JPH04179482A - Gene derived from hepatitis c virus - Google Patents

Abstract

NEW MATERIAL:The subject gene containing a base sequence capable of coding an amino acid sequence expressed by the formula, etc. USE:Diagnosis of hepatitis C, etc. PREPARATION:A hepatitis C virus RNA genetic fragment prepared from blood serum of a patient suffering from the hepatitis C is converted into a DNA and cloned.

Description

[Detailed Description of the Invention] [Industrial Application Field] The present invention provides a gene derived from hepatitis C virus, which is the cause of hepatitis C, and a gene obtained by incorporating the gene into a vector capable of expressing the gene in Escherichia coli. The present invention relates to a recombinant vector, an E. coli transformed with the recombinant vector, a polypeptide produced using the E. coli, and a method for producing the polypeptide.

The gene and polypeptide according to the present invention are extremely useful for diagnosing hepatitis C.

[Conventional technology]

Based on serum from patients who developed non-A, non-B hepatitis after blood transfusion, C.
A part of the gene of hepatitis virus (hereinafter sometimes abbreviated as HCV) was cloned, and this was reported in Science by Horton et al. of Chiron Corporation in the United States [5ci
ence, Vol. 244. pp, 359-36
2 (1989), ]. Furthermore, they inserted a portion of the gene encoding the nonstructural protein region of the hepatitis C virus into a yeast expression vector, and succeeded in expressing this gene in yeast. A part of the nonstructural protein produced by this method is derived from the anti-HC protein present in the serum of hepatitis C patients.
Antigenic to V antibody [The Lance
t,, Vol, 335. pp, 1-3.1990. ]
.

This protein is the only antigen for hepatitis C diagnosis currently commercially available.

[Problem to be solved by the invention]

Antigenic proteins produced in yeast can detect antibodies that appear after about 6 months after the onset of hepatitis C, so early diagnosis is not possible, and false positives or false negatives may occur. [The Lancet.

Vol, 335. pp. 754-757 (1990)
and Clinical Science, Volume 25, No. 7, Page 827, 199
It has gradually become clear that there are problems with the 2008 [year 0]. Therefore, there is a need for the development of new antigenic polypeptides that enable early diagnosis with higher accuracy.

Hepatitis C is hepatitis caused by the hepatitis C virus, and it is said that most non-A, non-B hepatitis after blood transfusion is caused by this hepatitis. In many cases, the disease progresses to liver cancer. Hepatitis C virus has a gene length of about 1
It is thought to be a 0 kb (approximately 10,000 nucleotides) RNA virus, and is estimated to be a member of the flavivirus family. Considering this, approximately 1.5 k from the 5° distal side
It is thought that the portion b (approximately 1500 nucleotides) corresponds to the structural protein gene portion, and the remaining 8.5 kb corresponds to the nonstructural protein gene portion. Regarding the base sequence of the hepatitis C virus gene, the non-structural protein gene region is in European patent EPO318216, the structural protein gene region is in Nucleic Ac1ds Research
, Vol., 18. NcL15°11, 4626 (1
990), but these are only fragmentary reports, and the entire region of the open reading frame has not yet been reported.

We have been conducting intensive research on hepatitis C virus genes. There have been only a few reports on the nucleotide sequence of hepatitis C virus gene fragments, but among them, Kato, Okoshi, Shimotono et al.
pointed out differences in the base sequences of the hepatitis C virus gene and the American hepatitis C virus gene, and reported that there are Japanese and American hepatitis C viruses [P
rOCeedings of the Japan A
academy, Vol, 65. Ser, B.
N (L9, pp, 219-223 (1989),
]. However, it is not known in detail whether the nucleotide sequence of the entire hepatitis C virus gene differs between the American type and the Japanese type. It can be said that no knowledge has been obtained to date. In order to detect antibodies against the Japanese hepatitis C virus, is it effective to produce an antigen protein from a gene derived from the Japanese hepatitis C virus?Currently, it is difficult to determine which gene region can be used in any host-vector system. It is still completely unclear whether an antigen polypeptide (hereinafter sometimes referred to as "polypeptide having rHCV antigenic activity") that is useful for immunological diagnosis can be effectively obtained by loading the antigen.

Up until now, we have been conducting our own independent research into the gene expression of gene fragments derived from the hepatitis C virus.

As a result, we succeeded in elucidating the entire open reading frame of the Japanese hepatitis C virus gene for the first time, and furthermore, by expressing a specific gene fragment in Escherichia coli cells, we were able to develop a polypeptide with HCV antigenic activity. We have succeeded in obtaining this, and have completed the present invention.

[Means for Solving the Problems] The present invention resides in a gene derived from hepatitis C virus that includes a base sequence encoding the following amino acid sequence.

Amino acid sequence (1) Trp Leu Leu Ser Pro Arg G
ly Ser Arg Pr.

Ser Trp Gly Pro Thr Asp P
ro Arg Arg ArgSer Arg Asn
Leu Gly Lys Val Ile Asp
ThrLeu Thr Cys Gly Phe Al
a Asp Leu Met GlyTyr Ile
Pro Leu Val Gly Ala Pro L
eu GlyGly Ala Ala Arg Ala
Leu Ala His Gly ValArg V
al Leu Glu Asp Gly Val As
n Tyr AlaThr Gly Asn Leu
Pro Gly Cys Ser Phe 5erAs
n Val Ser Gly Ile Tyr His
Val Thr AsnHis Val Thr G
ly Gly Arg Vat Alaδer Ser
Thr Gin Ser Leu Val Ser T
rp Leu Ser GlnVal Tyr Cys
Phe Thr Pr.

Amino acid sequence (2) Glu Phe Ala Gln Gly Trp G
ly Pro rle ThrHis Asp Met
Pro Glu Ser Ser Asp Gln
ArgPro Tyr Cys Trp His Ty
r Ala Pro Arg Pr.

Cys Gly Ile Val Pro Ala S
er Gin Val CysGly Pro Val
Tyr Cys Phe Thr Pro Ser
Pr.

Val Val Val Gly Thr Thr A
sp Arg Phe GlyAla Pro Thr
Tyr Ser Trp Gly Glu Asn
GluThr Asp Val Leu Leu Le
u Ser Asn Thr ArgPro Pro
Gln Gly Asn Trp Phe Gly C
ys ThrTrp Met Asn Amino acid sequence (3) Leu Leu Ser Asn Thr Arg P
ro Pro Gln GlyAsn Trp Phe
Gly Cys Thr Trp Met Asn
5erThr Gly Phe Thr Lys Th
r Cys Gly Gly Pr.

Pro Cys Asn lie Gly Gly V
al Gly Asn Asn Thr Leu Val
Cys Pro Thr Asp Cys Phe
ArgLys His Pro Glu Ala Th
r Tyr Thr Lys CysGly Ser
Gly Pro Trp Leu Thr Pro A
rg CysMet Val Asp Tyr Pro
Tyr Arg Leu Trp HisTyr P
ro Cys Thr Val Asn Phe Th
r Val Phell)l Leu Ile
NIs Leu Fils Arg ASn
lle VatAsp Val Gln Tyr
Leu Tyr Gly lie Gly Seret Amino acid sequence (4) Leu Phe Leu Leu Leu Ala A
sp Ala Arg ValCys Ala Cys
Leu Trp Met Met Leu Leu
l1eAla Gln Ala Glu Ala Th
r Leu Glu Asn LeuVal Vat
Leu Asn Ala Ala Ser Val A
la GlyAla His Gly Leu Leu
Ser Phe Leu Val PhePhe C
ys Ala Ala Trp Tyr Ile Ly
s Gly ArgLeu Val Pro Gly
Ala Ala Tyr Ala Leu TyrGl
y Val Trp Pro Leu Leu Leu
Leu Leu LeuAla Leu Pro P
ro Arg Ala Tyr Ala Met As
pPro Pro Leu Asn Val ArgG
ly Gly ArgλI! Ala rle Ile
Leu Leu Thr Cys Ala Val H
asPro Glu Leu Ile Phe Asp
Ile Thr Lys Hanging Leu Leu Ala
Ile Leu Gly Pro Leu Met *1
iLeu Gin Ala Gly lie
Thr Arg Val Pro TyrP
he Val Arg Ala Gin Gly Le
u Ile Arg X! aCys Met Leu
Val Arg Lys Val Ala Glyδi
His Tyr Val Gln Met Ala
Phe Met Lys 1ieuAla Ala L
eu Thr Gly Thr Tyr Val Ty
rλ! Product His Leu Thr Pro Leu A
rg Asp Trp Ala A:5Ala Gly
Leu ArgAsp Leu Ala Val A
La Oa! Glu Pro Val Val Phe
Ser Asp Met Glu Amino Acid Sequence) Ala Val Ala Val Glu Pro V
al Val Phe 5erAsp Met Glu
Thr Lys Leu Ile Thr Trp
GayAla Asp Thr Ala Ala Cy
s Gly Asp lie I! 2Ser Gly
Leu Pro Val Ser Ala Arg A
rg GayLys Glu lie Leu Leu
Gly Pro Ala Asp 5erPhe G
ly Glu Gin Gly Trp ArgLeu
Leu AhaPro Ile Thr Ala T
yr Ser Gln Gin Thr Ar′gGl
y Leu Leu Gly Cys Ic
e Ile Thr Ser LeuThr
Gly Arg Asp Lys Asn Gin V
al Asp Glylie Ser Tyr Leu
Lys Gly amino acid sequence) Ser Met Thr Pro Cys Thr C
ys Gly Ser 5erAsp Leu Tyr
Leu Val Thr Arg His Ala
AspVal Vat Pro Val Arg Ar
g Arg Gly Asp SerArg Gly
Ser Leu Leu Ser Pro Arg P
ro l1eSer Tyr Leu Lys Gly
Ser Ser Gly Gly Pr.

