achieved in two ways. The first method is to insert foreign genes into yeast nuclear DNA. It consists of stable integration. This method allows stable expression of foreign proteins at low levels. give transformed cells. Another method is to generate autonomous multicopy replication of the foreign gene. This is a method in which Escherichia c. similar, but more complex, to those used for bacterial transformation such as It's rough. Therefore, the transformed strain is capable of expressing high levels of the heterologous protein. It is Noh. Furthermore, the marker created in the plasmid always maintains the selection effect. The presence of the plasmid becomes stable. Using the second method, in yeast aromatase was expressed.

Figure 5 of Pompon, D. et al. above is a process diagram for the construction of an aromatase expression plasmid. It is. The following array: adapter into plasmid pYeDP1/82 restricted with BamHI. Connected. BamH1 site just next to GALIO-CYCI promoter A plasmid carrying the above insert in an orientation such that the ) was selected. Therefore, plasmid PYeDP11 contains a BglII site and and has a new and unique BamHI site. with EcoRI from λgt11 vector EcoRI flag corresponding to full-length aromatase cDNA by partial digestion of The 5° end of the cDNA was inserted into the EcoRI site of PYeDPll. Cloned in an orientation adjacent to the GALlo-CYC1 segment of the vector. , pExxxl was obtained.

Deletion of the 5° flanking sequence of the aromatase cDNA was induced in the jingle strand M13 tomato. A synthetic adapter containing the BglII restriction enzyme site sequence from Rix was followed by an alloprotein. Complete inv double-stranded DNA encoding the amino-terminal portion of matase This was done by intro synthesis. The 700bp BamHI flag of pExxxl cDNA75gment into the BamHI site of phage M13MP18. The vector was cloned in such a direction that the 3' end of the vector was closer to the EcoRI site of the vector.

The following array: 5°-GATCAGATCTATGGTTTTGGA^^TGCTG-3° a Hybridize the adapter-primer with jingle strand phage DNA. and deoxynucleotide-triphosphate and E. coliDN It was extended using the Flenow fragment of A. This new combination The resulting jingle strand was purified, and then M13 reverse sequence primer (rever se sequencing primer) to synthesize complementary strands. started. By this method, the translation start codon (tr ansduction 1initiation codon) A double-stranded DNA containing a glII site was obtained. This DNA fragment was double digested with BamHI and BglII restriction endonucleases to Seven fragments of 620 bp were obtained encoding the amino-terminal portion of matase. this The fragment was placed into the B gl II-B amHI digested pExxl plasmid. Full-length aromatase cloned in the appropriate orientation and inserted into the yeast expression unit. The code sequence was reconstructed to obtain plasmid pAroX17.

Construction of aromatase expression plasmid pHβ-Aro (Fig. 2) pAroX17 Digested with restriction enzymes BglII and StuD and the aromatase cDNA as described above. 1 including A. A 9kb fragment was purified. With restriction processing by BglII The end of the resulting fragment has a 3°-OH recessed end, and this recess Fill-in by adding enzyme and appropriate deoxynucleotides It was set as a runt end. Next, this aromatase cDNA fragment was converted into SaII and HjndIII restriction digested and plant-terminated expression vector pH β Apr-1-neo (Gunnin g), P, et al., P roc, Natl, Acad, Sci, USA, 84:4831-4835 ( (1987)). BglJI site in β-actin promoter Plasmids with cDNA inserts in exactly adjacent orientations are selected and developed. used in the current experiment.

Aromatase expression Expression of aromatase was determined in human breast cancer cell lines MCF-7 and BT-20 and The non-cancerous human cell line HBL-100 was expressed using the expression plasmid pHβ- Transformation was performed with Aro. Aromatase was transformed with pHβ-Aro plasmid. It was also expressed in transformed Chinese hamster ovary cells (CHO).

