JPH04197179A - Large protein gene of human papainfluenza 2 virus and substance containing the gene - Google Patents

Abstract

NEW MATERIAL:The subject human parainfluenza 2 gene containing the unit expressed by the total or a part of the formula as the total or a part of the base-sequence constituting the gene. USE:Diagnostic for PIV-2 infection disease, etc. PREPARATION:The objective gene can be synthesized by phosphoamidite process based on the base sequence having complementarity to the gene RNA of PIV-2.L protein of formula.

Description

Detailed Description of the Invention [Industrial Application Field] The present invention relates to human parainfluenza type 2 virus (hereinafter referred to as PIV-2) large protein (hereinafter referred to as L
More specifically, it shows complementarity to the gene RNA of PIV-2 L protein, and roughly includes the entire coding region of PIV-2 L protein. For example, the gene is useful as a test agent for PIV-2 infection or as a therapeutic agent.

[Conventional technology and its problems]

For example, in order to enhance the therapeutic effect of viral infections, it is necessary to identify the infectious virus and perform appropriate treatment based on the identification results.

Conventionally, viruses have been identified based on their serological properties, and the main methods are enzyme-linked immunosorbent assay (hereinafter referred to as ELISA), neutralization reaction method, and complement fixation reaction. method, hemagglutination inhibition reaction method, fluorescent antibody method, agar precipitation reaction method, etc. are known. However, in both of these methods, the determination is made by measuring antibodies against the virus in the specimen, and in order to make a highly accurate determination, - The virus antibody titer increases one week after infection during boat fishing. This has to be done at the beginning of the disease, and in some cases, it may be necessary to take a re-measurement several weeks later for confirmation.Therefore, there is a problem in that it is difficult to make pre-symptomatic and early diagnosis.

Usually, the ELISA method is used to measure PjV-2 (7), and this method measures antibodies against PIV-2 in a sample. The sample is added and reacted, washed, then an anti-PIV-2 antibody is added and reacted in the same manner, and then an enzyme-labeled antibody is added and reacted, followed by color development. This method also Similar to the above, it is difficult to make pre-symptomatic and early diagnosis, inevitably delaying the start of treatment, and it is difficult to increase the therapeutic effect.

The present invention makes it possible to solve the above-mentioned problems, and in particular provides a gene useful as a test agent that enables early diagnosis of PIV-2 infection.

[Means to solve the problem]

