JPH0411889A - Human parainfluenza 4a type virus phosphoprotein gene and substance containing the same gene - Google Patents

Abstract

NEW MATERIAL:The subject gene in which all or part of a base sequence expressed by the formula is all or part of a base sequence constructing the gene. USE:Testing agents, etc., for infectious diseases with the subject virus. PREPARATION:A cDNA prepared from an mRNA obtained from cells infected with the subject virus is transduced into a vector, cloned with Escherichia coli and screened with a nucleocapsid RNA to isolate the clone capable of coding the subject virus.P protein gene and separate an insert DNA from the obtained plasmid.

Description

Detailed Description of the Invention [Field of Industrial Application] The present invention relates to the human parainfluenza virus type 4A virus (hereinafter abbreviated as PIV-4A) phosphoprotein (hereinafter abbreviated as P protein) gene and the gene. More specifically, the substance containing PiV-4A-P protein gene R
Shows complementarity to NA, and furthermore, PIV-4AOvW
& The entire coding region in white and the amino terminal side of P protein (hereinafter referred to as
(abbreviated as N-terminal side) and carboxyl-terminal side (hereinafter referred to as
PI
This gene is useful as a test drug for V-4A infection or as a therapeutic drug.

[Conventional technology and its problems]

In order to enhance the therapeutic effect of viral infections, it is necessary to identify the infectious virus and perform appropriate treatment based on the identification results.

Conventionally, viruses have been identified based on serological properties, and the main methods are enzyme-linked immunosorbent assay (hereinafter referred to as ELISA), neutralization reaction method, and complement fixation reaction method. , hemagglutination inhibition reaction method, fluorescent antibody method, agar precipitation reaction method, etc. are known. However, in both of these methods, the determination is made by measuring antibodies against the virus in the sample, and in order to make a highly accurate determination, - The virus antibody titer increases after one week of infection during boat fishing. This has to be done at the beginning of the disease, and in some cases, it may be necessary to re-measure after a few weeks to confirm, making it difficult to make early diagnosis before the onset of the disease.

Normally, PIV-4A (D measurement!, :HAELIS
Method A is used, and this method detects PIV-
It measures antibodies against 4A, for example, PIV
-4A was immobilized on the plate, the specimen was added to the plate, reacted, washed, an anti-P IV-4A antibody was added and reacted in the same manner, and then an enzyme-labeled antibody was added and reacted,
This method is measured by developing color, but as mentioned above, this method also has the problem that it is difficult to diagnose before the onset of symptoms and at an early stage, which inevitably results in a delay in starting treatment, making it difficult to increase the therapeutic effect. There is.

The present invention makes it possible to solve the above-mentioned problems, and particularly provides a gene useful as a test agent for early diagnosis of PIV-4A infection.

[Means to solve the problem]