Leu Leu Cys Pro Ser Gly H
is Val Vat Glylle Phe Arg
Ala Ala Val Cys Thr Arg
ci; Val Ala Lys Ala Val As
p Phe Ile Pro VatHis Ser
Thr Asp Ser Thr Thr Amino Acid Sequence) Gly Ala Tyr Asp lie rle I
le Cys Asp GluCys His Ser
Thr Asp Ser Thr Thr rle
LeuGly Ile Gly Thr Vat Le
u Asp Gin Ala GluThr Ala
Gly Ala Arg Leu Val Val L
eu AlaThr AlaThr Pro Pro
Gly Ser lie Thr Va! Pro H
is Pro Asn Ile Glu Glu V
al Ala LeuSer Asn Thr Gl
y Glu lie Pro Phe Tyr Gly
Lys Ala Ile Pro Ile Glu A
la rle Lys GlyTyr Glu Leu
Thr Pro Ala Amino Acid Sequence) Asp Ala Gly Cys Ala Trp T
yr Glu Leu ThrPro Ala Glu
Thr Ser Val ArgLeu Arg A
laTyr Leu Asn Thr Pro Gly
Leu Pro Val CysGin Asp H
is Leu Glu Phe Trp Glu Se
r ValPhe Thr Gly Leu Thr
His lie Asp Ala His Phe Le
U Ser Gln Thr Lys Gin Ala
Gly Asp Asn Leu Pro Tyr L
eu Val Ala Tyr Gin AlaThr
Val Cys Ala Arg Ala Gln
Ala Pro PrcPro Ser Trp As
p Gin Met Trp Lys amino acid sequence) Tyr Gln Ala Thr Val Cys A
la Arg Ala GinAla Pro Pro
Pro Ser Trp Asp Gin Met
TrpLys Cys Leu lie Arg Le
u Lys Pro Thr LeuHis Gly
Pro Thr Pro Leu Leu Tyr A
rg Leu 'Gly Ala Val Gi
n Asn Glu Vat Thr Leu Thr
i(is Pro Ile Thr Lys Tyr
lie Met Ala CysMet Ser Al
a Amino acid sequence (10) Trp Asp Gin Met Trp Lys C
ys Leu Ile ArgLeu Lys Pro
Thr Leu His Gly Pro Thr
Pr.

Leu Leu Tyr Arg Leu Gly A
la Val Gln AsnGlu Val Thr
Leu Thr His Pro Ile Thr
LysTyr rle Met Ala Cys Me
t Ser Ala Asp Leu Glu Va
l Val Thr Ser Thr Trp Val
Leu ValGly Gly Val Leu A
la Ala Leu Ala Ala TyrCys
Leu Thr Thr Gly Ser Val
Val Ile ValGly Arg Ile I
Le Leu Ser Gly Arg Pro Al
aThr Ala Ser rle Thr Amino Acid Sequence Sequence 1) Ala lie Ala Ser Leu Met A
la Phe Thr
Ser Pro Leu Thr Thr Gln
AsnThr Leu Leu Phe Asn Il
e Leu Gly Gly TrpVal Ala
Ala Gln Leu Ala Pro Pro S
er AlaAla Ser Ala Phe Val
Gly Ala Gly Ile AlaGly A
la Ala Val Gly Ser lie Gl
y Leu GlyLys Val Leu Val
Asp Ile Leu Ala Gly TyrGl
y Ala Gly Val Ala Gly Ala
Leu Vat AlaPhe Lys Val M
et Ser Gly Glu Met Pro Se
rAmino acid sequence sequence 2) Gly Ala Val Gln Trp Met A
sn Arg Leu l1eAla Phe Ala
Ser Arg Gly Asn His Val
5erPro Thr Hir Tyr Val Pr
o Glu Ser Asp A11aAlaAla
Arg Val Thr Gin Ile Leu
Ser 5erLeu Thr Tie Thr Gl
n Leu Leu Lys Arg LeuHis
Gin Trp Ile Asn Glu Asp C
ys Ser ThrPro Cys Ser Gly
Ser Trp Leu Lys Asp VatT
rp Asp Trp rle Cys Thr Va
l Leu Ser AspPhe Lys Thr
Trp Leu Gln Ser Lys Leu L
euTyr Val Thr Gly Met Thr
Amino acid sequence sequence 3) Trp Arg Val Ala Ala Glu G
lu Tyr Val GluVal Thr Arg
Val Gly Asp Phe His Tyr
VatThr Gly Met Thr Thr As
p Asn Val Lys CysPro Cys
Gln l/al Pro Ala Pr.

Amino acid sequence (14) Val Lys Cys Pro Cys Gln V
al Pro Ala Pr.

Glu Phe Phe Thr Glu Val A
sp Gly Val ArgLeu His Arg
Tyr Ala Pro Val Cys Lys
Pr.

Leu Leu Arg Glu Glu Val V
al Phe Gln ValGly Leu Asn
Gln Tyr Leu Val Gly Ser
GlnLeu Pro Cys Glu Pro Gl
u Pro Asp Val AlaVat Leu
Thr Ser Met Leu Thr Asp P
ro 5erHis Ile Thr Ala Glu
Thr Ala Lys ArgArgLeu Al
a Arg Gly Ser Pro Pro Ser
Leu AlaSer Ser Ser Ala S
Er Gin Leu Ser Ala Pr.

Ser Leu Lys Ala Thr Cys T
hr Thr His His Asp Ser Pro
Asp Ala Asp Leu Ile Glu
AlaAsn Leu Leu Trp Arg Gi
n Glu Met Gly Gly Asn Ile
Thr Arg Val Glu Ser Glu A
sn LysVal Val Ile Leu Asp
Ser Phe Asp Pro [IeArg A
la Val Glu Asp Glu Arg Gl
urle 5erVal Pr.

Amino acid sequence (15) Asp Pro Ile Arg Ala Vat G
lu Asp Glu ArgGlu Ile Ser
Val Pro Ala Glu Ile Leu
ArgLys Pro ArgLys Phe Pr
o Pro Ala Leu Pr.

11e Trp Ala Arg Pro Asp T
yr Asn Pro Pr.

Leu Leu Glu Ser Trp Lys A
sp Pro Asp TyrVal Pro Pro
Val Val His Gly Cys Pro
LeuPro Ser Thr Lys Ala Pr
o Pro Ile Pro Pr.

Pro Arg Arg Lys Arg Thr V
al Val Leu Thr Glu Ser Thr
Vat Ser Ser Ser Ala Leu Ala
GluGly Ala Leu lie Thr Pr
.

Amino acid sequence (16) Val Cys Cys Ser Met Ser T
yr Thr Trp Thr Gly Ala Leu
Ile Thr Pro Cys Ala Ala
GluGlu Ser Lys Leu Pro li
e Asn Pro Leu 5erAsn Ser
Leu Leu Arg His His Ser M
et ValTyr Ser Thr Thr Ser
Arg Ser Ala Ser LeuArg G
ln Lys Lys Val Thr Phe As
p Arg LeuGln Val Leu Asp
Asp His Tyr Arg Asp ValLe
u Lys Glu Met Lys Ala Lys
Ala Ser Thr Val Lys Ala A
rg Leu Leu Ser Ile Glu Gl
uSer Tyr Asp Thr Arg Cys
Phe Asp Ser Thr Val Thr Gl
u Asn Asp Ile Arg Thr Glu
Amino acid sequence sequence 7) Phe Asp Ser Thr Val Thr G
lu Asn Asp lieArg Thr Glu
Glu Ser Ile Tyr Gin Cys
CysAsp Leu Ala Pro Glu Al
a Arg Gln Ala IleArg Ser
Leu Thr Glu Arg Leu Tyr V
al GlyGly Pro Leu Thr Asn
Ser Lys Gly Gin AsnCys G
ly Tyr Arg Arg Cys Arg Al
a Ser Gly Vat Leu Thr Thr
Ser Cys Gly Asn Thr Leuhr Amino acid sequence (18) Ser Gly Vat Leu Thr Thr S
er Cys Gly AsnThr Leu Thr
Cys Tyr Leu Lys Ala Thr
Ala Ala Cys Arg Ala Ala Ly
s Leu Gln Asp CysThr Met
Leu Val Asn Gly Asp Asp L
eu ValVal lie Cys Glu Ser
Ala Gly Thr Gln GluAsp A
la Ala Ala Leu Arg Ala Ph
e Thr GluAla Met Thr Arg
Tyr Ser Ala Pro Pro GlyAs
p Pro Pro Gin Pro Glu Tyr
Asp Leu GluLeu lie Thr S
er Cys Ser Ser Ser Asn Vat 5e
rTyr Tyr Leu Thr ArgAmino acid sequence 9) 11e Thr Ser Cys Ser Ser A
sn Val Ser ValAla His Asp
Ala Ser Gly Lys Arg Val
TyrTyr Leu Thr Arg Asp Pr
o Thr Thr , Pro LeuAla Arg
Ala Ala Trp Glu Thr Val
Arg His Thr Pro Val Asn Se
r Trp Leu Gly Asn l1elie
Met Tyr Ala Pro Thr Leu T
rp Ala ArgMet Ile Leu Met
Thr His Phe Phe Ser l1eL
eu Leu Ala Gln Glu Gln Le
u Glu Lys AlaLeu Asp Cys
Gln Amino acid sequence (20) Thr Met Leu Val Asn Gly A
sp Asp Leu ValVal Ile Cys
Glu Ser Ala Gly Thr Gln
GluAsp Ala Ala Ala Leu Ar
g Ala Phe Thr GluAla Met
Thr Arg Tyr Ser Ala Pro P
ro GlyAsp Pro Pro Gin Pro
Glu Tyr Asp Leu GluLeu I
le Thr Ser Cys Ser Ser As
n Val SerVal Ala )lis Asp
Ala Ser Gly Lys Arg VaiT
yr Tyr Leu Thr Arg Asp Pr
o Thr Thr Pr.

Leu Ala Arg Ala Ala Trp G
lu Thr Val ArgThr Lys Leu
Lys Amino acid sequence (21) Arg Tyr Ser Ala Pro Pro G
ly Asp Pro Pr.

Gln Pro Glu Tyr Asp Leu G
lu Leu lie ThrSer Cys Ser
Ser Asn Val Ser Vat Ala
HasAsp Ala Ser Gly Lys Ar
g Vat Tyr Tyr LeuThr Arg
Asp Pro Thr Thr Pro Leu A
la ArgAla Ala Trp Glu Thr
Val Arg His Thr Pr.

Val Asn Ser Trp Leu Gly A
Sn lie Ile MetTyr Ala Pro
Thr Leu Trp Ala Arg Met
1ieLeu Met Thr His Phe Ph
e Ser Ile Leu LeuTyr Asn
Gly Gly Asp lie Tyr His S
er Leulle Tyr Leu Leu Pro
Asn Arg A hepatitis C virus-derived gene containing at least one base sequence selected from the following base sequences (1) to (21).