The present invention provides that all or a part of the base sequence constituting the gene has the following [formula]% formula% 321I CCATTTCTTGTTAAATTCCTACCTC
ATTCTAAGCTTCAACCAGTAGAACA
ATGGTACAAGTTGATCAATGCTTCA
TGTAATACTATATCTGACTCAATTG
ATAGATGTATGGAGAATATTTCTAT
TAAGCTTACTGGGAAAAACAATCTA
TTCTCTCGATCCAGAGGAACTGCAG
GTGCAGGTAAAAAACAGTAAATCAC
CCTCAATGATATCCAATCTATTTGG
GAATCAAACAAGTGGCAACCTAATG
TATCTTTATGGCTTACAATTAAATA
CCAAATGCGACAACTTATAATGCAT
CAAAGTTCTCGTCAGCCGACTGATT
TAGTTCACATTGTTGACACACGATC
TGGTCTAATAGTTATCACCCCTGAA
CTTGTTATTTGTTTTGATCGGTTAA
ATAGTGTTTTTAATGTATTTTACATT
TGAGATGACTTTTAATGGTAAGTGAC
ATGTTTGAGGGAAGGGATGAATGTCA
CCGCTCTCTGCACTATTAGTCATTA
CTTATCTCCACTAGGGCCCAAGGATA
GATAGATTGTTTTCCCATTGTAGATG
AATTAGCACATAGTGGAATTAGCAG
GGTCATTTCATTCCCTTTATTACACA
AAGGATGAATCAATAACTGTTACTA
CACAATTGTTAGATACAAAAAAGCTT
AATAGAATTTCAACATGATAATGCT
GAAAATATCTTACGAATATACACTCA
AGCATTGGAAAGAGAGATCTCTCTCCAT
AGAATTTAGAAAGTGCTTTGACTTT
GATCCTGGTGAGGAGCTAAGCATTT
TTATGAAAGACAAGGCAATAAGGTGC
TCCAAGAAGTGATTGGATGAGTGTA
TTTCGTAGAAGTCTAATAAAAACAAC
GACATCAGAGACATCATATTCCTAT
GCCCAATCCATTTTAATAGACGTCTA
TTACTCAATTTCTTAGAAGATGACA
GTTTTGATCCAGTTGCCGAGCTTCG
ATATGTTACCGGTGGTGAATATCTC
CAAGATGACACATTTTTGTGCATCT
ACTCATTAAAAGAGAAAGAAATAAA
ACCAGATGGAAGGATATTTGCTAAG
CTTACTAATAGAATGCGGTCCTGTC
AAGTAATTGCGGAAGCAATTCTCGC
AAATCATGCAGGTACTCTAATGAAG
To GAAACGGAGTTGTCTTGAATCAAT
TATCACTGACTAAATCATTGCTTAC
TATGAGTCAAATTGGCATAATATCA
GAAAAGGCGAAGAGATATACGCGAG
ATAACATCTCCATCCCAAGGTTTCCA
TACAATCAAGACTGATTCTAAAAAT
AAGAGGAAAAGCAAAACTGCATCAT
CATACCTCACAGATCCTGATGATAC
ATTTGAACTTAGTGCATGTTTATA
ACTACTGATCTTGCTAAAATACTGTC
TTCAATGGAGATATCAGACCATAAT
21!811 CCATTTTGCTCGAACATTAAACAGA
ATGTATGGAGTTCCA212@CATTTATTTGAATGGATTCATCTTC
GTTTAATTAGATCTA216@CATTATATGTTGGTGATCCATTCAA
TCCTCCTGCCGCAACTGATGCTTTC
GATCTAGATAAAGTATTAAATGGTG
ATATCTTTATAGTCTCCAAGGGAGG
TATTGAAGGCCTATGTCAGAAAATG
TGGACAATGATCTCTATTCTGTGA
TCATCCTCTC32i1 TTCAGCCGAATCCAAAACAAGAGTA
ATGAGCATGGTTCAAGGAGATAATC
AGGCGATTGCAGTTACAACAAGAGGT
TCCTAACTGACCAAAACTTGCAGTAT
TGATATATCTAGAAGTTTTAAGAAAA
TTATCATGGTCTTCTTTATTGAATG
GAAGAACTTTTAGAAGGATTAGAAAC
TCCAGATCCAATTGAAGTTGTCAAT
GGTTTCTTGATTGTAGGTACAGGAG
ATTGTGATTTTTGTA36・e TGCAGGGTGACGACAAAATTTACTTG
GTTCTTTTTACCTATGGGGATAATT
ATTGATGGAAATCCTGAAAACTAATC
CACCCATCAGAGTTCCATACATTGG
GTCTAGAACAGAGGAAAGAAGAGTT
GCATCAATGGCATATATAAAGGTG
CCACACACAGTTTGAAGGCTGCTCT
TAGAGGCGCAGGGGTATATATTTGG
GCATTCGGGGATACTGTAGTGAACT
GGAATGATGCACTTGATATCGCAAA
TACTAGGGTTAAGATATCCCTAGAG
CAACTTCAGACCCTTTACACCTCTT
CTACATCTGCAAACATTACACACCG
TTTAGATGATGGAGCCACAACACTT
AAATTCACTCCGGTTATCCTATCTG
ACTATAACTAATAACTGGATTAGGTGA
448e ATGTTCTTATATACTAAGATAGATTTA
GTTTTTAAAATTAAATGGCATGGAATT
TCCTTCTTGAGCTTGCATTCCAGAT