The present invention provides that all or part of the base sequence constituting the gene has the following [formula] [formula]; AGGTCACTCAATCGTTCA
GGCTACTATAATTTCTAATTCCGGA
CAAAACCGACAAAATGAGCTTTGAA
ATAAGTGTAGAGGGAAAATTGAAGAGC
TCATTGAGACTGGCAATCTCCAAC”A
TAGACCATGCACTAAAAGAATTAGG
TGCAACCAGTCAATCATCACTAAAC
AAACCTCCATCCCCAAAGTAGCAGAA
CAGAAGGGAAATGATGGTGGAACCCAA
GATTTCAAAGAAATCCGGCTCCTGTA
GAGGCACCTGCCCATATACATCCACAG
CACAACGGTCACACAATGAAGAGAA
TGAATCAGGAAGACAAAATCTAGAC
AGCCTTTCCATGATATCCAATAAAC
CCCAGACAGGCACGCTGCTTATGGG
ATCAGACACACAACTTCCAAGTCCA
TCAAAGACTTATCAAAGGACTCATTC
TTGATGCAAAAAAGAGAGCACTAAA
TGAGCCAAGAAGGGGATCAAAAGATA
ACAAATGAACATGGCAGTATGAATG
ACACCAGGATATTTAAGAGGGGGGA
ATATAGATACCAGGAAAGAGGCTTG
GGTTACAC＾GAATCAGAGATCAAGA
ACACAACCCCCACTCCAAGACATCG
AAGAGAGTACTCGATTTCATGGGTT
AACGGAAGAACCACAATATCCGAGGT
GGTGCAATCCATGCTGCGCACCAGT
CAAATCAAACTGCCTCTGTCGAAAAAA
TGCACATGTGGAAGATGTCCCCAAA
TTTGCGAACTATGCATCAGAGATCC
TTGATGCAATTAAGGCATTAGAAGT
GAGACTAGACAGGATTGAGGGGAAA
GTTGACAAAAATTATGCTTACTCAAA
ATACAATTCAGCAAACAAAGAATGA
CACTCAACAAATCAAAGGTTCACTT
GCCACAATTGAGGGCCTAATCACGA
CAATGAAAATAATGGATCCTGGAGT
CCCATCAAAGTAAGTCTCAGGAGT
TTAAACAAAAGAATCAGAACAAGTTTC
CTATAATTGTTACTGGTAACGGAGA
CGTCTCAAAATTTGTTGATCAAAGAC
AATACAATTACACTTGACTCATTAG
CAAGACCCATATTATCTGGAACCCAA
ACAAAAAAACCGATGAGAGACGAGCA
GGTGTTCGTATAGATGCACTTAAAA
TAACAGTCTCAGAAATGATTCGGGA
TCTATTTGGAGACTGTGATAAGAGC
AAAAAGCTTCTTGAATCAAATAAATA
TGGCAAACTACAGAGCAAGACATCAA
TCTGATCAAAACCCAATGCCCTTAGA
AGTATCACCTAAATTATGAGAGTCA
TAGGTCATAGGGACAATCGCGATTC
^GATCCACTCAACACACCCAATCCTT
CAATCCCACATCCCAAAAGAAACAAC
TGGACCACACTCTCAAGAATCAAAA
CCAAATCGAATGACAACAACATTAA
TCGTCATCAAACAACACAGAGCA
CCATGACCGCACATACACCCAACCC
CCAAACAGGCACAACCCACCAGCTCA
TAGGTTATTTCCGTGACAATATAAA
A gene that is a unit represented by all or part of TAATTTAAG (hereinafter sometimes abbreviated as DNA fragment)
By providing this, it is possible to solve the problem that it is difficult to diagnose PIV-4A infection before its onset and at an early stage.

The DNA fragment provided by the present invention is PIV-4A
- Since it shows complementarity to P protein gene RNA, this
When used as a test agent for identifying IV-4A, PIV-
4A can be directly identified, and problems with conventional indirect identification methods using antibody measurements can be solved.

In addition, the number of G bases from the 511th to 5161000 G bases in the base sequence represented by the above [Formula] is 2 more G bases added to the same position at the stage of transcription into mRNA, resulting in a total of 8 G bases. There are those with a base, and those with three G bases added for a total of nine G bases, and the above [[
The mRNA consisting of 6 G bases and 9 G bases represented by the formula] codes for protein, and the mRNA consisting of 8 G bases codes for P protein, and this P protein and V Proteins share an N-terminal amino acid sequence. Therefore, the DNA fragment of the present invention represented by the above [formula] is P IV
-4A-V contains the entire coding region of the protein and the regions encoding the N-terminus and C-terminus of the P protein, so the expressed V
Since the N-terminal side of the protein and P protein can be used as an antigen when producing antibodies or as a raw material for vaccines, it can be used as a therapeutic drug for PIV-4A infection.

In the present invention, it goes without saying that the unit represented by all or part of the above [formula] can itself be used as a test drug or a therapeutic drug, but all or part of the unit can be used in other suitable forms. A gene incorporated into a DNA vector can also be used in the same manner as above (IF claim), and furthermore, the vector does not necessarily have to be a DNA vector, but can be made of other suitable materials such as polymers, cellulose, glass, Substances containing genes obtained by incorporating them into ceramics, pharmaceuticals, etc., or mixing them with these can also be used (Claim 2), and these genes or substances containing genes are also included in the present invention. .

