WO1991005794A1

WO1991005794A1 - Stable mammalian cell lines that express aromatase

Info

Publication number: WO1991005794A1
Application number: PCT/US1990/005873
Authority: WO
Inventors: Shiuan Chen
Original assignee: City Of Hope
Priority date: 1989-10-18
Filing date: 1990-10-12
Publication date: 1991-05-02
Also published as: JPH04502261A; AU6645790A; CA2044249A1; EP0450048A4; EP0450048A1

Abstract

Stable mammalian cell lines that express human aromatase and which are useful to screen anti-breast cancer drugs are disclosed.

Description

_!__

STABLE MAMMALIAN CELL LINES THAT EXPRESS AROMATASE

This application is a continuation of United States Serial No. 07/422,904 filed 18 October 1989.

FIELD OF THE INVENTION

This invention relates to mammalian cell lines which express aromatase. The cell lines are useful to screen aromatase inhibitors useful as anti-breast cancer drugs.

BACKGROUND OF THE INVENTION Aromatase catalyzes the formation of C-18 estrogenic steroids from C-19 androgens. Aromatase inhibitors are useful in breast cancer therapy because of the central importance of estrogens to the development of such malignancies.

At the present time, in vitro methods are commonly used to screen aromatase inhibitors. The investigation can be carried out using a partially purified aromatase preparation. See Taniguchi, H. , et al.. Anal. Biochem. 181:167-171 (1989). Data from such methods may not represent the activity of the drugs in intact cells. There are also methods using animal tissues which express aromatase. See Schen el, A.H., et al., J.Steroid Biochem. 33:125-131 (1989) . These tissues express aromatase at such a low level that enzyme assay requires a long incubation. In addition, tissue specimens are usually heterogeneous. Therefore, it is difficult to compare data from experiment to experiment. Aromatase has been expressed in yeast. Pompon, D., et al.. Molecular Endrocrinoloqy 3:1477-1487 (1989). However, the yeast model is not preferred for screening drugs for humans. The need for a reliable and a rapid method for the primary screening of aromatase inhibitors is apparent. Such a method requires stable mammalian cell lines which contain high levels of aromatase. Corbin, C.J., et al., Proc.Natl.Acad.Sci.USA 85:8948-8952 (1988) report the expression of human aromatase cDNA in mammalian COS cells through a transient expression method. Because the enzyme is expressed for only a short period of time, the Corbin cell lines are impractical for screening anti-breast cancer drugs.

SUMMARY OF THE INVENTION

This invention provides stable mammalian cell lines which contain high levels of aromatase useful for the primary screening of aromatase inhibitors. The uptake efficiency of such inhibitors can be evaluated because aromatase activity is measured using intact cells. The effect on cell growth is apparent from a comparison of growth rate in the presence and absence of inhibitors.

More particularly, this invention includes the construction of expression plasmids containing aromatase cDNA and mammalian cells transfected with such plasmids which express a functional aromatase protein. The aromatase expression product has enzymatic properties substantially identical to the enzyme in human placenta.

The expressed enzyme has the same Michales-Menken constant (Km) as the wild type enzyme and is coupled efficiently with the endogenous NADPH-cytochrome P-450 reductase. The activity of the expressed enzyme is inhibited by known aromatase inhibitors with Ki values similar to those reported in the literature. Accordingly, an important aspect of this invention includes methods to screen aromatase inhibitors as drugs to treat, inter alia, estrogen dependent breast cancer.

DETAILED DESCRIPTION OF THE INVENTION

A full-length human placental aromatase cDNA clone "Aro 2" was isolated upon screening a human placental cDNA library with an aromatase cDNA probe and an oligonucleotide probe whose sequence was derived from a human aromatase genomic clone. Expression plasmids containing the aromatase cDNA clone were constructed. The enzyme was expressed at high levels in transfected mammalian cell lines. The expressed enzyme activity was inhibited by a known aromatase inhibitor, 4-hydroxyandrostenedione.

The transfected cell lines are useful in known assay procedures to screen aromatase inhibitors. Such assays may be performed directly on cultured cells without purifying the expressed enzyme.