GTACTACTTAAGGATATCATTGG
ACAAATATATTTGACTATACTTATA
TGACTTTGCGCAGGATAACCCGGAAC
TGCTCTAAAATAATATTGCAGCTACT
ATTAGCCATCCAAAATTATTAAGAC
GTGCAATGAATCTTGATATTATTCAC
TCCTATACATGCACCGTATTTAGCT
TCATTAGATTATGTCAAATTAAGTA
TTGATGCAATTCAGTGGGGAGTTAA
ACAAGTTCTTGCTGATTTATCAAAT
GGAATTGATCTTGAAATCTTGATTC
TTTCAGAGGGATTCAATGGAAATTAG
TGATAGGCAATGAATCTCATTGCT
AGAAAACTAACTCTCCTTGCACTTG
TTAAAGGTGAGAGACTATACTTTTTCC
AAAAATTAAAGGGATGCCACCAGAA
GAAAAGTGTTTAGTCTTAACTGAAT
ATCTAGCAATGTGTTATCAAAATAC
TCATCACTTAGATCCAGATCTTCAA
AAGTATTTATATATAATCTAACTAATC
CAAAATTGACTGCATTTCCCAGTAA
CAACTTCTACTTAACTAGAAAAAATC
CTTAATCAAATTAGAGAATCAGACG
AAGGACAATATATTATATCACCTCATA
TTATGAATCCTTTCGAACAATTAGAA
ACAGATATAATTCTTCACTCTACTT
TAACTGCTCCTTATGATAATTCAGA
AAACTCTAAACAAAGTTCGATTTATC
CCTTTCGACATCTTTCCACATCCAG
AATCTCTCGAGAAAATATCCTCTCC
AGTTGATCATGACTCTCAATCTGCA
ATTTCAACACTAATTCCAGGCCCTC
CTTCTCATCATGTATTACGACCACT
AGGAGTGTCATCCACAGCTTGGTAT
AAAGGGATAAGTTATTGTAGATACC
TAGAAACACAAAAAGATACAGACTGG
TGATCATCTTTATTATTAGCCGAAGGA
AGCGGTGCTTCAATGTCACTTCTAG
AACTCTTATTTCCAGGAGATACTGT
CTATTATAATAGTCTTTTTTAGTAGT
GGAGAGAATCCTCCACAGAGAAAACT
ATGCCCTCCTTCCAACTCAATTTGT
ACAGAGTGTTCCATATAAAATTGTGG
CAAGCTGATCTTGCTGATGATAGCA
ATTTGATAAAAAGATTTTGTCCCATT
ATGGAATGGAAACGGTGCAGTTACA
GACTTATCAAACAAAGGATGCAGTTG
CATTCATAATACATAAAGTAGGAGC
AGAGAAAGCATCCCTTGTCCATATA
GATCTCGAATCAACTGCTAATATAA
ATCAGCAAAACTCTGTCCAGATCCCA
GATTCATTCATTAATTATAGCAACT
ACTGTTCTTAAGAGGGGTGGGATAT
TAATTTATAAAACATCATGGCTTC
GTTTTCTAGGTTTAGTCAACTAGCA
GGTCTACTTTGGTGCTTCTTTGACC
GGATCCATCTAATACGTAGTAGCTA
TTCTGATCCTCACAGTCATGAGGTT
TATCTTGTATGTAGACTTGCCGCAG
ATTTTAGAACTATCGGTTTCAGTGC
AGCTCTAGTAACTGCTACTACTCT
CACAATGACGGATTCACAACAATAC
ATCCTGATGTTGTTTGTAGTTATTG
GCAACACCATCTTGAAAATGTTGGG
AGAGTCGGAAAAGTAATTGATGAGA
TACTTTGATGGTTTAGCCACCAACTT
CTTCGCAGGAGATAATGGGCTTATT
CTAAGATGTG624 @ GAGGAACTCCAAGCTCCAGAAAATG
GTTAGAGATTGACCAGTTAGCATCA
TTTGATTTGGTTCAAGATGCTCTGG
TTACACTTATCACTATACACCTAAA
GGAAAATTATAGAAGTGCAGTCATCA
CATACAGAGGATTATACATCTCTCC
TCTTCACACC84@8 TTATAATATTGGTGCAGCAGGGAAA
GTCAGAACTATCATCAAATTAATTC
TAGAACGATCTTTAATGTATACAGT
CCGAAATTGGTTAGTTTTACCCAGT
TCCATCCGGGATTCTGTACGACAAG
ATTTAGAATTAGGGTCATTTAGATT
AATGTCTATTTTTAAGTGAACAGACA
TTTCTTAAAAAAGACACCCACAAAAAA
AATACTTACTTGATCAGCTTACAAG
GACATATATATCAACCTTCTTTTAAC
TCTCACTCAGTC, CTTCCCCTCCAC
GA to CGTCCATATCAAAAAACAAAATAT
AAGCCTTAGGTAGTGTAATATGGTA
TCGATGGCGAAGAATTATGAACAACA
ATGATTATAAGAACTCATGATAGTT
The problem is that it is difficult to diagnose PIV-2 infection before its onset and at an early stage by providing a gene (hereinafter sometimes abbreviated as a DNA fragment) that is a unit expressed by all or part of TTATTTAAGAAA. This is an attempt to solve the problem.