The method for producing the DNA fragment represented by the above [formula] in the present invention is not particularly limited and can be carried out according to a conventional method. For example, (a) cDNA prepared from mRNA obtained from PIV-4A infected cells (1) A method of screening using nucleocapsid RNA as a probe; (2) A method of screening using nucleocapsid RNA as a probe; A clone encoding the PIV-4A-P protein gene is isolated by a method of screening using oligonucleotides, a method of screening using an antibody against PIV-4A, etc., and a clone encoding the PIV-4A-P protein gene is isolated. Method for separating insert DNA from plasmid, (b) Table 1tL'5PIV-4A-P using the above [formula]
The phosphoramidite method (Nature.

310, p. 105, 19B4), (c) a method of combining the above (a) and (b), and the like.

The DNA fragment of the present invention obtained by the above method can be used as follows.

For example, when used as a test reagent, the DNA fragment obtained by the above method may be treated with an appropriate restriction enzyme (e.g. E
coT221, etc.) into ten or more bases (preferably 17 or more bases, more preferably 20 or more bases), and then labeling with a radioactive isotope or the like to obtain a test reagent. ) PIV-4A can be identified by the Northan hybridization method (hereinafter referred to as the Northan method), which is determined by autoradiography after reacting with an immobilized nylon membrane etc. .

In addition, when used as a therapeutic agent, the DNA fragment is inserted into an appropriate vector as necessary, and various methods for protein expression are used, such as an in vitro synthesis system using rabbit red blood cell lysate, Escherichia coli, or Bacillus subtilis. The protein encoded in the gene is expressed using a system using microorganisms such as yeast, insects, mammalian cells, etc., and the expressed protein can be used as an antigen when making antibodies. Alternatively, it can be used as a raw material for vaccines.

〔Example〕

Hereinafter, the present invention will be explained in more detail based on Examples.

Primary monkey kidney cells were grown in Eagle's essential medium containing 6% fetal bovine serum, and then this culture medium was replaced with Eagle's essential medium containing freshly prepared actinomycin D (2 μg/ml). Next, PI V-4A (Toshiba Corporation)
was inoculated and cultured in the same culture solution for 24 hours. After detaching virus-infected cultured cells with a trypsin/EDTA mixture, the cells were collected by centrifugation at 8,000 rpm for 10 minutes, and guanidine isothiocyanate solution (6M guanidine isothiocyanate, 5mM sodium citrate, 0.1M 2-mercaptoethanol, 0.6% sodium lauroyl sarcosinate) was added, quickly dissolved in a homogenizer, and passed through a syringe barrel equipped with a 21G needle 6 times to shear the chromosomal DNA. The obtained cell lysate was centrifuged again at 8,000 rpm, and 9 ml of the obtained supernatant was layered in another centrifuge tube containing 3 mf of a 6°7M cesium chloride aqueous solution, and then centrifuged using a Beckman rotor (B
eekman 5W40Ti rotor)
Ultracentrifugation was performed at 37,000 rpm for 18 hours at 18°C, and the RNA pellet was collected after centrifugation.

From the RNA obtained as above, oligo dT cellulose Type? (Pharmacia)
a) mRNA containing poly A chain (hereinafter referred to as
poly(A+) RNA] was isolated and purified.

2 cDNA--1-; The cDNA library was synthesized according to the Okayama-Barb method.

That is, 6 μl of distilled water was added to 4 gg of the above po Iy (A+) RNA, heated at 65° C. for 10 minutes, and then rapidly cooled.
8-1.2 μg/μm)] 10 μm, synthesis reaction solution (
500mM Tris-HCl buffer pH 8.3,
300mM potassium chloride, 80mM magnesium chloride,
3μl of 3mM dithiothreitol) and 20m
M dATP, 20mM dCTP, 20mM dGT
Add 1 u1 each of P and 20 mM dTTP, and then add 2
After adding 0 units of RNasin and 40 units of reverse transcriptase, the total volume was adjusted to 30 μm with distilled water, and the reaction was performed at 42°C for 30 minutes.
Strand cDNA was synthesized.

