CA2044249A1 - Stable mammalian cell lines that express aromatase - Google Patents

Abstract

Stable mammalian cell lines that express human aromatase and which are useful to screen anti-breast cancer drugs are disclosed.

Description

2~L4 2~

'.'.:.

STABT~ MAMMALIAN CELL LINES THAT EXPRESS AROMATASE

This application is a continuation of United States Serial No. 07/422,904 filed 18 October 1989.

FIE~D OF THE INVENTION
This invention relates to mammalian cell lines ~; which express aromatase. The cell lines are useful to screen aromata6e inhibitors useful as anti-breast cancer drugs.
.j . .
BACKGROUND OF THE INVENTION
Aromatase catalyzes the formation of C-18 esitrogenic steroids rrOm C-l9 androgens. Aromatase lnhibitors are useful in broast cancer thierapy because of the central importance of ostrogens to the ~-development of siuch malignanciesi.
At the present time, in vitro methods are commonly used to screen aromatase inh~bitor~. The investigation c~n be carrl~d out using a pairtlally purifled aro~atase preparaition. See Taniguchi, H., ot al., Anal. Biochem. 181:167-171 (1989~. Data from siuch methodci may not represent the activity of the drugs in intact cells- There are also methods using animal tissues which express aromatase. See Schenkel, A.H., et al., J.Steroid Biochem. 33:125-131 ;!
89). These tissues express aromata~e at such a low level that enzyme assay requires a long incubation. In addition, tissue specimens are usually heterogeneous. Therefore, it i8 di~ficult to compare data from experiment to experiment.
Aromatase has ~een expressed in yeast. Pompon, D., et al., Molecul~r Endrocrinoloqy 3:1477-1487 (1989).
~owever, the yeast model is not preferred for -screening drugs for humans. ~-~ .

2~2~
WO9l/0~794 PCT/US90/05873 ,' . :' . .
The need for a reliable and a rapid method for the primary screening of aromatase inhibitors is apparent. Such a method reguires stable mam~alian cell lines which contain high levels of aromatase.
Corbin, C.J., et al., Proc.Natl.Acad.Sci.USA
85:8948-8952 (1988) report the expression of human aromata~e cDNA ln mammallan COS cells through a tranelent expr~6~ion method. ~ecause the enzyme is expressed for only a short period of time, the Corbin cell lines are i~practical for screening anti-breast cancer drugs.
SUMMARY OF THE INVENTION
This invention provides stable mammalian cell -' lines which contain high levels of aromatase useful ' for the primary ~creening of aromatase inhibitors.
The uptake efficiency of ~uch lnhibitors can be '' ~valuated becauso aromata~e actlvity i8 meagured u~ing lntact cell~. Th- effect on cell growth i~
apparent ~rom a comparison of growth rate in the presence and absence of inhibitor~
More partlcularly, thi~ invention includes the construction o~ xpre~slon pla~mits containl~g aromata~- oDNA and mammallan cells transfected with uch plasmids which express a functional aromatase protein. The aromatase expro~sion product has enzymatic propertieC ~ub~tantially identical to the enzyme in,human placenta.
The expressed enzyme has the same Michales-Menken constant (Xm) ~s the wild type enzyme and is coupled -,, efficiently with the endogenous NADPH-cytochrome P-450 reductase. The activity of the expressed enzyme is inhibited by known aromatase inhibitors with Ki values similar to those reported in the literature. Accordingly, ~n important ~spect of this ~ .
.~;. .

.. . .

-' ' - :

~ 2 ~ ~ ~i 2 ~
WO9l/05794 PCT/US90/05873 invention includes methods to screen aromatase inhibitors as drugs to treat, inter alia, estrogen , dependent breast cancer.
DETAILED DESCRIP~ION OF THE INVENTION
A full-length human placental aromatase cDNA
clone ~Aro 2" was isolated upon screening a human placental cDNA library w~th an aromatase cDNA pro~e and an oligonucleotide probe whose seguence was derived rom a human aromatase genomic clone.
Expression plasmids containing the aromatase cDNA
clone were constructed. The enzyme was expressed at high levels in transfected mammalian cell lines. The , expressed enzyme activity was inhibited by a known -aromatase inhibitor, 4-hydroxyandrostenedione.
~, The transfected cell lines Are useful in known a~say procedures to ~icreen aromatase inhibitors.
Such a~says may be perform-d dirQctly on cultured ¢ell~ without puri~ying the expressed enzyme.
DESCRIPTION OF THE FIGURES
~:' Figure 1 depict~ the nucl-otide ~eguence of oDNA
clono Aro 2 and the d-duc-d amino acid s~uence. The ;i~ peptide 6eguence data con~irms that the Aro 2 clone ncode6 ~or human pl~cental aromatase. Regions 'j~ corresponding to peptides determi~ned by microsequencing methods are underlined.
^~ Figure 2 shows the structure of an aromatase expre~sion plasmid pH ~-Aro useful to expre6s aromata~e in mammalian cell lines.
Figure 3 shows that aromatase expressed in CHO
cells transfected with the plasmid of Figure 2 has nctivity following the normal Michales-Menken ~ kinetics.
`~ Figure 4 6hows that the aromatase expressed in CHO cell~ transfected with the plasmid of Figure 2 is inhibited by 4-hydroxyandrostenedione.
. ~ . .