The DNA fragment provided by the present invention is PIV-2.
Since it shows complementarity to the gene RNA of L protein, it is used as PI.
When used as a test agent for V-2 identification, PIV-2
This allows for direct identification of antibodies, making it possible to solve problems with conventional indirect identification methods using antibody measurements.

Furthermore, the PIV-2 L protein gene of the present invention is
Since it contains the entire coding region of the 2.L protein, the expressed protein can be used as an antigen for producing antibodies or as a raw material for vaccines, making it suitable for use as a therapeutic agent for PIV-2 infections. is also useful.

The method for producing the DNA fragment represented by the above [formula] in the present invention is not particularly limited and can be carried out according to a conventional method.For example, (a) cDNA prepared from mRNA obtained from PIV-2 infected cells. (2) A method of screening using nucleocapsid RNA as a probe; (2) A method of screening using nucleocapsid RNA as a probe; A clone encoding the PIV-2 L protein gene is isolated by a method of screening using an oligonucleotide obtained from a PIV-2, or a method of screening using an antibody against PIV-2. (b) A method for isolating insert DNA from the plasmid of a clone obtained by [
The phosphoramidite method (
Nature.

310, p. 105, 1984), (c) a method using a combination of the above (a) and (b), and the like.

The DNA fragment of the present invention obtained by the above method can be used as follows.

For example, the DNA fragment obtained by the above method is further cut into ten or more bases, preferably twenty or more bases, with an appropriate restriction enzyme (e.g., BgllI, etc.) if necessary, and then labeled with a radioactive isotope or the like for inspection. Northern hybridization method (hereinafter referred to as the Northern method), etc., in which the test agent is reacted with a nylon membrane etc. on which RNA extracted from a sample (pharyngeal fluid, etc.) is immobilized, and then judged by autoradiography, etc. Identification of P IV-2 can be performed.

In the present invention, the unit represented by all or a part of the above [formula] is useful as a test drug, etc., but the unit can also be appropriately incorporated into an NA vector and used in the same manner as above. Furthermore, the vector does not necessarily have to be a DNA vector; it can also be used by incorporating it into other suitable substances, such as polymers, cellulose, glass beads, pharmaceuticals, etc., or by mixing it with these. can.

〔Example〕

Hereinafter, the present invention will be explained in more detail based on Examples.

After Vero cells were grown in Eagle's essential medium containing 5% fetal bovine serum, this culture medium was replaced with Eagle's essential medium containing freshly prepared actinomycin D (2 μg/m 1 ). Next, PIV-2 (Toshiba strain) was inoculated and cultured in the same culture solution for 24 hours. After detaching the virus-infected ring cells with a trypsin/EDTA mixture, the cells were collected by centrifugation at 8000 rpm for 10 minutes, and then incubated with a guanidine isothiocyanate solution (6M guanidine isothiocyanate, 5mM sodium citrate, 0.1M 2-mercaptoethanol, 0.5%
Sodium lauroyl sarcosinate) was added, quickly dissolved in a homogenizer, and the chromosomal DNA was sheared by passing it through a syringe barrel equipped with a 21G needle 5 times. The obtained cell lysate was centrifuged again at 8000 rpm, and 9 ml of the obtained supernatant was layered on another centrifuge tube containing 3 ml of a 5.7 M cesium chloride aqueous solution, and then centrifuged using a Beckman rotor (
Beckman 5W40Ti rotor)
Ultracentrifugation was performed at 37,000 rpm for 18 hours at 18°C, and the RNA pellet was collected after centrifugation.

From the RNA obtained as above, oligo dT cellulose Type 7 (Pharmacia
a)) was used to extract mRNA containing poly A chain (hereinafter referred to as p
o ly (A+) RNA] is separated,
Purified.

2 cDNA--The Lee cDNA library was synthesized according to the Okayama-Barb method. That is, 5 μl of distilled water was added to 4 μg of the above pO1y(A+) RNA, heated at 65°C for 10 minutes, and then rapidly cooled.
Oligo dT was added to the Kpn I site of the vector (
0.8-1.2μg/μ1)) 10μ! , synthesis reaction solution (
500mM Tris-HCl buffer pH 8, 3,300m
M potassium chloride, 80mM magnesium chloride, 3mM dithiothreitol) 3μm, and 20mM dATP,
20mM dCTP, 20mM dGTP.