Base sequence (1) IO+1 116
1ullCCACGACAATACGACGCCACG
TCGATTTGCTCGTTGGGGCGGCTGC
TCTCTGTTCCGCTATGTACGTTGGG
GATCTCTGCl; i”l'L:A to I'L:GA base sequence (2) TGAGTTCGCTCAGGGGTGGGGTCCC
ATCACTCATGATATGCCTGAGAGCT
CGGACCAGAGGCCATATTGCTGGCA
CTACGCGCCTCGACCGTGCGGGATC
GTGCCTGCGTCGCAGGTGTGTGGTC
CAGTGTATTGCTTCACTCCGAGCCC
TGTTGTAGTGGGGACGACCGATCGT
TTCGGCGCTCCTACGTATAGCTGGG
GGGAGAATGAGACAGACGTGCTGCT
ACTTAGCAAACACGCG base sequence (3) TGCTACTTAGCAACACGCδδCCGCC
TCAnGCAACTGGHTGGGTGCACGTG
GATGAACAGCACTGGGTTCACCAAG
ACGTGCGGGGCCCTCCGTGCAACA
TCGGGGGGGGTCGGCAACAACACCTT
GGTCTGCCCCACGGATTGCTTCCGG
AAGCACCCCGAGGCCACTTACACAA
AGTGTGGCTCGGGGCCCTGGTTGAC
ACCCAGGTGCATGGTTGACTACCCA
TACAGGCTCTGGCACTACCCCTGCA
CTGTTAACTTTACCGTCTTTAAGGT
CAGGATGTATGTGGGGGGCGTGGAG
CACAGGCTCAATGCTGCATGCAATT
GGACTCGAGGAGAGCGCTGTGACTT
GGAGGACAAGAGTGGCAGATACTGC
CCTGTTCCTTCACCACCCTACCGGC
CCTGTCCACTGGCTTGATCCATCTT
CACCGGAACATCGTGGACGTGCAAT
ACCTGTACGGTATAGGGTCGGCAG
TGTCT CCTTT G CAATCAA ATG
GGA GTA TA TCCTGT TG CTTT
TC base sequence (4) CTTTTCCTTCTTCTGGCGGACGCGC
GCGTCTGTGCCTGCTTGTGGATGAT
GCTGCTGATAGCCCAGGCTGAGGCC
ACCTTAGAGAACCTGGTGGTCCTCA
ATGCGGCGTCTGTGGCCGGAGCGCA
TGGCCTTCTCTCCTTCCTCGTGTTTC
TTCTGCGCCGCCTGGTACATCAAAG
GCAGGCTGGTCCCTGGGGCGGCATA
TGCTCTCTATGGCGTATGGCCGTTG
CTCCTGCTCTTGCTGGCCTTACCAC
CACGAGCTTATGCCATGGACCGAGA
GATGGCTGCATCGTGCGGAGGCGCG
GTTTTTGTAGGTCTGGTACTCTTGA
CCTTGTCACCATAACTATAAGGTGTT
CCTCGCTAGGCTCATATGGTGGTTA
CAATATTTTTATCACCAGAGCCGAGG
CGCACTTGCAAGTGTGGGTCCCCCC
TCTCAATGTTCGGGGAGGCCGCGAT
GCCATCATCCTCCTTACATGCGC'G
GTCCATCCAGAGCTAATCTTTGACA
TCACCAAAACTTCCTGCTCGCCATACT
CGGTCCGCTCATGGTGCTCCAGGCT
GGCATAACTAGAGTGCCGTACTTTG
TACGCGCTCAGGGGCTCCATCCGTGC
ATGCATGTTAGTGCGGAAGGTCGCT
GGAGGCACTATGTCCsv++ AAATGGCCTTCATGAAGCTGGCCGC
GCTGACAGGTACGTACGTATGAC
CATCTTACTC(,ACTGCGGGATTGG
GCCCACGCGGGCCTACGAGACCTTG
CGGTGGCAGTAGAGCCCGTCGTCTT
CTCTGACATGGA base sequence (5) GCGGTGGCAGTAGAGCCCGTCGTCT
TCTCTGACATGGAGACTAAAACTCAT
CACCTGGGGGGGCAGACACCGCGGCG
TGTGGGGACATCATCTCGGGTCTAC
CAGTCTCCGCCCGAAGGGGGAAGGA
GATACTTCTAGGACCGGCCGATAGT
TTTGGAGAGCAGGGGTGGCGGCTCC
TTGCGCCTATCACGGCCCTATTCCCA
ACAAACGCGGGGCCTGCTTGGCTGT
ATCATCACTAGCCTCACAGGTCGGGG
ACAAGAACCAGGTCGATGGGGAGGT
TCAGGTGCTCTCCACCGCAACGCAA
TCTTTCCTGGCGACCTGCGTCAATG
GCGTGTGTTGGACCGTCTACCATGG
TGCCGGCTCGAAGACCCTGGCCGGC
CCGAAGGGTCCAATCACCCAAATGT
ACACCAATGTAGACCAGGACCTCGT
CGGCTGGCCGGCGCCCCCCGGGGCG
CGCTCCATGACACCGTGCAC'CTGC
GGCAGCTCGGACCTTTTACTTGGTCA
CGAGGCATGCTGATGTCGTTCCGGT
GCGCCGGCGGGGCGACAGCAGGGGG
AGCCTGCTTTTCCCCCAGGCCCATCT
CCTACCTGAAGGG base sequence (6) TCCATGACACCGTGCACCTGCGGCA
GCTCGGACCTTTTACTTGGTCACGAG
GCATGCTGATGTCGTTCCGGTGCGC
CGGCGGGGCGACAGCAGGGGGAGCC
TGCTTTCC, CCCAGGCCCCATCTTCCT
ACCTGAAGGGCTCCTCGGGTGGACC
ACTGCTTTGCC, +70 CTTCGGGGCACGTTGTAGGCATCT
CCGGGCTGCTGTGTGCACCCGGGGG
GTTGCGAAGGCGGTGGACTTCATAC
CCGTTGAGTCTATGGAAAACTACCAT
GCGGTCTCCGGTCTTCACAGA CAA
CT CA TCCCCTCCGGCCGTA CC
GCAAA CATTCCA AGTGGCA CAT
TTACA CGC'rCCCACTGG CA G
CGGCAAGAG CA CCAAAGTGCCGG
CTGCATATGCAGCCCAAGGGTACAA
GG Thousand GCTCGTCCTAAAACCCGTCCGTT
GCCGCCACATTGGGCTTTGGa7゜AGCGTATATGTCCAAGGCACATGGC
ATCGAGCCTAACATCAGAACTGGGG
TAAGGACCATCACCACCGGGCGGCCC
CATCACGTACTCCACCTATTGCAAG
TTCCTTGCCGACGGTGGATGCTCCG
GGGGCGCCTATGACATCATAATATG
TGATGAATGC base sequence (7) base sequence (8) GACCTCGGTTAGGTTGCGGGCTTAC
CTAAATACACCAGGGTCTTCACAGG
CCTCACCACATAGATGCCCACTTC
TTGTCGCATACCAAGCCACAGTGTG
CGCCAGGGCTCAGGCTCCAC base sequence (
9) Base sequence (lO) GGGCAG(iA'l'l;A'll;'I"I'L
i'l' to U et al. 1.1ljAljtitl
11810; Shishi GACAGGGAAGTCCTCTA
CCAGGAGTTCGATGAGATGGAAG base sequence (11) TGATAGC[iT1'(i'I'l'L:Li
(jLi base sequence (12) AGGGGGCTGTGCAGTGGATGAAACCG
GCTGATAGCGTTCGCTTCGCGGGGT
AACCACGTCTCCCCCCACGCACTATG
TGCCCGAGAGCGACGCCGCGGCGCG
TGTTACTCAGATCCTCTCCAGCCTT
ACCATCACTCAGTTGCTGAAGAGGC
TTCATCAGTGGATTAATGAGGACTG
CTCCACGCCTTGTTCCGGCTCGTG
CTAAAGGATGTTTGGGACTGGATAT
GCACGGTGTTGAGTGACTTCAAGAC
TTGGCTCCAGTCCAAGCTCCTGCCG
CGGTTACCGGGACTCCCTTTCCCTGT
CATGCCAACGCGGGTACAAGGGAGT
CTGGCGGGGGGGATGGCATCATGCAA
ACCACCTGCCCATGTGGAGCACAGA
TCACCGGACATGTCAAAAAATGGCTC
CATGGAACATTCCCCATCAACGCAT
ACA CCACGGGCCCCT base sequence (13) AC(il'GAAAl'LiUniA'lWl;AL
iLi l I L; t; eight-shishishishishishishishishishi dish base sequence (l
4) GTGAAATGCCCATGCCAGGTTCCAG
CCCCTGAATTTTTCACGGAGGTGGA
TGGAGTACGGTTGCACAGGTATGCT
CCAGTGTGCAAACCTCTCCTACGA
GAGGAGGTCGTATTCCAGGTCGGGGC
TCAAACCAGTACCTGGTCGGGTCACA
GCTCCCATGTGAGCCCGAACCGGAT
GTGGCAGTGCTCACTTCCATGCTCA
CCGACCCCTCTCCATATTACAGCAGA
GACGGCCAAGCGTAGGCTGGCCAGG
GGGTCTCCCCCCTCCCTTGGCCAGCT
CTTCAGCTAGCCAGTTGTCTGCGCC
TTCTTTGAAGGCGACATGTACTACC
CATCATGACTCCCCGGACGCTGACC
TCATCGAGGCCAACCTCCTGTGGCG
GCAGGAGATGGGCGGGAACATCACC
CGTGTGGAGTCAGAAAATAAGGTGG
TAATCCTGGACTCTTTGTCCC base sequence (l5) GATCCGATTCGGGCGGTGGAGrJAT
GAGAGGGAAAATATCCGTCCCGGCG
AGATCCTGCGAAAACCCCAGGAAGTT
CCCCCCAGCGTTGCCCATATGGGCA
CGCCCGGATTACAACCCTCCACTGC
TAGAGTCCTGGAAGGACCCGGACTA
CGTCCCCCCGGTGGTACACGGGTGC
CCTTTGCCATCTACCAAGGCCCCCC
CAATACCACCTCCACGGAGGAAGAG
GACGGTTGTCCTGACAGAGTCCACC
GTGTCTTCTGCCTTGGCGGAGCTCG
CTACTAAGACCTTTTGGCAGCTCCG
GTCGTCGGCCGTTGACAGCGGCACG
GCGACTGGCCCTCCCGATCAGGCCT
CCGACGACGGCGACAAAGGATCCGA
CGTTGAGTCGTACTCCTCCATGCCC
CCCCTCGAGGGAGAGCCAGGGGACC
CCGACCTCAGCGACGGGTCTTGGTC
TACCGTGAGCGGGAAGCTGGTGAG
GACGTCGTCTGCTGCTCCAATGTCCT
ATACATGGACAGGTGCCTTGA base sequence (l6) GTCTGCTGCTCAATGTCCTATACAT
GGACAGGTGCCTTGATCACGCCATG
CGCTGCGGAGGAGAGCAAGTTGCCC
ATCAATCCGTTGAGCAACTCTTTGC
TGCGTCACCACAGTATGGTCTACTC
CACAACATCTCGCAGCGCAAGTCTG
CGGCAGAAGAAGGGTCACCTTTGACA
GACTGCAAGTCCTGGACGACCACTA
CCGGGACGTGCTCAAGGAGATGAAG
GCGAAGGCGTCCACAGTTAAGGCTA
GGCTTCTATCTATAGAGGAGGCCTG
CAAACTGACGCCCCCACATTCGGCC
AAATCCAAATTTGGCTACGGGGCGA
AGGACGTCCGGAGCCTATCCAGCAG
GGCCGTCAAACCACATCCGCTCCGTG
TGGGAGGACTTGCTGGAAGACACTG
AAACACCAATTGATACCACCATCAT
GGCAAAAAATGAGGTTTTCTGCGTC
CAACCAGAGAGAAAGGAGGCCGCAAGC
CAGCTCGCCTTATCGTATTCCCAGA
CCTGGGGGTACGTGTATGCGAGAAG
ATGGCCCTTTACGACGTGGTCTCCA
CCCTTCCTCAste GGC C GTGATGGG C CC CTCA
TA CGGA TT C C AGTA CT C
T C C TGGGCAGCGGGTCGAGTTC
CTGGTGAATAACCTGGAAATCAAAGA
AATGCCCTATGGGCTTCTCATATGA
CACCCGCTGCTT base sequence (17) CTTTGACTCAACGGTCACTGAGAAT
GACATCCGTACTGAGGAATCAATTT
ACCAATGTTGTGACTTGGCCCCCGA
AGCCAGGCAGGCCATAAGGTCGCTC
ACAGAGCGGCTTTATGTCGGGGGTC
CCCTGACTAATTCGAAGGGGCAGAA
CTGCGGTTATCGCCGGTGCCGCGCA
AGTGGCGTGCTGACGACTAGCTGCG
Base sequence (18) AAGTGGCGTGCTGACGACTAGCTGC
GGCAACACCCTCACATGTTACTTGA
AGGCCACTGCGGCCTGTCGAGCTGC
AAAGCTCCAGGACTGCACGATGCTC
GTGAACGGAGACGACCTTGTCGTTA
TCTGTGAGAGTGCGGGAACCCAGGA
GGATGCGG CGGCCCTACGAGCCTT
CACGGAGGCTATGACTAGGTATTCC
GCCCCCCCCGGGGACCCGCCCCCAAC
CAGAATACGACTTGGAGCTGATAAC
GTCATGCTCCTCCCAATGTGTCGGTC
GCGCACGATGCATCCCGGCAAAAGGG
TGTACTACCTCACCCGTG base sequence (I9
) GATAACGTCATGCTCCTCCAAATGTG
TCGGTCGCGCACGATGCATCCGGCA
AAAGGGTGTACTACCTCACCCGTGA
CCCCACCACCCCCCCCTCGCACGGGCT
GCGTGGGAGACAGTTAGACACACTC
CAGTCAACTCCTGGCTAGGCAATAT
CATCATGTATGCGCCCACCCTATGG
GCGAGGATGATTCTGATGACTCATT
TCTTCTCTATCCTTCTAG CTGAGG
AGCAAACTTGAAAAAAGCCCTGGATTG
TCAG base sequence (20) CACGATGCTCGTGAACGGAGACGAC
CTTGTCGTTATCTGTGAGAGTGCGG
GAACCCAGGAGGGATGCGGCGGCCCT
AcGAδCCTTCACGGAGGCTATGACT
AGGTATTCCGCCCCCccGδGGACC
CGCCCCAAACCAGAATACGACTTGGA
GCTGATAAC5TCATGCTCCTCCAAT
GTGTCGGTCGCGCACGATGCATCC5
GCAAAAGGGGTGTACTACCTCACCCG
TGACCCCACCACCACCCCCCTCGCACGG
GCTGCGTGGGAGACAGTTAGACACA
CTCCAGTCAACTCCTGGCTAGGCAA
TATCATCATGTATGCGCCCA base sequence (
21) 1'l'A Ui'Ll;A'l"I'1.1ALi L:A L:'l"l'LiA L:'l'A U
L:'I'l;ALiA'l'UA'l”l et al.AACG
ACTCCATGGTCTTTAGCGCATTTTCA
CTCCACAGTTACT Furthermore, the present invention provides the above C
It is a recombinant vector obtained by integrating a gene derived from the hepatitis virus into a vector capable of expressing the gene in E. coli.