After the completion of second-strand cDNA synthesis, terminal deoxynucleotyral transferase is activated in the presence of dGTP.
Add 0-30 dG bases, then restriction enzyme (Ht
After digestion with ndl[I] and annealing with a linker having a dC base chain, the mixture was closed into a ring using E. coli ligase. Finally, the second strand is synthesized using DNA polymerase in the presence of RNaseH to complete the complete plasmid DNA.
Competent cells (DHI) 100-200 obtained by applying calcium chloride treatment to the 0th order of A
5 μl, 10 μl of a mixture of 0.4 M magnesium chloride, 10.1 M calcium chloride, and 0.02 μl of the above DNA.
℃g was added and left closed at 0℃ for 40 minutes, then at 42℃ for 90 seconds, and then the culture solution (10g of Bactodributon, 5g of yeast extract, 5g of sodium chloride, 10g of sodium chloride) was added.
Transformed cells were obtained by adding 1.5 ml of a solution dissolved in 00 ml of distilled water and leaving the mixture at 87°C for 40 minutes.

200μ due to the above! 1500 independent clones were obtained by introducing 0.02°C g of plasmid DNA into competent cells (DHl) in the presence of ampicillin.

3 Leo Si RNA Lo ;PI
V-4A-infected primary monkey kidney cells were treated with 0.6% Nonide
-40.10mM solution containing vanadyl ribonucleotide complex (0.15M sodium chloride, 0.05M Tri
s-hydrochloric acid buffer), solubilized by pipetting in water for 1 hour, and centrifuged at 8000 rpm for 10 minutes.
9 ml of the supernatant obtained from the above centrifugation was further layered in a centrifuge tube in which 1 ml, 2.5 ml, and 1 ml of the 25% aqueous solution were layered in this order, and the tube was placed in a 5W Beckman rotor.
Equilibrium density gradient centrifugation was performed in 40Ti at 37,000 rpm for 18 hours at 16°C. After centrifugation, the virus nucleocapsid band generated in the 30% cesium chloride aqueous solution layer was collected. Next, 0.1% SDS and Brotainase K (2.5 mg/ml) were added to perform proteolysis at 56°C for 15 minutes, followed by treatment with phenol and a warm phenol/chloroform solution to obtain nucleocapsid RNA. The resulting nucleocapsid RNA was treated with 50mMTri.
S-HCl buffer (pH 9.7) was added, heated at 95°C for 10 minutes, and then gradually cooled to room temperature.Next, 20 μm of this RNA solution was diluted with buffer (250mM Tris-HCl, 50%
mM Magnesium Chloride, 25mM DTT, 7.5mM
spermine, 500mM potassium chloride) 10ul,
and 32pATP (100μC/600pM) 3μ
m, T4-DN Akinase 2 units
After adding JE, the total volume was made up to 50 μl with distilled water, and the mixture was reacted at 37° C. for 1 hour to obtain a nucleocapsid RNA probe.

4 Colony Harization: 100 to 200 μm of the transformed cells obtained in (2) above were treated with ampicillin (1
20 u g/ml) on a 15 cm agar plate (10 g bactodributon, 5 g yeast extract, 5 g sodium chloride, 15 g agar were added and the total volume was adjusted to 10,100 O with distilled water) for 12 hours, 3
Cultured at 7°C.

Copy the colonies that have formed on the nitrocellulose membrane, and
The cells were incubated at ℃ for 6 hours. Next, this membrane was treated with a 0.5N sodium hydroxide/1.5M sodium chloride mixture for 10 minutes, and further treated with 0.5MTr containing 1.5M sodium chloride.
After being placed in is-hydrochloric acid buffer pH 8.0 for 10 minutes, 0.
Rinse for 5 minutes in a 3M sodium chloride/10.03M sodium citrate mixture. After rinsing, air dry the membrane,
The DNA was fixed to the membrane by vacuuming and baking at 0° C. for 1 hour.