Assay of aromatase in cells transformed with pHβ-Aro plasmid Transformed cell lines express high levels of aromatase by activity measurements It has been shown. Enzyme activity assays can be performed directly in cultured cells without enzyme purification. went. Grow cells to confluence in a 6-well cell culture plate. I set it. Cells were washed twice with serum-free cell culture medium before assay. Substrate a Ndrost-4-ene-3,17-dione [1β,2β-”H(N)) (specific activity 43. ICj/mol) was dissolved in serum-free cell culture medium and then filtrated. cells and add to each well. Incubate for 30 minutes at 37°C, followed by on ice. After incubating for 5 minutes, remove 1 ml of medium from each well. This culture The substrate was first mixed with an equal volume of chloroform to extract the unconsumed substrate; It is then mixed with activated carbon treated with dextran. Activated carbon can be removed by simple centrifugation. and count the supernatant containing product and tritiated water. cells to 0.5N of NaOH and measure the protein concentration. Figure 3 is an illustrative example. Aromatase expressed in O cells is a normal Michaelis-Menten kinete. It has been shown that it has activity according to the schedule. Table 1 shows that these cell lines The expressed aromatase was analyzed for aromatase in human placental microsomes. Michaelis-Menten constant (Km) and maximum velocity (Vma) similar to those calculated x).

Table 1 Cell Rai: / Km (nM) Vmax (pmol C3H) H,0 formation / hr/mg) CHO57,8201,2 MCF-755,610 BT-2064,562,5 HBL-10039,926,7 Figure 4 shows that the expressed aromatase is a known aromatase inhibitor, 4- It is shown to be inhibited by hydroxyandrostenedione. 50% activity inhibition was produced by the addition of 30 nM of the inhibitor, a concentration similar to that reported in the literature. be. This result indicates that this system may be used as a screening agent for aromatase inhibitors as breast cancer therapeutics. Shows that it is useful for learning.

FIG, l-I GGGρGGACGGAAGGTCCTGTGCTCGGG ATCTTCCAGACGTCGCGACTCTAAATTGCCCCCTCT GAGGTTAAGGAACACAAG 81ACATACAAA CATCC ATCCTTGCCAATAGDTCATCCTCACAGTGAACACT CAGTGGCCCTGCTCCTGTTCA CACCAGAGAA CCA GGCTA CAAGAGAA A AAGCAGAGGCCA AGAGTT sGA TTGAGA AGGA TAGGCCTTCATTA A CAA A AT GTATGTCTGGTTCCCCAGTAGAGCTCT` CT CAGGCCAATGTCAGGGTACCTGGGGGcciAc CCAl: CTG’CTAGTGTGAATTAAAGTACTTTGGGCCCTGT GTCTG CTGTA GAAA A AA A AA TT CA CAT GA　TGCA　CTTCAAA　TsCA　A　A　TAAA　A ATCCTTTTGGCATGTTCCCATTTTTGCTTAGCTCAA TTAGTG DingGGCTAACCAAAGAGATAA 24W1 CCAACCCAATGGGCTCAAACTTCTAAGGGGTACTCC TCTCATCCCCTTTATCCTTCTCCCCT　26O1 CGACATTTTCTCCCTCTTTCDTCCCATGACCCCAAA GC-AAGGGCAAACAGATCAGTAAAAGAACGTGGTCAGA GTAGAACCCCTGAAGTATTTTTTAATCCTACCTCAA AATTTAACAGTT 27Q1 Engraving (no changes to the original) Ec A J 170S (nM-1) Procedural amendment 1991/Monday 3rd Country

Claims (8)

[Claims] 1. An isolated cDNA consisting of the nucleotide sequence shown in FIG. 2. An isolated polypeptide consisting of the amino acid sequence shown in FIG. 3. Aromatase expression plasmid pHβ-Aro. 4. Transformed mammalian cells expressing aromatase. 5. Mammalian cells transformed with plasmid pHβ-Aro. 6. Humans transformed with plasmid pHβ-Aro expressing human aromatase. breast cancer cells. 7. The claim is that the cells are MCF-7 cells, BT-20 cells or HBL-100 cells. 6. The human breast cancer cell described in 6. 8. Activity of aromatase expressed by the cell defined in claim 4, 5 or 6. human aromatase by measuring the extent to which a known amount of an inhibitor inhibits Screening methods for inhibitors.