Add 1μl of 20mM dTTP to each, and add 20mM dTTP to each well.
After adding units RNasin and 40 units reverse transcriptase, dilute the total volume to 30 μl with distilled water.
The reaction was carried out at 42° C. for 30 minutes to synthesize the first strand cDNA. After completion of the second strand cDNA synthesis, 10 to 30 dG bases were added using terminal deoxynucleotidral transferase in the presence of dGTP. Next, it was digested with the restriction enzyme HindH, annealed with a linker having a dC base chain, and then closed into a ring using E. coli ligase. Finally, in the presence of RNaseH, the second strand is synthesized by DNA polymerase to complete the complete plasmid D.
Created NA. Competent cells (DHI) 100 to 20 obtained by subsequent calcium chloride treatment
10 μl of a mixture of 0.4 M magnesium chloride, 10.1 M calcium chloride, and the above DNA 0 μl
．． Add 02Mg at 0°C for 40 minutes, then at 42°C for 9
Leave it for 0 seconds, then culture solution (10g of Bactodributon,
5g of yeast extract, 5g of sodium chloride in 1
Transformed cells were obtained by adding 1.5 ml of a 0100 O solution dissolved in distilled water and leaving the mixture at -37°C for 40 minutes.

By introducing 0.02 Mg of plasmid DNA into 200 μl of competent cells (DHl) as described above, 2500 independent clones were obtained in the presence of ampicillin.

3 ShiRNA Low's PIV
-2 infected Vero renal cysts, 0.6% Nonide) P-40,
A solution containing 10mM vanadyl ribonucleotide complex (
0.15M Sodium Chloride, 0.05M Tri
s-hydrochloric acid buffer) was added, solubilization was performed by viveting on ice for 1 hour, and centrifugation was performed at 8000 rpm for 10 minutes. Next, a 40% aqueous solution of cesium chloride, a 30% aqueous solution,
9 ml of the supernatant obtained from the above centrifugation was further layered in a centrifuge tube in which 1 ml, 2.5 ml, and 1 ml of the 25% aqueous solution were layered in this order, and the tube was placed in a 5W Beckman rotor.
At 40Ti, 37000 rpm, 18 hours, 16
Equilibrium density gradient centrifugation was performed at °C. After centrifugation, the viral nucleocapsid band generated in the 30% cesium chloride aqueous solution layer was collected. Next, 0.1% SDS and proteinase K (2.5 mg/ml) were added and protein decomposition was performed at 56°C for 15 minutes. Thereafter, treatment was performed with phenol and a phenol/chloroform mixture to obtain nucleocapsid RNA. The resulting nucleocapsid RNA was diluted with 50mM
Add Tris-HCl buffer pH 9.7 and incubate at 95°C for 10
After heating for a minute, the mixture was gradually cooled to room temperature. Next, this R
Add buffer (250mM Tris-HCl, 50mM magnesium chloride, 25mM DTT) to 20μl of NA solution.
, 7.5mM spermine, 500mM potassium chloride) 10μ11 and 32PATP (100μCi
/600pM) 3μI, T4-DNA Kinase 2un
After adding its, make the total volume to 60 μl with distilled water, and add 37
The mixture was reacted for 1 hour at ℃ to obtain a nucleocapsid RNA probe.

Colony Happening Transfer 100 to 200 µl of the above transformed cells to a 15 cm agar plate containing ampicillin (120 ug/ml) (10 g bactodributon, 5 g yeast extract, 5 g sodium chloride, 15 g agar) and bring the total volume to 1000 ml with distilled water. ), sow for 12 hours, 3
Cultured at 7°C.

Copy the colonies that have formed on the nitrocellulose membrane, and
The cells were incubated at ℃ for 6 hours. Next, this membrane was treated with a 0.5N sodium hydroxide/1.5M sodium chloride mixture for 10 minutes, and then treated with a 0.5M solution containing 1.5M sodium chloride.
After being placed in Tris-HCl buffer pH 8.0 for 10 minutes,
Rinse for 5 minutes in a 0.3M sodium chloride/10.03M sodium citrate mixture. After rinsing, the membrane was air-dried, vacuumed and baked at 80° C. for 1 hour to fix the DNA to the membrane.