For each 5 membranes obtained in this way, denatured salmon RNA
(1mg/ml) 1ml, 5SPE solution (3°6M sodium chloride, 200mM monobasic sodium phosphate, 20m
M EDTA) 7.5 ml, Denhard solution (2% B
SA, 2% Ficoll, 2% polyvinylpyrrolidone)
A hybridization solution consisting of 1.25 ml and 1.25 ml of 10% 5DS was added and reacted at 42°C for 12 hours, and then a new III! L. Add the nucleocapsid RN of (3) above to the above prehybridization solution.
Add A probe to 5 million Ci/ml,
The reaction was carried out at 2°C for 18 hours.

After the reaction, 20-fold dilution of 5SP containing 0.1% SDS
Washed twice for 5 min at 42°C in solution E, then 0.1%
1 at 42°C in 200-fold diluted 5SPE solution containing SDS.
Washing was performed twice for 5 minutes. After cleaning, air dry the membrane and
-80 using line film (manufactured by Kodak, RX5)
Autoradiography was performed for 12 hours at °C and several positive clones were obtained.

5 - ゛; The Northan method was performed using the above positive clones.

That is, P IV-4 obtained by the method (1) above
poly (A+) RNA derived from A-infected cells, poly V (A+) RNA derived from virus-uninfected cells, and r
After each RNA marker was electrophoresed in a 1.5% agarose gel, it was transferred to a nylon membrane (Hybond-N, manufactured by Amajam), air-dried, and covalently bound to the nylon membrane by UV irradiation. Next, hybridization was performed using each of the above positive clones as probes.

That is, the nylon membrane was reacted in the prehybridization solution (4) above at 42°C for 12 hours, and then the 32p-labeled probe made from each positive clone was incubated at 1 million Ci/ml. After the 0 reaction, which was added to the hybridization solution and reacted at 42°C for 18 hours, was washed in the same manner as in (4) above, and autoradiography was performed using X-ray film.
6 clones that hybridize to the 00base position
The clone containing the largest inserter DNA was named p4AP.

Note that the probe for each positive clone makes each clone Hi
After digestion with nd m and EcoRI, insert DNA was separated by electrophoresis using low melting point agarose, extracted, and obtained by random prime labeling using 32PdCTP.

Clone I) 4AP obtained in (5) above was digested with various restriction enzymes, and a restriction enzyme restriction map was prepared, and the results are shown in FIG.

That is, FIG. 1 shows that clone p4AP was converted to HindlI [
, Xba L Hpa I, EcoT22 I
After cutting with restriction enzymes such as , Bam1 (I, EcoRI, etc.), the obtained fragment was transformed into plasmid ptrc118
Introduce each to the multi-cloning site and SEQUE
Deletion of sea fence was performed using NASETM kit (manufactured by Toyobo Co., Ltd.) In addition, some deletion mutants were created using deletion kit for kilo sea fence (manufactured by Takara Shuzo Co., Ltd.), sea fence was performed, and the base sequence was determined. This is a restriction enzyme map created by Shishiritoyo. In the drawing, 1 and 3 are vector DNA, and 2 is insert DNA, which is the DNA fragment of the present invention.

The results were as shown in formula c above.

7 V-4A; (7-1) The first base 1 to 11 of the above [formula
When using a part of the inserter) DNA represented by position 71: The p4AP clone obtained in (5) above was
After cutting with I, a part of the inserter DNA was separated and extracted by electrophoresis using low melting point agarose, and a probe was prepared by random prime labeling using 3ap. Next, the PIV-4A-infected cell-derived RNA obtained by the method (1) above and the virus-uninfected cell-derived RNA were mixed at 0.
After plotting 35Mg each on a nylon membrane, air drying and UV
The irradiation and subsequent treatments were carried out in exactly the same manner as the Northern method described in (5) above, followed by reaction and autoradiography.

As a result, the PIV-4A virus RNA in the sample was plotted in the area where PIV-4A-infected cell-derived RNA was plotted.
A positive signal generated by the same probe hybridized with A was observed, confirming infection with PIV-4A. On the other hand, no reaction was observed in the area where RNA derived from virus-uninfected cells was plotted.