. s . _ : ;: ~ .. . - - . . . ., ,.:

2~2~
.....
; WO9l/05794 PCT/US90/05873 Clonina and Analvsis of Aro 2 Details of the cloning and analysis of aromatase - cDNA, Aro 2 containing the full-length coding region are set forth in Pompon, D., et al., Expression of Human Placental Aromatase in Saccharomvces cerevisiae, Molecular Endocrinoloav 3:1477-1487 ~' ~1989). This paper ls incorporated her~in by express re~erence.
; Design and Construction of Aromatase Ex~ress~on Plasmid PAroxl7 Constitutive or stable gene expression offers advantages over transient expression in the stable 3 maintenance of transfected DNA in cells and in the possibillty Or isolating enough xpressed protein for further biochemical and biophysical analyces. The yeast S. csrevisiae ls a us-ful host for the oxpr-ssion of mammalian genes particularly oytochrome P-4SOs because the cells contain microsomal ~: membranes, ¢ytochrome P-450 reductase and cytochrome bs to allow me~brane lntegration and catalytic stability. Gene xpression in y-ast can be accompliished by two ways. The first involves the stable integration of the foreign gene into the yeast nuclear DNA. This gives stably trans~ormed cells expressing the heterologous protein at a low ievel.
The alternative approach is to include the foreign gene in an autonomous multicopy replicate plasmid which is similar to, but more complex to that used to transform bacteria like Esherichia coli. Therefore, the tran6formed strain ~an express high level6 of a heterologous protein. In addition, the presence of pIasmids is stabilized by the maintenance of a constant election pressure attributed by a marker ~; being constructed into the plasmids. The secand approach was used to express aromatase in yeast.

. .~ , .
.. . .

. . ~ -. : . .~ :..... ~ . . ; . . . :,. . . ; . :

2 ~

W O 91/05794 PC~r/U590/05873 _5_ ; ' ~
.
Figure 5 of Pompon, D., et al., su~ra, is the diagram for the construction of the aromatase expre~sion plasmids. An adaptor with the following ~
sequences ~ -5' GATCAGATCTATGGTTTTGGAAATGCTG 3' 3' TCTAGATACCAAAACC m ACGACCTAG S' was ligated to the BamHI restricted plasmid pYeDPl/8-2. Plasmids (i.e. PYeDP11) bearing the insert in the orientation in which the BamHI site just flanking the GAL10-CYC1 promoter was destroyed were selected. Plasmid pYeDPll, therefore, has a Bgl - II site and a new unigue ~amHI site. The EcoRI
~t~ fragment corresponding to the full-length aromatase , cDNA was excised from the ~g~11 vector by limited EcoRI digestion and cloned into the EcoRI site of pY-DPll ln the orientation that the 5' end of the cDNA i~ next to the GAL10-CYCl ~egment of the vector giving pExxl.
Deletion Or the 5'-flanXing sequ-nces Or romatase cDNA w~s performed by ~ull in vitro ynthesis of a double stranded DNA encoding the amino-terminal part of the Aromatase preceded by a synthetic adaptor containing Bgl II restriction site sequence from a single stranded M13 matrix. The-700 bp BamHI fragment of pExxl was cloned in the BamHI
site of phage M13MP18 in the orientation that bring the 3'-end of the cDNA fragment close to the EcoRI
site of the ~ector. An adaptor-primer, with the ~equence 5'-GATCAGATCTATGGTTTTGGAAATGCTG-3', was - hybridized with the single 6tranded phase DNA and was ~ri elongated using deoxynucleotide-triphosphates and the Klenow fragment of E. coli DNA polymerase I. This newly synthesized single stranded was purified, and the N13 reverse sequencing primer was then added to ~:.
initiate the synthesis of the complementary strand.