Furthermore, the present invention resides in E. coli transformed with the above recombinant vector. Furthermore, the present invention provides a method for producing a polypeptide having HCV antigenic activity, which comprises culturing the E. coli in a medium to produce a polypeptide having HCV antigenic activity, and collecting the polypeptide from the culture. It is in.

Furthermore, the present invention provides the following amino acid sequences +11 to (2
1) HCV antigenic active polypeptides containing at least one type of amino acid sequence.

Amino acid sequence (1) Trp Leu Ser Pro Arg G
ly Ser Arg Pr.

Ser Trp Gly Pro Thr Asp P
ro Arg Arg ArgSer Arg Asn
Leu Gly Lys Val Ile Asp
ThrLeu Thr Cys Gly Phe Al
a Asp Leu Met GlyTyr Ile
Pro Leu Vat Gly Ala Pro L
eu GlyGly Ala Ala Arg Ala
Leu Ala His Gly ValArg V
al Leu Glu Asp Gly Val As
n Tyr AlaThr Gly Asn Leu
Pro Gly Cys Ser Phe 5er11
e Phe Leu Leu Ala Leu Leu
Ser Cys Leu1'hr l'hr l
le Arg Arg Hls Val A
Sp Leu LeUVal Gly Ala Al
a Ala Leu Cys Ser Ala Met
Met Ala ber L;)'S Arg
t'ro lle ASp Lu1l P
neVal Tyr Cys Pt+e Thr Pr
.

Amino acid sequence (2) Glu Phe Ala Gin Gly Trp G
ly Pro lie ThrHis Asp Met
Pro Glu Ser Ser Asp Gln
ArgPro Tyr Cys Trp His Ty
r Ala Pro Arg Pr.

Cys Gly [le Vat Pro Ala S
er Gin Val CysGly Pro Vat
Tyr Cys Phe Thr Pro Ser
Pr.

Val Val Val Gly Thr Thr A
sp Arg Phe GlyAla Pro Thr
Tyr Ser Trp Gly Glu Asn
GluThr Asp Val Leu Leu Le
u Ser Asn Thr ArgPro Pro
Gln Gly Asn Trp Phe Gly C
ys ThrTrp Met Asn Amino acid sequence (3) Leu Leu Ser Asn Thr Arg P
ro Pro Gin GlyAsn Trp Phe
Gly Cys Thr Trp Met Asn
5erThr Gly Phe Thr Lys Th
r Cys Gly Gly Pr.

Pro Cys Asn Ile Gly Gly V
al Gly Asn Asn Thr Leu Val
Cys Pro Thr As1) Cys Phe
ArgLys His Pro Glu Ala T
hr Tyr Thr Lys CysGly Ser
Gly Pro Trp Leu Thr Pro
Arg CysMet Vat Asp Tyr Pr
o Tyr Arg Leu Trp HisTyr
Pro Cys Thr Val Asn Phe T
hr Val Pheet Amino acid sequence (4) Leu Phe Leu Leu Leu Ala A
sp Ala Arg ValCys Ala Cys
Leu Trp Met Met Leu Leu
l1eAla Gin Ala Glu Ala Th
r Leu Glu Asn LeuVat Val
Leu Asn Ala Ala Ser Val A
la GlyAla His Gly Leu Leu
Ser Phe Leu Val PhePhe C
ys Ala Ala Trp Tyr Ile Ly
s Gly ArgLeu Val Pro Gly
Ala 'Ala Tyr Ala Leu TyrG
ly Val Trp Pro Leu Leu Le
u Leu Leu LeuAla Leu Pro
Pro Arg Ala Tyr Ala Met A
spCYS Met Leu Val Arg Lys
Val Ala city btyHis Tyr
Val Gln Met Ala Phe Met L
ys LeuGlu Pro Val Vat Phe
Ser Asp Met Glu amino acid sequence) Ala val Ala Val Glu Pro V
al Val Phe 5erAsp Met Glu
Thr Lys Leu Ile Thr Trp
G'ryAla AsP Thr Ala Ala C
ys Gly Asp lie l1eSer Gay
Leu Pro Val Ser Ala Arg
Arg GLLys Glu Ile Leu Leu
Gly Pro Ala AspSerPhe Gl
y Glu Gin Gly Trp Arg Leu
Leu A! aPro Ile Thr Ala T
yr Ser Gin Gln Thr ArgGly
Leu Leu Gly Cys rle
Ile Thr 5e-r LeuThr
Gly Arg Asp Lys Asn Gin V
al Asp G! yThr Gln Met Tyr
'rhr Asn Val Asp (iln As
Ser Tyr Leu Lys Gly Amino Acid Sequence) Ser Met Thr Pro Cys Thr C
ys Gly Ser 5erAsp Leu Tyr
Leu Val Thr Arg His Ala
AspVat Val Pro Val Arg Ar
g Arg Gly Asp SerArg Gly
Ser Leu Leu Ser Pro Arg P
ro l1eSer Tyr Leu Lys Gly
Ser Ser Gly Gly Pr.

Leu Leu Cys Pro Ser Gly H
is Val Val Glylie Phe Arg
Ala Ala Val Cys' Thr Arg
GlyVal Ala Lys Ala Val A
sp Phe Ile Pro ValGlu Ser
Met Glu Thr Thr Met Arg
Ser Pr.