DESCRIPTION OF THE FIGURES

Figure 1 depicts the nucleotide sequence of cDNA clone Aro 2 and the deduced amino acid sequence. The peptide sequence data confirms that the Aro 2 clone encodes for human placental aromatase. Regions corresponding to peptides determined by microsequencing methods are underlined.

Figure 2 shows the structure of an aromatase expression plasmid pH β-hro useful to express aromatase in mammalian cell lines.

Figure 3 shows that aromatase expressed in CHO cells transfected with the plasmid of Figure 2 has activity following the normal Michales-Menken kinetics.

Figure 4 shows that the aromatase expressed in CHO cells transfected with the plasmid of Figure 2 is inhibited by 4-hydroχyandrostenedione. Cloning and Analysis of Aro 2 Details of the cloning and analysis of aromatase cDNA, Aro 2 containing the full-length coding region are set forth in Pompon, D. , et al.. Expression of Human Placental Aromatase in Saccharomyces cerevisiae. Molecular Endocrinology 3_^:1477-1487 (1989) . This paper is incorporated herein by express reference.

Design and Construction of Aromatase Expression Plasmid pAroX17

Constitutive or stable gene expression offers advantages over transient expression in the stable maintenance of transfected DNA in cells and in the possibility of isolating enough expressed protein for further biochemical and biophysical analyses. The yeast S. cerevisiae is a useful host for the expression of mammalian genes particularly cytochrome P-450s because the cells contain microsomal membranes, cytochrome P-450 reductase and cytochrome bs to allow membrane integration and catalytic stability. Gene expression in yeast can be accomplished by two ways. The first involves the stable integration of the foreign gene into the yeast nuclear DNA. This gives stably transformed cells expressing the heterologous protein at a low level. The alternative approach is to include the foreign gene in an autonomous multicopy replicate plasmid which is similar to, but more complex to that used to transform bacteria like Esherichia coli. Therefore, the transformed strain can express high levels of a heterologous protein. In addition, the presence of plasmids is stabilized by the maintenance of a constant selection pressure attributed by a marker being constructed into the plasmids. The second approach was used to express aromatase in yeast. Figure 5 of Pompon, D. , et al., supra, is the diagram for the construction of the aromatase expression plasmids. An adaptor with the following sequences

5' GATCAGATCTATGGTTTTGGAAATGCTG 3'

3' TCTAGATACCAAAACCTTTACGACCTAG 5' was ligated to the BamHI restricted plasmid pYeDPl/8-2. Plasmids (i.e. PYeDPll) bearing the insert in the orientation in which the BamHI site just flanking the GALIO-CYCI promoter was destroyed were selected. Plasmid pYeDPll, therefore, has a Bgl II site and a new unique BamHI site. The EcoRI fragment corresponding to the full-length aromatase cDNA was excised from the λgtll vector by limited EcoRI digestion and cloned into the EcoRI site of pYeDPll in the orientation that the 5' end of the cDNA is next to the GALIO-CYCI segment of the vector giving pExxl.

Deletion of the 5'-flanking sequences of aromatase cDNA was performed by full in vitro synthesis of a double stranded DNA encoding the amino-terminal part of the aromatase preceded by a synthetic adaptor containing Bgl II restriction site sequence from a single stranded M13 matrix. The 700 bp BamHI fragment of pExxl was cloned in the BamHI site of phage M13MP18 in the orientation that bring the 3'-end of the cDNA fragment close to the EcoRI site of the vector. An adaptor-primer, with the sequence 5'-GATCAGATCTATGGTTTTGGAAATGCTG-3', was hybridized with the single stranded phase DNA and was elongated using deoxynucleotide-triphosphates and the Klenow fragment of E. coli DNA polymerase I. This newly synthesized single stranded was purified, and the Ml3 reverse sequencing primer was then added to initiate the synthesis of the complementary strand. By this approach, a double stranded DNA including a synthetic Bgl II site immediately flanking the transduction initiation codon of the aromatase cDNA was obtained. A double digestion of this DNA fragment by BamHI and Bgl II restriction endonucleases gave a 620 bp fragment encoding the amino-terminal part of aromatase. This fragment was cloned in the suitable orientation into the Bgl II-BamHI digested pExxl plasmid to reconstitute a full-length aromatase coding sequence inserted into the yeast expression unit giving plasmid pAroX17.