~,d!
i . .i 20~2'~

,': ' By this approach, a double stranded DNA including a synthetic Bgl II ~ite immediately flanking the transduction initiation codon of the aromatase cDNA
was obtained. A double digestion of this DNA
fragment by BamHI and Bgl II restriction endonucleases gave a 620 bp fragment sncoding the am~no-terminal paxt of aromatase. This ~ragment was cloned in the suitable orientation into the Bgl II-BamHI digested pExxl plasmid to reconstitute a ~ull-length aromatase coding 6equence inserted into the yeast expression unit giving plasmid pAroX17.
:
Construction of Aromatase Expression Plasmid, ~H ~-Aro (Fiaure 2) .
pAroX17 wa~ digested with restriction enzymes, ~ -Bgl II ~nd Stu I, and the pr-vioud y described 1.9 Xb fragment containing aromatase cDNA was purified. The end of the fragment created through restriction by Bgl II has a 3'-OH reces~ed end, ? nd lt was f~lled in to ~orm blunt nd by the addit~on o~ Xlenow enzyme and the ~ppropxi~te deoxynucleotides. This aromatase cDNA fragment was then ligated to a Sal I and Hind III restricted and bluntly ended expression vector, pH ~ Apr-l-neo (see Gunning, P., et aI., Proc.Natl.Acad.Sci. USA 84:4831-4835 (1987)). -P}asmid~ bearing the cDNA insert in the orientation in which the Bgl II site just flanking the ~-actin promoter were ~elected and used for expression experiments.

~ ~ .

?:
. . .
'1 .
. . _ 2 a ~
WO91/05794 PCT~US90/05873 _7_ ExDression of Aromatase Aromatase was expressed by human breast cancer cell lines MCF-7 and BT-20 and one non-cancerous human cell line HB~-100 transfected in known manner with the expression plasmid pH ~-Aro. Aromatase was ;~-also expressed by the Chinese hamster ovary (CHO) cell line transfected wlth the pH ~-Aro plasmid.
, . .
Aromatase Assay in Cells Transfected with pH B-Aro Plasmid ~.. ..
The transfected cell lines express high level of aromatase as indicated by activity measurement. The enzyme assay was performed directly on cultured cells without purifying the enzyme. Cells are grown to confluence on six-well cell culture plates. Cells are wa~hed twice with ~erum ~ree cell culture medium before assay. The substrate, androst-4-ene-3, 17-dione [1~,2~-3H(N)] (specific actlvity, 43.1 C1/mol), dissolvod in serum ~ree cell culture medium and ~llter-sterllized, 1~ addQd into each well.
After 30 min incubation at 37'C and ~ollowed by 5 min incubatlon on ice, 1 ml of culture ~edium is withdrawn from each well. The culture medium is initially mixed with egual volume of chlorofor~ to extract unused substrate, and further mixed with dextran treated charcoal. Charcoal is removed by --~
brief centrifugation, and the supernatant containing the product, tritiated water, is counted. The protein concentration is determined after dissolving cells with 0.5 N NaOH. Figure 3 serves as an example - -and shows that the aromatase expressed in CHO cells has activity following normal Michales-Menken kinetics. Table I shows that aromatase expressed in `' , ':
:

2 ~ ~ L9 2 ~ 9 W091/05794 PCT/~S90/05873 .` ', ~-"' these cell lines has Michales-Menken constant (Km) and maximum velocity (Vmax) 6imilar to those calculated for aromatase in human placental microsomes.

., TABLE I
Cell Lines Km (nM) Formed/hr/mg) C~0 57.8 201.2 MCF-7 55.6 10 BT-20 64.5 62.5 H8~-100 39.9 26.~
Figure 4 shows that the expressed aromatase is ` inhibited by 4-hydroxyandrostenedione, a well-known ~, aromatase inhibitor. A 50% inhibition of the , activity would be achieved by the addition of 30 nM
'i of the inhibitor, a concentration ~imilar to that reported in the literature. This result indicates that this ~ystem will be u~e~ul to screen ~romatase ~¦ inhibitors a~ drugs to treat bre~6t c~ncer.

,.

. ~ ' .

.~
., - .

:1 :

.~ ' - .: ' . ~ ~ - , ..

Claims (8)

WHAT IS CLAIMED IS:

1. Isolated cDNA comprising the nucleotide sequence depicted by Figure 1.

2. An isolated polypeptide comprising the amino acid sequence depicted by Figure 1.

3. The aromatase expression plasmid pH .beta.-Aro.

4. A transfected mammalian cell which expresses aromatase.

5. A mammalian cell transfected with the plasmid pH .beta.-Aro.

6. A human breast cancer cell transfected with plasmid pH .beta.-Aro which expresses human aromatase.

7. A human breast cancer cell as defined by claim 6 which is an MCF-7 cell, a BT-20 cell, or an HBL-100 cell.

8. A process for screening human aromatase inhibitors which comprises determining the extent of inhibition of the activity of aromatase expressed by cell as defined by claim 4, claim 5 or claim 6 caused by a known amount of said inhibitor.