His Ser Thr Asp Ser Thr T
hr amino acid sequence) Gly Ala Tyr Asp Ile lie I
le Cys Asp GluCys His Ser
Thr Asp Ser Thr Thr Ile
LeuGly rle Gly Thr Val Le
u Asp Gin Ala GluThr Ala
Gly Ala Arg Leu Val Vat L
eu AlaThr AlaThr Pro Pro
Gly Ser lie Thr ValPro H
is Pro Asn Ile Glu Glu Va
l Ala LeuSer Asn Thr Gly
Glu Ile Pro Phe Tyr GlyLy
s Ala Ile Pro Ile Glu Ala
Ile Lys GlyGly Arg His L
eu lie Phe Cys His Ser Ly
sTyr Glu Leu Thr Pro Ala amino acid sequence) Asp Ala Gly Cys Ala Trp T
yr Glu Leu ThrPro Ala Glu
Thr Ser Vat Arg Leu Arg
AlaTyr Leu Asn Thr Pro Gl
y Leu Pro Vat CysGln Asp
His Leu Glu Phe Trp Glu S
er VatPhe Thr Gly Leu Thr
His lie Asp Ala HisAsn L
eu Pro Tyr Leu Vat Ala Ty
r Gln AlaThr Val Cys Ala
Arg Ala Gin Ala Pro Pr.

Pro Ser Trp Asp Gin Met T
rp Lys amino acid sequence) Tyr Gln Ala Thr Val Cys A
la Arg Ala G! nAla Pro Pro
Pro Ser Trp Asp Gln Met
Tr'pLys Cys Leu lie Arg L
eu Lys Pro Thr Le'uHis Gl
y Pro Thr Pro Leu Leu Tyr
ArgLeuGly Ala Val Gln As
n Glu Val Thr Leu Thr His
Pro Ile Thr Lys Tyr lie M
et Ala C''!; Met Ser Ala amino acid sequence (10) Trp Asp Gln Met Trp Lys C
ys Leu Ile ArgLeu Lys Pro
Thr Leu His Gly Pro Thr
Pr.

Leu Leu Tyr ArgLeu Gly Al
a Val Gin AsnGlu Val Thr
Leu Thr His Pro Ile Thr L
ysTyr lie Met Ala Cys Met
Ser Ala Asp LeuGlu Val V
al Thr Ser Thr Trp Val Le
u ValGly Gly Val Leu Ala
Ala Leu Ala Ala TyrCys L
eu Thr Dinghr Gly Ser V
Al Val Ile Va! GlyArg
lie Ile Leu Ser Gly Arg P
ro AlaThr Ala Ser Ile Th
r Amino acid sequence Sequence 1) Ala lie Ala Ser Leu Met A
la Phe Thr
Ser Pro Leu Thr Thr Gin
AsnThr Leu Leu Phe Asn Il
e Leu Gly Gly TrpVal Ala
Ala Gin Leu Ala Pro Pro S
er AlaAla Ser Ala Phe Val
Gly Ala Gly Ile AlaGly A
la Ala Val Gly Ser lie Gl
y Leu GlyLys Val Leu Val
Asp lie Leu Ala Gly TyrGl
y Ala Gly Val Ala Gly Ala
Leu Val AlaPhe Lys Vat M
et Ser Gly Glu Met Pro Se
rAmino acid sequence sequence 2) Gly Ala Val Gln Trp Met A
sn Arg Leu l1eAla Phe Ala
Ser Arg Gly Asn His Val
5erPro Thr His Tyr Val Pr
o Glu Ser Asp AlaAla Ala
Arg Vat Thr Gln Ile Leu S
er Ser 'Leu Thr lie Thr
Gln Leu Leu Lys Arg LeuH
is Gln Trp lie Asn Glu As
p Cys Ser ThrPro Cys Ser
Gly Ser Trp Leu Lys Asp V
alTrp Asp Trp Ile Cys Thr
Val Leu Ser AspPhe Lys T
hr Trp Leu Gin Ser Lys Le
u LeuCys Gly Ala Gin Ile
Thr Gly His Val LysTyr Va
l Thr Gly Met Thr Amino Acid Sequence 3) Trp Arg Val Ala Ala Glu G
lu Tyr Val GluVal Thr Arg
Val Gly Asp Phe His Tyr
ValThr Gly Met Thr Thr As
p Asn Vat Lys CysPro Cys
Gin Val Pro Ala Pr.

Amino acid sequence (14) Val Lys Cys Pro Cys Gin V
al Pro Ala Pr.

Glu Phe Phe Thr Glu Val A
sp Gly Val ArgLeu His Arg
Tyr Ala Pro Vat Cys Lys
Pr.

Leu Leu Arg Glu Glu Val V
al Phe Gln ValGly Leu Asn
Gin Tyr Leu Val Gly Ser
GinLeu Pro Cys Glu Pro Gl
u Pro Asp Vat AlaVal Leu
Thr Ser Met Leu Thr Asp P
ro 5erHis lie Thr Ala Glu
Thr Ala Lys Arg ArgLeu A
la Arg Gly Ser Pro Pro Se
r Leu AlaVal Pr.

Amino acid sequence (15) Asp Pro lie Arg Ala Val G
lu Asp Glu ArgGlu Ile Ser
Val Pro Ala Glu Ile Leu
ArgLys Pro ArgLys Phe Pr
o Pro Ala Leu Pr.

11e Trp Ala Arg Pro Asp T
yr Asn Pro Pr.

Leu Leu Glu Ser Trp Lys A
sp Pro Asp TyrVal Pro Pro
Val Val His Gly Cys Pro
LeuPro Ser Thr Lys Ala Pr
o Pro Ile Pro Pr.

Pro Arg Arg Lys Arg Thr V
al Vat Leu Thr Glu Ser Thr
Val Ser Ser Ser Ala Leu Ala
GluGly Ala Leu Ile Thr Pr
.

Amino acid sequence (16) Val Cys Cys Ser Met Ser T
yr Thr Trp Thr Gly Ala Leu
Ile Thr Pro Cys Ala Ala
GluGlu Ser Lys Leu Pro li
e Asn Pro Leu 5erAsn Ser
Leu Leu Arg His His Ser M
et ValTyr Ser Thr Thr Ser
Arg Ser'Ala Ser LeuArg G
in Lys Lys Vat Thr Phe As
p Arg LeuGin Vat Leu Asp
Asp His Tyr ArgAsp ValLeu
Lys Glu Met Lys Ala Lys
Ala Ser Thr Val Lys Ala Ar
g Leu Leu Ser Ile Glu Glu
Ala Cys Lys Leu Thr Pro P
ro His Ser AlaVat Thr Glu
Asn Asp Ile Arg Thr Glu Amino acid sequence 7) Phe Asp Ser Thr Val Thr G
lu Asn Asp IleArg Thr Glu
Glu Ser lie Tyr Gln Cys
CysAsp Leu Ala Pro Glu Al
a Arg Gin Ala IleArg Ser
Leu Thr Glu Arg Leu Tyr V
al GlyGly Pro Leu Thr Asn
Ser Lys Gly Gin AsnCys G
ly Tyr Arg Arg Cys Arg Al
a Ser G-1yVal Leu Thr Thr
Ser Cys Gly Asn Thr Leuh
r Amino acid sequence (18) Ser Gly Vat Leu Thr Thr S
er Cys Gly AsnThr Leu Thr
Cys Tyr Leu Lys Ala Thr
Ala Ala Cys Arg Ala Ala Ly
s Leu Gin AspCysThr Met L
eu Val Asn Gly AspAsp Leu
ValVal lie Cys Glu Ser A
la Gly Thr Gln GluAsp Ala
Ala Ala Leu Arg Ala Phe
Thr GluAla Met Thr Arg Ty
r Ser Ala Pro Pro GlyAsp
Pro Pro Gin Pro Glu Tyr A
sp Leu GluLeu Ile Thr Ser
Cys Ser Ser Asn Val 5erT
yr Tyr Leu Thr ArgAmino acid sequence 9) lie Thr Ser Cys Ser Ser A
sn Val Ser VatAla His Asp
Ala Ser Gly Lys Arg Val
TyrTyr Leu Thr Arg Asp Pr
o Thr Thr Pro LeuAla Arg
Ala Ala Trp Glu Thr Val A
rg HisThr Pro Val Asn Ser
Trp Leu Gly Asn l1erle M
et Tyr Ala Pro Thr Leu Tr
p Ala ArgMet Ile Leu Met
Thr His Phe Phe Ser 1ieLe
u Leu Ala Gln Glu Gin Leu
Glu Lys A! aLeu Asp Cys G
in Amino acid sequence (20) Thr Met Leu Val Asn Gly A
sp Asp Leu ValVal Ile Cys
Glu Ser Ala Gly Thr Gln
GluAsp Ala Ala Ala Leu Ar
g Ala Phe Thr GELA La Met
Thr Arg Tyr Ser Ala Pro P
ro GayAsp Pro Pro Gin Pro
Glu Tyr Asp Leu GiuLeu
lie Thr Ser Cys Ser
Ser Asn Val 5erVal Ala
His Asp Ala Ser Gly Lys
Arg ValTyr Tyr Leu Thr Ar
g Asp Pro Thr Thr Pr.

Leu Ala Arg Ala Ala Trp G
lu Thr Val ArgHis Thr Pro
Val Asn Ser Trp Leu Gly
Asn11e lie Met Tyr Ala
Pro Thr Leu Trp A! aAr
g Met Ile Leu Met Thr His
Phe Phe Ser11e Leu Leu
Ala Gln Glu Gln Leu
Glu LysThr Lys Leu Lys Amino acid sequence (21) Arg Tyr Ser Ala Pro Pro G
ly Asp Pro Pr.

Gin Pro Glu Tyr Asp Leu G
lu Leu Ile ThrSer Cys Ser
Ser Asn Val Ser Val Ala
HisAsp Ala Ser Gly Lys Ar
g Val Tyr Tyr LeuThr Arg
Asp Pro Thr Thr Pro Leu A
la ArgAla Ala Trp Glu Thr
Val Arg His Thr Pr.

Val Asn Ser Trp Leu Gly A
sn rle lie MetTyr Ala Pro
Thr Leu Trp Ala Arg Met
rleLeu Met Thr )lis Phe P
He Ser Ile Leu LeuHis Se
r Tyr Ser Pro Gly Glu lie
Asn ArgLeu Phe Asn Trp A
La Val Lys Thr Lys Leulle
Tyr Leu Leu Pro Asn Arg(
(Margins below this page) The gene derived from the hepatitis C virus referred to in the present invention is C
Hepatitis C virus RNA prepared from hepatitis patient serum
It can be obtained by converting a gene fragment into DNA and cloning it.

That is, hepatitis C virus is isolated from the serum of a patient with non-A, non-B hepatitis after blood transfusion (patient whose blood alanine aminotransferase (ALT) value is 150 or more) by ultracentrifugation, and then genetic RNA is extracted from the virus. Prepare
A cDNA library can be prepared by synthesizing cDNA from the RNA using reverse transcriptase and then inserting the cDNA fragment into a plasmid vector. Another method is Proceedings
of the Japan Academy, Vol.
65. Ser, B, No, 9. pp, 219-2
23 (1989), that is, a method in which a target region is amplified by RT-PCR, which combines reverse transcriptase and PCR, and the amplified gene fragment is cloned is also effective. In addition to cloning methods, the structural protein gene region can also be
Those synthesized by organic chemical synthesis can also be suitably used.