Construction of Aromatase Expression Plasmid, pH £-Aro (Figure 2)

pAroX17 was digested with restriction enzymes, Bgl II and Stu I, and the previously described 1.9 Kb fragment containing aromatase cDNA was purified. The end of the fragment created through restriction by Bgl II has a 3'-OH recessed end, and it was filled in to form blunt end by the addition of Klenow enzyme and the appropriate deoxynucleotides. This aromatase cDNA fragment was then ligated to a Sal I and Hind III restricted and bluntly ended expression vector, pH β Apr-1-neo (see Gunning, P., et al., Proc.Natl.Acad.Sci. USA 84:4831-4835 (1987)). Plasmids bearing the cDNA insert in the orientation in which the Bgl II site just flanking the ø-actin promoter were selected and used for expression experiments. Expression of Aromatase Aromatase was expressed by human breast cancer cell lines MCF-7 and BT-20 and one non-cancerous human cell line HBL-100 transfected in known manner with the expression plasmid pH -Aro. Aromatase was also expressed by the Chinese hamster ovary (CHO) cell line transfected with the pH y9-Aro plasmid.

Aromatase Assay in Cells Transfected with pH g-Aro Plasmid

The transfected cell lines express high level of aromatase as indicated by activity measurement. The enzyme assay was performed directly on cultured cells without purifying the enzyme. Cells are grown to confluence on six-well cell culture plates. Cells are washed twice with serum free cell culture medium before assay. The substrate, androst-4-ene-3, 17-dione [l ,2yø-³H(N) ] (specific activity, 43.1 Ci/mol) , dissolved in serum free cell culture medium and filter-sterilized, is added into each well. After 30 min incubation at 37°C and followed by 5 min incubation on ice, l ml of culture medium is withdrawn from each well. The culture medium is initially mixed with equal volume of chloroform to extract unused substrate, and further mixed with dextran treated charcoal. Charcoal is removed by brief centrifugation, and the supernatant containing the product, tritiated water, is counted. The protein concentration is determined after dissolving cells with 0.5 N NaOH. Figure 3 serves as an example and shows that the aromatase expressed in CHO cells has activity following normal Michales-Menken kinetics. Table I shows that aromatase expressed in these cell lines has Michales-Menken constant (K_m) and maximum velocity (V_max) similar to those calculated for aromatase in human placental microsomes.

TABLE I

Vmax (Pmol [³H] H₂0 Formed/hr/mg)

201.2 10

62.5

26.7

Figure 4 shows that the expressed aromatase is inhibited by 4-hydroxyandrostenedione, a well-known aromatase inhibitor. A 50% inhibition of the activity would be achieved by the addition of 30 nM of the inhibitor, a concentration similar to that reported in the literature. This result indicates that this system will be useful to screen aromatase inhibitors as drugs to treat breast cancer.

Claims

HAT IS CLAIMED IS:

1. Isolated cDNA comprising the nucleotide sequence depicted by Figure 1.

2. An isolated polypeptide comprising the amino acid sequence depicted by Figure 1.

3. The aromatase expression plasmid pH -Aro.

4. A transfected mammalian cell which expresses aromatase.

5. A mammalian cell transfected with the plasmid pH 0-Aro.

6. A human breast cancer cell transfected with plasmid pH 0-Aro which expresses human aromatase.

7. A human breast cancer cell as defined by claim 6 which is an MCF-7 cell, a BT-20 cell, or an HBL-100 cell.

8. A process for screening human aromatase inhibitors which comprises determining the extent of inhibition of the activity of aromatase expressed by a cell as defined by claim 4, claim 5 or claim 6 caused by a known amount of said inhibitor.