For each 5 membranes obtained in this way, denatured salmon RNA
(1 mg/ml) 1 ml, 5SPE solution (3°6M sodium chloride, 200mM monosodium phosphate, 20mM
EDTA) 7.5 ml, Denhard solution (2% BSA
, 2% Ficoll, 2% polyvinyl and lolidon)1.
A prehybridization solution consisting of 25ml of 5DS and 1.25ml of 10% 5DS was added and reacted at 42°C for 12 hours, and then the nucleocapsid RNA probe was added to the freshly prepared prehybridization solution at 500%
The solution was added at a concentration of 1,000,000 Ci/ml, and the reaction was carried out at 42°C for 18 hours.

After completion of the reaction, 20-fold dilution of 5SP containing 0.1% SDS
Wash twice for 5 min at 42°C in solution E, then 0.1% SD
Washing was performed twice for 15 minutes at 42° C. in a 200-fold diluted 5SPE solution containing S. After washing, the membrane was air-dried and exposed to −80″CI using an X-ray film (RX5, manufactured by Kodak).
Autoradiography was performed for 2 hours and several positive clones were obtained.

0LL-L: The Northan method was performed using the positive clones above the LZ periphery. That is, poly (A+) RNA derived from PIV-2 infected cells, poly (A+) RNA derived from virus-uninfected cells, and rRNA markers obtained by the method (1) above,
After electrophoresis in a 1.5% agarose gel, the RNA was transferred to a nylon membrane (Hybond-N, manufactured by Amajam), air-dried, and covalently bonded to the nylon membrane by irradiation with UV Wire. Hybridization was performed using each clone as a probe.

That is, the nylon membrane was reacted in the above prehybridization solution at 42°C for 12 hours, and then 100% of the 32p-labeled probe made from each positive clone was incubated.
It was added to the prehybridization solution at a concentration of 10,000 Ci/ml and reacted at 42°C for 18 hours. After the reaction was completed, washing was performed in the same manner as in (4) above, and autoradiography was performed using X-ray film. As a result, approximately 7000 ba
One clone hybridizing to the se position was obtained.

This clone was named 9M2L.

Note that the probe for each positive clone makes each clone Hi
After digestion with .

The clone pM2L obtained in (5) above was digested with various restriction enzymes to create a restriction enzyme map, and the results are shown in FIG.

That is, FIG. 1 shows clone pM2L as HIndm, E
After cleavage with co31 I and EcoRI restriction enzymes, the resulting fragment was cleaved into plasmid “pUCllB”.
Introduce each to the multi-cloning site and SEQUE
Sea fencing was performed using the NASETM kit (manufactured by Toyobo Co., Ltd.), and some deletion mutants were created using the deletion kit for kilo sea fencing (manufactured by Takara Shuzo Co., Ltd.), and sea fencing was performed to determine the base sequence. This is a restriction enzyme map created by In the drawing, 1 and 3 are vector DNA, and 2 is inserter) D
NA is the DNA fragment of the present invention.

The results were as shown in the above [Formula].

7 When using the entire PIV-2 (7-1' insert) DNA: After cutting the pM2L clone obtained in (5) above with SmaI and EcoRI, approximately The band migrating at the 7000 base pair position was cut out, extracted, and inserted into the insert by ethanol precipitation.
NA was collected.

Obtained insert DNAI u l (10pm.

tes/μl) per buffer solution (0.5M Tri
s-hydrochloric acid p) (7,6,0,1M MgC12,50m
M dithiothreitol, 1mM spermidine hydrochloride, 1
2 ul (mM ED TA), distilled water 11.
4 μl, (r32P)ATP 5 μl (2 nmol
eS/μl).

Bacteriophage T4 polynucleotide kinase 8
After adding unit, the mixture was reacted at 37°C for 45 minutes. Next, the reaction solution was purified using Bio-gel P60 (Japan Bio-Rad Laboratories Co., Ltd.), and the resulting purified product was used as a probe.

Next, 0.35μ of RNA derived from PIV-2 infected cells obtained by the method (1) above and RNA derived from virus-uninfected cells was added.
After plotting each g on a nylon membrane, air-drying, UV irradiation, and incubating in the hybridization solution of (4) above for 42 hours.
The reaction was carried out at ℃ for 12 hours.

Next, the probe was placed in a boiling water bath for 2 minutes, then rapidly cooled and added to a concentration of 1,000,000 Ci/ml, and further reacted at 42° C. for 18 hours. After the reaction is completed, 0.1%
It was washed twice for 5 minutes at 42°C in a 20-fold diluted 5SPE solution containing SDS, and then twice for 15 minutes at 42°C in a 200-fold diluted 5SPE solution containing 0.1% SDS. After washing, the membrane was air-dried and exposed to -8
Autoradiography was performed for 12 hours at 0°C.