By collecting a large amount of information on the base sequences of these gene fragments, it is possible to clarify the entire region of the open reading frame of the hepatitis C virus gene. The entire open reading frame region of the Japanese hepatitis C virus gene thus clarified is shown in FIG. In addition, whether the gene base sequence or DNA is shown in Figure 1, the gene of hepatitis C virus is originally RNA;
When interpreting Figure 1 as an RNA gene, read it by replacing T (thymine) with U (uracil).

Figure 1 shows the entire open reading frame region of hepatitis C virus.
284-1534, ■1389-1669, ■1610
~2214, ■2164~2939, ■2902~34
88, ■3355-3976, ■3922-4601,
■4562-4829, ■4763-4955, @14
809-5394, @5356-5775, a2157
29-6317, @6246-6357, [Yes] 632
8-6812, ■6769-7298, @7249-7
966, @7926-8141. @8100-8416
, ali118343-8595, [phase]8190-8
By expressing each of the 21 types of gene fragments 862 and 8290 to 9030, polypeptides each having antigenic activity can be obtained. A recombinant plasmid obtained by inserting each of these 21 fragments into the plasmid vector pTZ19R (however, only 0 fragments were inserted into pUc 118)
are respectively pHCV1 to pHCv21, and from these,
Recombinant vectors are obtained by collecting each HCV gene fragment, inserting it in-frame downstream of the start codon of an expression vector, and connecting a stop codon downstream thereof.

All of the polypeptides expressed from these 21 types of gene fragments exhibit antigenic activity.

The amino acid sequences and base sequences shown here for each of the 21 types are merely examples, and the present invention is not limited to these amino acid sequences and base sequences in any way. That is, the 21 types of gene fragments are not limited by base sequences or amino acid sequences, but are specified by their positions on the hepatitis C virus genetic map. Furthermore, even if a part of the base sequence of each of the 21 types of gene fragments is replaced, inserted, or deleted, the properties of the polypeptide having HCV antigenic activity produced by the gene expression will remain the same. Substantially equivalent polypeptides to the respective polypeptides provided by the invention are included in the present invention. 21 more
Regarding each type of gene fragment, gene fragments that vary within the range of codon fluctuation, that is, gene fragments that differ only in bases within the range that does not change the amino acid sequence, are considered to be substantially the same as in the present invention. . Furthermore, the properties of polypeptides that hybridize with each of the 21 types of gene fragments and have HCV antigenic activity produced by their expression are substantially equivalent to the polypeptides shown by the present invention. If so, it is included in the invention.

The structural protein genes of the hepatitis C virus are expressed using commonly known gene expression systems, namely the E. coli host-vector system;
Gene expression is possible using a Bacillus subtilis host-vector system, a yeast host-vector system, an insect cell or insect host-vector system, an animal cell host-vector system, and the like.

Among these, Escherichia coli is an example that can be suitably used.

The expression vector for Escherichia coli is not particularly limited, and any commonly used expression vector can be used, and expression vectors in which gene expression occurs frequently are particularly preferably used. For example, a series of pUC vectors (Takara Shuzo Products), a series of pTv vectors (Takara Shuzo Products), a series of p'rz vectors (TOY
A series of pTTQ vectors (Amajam product), a series of pET vectors (Methods i product)
n enzymology.

Vol. 185) and the like are suitable.

Expression vectors that can express genes in E. coli usually contain a promoter for gene expression that works inside E. coli,
An operator is attached to control it.

When gene expression is performed using a recombinant vector, a plurality of randomly arranged amino acids may be added to the N-terminus or C-terminus of the polypeptide. That is, 21 in the present invention
Each type of gene fragment lacks a start codon and a stop codon, so it is necessary to insert a start codon upstream and a stop codon downstream of the gene fragment. The region from the start codon to each gene body becomes an extra amino acid at the N-terminus, and the region after the gene body until the 3' stop codon appears becomes an extra amino acid at the C-terminus.

However, such multiple amino acids added to the N-terminus or C-terminus are random amino acids,
As long as it is unrelated to HCV antigen activity, it will not affect the antigen activity measurement.

Any Escherichia coli bacteria can be used for transformation without any particular restrictions. For example, JM83, JM109, HBOI
, DHL, W3110, C600, BL21.
BL21 (DH3) and the like can be suitably used.

Twenty-one types of Escherichia coli were transformed with recombinant plasmids each containing 21 types of gene fragments, that is, plasmids of pHCV 1 to pHcV21.
hiacoli) are respectively E, coli HCVI
-'E, coli HCV21, and was deposited on November 5, 1990 at the Institute of Microbial Technology, Agency of Industrial Science and Technology, Ministry of International Trade and Industry, 1-1-3 Tsukuba Denzoku, Ibaraki, and each has the following accession number. has been granted. That is, E. coli HCVI [bases 284-1 in Figure 1]
Recombinant plasmid pHCV with 534 fragments
1 in the bacterial body] is E, coli 1 (CV2
The recombinant plasmid pHCV 2 having a fragment from 389 to 1669 is contained in the microbial cell.
No. 826 is E. coli HCV3 [A strain containing a recombinant plasmid pHCV 3 having the fragment from bases 1610 to 2214 in Fig. 1 is designated as E. coli HCV3 as Fiber Science and Technology No. 11827) ( CV4
[The recombinant plasmid pHCV 4 having the fragment from bases 2164 to 2939 in Fig. 1 is contained in the bacterial body] is E. coli
HCV5 [having a recombinant plasmid pHCV 5 having a fragment from bases 2902 to 3488 in Figure 1 in the bacterial body] is published as E. co.
li HCV6 [containing a recombinant plasmid pHCV 6 having a fragment between bases 3355 and 3976 in Figure 1] is published as E.
, coli HCV7 [Bases 3922-46 in Figure 1
Recombinant plasmid pHc with 01 Machi (7) fragment
V 7 in the microbial body] is a microorganism of microorganisms with microorganisms
The number is E. coli HCV8 [A strain containing a recombinant plasmid pHcV8 having a fragment from bases 4562 to 4829 in Figure 1 in the microbial body is
No. 1832, E. coli HCV9 [No.
The bacteria containing the recombinant plasmid pHCV 9 containing the fragment from bases 4763 to 4955 in the figure is E. coli HCVI
O [Contains a recombinant plasmid pHcVI O having a fragment from bases 4809 to 5394 in Fig. 1 in the bacterial body]
is E. coli as Microtechnical Research Institute No. 11834.
HCVI1 [having a recombinant plasmid pHcV11 having a fragment from bases 5356 to 5775 in Figure 1 in the bacterial body] was published as E.
, coHHCVI2 [bases 5729-6 in Figure 1
Recombinant plasmid pHcV1 with fragments up to 317
2 in the bacterial body] is E. coli HCVI3 [base 6 in Fig.
The recombinant plasmid pHcV13 having a fragment from 246 to 6357 is present in the microbial cell.
As No. 837, E. coli HCVI4 [having a recombinant plasmid pHcV14 having a fragment from bases 6328 to 6812 in Fig. 1 is contained in the bacterial body] is designated as E. coli HCVI4 as No. 11838.
5 [Recombinant plasmid containing the fragment from bases 6769 to 7298 in Figure 1 p) The co which has lcV15 in the bacterial body is E, co
li HCVI6 [Bases 7249 to 796 in Figure 1
E. coli HCVI7 [base 79 in Fig.
Recombinant plasmid I with fragments from 26 to 8141
) Contains HCVI7 in the bacterial body]
No. 841, E. coli HCVI8 [No.
The recombinant plasmid pHcV18 having a fragment from bases 8100 to 8416 in the figure is contained in the microbial body as E. coli HCVI.
9 [The bacteria containing the recombinant plasmid HCV19 having the fragment from bases 8343 to 8595 in Figure 1 are E.
HCV20 [The recombinant plasmid pHcV20 containing the fragment from bases 8190 to 8862 in Figure 1 is designated as E.
, coli HCV21 [Base 8290 in Figure 1
Recombinant plasmid pHc with fragments up to 9030
1, which has V21 in the bacterial body, is manufactured by Kaikoken Bacteria No. 11845.
Each item is assigned a number.

When expressing a structural protein gene using E. coli, it is sufficient to activate the upstream promoter, and when the operator is absent or open, a commonly used nutrient-rich E. coli medium ( Structural protein genes can be expressed while culturing in L medium, TY medium, etc.). When gene expression is controlled using an operator or when a gene expression control system using T7 RNA polymerase is used, an appropriate control method is applied to the control mechanism. For example, in vector systems such as pUC, pTV, pTZ, and pTTQ, in which the lac promoter and lac operator regulate gene expression, the promoter is closed in the presence of glucose.
The presence of lactose or its derivative IPTG (isopropylthiogalactoside) opens the promoter.

Therefore, nutrient media that do not contain glucose or lactose [various inorganic media, semi-synthetic media (M9 medium, etc.), media using casein decomposition products as a nutrient source (Bactodributon medium, etc.)]
] After pre-culture, IPTG is added to initiate gene expression.

Of course, it is also effective to perform gene expression by preculturing in a nutrient-rich medium containing glucose, collecting and washing the cells, then transferring to a nutrient medium not containing glucose, and adding IPTG. In the pET vector system, gene expression is similarly induced by IPTG, but the mechanism is different from that of pUC and the like. That is, the host BL21 (
There is a gene encoding T7 RNA polymerase following the 1acUV5 promoter on the chromosome of DE3). First, the T7 RNA polymerase gene on the chromosome is activated by IPTG, and then the produced T7
RNA polymerase selectively recognizes the φlO promoter on the vector pET, and as a result, a large amount of the gene downstream of the φlO promoter is transcribed, resulting in the production of a large amount of gene product. The 1acUV5 promoter is not subject to catabolite repression by glucose, and in this host-vector system, lactose-free nutrient media [various inorganic media, semi-synthetic media (M9 medium, etc.), media with casein decomposition products as a nutrient source] After culturing in TPTG
A method is adopted in which gene expression is initiated by adding .