(7-2) When using the entire insert DNA represented by numbers 1 to 1502 in the above [Formula]; (5) above.
The p4AP clone of PstI and EcoR
After cutting with I, the band at a position of about 1600 base pairs was cut out by electrophoresis using low melting point agarose, extracted, and the insert DNA was precipitated with ethanol.
was recovered. The resulting insert DNA I μl (1
buffer solution (0.5M
Tris-hydrochloric acid pH7,6,0,1M MgC
! 2.50mM dithiothreitol, 1mM spermidine hydrochloride, 1mM EDTA) 2μm, distilled water 11.4
μm, (γ32P)ATP 5 μl (2Mmo I e
After adding 8 units of bacteriophage T4 polynucleotide kinase, the mixture was reacted at 37°C for 45 minutes.

Next, the reaction solution was purified using B to-ge I P2O (Japan Bio-Rad Laboratories, Inc. U), and the obtained purified product was used as a probe.

Next, RNA derived from PIV-4 At% stained cells obtained by the method (1) above, RNA Att derived from virus-uninfected cells,
After plotting 0.35 Mg on a nylon membrane, air drying,
The probe was irradiated with UV and reacted at 42°C for 12 hours in the hybridization solution of (4) above, then placed in a boiling water bath for 2 minutes and then rapidly cooled.
20,000 Cj/ml and further reacted at 42°C for 18 hours.
Wash twice for 5 minutes at 42°C in 5-fold diluted 5SPE solution,
Next, washing was performed twice for 16 minutes at 42° C. in a 200-fold diluted 5SPE solution containing 0.1% SDS. After cleaning,
The membrane was air-dried and autoradiographed using X-ray film at -80°C for 12 hours.

As a result, the PIV-4A virus RNA in the sample was plotted in the area where PIV-4A-infected cell-derived RNA was plotted.
A positive signal generated by the same probe hybridized with A was observed, confirming infection with PIV-4A. On the other hand, no reaction was observed in the area where RNA derived from virus-uninfected cells was plotted.

(7-3) When using a partial fragment of the insert DNA represented by numbers 1 to 728 in the above [formula];
) p4AP clone of EcoT22r and Eco
After cleavage with RI, electrophoresis using low melting point agarose was performed to cut out the band that migrated at a position of about 700 base pairs, extract the DNA fragments, and recover them by ethanol precipitation. It was made into a probe by labeling.

In other words, 10 μm of distilled water was added to 0.1 Mg of DNA fragments, and the mixture was rapidly cooled in boiling water using a 2-molecule R apparatus. 6,110mM
Tris-HCl pH 8, 11mM MgCl2.
22mM 2-mercaptoethanol, 44MM dA
TP, 44MM dGTPl 44MMd TTP,
0.12mM Tris-HCl pH 7°5.
0.12mM EDTA, 11 units
s/m1 oligonucleotide pd(N)s (Pharmacia Co., Ltd. 11)) 11.4 μl, (α32P)dC
6 μl of TP (100 μCi/600 pM) and 2.5 units of Flenow were added and allowed to react at room temperature for 6 hours, and the resulting reaction solution was purified by Bio-gel P2O and used as a probe.

Next, RNA derived from P IV-4A infected cells and RNA derived from virus-uninfected cells obtained by the method (1) above were combined.
After plotting 0.35 Mg on a nylon membrane, air drying,
Autoradiography was performed in exactly the same manner as in (7-2) above, including UV radiation and subsequent treatments.

As a result, the PIV-4A virus RNA in the sample was plotted in the area where PIV-4A infected cell-derived RNA was plotted.
A positive signal generated by the same probe hybridized with A was observed, confirming infection with PIV-4A. On the other hand, no reaction was observed in the area where RNA derived from virus-uninfected cells was plotted.