As a result, a positive signal generated by the same probe that had hybridized with the PIV-2 virus RNA in the sample was observed in the area where PIV-2 infected cell-derived RNA was plotted, indicating that the cell was infected with PIV-2. confirmed. On the other hand, no reaction was observed in the area where RNA derived from virus-uninfected cells was plotted.

(7-2) When using a partial fragment of insert DNA; After cleaving the pM2L clone obtained in (5) above with Pstr, approximately 2
The band that migrates at the 100 base pair position is cut out and D
After extracting the NA fragments, they were recovered by ethanol precipitation. The obtained DNA fragment was used as a probe by random prime labeling. That is, the DNA fragment O0lμ
Add 10 μl of distilled water to g and quench by placing in boiling water for 2 minutes, then add 1 μm of bovine serum albumin (10 mg/ml),
Random solution (0.44M HEPES pH6.6,
110mM Tri s-HCl pHs, 11mM Mg
C12, 22mM 2-mercaptoethanol, 44μM
dATP, 44μM dGTP, 44μM d
TTP, 0.12mM Tris-hydrochloric acid p)1
7.5.0.12mM ED TA, 11 u n
i t s/ml oligonucleotide pd(N)s
(manufactured by Pharmacia Co., Ltd.)) 11.4 μl, (α32
P) 5 μl of dCTP (100 μCi/600 pM) and 2.5 units of Flenow were added and reacted at room temperature for 6 hours.

The obtained reaction solution was purified by Bio-gel P2O and used as a probe.

Next, the PIV-2-infected cell-derived RNA and virus-uninfected cell-derived RNA obtained by the method (1) above were mixed at 0.3
After plotting 5 μg each on a nylon membrane, it was air-dried, irradiated with υ■, and reacted for 12 hours at 42°C in the hybridization solution described in (4) above.Then, it was placed in a boiling water bath for 2 minutes, and then rapidly cooled. The applied probe was heated to 1,000,000 Ci.
/ml and further reacted at 42°C for 18 hours.

After the reaction, 20-fold diluted 5SPE containing 0.1% SDS
Wash twice for 5 min at 42°C in solution, then 0.1% SD
Washing was performed twice for 15 minutes at 42° C. in a 200-fold diluted 5SPE solution containing S. After washing, the membrane was air-dried and autoradiography was performed at -80° C. for 12 hours using X-ray film.

As a result, in the area where RNA derived from PIV-2 infected cells was plotted, a positive signal generated by the same probe that had hybridized with PIV-2 viral RNA in the sample was observed, indicating that the cells were infected with PIV-2. This was confirmed. In contrast, RN from virus-uninfected cells
No reaction was observed in the area where A was plotted.

(7-3) When using an oligonucleotide synthesized based on the base sequence represented by the above [formula]: the above [formula]
Based on the base sequence shown above, an oligonucleotide of ten or more bases can be synthesized and used as a probe.

DNA synthesizer (DNA synthesizer model 381A
(Abride Biosystems Japan Co., Ltd.)
Oligonucleotide (5'-ATCTT) synthesized using
GCTGAACGACTTGG-3') was purified using an oligonucleotide purification cartridge (manufactured by Applied Biosystems Japan Co., Ltd.). 1 μl of the obtained synthetic oligonucleotide (10 pmoles/μ
per l), 2 μl of the buffer solution <7-1) above, and 11 ml of distilled water.
．． 4μm, (y32P)ATP5μm (2nmol
After adding 8 units of bacteriophage T4 polynucleotide kinase (e s/μl), the mixture was reacted at 37°C for 45 minutes. Next, the reaction solution was mixed with Bio-gel P60
The purified product obtained was used as a probe.

Next, the PIV-2-infected cell-derived RNA obtained by the method (1) above and the virus-uninfected cell-derived RNA were added to 0.3
After plotting 5 μg each on a nylon membrane, it was air-dried, UV irradiated, and reacted in the hybridization solution (4) above at 42° C. for 12 hours.

Next, the above probe was added at a concentration of 1,000,000 Ci/ml, and the reaction was further carried out at 42°C for 18 hours.