The molecular weight of a polypeptide is determined by SDS polyacrylamide gel electrophoresis, and the substance is identified by determining the N-terminal amino acid sequence and amino acid composition by amino acid analysis. The polypeptides referred to in the present invention are usually derived from 21 types of HCV gene fragments, and have a plurality of extra amino acids added before and after the essential part for antigenic activity, that is, at the N-terminus and C-terminus. There is. That is, the addition of multiple random amino acids derived from the gene between the N-terminal start codon and the gene body, and the addition of multiple random amino acids derived from the gene between the gene body and the stop codon. This is what I did.

The polypeptide can be used as a diagnostically useful antigen for EIA, RIA, or agglutination reagent. For example, in EIA and RIA, polypeptides are immobilized on various solid phases, and when a sample (serum) is added to this, anti-H
If there is a CV antibody (primary antibody), it will bind to the polypeptide. Then react with anti-HCV antibody (primary antibody),
By reacting with a secondary antibody (anti-human IgG), the presence of an anti-HCV antibody (primary antibody) can be immunodetected. Detection methods include a method in which the secondary antibody is labeled with an enzyme and the reaction of the enzyme is measured (EIA), and a method in which the secondary antibody is labeled with a radioactive compound and the radiation emitted from the radioactive compound is detected (RIA). There is. In the case of an agglutination reagent, a polypeptide is sensitized to a carrier, and the carrier is reacted with patient serum. At this time, if anti-HCV antibodies are present in the serum, the carrier will aggregate, and the presence of anti-HCV antibodies in the serum can be immunologically detected.

〔Effect of the invention〕

According to the present invention, polypeptides having useful antigenicity that specifically react with antibodies of hepatitis C virus can be efficiently produced. The polypeptide thus obtained is C
It can be used as a diagnostic agent for type hepatitis. The polypeptide having useful antigenicity obtained by the present invention recognizes anti-hepatitis C virus antibodies present in the serum of patients with hepatitis C.
SA) can be used as a diagnostic antigen.

(Margins below this page) [Examples] Examples are shown below to specifically illustrate the present invention, but the scope of the present invention is not limited to these Examples.

Note that the plasmids and restriction enzymes used in the following examples are all manufactured by Takara Shuzo ■.

Example 1 (Preparation of RNA) After blood transfusion, 3000 ml of non-A, non-B patient serum was prepared at 19.00 Or
Ultracentrifugation was performed at pm for 16 hours to obtain a precipitate. The precipitate is GI
Dissolve in 100 ml of TC solution, and add 100 ml of phenol-chloroform (1:
1), and after shaking at room temperature for 15 minutes, soooorpm,
Centrifuged for 15 minutes. The aqueous layer of the reaction solution was taken out, 100 ml of isopropyl alcohol was added, and the mixture was heated to -20°C for 3
After standing for a period of time, the mixture was centrifuged at 300 rpm for 15 minutes to obtain a precipitate. A GITC solution (4M
Guanidium isothiocyanate (manufactured by Burka Co., Ltd.), 25
mM Sodium Citrate, 0.5% Sarcosyl, 0
．． 10 ml of 1M mercaptoethanol was added to prepare a solution. For the lysate, add 10 m2 of phenol.
Chloroform (1:1) was added, and after shaking at room temperature for 10 minutes, centrifugation was performed at 3000 rpm for 15 minutes. The aqueous layer of the reaction solution was taken out, 20 ml of chloroform was added, and the mixture was shaken for 5 minutes. After shaking, centrifugation was performed at 3000 rpm for 5 minutes, and 10 ml of an aqueous layer was collected. For 10m1 of this water layer, 5
0.4 ml of MNaCl solution was added.

Then add 30 ml of water-cooled ethanol and -20°
It was left at C for 12 hours. After leaving it for 15 minutes at 3000 rpm
Centrifugation was performed for a minute to obtain a precipitate. The precipitate was washed with 75% ethanol, dried, dissolved in 200 μl of distilled water, and RN
A solution solution was obtained.

(Construction of cDNA library) A cDNA synthesis kit or a synthesis kit from BRL was used. The method is described in the cDNA synthesis manual [BRL/Cosmo Bio Inc. Instruction Manual, Cat.
N.

8267SA]. In the (preparation of RNA) section of this example, single-stranded R prepared from non-A, non-B patient serum
Add 5 μl of 20 base oligonucleotide to 5 μl of NA solution.
μl (100 μM) was added to perform a reverse transcriptase reaction, resulting in RNA/DNA double strands. Then E. coli DNA
Add polymerase ■ and Escherichia coli RNA degrading enzyme H,
It was made into a DNA/DNA double strand.

Next, Eco was added to both ends of the double-stranded DNA thus obtained.
A RI linker was attached. For this treatment, an enzyme from Takara Shuzo was used, and the reaction was carried out under the reaction conditions attached to the enzyme from Takara Shuzo. First, using approximately 1 μg of double-stranded DNA,
RI methylase treatment, followed by T4 DNA ligase reaction to ECoRI linker-d (GGAAT
TCC) was combined. The reaction solution obtained at the end was
It was cut with RI and the EcoRI fragment was recovered.

Finally, this EcoRI fragment was added to EcoR1 of λgt1.1.
site and create recombinant λgtll phage, using Stratagene's kit GIGAP.
ACKII GOLD is used, and the method is described in the manual [Protocol/In5truc] attached to the kit.
tion Manual Cat, #200214゜200215, 200216. December 6
．． 1989].

First, an EcoRI fragment was inserted into the EcoR1 site of λgtll, and this was ligated with T4 ligase. The obtained recombinant phage DNA solution was subjected to GIGAPACK I[G
OLD In Vitro'Packaging Ki
t was used to revert to phage. The titer at this time was 1.2 x 106. This titer value is
The number of independent clones is shown.

(Plaque hybridization) The method of plaque hybridization is the method of Maniatis et al. [Molecular Cloning, C
oldSpring Harbor Laborato
ry, New York (1982),]. First, E. coli Y1090 was used as a host, and the diameter was 15 mm.
The obtained recombinant λgt11 phage 5×10′ was displayed on 10 cm plates. The obtained plaques were transferred to nitrocellulose and hybridized. In this way, 6 clones having HCV gene fragments were selected. Then, phage DNA was recovered from this clone and then cut with EcoRI to generate six types of HCV gene fragments: Hl, H5, Hlo, Hl3,
The H2O and H21 fragments were recovered from the agarose electrophoresis gel.

After collecting the Hl, H5, Hlo, Hl3, H20, and H21 fragments, they were added to the Eco of plasmid vector pTZ19R.
It was inserted into the R1 site and the gene was cloned. Thus recombinant plasmid 1) HCVI, pHCV5, pH
cVlo, pHcV13, pHcV20, pHC■21
I got it.

(Gene amplification by RT-PCR method) To 4 μl of the obtained RNA solution, reverse transcriptase reaction solution [25
0mM Tris-HCl (pH 8,3), 375
mM KCI, 50mMDT7.15mM MgCl
212 ul, 1 ul (100 ng/4 ul) of the 3' downstream noantisense strand brimer solution described below, various deoxynucleotides [dATP, dGTP.

dCTP, dTTP, 15 mM each] were added in 0.5 μm portions to make a 9 μl solution.

Mineral oil was added to this, heated at 70°C for 2 minutes, then cooled to 37°C, and reverse transcriptase lμ1 (BR
(product of Company L) was added thereto, and the mixture was allowed to react at 37°C for 60 minutes.

This reaction solution (10 μl) was further added to the PCR reaction solution [400 μl].
mM Tris-HCI (pH 8,8), 100mM
Ammonium sulfate, 40mM magnesium chloride, 6
0mM mercaptoethanol, 0.1% BSA] 8.
3 μm, 4 types of deoxynucleotides [dATP,
dGTP, dcTP, dTTP.

5 μl of each 15 mM] were added. Next, add 5 u of a 30 base brimer solution having the base sequence of the sense strand on the upstream side of the target region for gene amplification.
1 (100 ng/μl) and a 30-base brimer solution 5 with the base sequence of the antisense strand on the 3' downstream side.
Add tt I (100 ng/μm) and finally add 0.0 ng/μm of water.
7 ul was added to make a solution with a total volume of 49 μl. Regarding the position of the primer, H2, H3, H6 for the purpose of amplification
, Hl, H8, H9, ) (12, Hl4, Hl6, Hl
7, H18100, a set of 30 bases of primers on each side of these fragments was used. However, in the case of the H4 fragment, there is a 30 base primer on the 5° side, and an EcoR1 site (GAATTC) downstream of the primer on the 3' side.
A 36-base primer with the base sequence added was used as a set. In addition, a set of H11 fragment and H15100, 36-base primer 7-, in which the EcoR1 site (GAATTC) nucleotide sequence was added upstream of the 5'-side primer and downstream of the 3'-side primer 7-, was used. H1
Fragment 9 has a Sac 1 site (G
AGCTC) and BamHr downstream of the 3' side braai 7-.
A 36-base primer to which a site (GGATCC) was added was used as a set. The base sequence of each primer is clear from FIG. 1.

The solution was treated at 92°C for 5 minutes, cooled to room temperature and the Ta
q Polymerase 1 μm (2 units, New Engl.
and Biolabs product) was added. Below, for the product made by A company (55'C, 45 seconds), polymerization (72°
C, 2 minutes) and denaturation (90°C, 1 minute) were repeated 35 times to amplify the DNA.

Hereinafter, the cloning of gene products amplified by RT-PCR will be described. This cloning method is based on the method of Maniatis et al. [Molecular Cloni
ng, Co1d Spring Harbor La
laboratory, New York (1982),
I followed 1. First, H2, H3, H6, Hl, H8
, H9, Hl2, Hl4, Hl6, Hl7, H1810
If 0, the amplified gene fragment was run on an agarose gel (2%)
DNA of the desired length was recovered from the electrophoresis. This was then treated with Klenow fragment enzyme to make the ends of the DNA blunt, and the 5'' end was phosphorylated using T4 polynucleotide kinase. This was inserted into the Hinc[1 site of plasmid vector pTZ19R, and the gene was cloned. I went. HIL H15
100, after recovery from agarose gel, cut with restriction enzyme EcoRI and transform it into plasmid vector p
It was inserted into the EcoR1 site of TZ19R and the gene was cloned. After recovering the H4 fragment from agarose gel, it was cut with the restriction enzyme EcoRI, and this was inserted into the Hincll-EcoR1 site of plasmid vector pTZ19R to clone the gene. In addition, after recovering the H19 fragment from agarose gel, the restriction enzyme 5a
The gene was cut with cl and BamHI and inserted into the 5acl-Bam old site of plasmid vector pUc118, and the gene was cloned.