(7-4) When using an oligonucleotide synthesized based on the base sequence represented by numbers 96 to 114 in [Formula] above; DNA synthesizer (DNA synthesizer model 381
A: Oligonucleotide (5'-AT) synthesized using Applied Biosystems Japan Co., Ltd.
TGAGACTGGCAATCTCA-3') was purified using an oligonucleotide purification cartridge (manufactured by Applied Biosystems Japan Co., Ltd.), and 1 ul (10 pmol) of the obtained synthetic oligonucleotide was purified.
1 e s/ul) per buffer solution 2 of the above (7-2)
μl, distilled water 11°4ul, (r32P)ATP 5
μl (2 nmoleS/μl) and 8 units of bacteriophage T4 polynucleotide kinase were added and reacted at 37°C for 45 minutes.
It was purified by gel P2O, and the obtained purified product was used as a probe.

Next, RNA derived from P IV-4A infected cells and RNA derived from virus-uninfected cells obtained by the method (1) above were combined.
After plotting 0.36 Mg on a nylon membrane, air drying,
Autoradiography was performed in exactly the same manner as in (7-2) above, including UV irradiation and subsequent treatments.

As a result, the PIV-4A virus RNA in the sample was plotted in the area where PIV-4A infected cell-derived RNA was plotted.
A positive signal generated by the same probe hybridized with A was observed, confirming infection with PIV-4A. On the other hand, no reaction was observed in the area where RNA derived from virus-uninfected cells was plotted.

1) The start codon (ATG; Nos. 57 to 59 of the above [formula]) in the insert DNA of the 4AP clone was linked to the expression vector PKK 223-3 (Pharmacia Co., Ltd. 11
) The position should be 15 base pairs from IO, counting from the glue bosome binding site.

That is, the deletion insert DNA obtained by removing the 1st to 56th base sequence of the base sequence shown in the formula
was created and introduced into the Sma1 site of the pKK 223-3 vector, and the resulting clone was transformed into E. coli JM
109 and cultured for 12 hours at 37°C in YT culture solution containing 100 μg/ml of ampicillin (16 g of Bactodributon, 10 g of Yeast Extract, and 5 g of sodium chloride dissolved in distilled water to make 11), and then incubated with isopropyl for 12 hours. Add thiogalactoside to 2mM, further culture with shaking at 37°C for 5 hours, and after culturing, the culture solution was incubated at 1000 Or pm for 10 minutes at 15°C.
The mixture was centrifuged to obtain a precipitate.

Next, the precipitate was mixed with 30 μl containing 30 mM sodium chloride.
After washing with mM Tris-HCl buffer (pH 7.5), suspending in the buffer, 1 mg of lysozyme and 0.25 M EDTA2 per 1 ml of suspension.
After adding 5 μl and leaving it at room temperature for 16 minutes, freeze-thaw four times, then centrifuge this thawed liquid at 1000 rpm for 60 minutes at 54°C to obtain the supernatant, and extract the protein contained in the supernatant. Upon identification, it was confirmed that the N-terminal sides of the ■ protein and P protein were included.

〔Effect of the invention〕

The gene represented by the above [formula] provided by the present invention specifically complements the gene RNA of PIV-4A-P protein, and therefore is useful for early diagnosis of PIV-4A infection. The gene represented by the above [formula] contains the entire coding region of the P IV-4A-V protein and the regions encoding the N-terminus and C-terminus of the P protein. Therefore, it is possible to use the N-terminal side of the expressed V protein and P protein as antigens for producing antibodies and as raw materials for vaccines.
It is extremely useful in that it can be applied simultaneously to both testing and treatment of A-infectious diseases.

[Brief explanation of drawings]

FIG. 1 shows PIV-4A・P expressed by the above [formula]
Restriction enzyme map of cDNA region of DNA showing complementarity to protein gene. 1 and 3...Vector DNA 2S・Φ・φ insert DNA (p4AP)

Claims (2)

[Claims] (1) All or part of the base sequence constituting the gene is
A human parainfluenza type 4A virus phosphoprotein gene which is a unit represented by all or part of the following [formula]. [Formula]; [There is a gene sequence. ] [There is a gene sequence. ] (2) All or part of the base sequence constituting the gene is
A substance containing the human parainfluenza type 4A virus phosphoprotein gene, which is a unit represented by all or part of the following [formula]. [Formula]; [There is a gene sequence. ]