After the reaction, 20-fold diluted 5SPE containing 0.1% SDS
Wash twice for 5 min at 42°C in solution, then 0.1% SD
Washing was performed twice for 16 minutes at 42° C. in a 200-fold diluted 5SPE solution containing S. After washing, the membrane was air-dried and autoradiography was performed using X-ray film at -80°C for 12 hours.

As a result, in the area where RNA derived from PIV-2 infected cells was plotted, a positive signal generated by the same probe that had hybridized with PIV-2 viral RNA in the sample was observed, indicating that the cells were infected with PIV-2. This was confirmed. In contrast, RN from virus-uninfected cells
No reaction was observed in the area where A was plotted.

Garden 1! Δ! 8/2/2019 Call for loan
The Δ9M2L clone contains almost the entire region of the L protein gene and the L
Since it contains the entire protein-encoded gene region, by inserting the inserter DNA of the 9M2L clone into an appropriate vector, it is possible to express the protein encoded in the gene.

The expressed protein can be used as an antigen for making antibodies, a raw material for vaccines, etc. Various methods can be used for protein expression, such as in vitro synthesis using rabbit red blood cell lysate, etc. Synthetic images, systems using microorganisms such as Bacillus subtilis, systems using cells such as yeast, insects, and mammals can be used to express proteins encoded by various genes.

9M2L clone's insert) Start codon in the DNA (
ATG, numbers 35 to 37 of the above [formula]) are expression vector pKK223-3 (manufactured by Pharmacia Co., Ltd.)
The position should be 15 base pairs from 10, counting from the glue bosome binding site. That is, a deletion insert DNA is prepared by removing nucleotides 0 to 34 of the base sequence shown in the formula [formula], and introduced into the SmaI site of pKK223-3'<lid(7).

The obtained clone was introduced into E. coli JM109,
YT culture solution containing 100 μg/ml ampicillin (16 g Bactodrypton, 1 Yeast Extract)
Dissolve 0g of sodium chloride in smoked water to make 11) and incubate at 37°C for 12 hours. Next, add isopropylthiogalactoside to 2mM and
Further shaking culture is carried out at 5°C for 5 hours. After the culture is completed, the culture solution is centrifuged at 110,000 rpm for 10 minutes at 15°C to obtain a precipitate. Next, the precipitate was dissolved in 30mM Tris=hydrochloric acid buffer containing 30mM sodium chloride (pH
After washing with 7, 5), suspend in the above buffer solution and make suspension 1.
1 mg of lysozyme and 0.25M EDT per m
After adding 25 μl of A and leaving at room temperature for 15 minutes, freeze-thaw four times. Next, this melt was heated to 11,000 Orp.
Centrifuge for 60 minutes at 4°C to obtain the supernatant. The target protein in the obtained supernatant was identified using the method of Komada et al.
gen, Virol, 1989, No. 7
Vol. 0, pp. 3487-3492) and the method of Ito et al.
Archjves□f Virology, 19
1987, Vol. 95, pp. 211-224).

That is, after immunoprecipitation using an anti-PIV-2 antibody, analysis is performed by polyacrylamide gel electrophoresis to confirm that L protein is expressed in E. coli.

〔Effect of the invention〕

The gene represented by the formula [formula ko] provided by the present invention specifically shows complementarity to the gene RNA of PIV-2L protein, so it can be used as a test agent for early diagnosis of PIV-2g infection. Furthermore, since the gene represented by the above [formula] includes the entire coding region of PIV-2 L protein, the expressed protein can be used as an antigen for antibody production.
Furthermore, since it can be used as a raw material for vaccines, it is extremely advantageous in that it can be applied to both the inspection and treatment of PIV-2g infection at the same time.

[Brief explanation of the drawing]

FIG. 1 is a restriction enzyme map of the cDNA region of DNA (pM2L) that is complementary to the PIV-2 gene represented by the above [formula]. l and 3...Vector DNA 2...Insert DNA

Claims (2)

[Claims] (1) All or part of the base sequence constituting the gene is
A human rose influenza type 2 virus large protein gene which is a unit represented by all or part of the following [formula]. [There is a gene sequence] [There is a gene sequence] [There is a gene sequence] [There is a gene sequence] (2) All or part of the base sequence constituting the gene is
A substance containing the human parainfluenza type 2 virus large protein gene, which is a unit represented by all or part of the following [formula]. [There is a gene sequence] [There is a gene sequence] [There is a gene sequence] [There is a gene sequence] [There is a gene sequence]