Thus recombinant plasmids pHCV2, pHCV3, p
HCV4, pHCV6, pHcV7, pHCV8, pH
CV9, pHcVll, pHcV12, pHCV14
, pHcV15.1) HCVI6.1) HCVI7, p
HcV18 and IIHCV19 were obtained, respectively. Note that the numbers of the gene fragments and the numbers of the recombinant plasmids correspond to each other.

(Preparation of recombinant vector for gene expression) The subsequent genetic manipulation technique was the method of Maniatis et al.
r Cloning, Co1d Spring Ha
rborLaboratory, New York
(1982), ].

The expression vector pUc19 was cut with EcoRI, and a double-stranded small D chemically synthesized using a DNA synthesizer was inserted downstream of this site.
NA fragment (5°) AATTCTGAGTGATTGA (3')
(3°) GACTCACTAACTTTAA (5°) was inserted. A vector in which this fragment was inserted in a direction in which the stop codon TGA derived from the small DNA fragment appeared in three frames downstream of EcoRI was selected, and an expression vector PST19 was obtained. Similarly, another small double-stranded DNA fragment (5') CTAGATGAGTGATTGA (3°)
(3')TACTCACTAACTGATC(5'
) was inserted into the Xba1 site of recombinant plasmid pHcV19 to obtain recombinant vector pHK19.

psT19 was then cut with pnl and ExoVII
After scraping off the single-stranded ends by nuclease treatment,
The expression vector psT19ΔKpn was obtained by recombining itself.

In addition, after cutting psT19 with the restriction enzyme Pstl, T4
The single strand ends were filled in by DNA Bo II merase treatment and religated by itself to obtain the expression vector psT19+Pst.

The EcoRE fragment was recovered from the recombinant plasmid pHcV1 and added to the EcoR of the expression vector psT19+Pst.
1 site, the recombinant vector pHK1
I got it.

In addition, the EcoRI fragment was recovered from the recombinant plasmid pHCV5 and used as the EcoRr fragment of the expression vector psT19.
By inserting into the site, recombinant vector pHK5 was obtained.

In addition, the ECORI fragment was recovered from the recombinant plasmid pHcV10 and inserted into the EcoR1 site of the expression vector psT19ΔKpn to obtain the recombinant vector pl (KIO).

Furthermore, the EcoRI fragment was recovered from the recombinant plasmid pHcV11 and inserted into the EcoR1 site of the expression vector psT19+Pst to obtain the recombinant vector pHK11.

Furthermore, the EcoRI fragment was recovered from the recombinant plasmid pHcV13 and inserted into the EcoR1 site of the expression vector psT19ΔKpn to obtain the recombinant vector pHK13.

In addition, the EcoRr fragment was recovered from the recombinant plasmid pHcV15 and used in the expression vector PST19+Pst.
By inserting into the coR1 site, the recombinant vector p
Obtained HK15.

Furthermore, the EcoRI fragment was recovered from the recombinant plasmid pHcV20 and inserted into the EcoR1 site of the expression vector psT19ΔKpn to obtain the recombinant vector pHK2O.

In addition, the EcoR1 fragment was recovered from the recombinant plasmid pHcV21 and used as the EcoR1 fragment of the expression vector psT19.
By inserting into one site, the recombinant vector pHK2
I got 1.

In addition, Hindllll from recombinant plasmid pHCV2
The ~EcoRI fragment was collected and inserted into the expression vector psT.
19 into the Hindlll-EcoR1 site to obtain recombinant vector pHK2.

In addition, Hindll from recombinant plasmid pHcV17
Collect the ~EcoRI fragment and insert it into the expression vector p
It was inserted into the Hindll-EcoR1 site of sT19 to obtain a recombinant vector pHK17.

In addition, the recombinant plasmid p) ICV18 to Hindl
The lr~EcoRI fragment was recovered and inserted into the Hindlll~EcoR1 site of the expression vector psT19 to obtain the recombinant vector pHK18.

After cutting the recombinant plasmid pHCV3 with the restriction enzyme PstI, the single-stranded end was scraped off by treatment with ExoVI IVtVt-ase, and recombined with itself to create plasmid pH3.
and further added Hindll-EcoRI from pH 3.
Collect the fragment and insert it into Hin of expression vector psT19.
dllll-EcoR1 site to obtain recombinant vector pHK3.

After cutting the recombinant plasmid pHcV8 with the restriction enzyme Pstr, the single-stranded ends were scraped off by ExoVIIj crease treatment and religated by itself to create plasmid pH8. Furthermore, the Hindlll-EcoRI fragment was recovered from pH8 and expressed. Hind of vector psT19
The recombinant vector pHK8 was obtained by inserting into the lII-EcoR1 site.

After cutting the recombinant plasmid pHCV9 with the restriction enzyme Pstl, the single-stranded end was scraped off by ExoVIIJ clease treatment and religated with itself to create plasmid pH9, and from pH9, HindlII to EcoRI
Collect the fragment and insert it into Hin of expression vector psT19.
The recombinant vector pHK9 was obtained by inserting into the dlLr~EcoR1 site.

After cutting the recombinant plasmid pHcV12 with 5phl of restriction enzyme, the single-stranded end was scraped off by ExoVII nuclease treatment, and recombined with itself to create plasmid pH1.
2, and then added Hindl[I-Eco
Collect the RI fragment and insert it into the expression vector psT19 H
It was inserted into the indlII to EcoR1 site to obtain the recombinant vector pHK12.

After cutting the recombinant plasmid pHCV4 with the restriction enzyme Pstl, the single-stranded ends were filled in with T4 DNA polymerase to make blunt ends, and the recombinant plasmid was religated with itself to create plasmid pi(4). pH 4 to Hindlrr-
The EcoRI fragment was collected and inserted into the expression vector psT1.
The recombinant vector pHK4 was obtained by inserting the vector into the Hindll-Eco stone site of 9.

After cutting the recombinant plasmid pHcV6 with the restriction enzyme Pstl, the single strand ends were filled in with T4 DNA Illll ramase treatment to make blunt ends, and the plasmid was religated with itself to create plasmid p)16.
- Collect the EcoRI fragment and insert it into the expression vector ps
Insert into Hind[I■~EcoRr site of T19,
Recombinant vector pHK6 was obtained.

After cutting the recombinant plasmid pHcV7 with the restriction enzyme Pstl, the single strand ends were filled in by T4 DNA Bo II merase treatment to make blunt ends, and the plasmid pHcV7 was religated to create plasmid pH7.
The EcoRI fragment was collected and inserted into the expression vector psT1.
9 into the HindIII-EcoR1 site to obtain the recombinant vector pHK7.

After cutting the recombinant plasmid pHcV14 with the restriction enzyme Pstl, the single strand ends were filled in by T4 DNA polymerase treatment to make blunt ends, and the plasmid pHcV14 was religated by itself to create plasmid pH14.
- Collect the EcoR1 fragment and insert it into the expression vector ps
It was inserted into the HindIII to EcoR1 sites of TI9 to obtain the recombinant vector pHK14.

After cutting the recombinant plasmid pHcV16 with the restriction enzyme Pstl, the single strand ends were filled in by T4 DNA po II merase treatment to make blunt ends, and the plasmid pHcV16 was religated by itself to create plasmid pH16.
The l-EcoR1 fragment was collected and inserted into the expression vector p
It was inserted into the Hindlll to EcoR1 sites of sT19 to obtain a recombinant vector pHK16.

In addition, HCV on recombinant vectors pHK1 to pHK21
The amino acid sequence of the protein produced when the gene fragment is expressed is shown in FIGS. 2 to 22 together with the base sequence of the reading frame. Note that FIG. 2 shows the case of pHK1, FIG. 3 shows the case of pHK2, and FIG. 4 shows the case of pHK3.

Example 2 E. coli E, coli HKI immediately after transformation [E. coli JM10 transformed with recombinant vector pHK1]
9] in 3 rifts of M92B medium (NH2Cl
0.3%, KH2PO, 0.3%, NatHPO
4o, 6%, NaCLO, 5%, MgSO4
1mM - Pactotrishuin 1%, Glucose 0
．． 2%, Ambinrin 100 μg/ml), and when the OD600 reached 0.8, the bacteria were collected.
After washing the bacterial cells with 0.9% saline, transfer them to 3 liters of fresh M92B medium without glucose, and add IPTG (isopropylthiogalactonodide) to a final concentration of 0.4 mM.
It was added once and then cultured at 37 degrees for 3 hours.

Next, culture solution 100 of JM109 cultured in the same manner
μl and 100 μl of HKI culture solution, respectively, were
The cells were subjected to S electrophoresis and analyzed by Western blotting. Analysis by Western blotting was performed according to the following procedure.

First, protein plotting was performed electrically using a Horizon Plot device manufactured by ATTO, and the membrane was Imopilone PvDF transfer membrane (manufactured by Millipore).
The method is the method of Andersen et al. [J, Bi
ochem, Biophys, Method.

Vol, 10. p203 (1984), 1. Imopilone PVDF to which the protein was then transferred
) The transfer membrane was reacted with normal human serum or post-transfusion non-A, non-B hepatitis patient serum as a secondary antibody, and then with the antibodies shown in Table 1 as a secondary antibody.

In this way, anti-HCV antibodies (-sub-antibodies) in serum were detected by the avidin/biotinylated enzyme complex reaction.

This experiment was also performed using the method of Taupin et al. [Proc, Natl.
,Acad,Sci,, U,S,A,, Vol,7
6゜p4350 (1979), ].

(Margins below this page) Table 1 As a result, when using post-transfusion non-A, non-B chronic hepatitis patient serum, a band was observed at the molecular weight position of 51 kd in HKI, or that band was not observed in JM109. There wasn't. In addition, when normal human serum is used, HKI,
That band was not detected in either JMI09. From this, it can be seen that the polypeptide produced by the present invention has C
It was found that antibodies in the serum of patients with type hepatitis can be specifically determined.

Next, preparative SDS electrophoresis was performed on 5 g of bacterial cells collected after culturing, and a band near the molecular weight of 51 was cut out.
M) Lys, 0.1 M Tricine, 0.1% SDS was electroeluted from the gel using an eluent.

This was repeated twice to obtain a solution containing 2 mg of crudely purified polypeptide. This crudely purified polypeptide was purified by performing ion exchange chromatography-1 reverse phase column chromatography to finally obtain 100 μg of polypeptide.

Using the purified polypeptide, the amino acid sequence of the N-terminal region was determined using an ABI model 1477A/12OA amino acid sequencing system (manufactured by ABI).

Bioblen Plus (manufactured by AB1) was used as a carrier. 5 from the N-terminus of the polypeptide thus determined
The amino acid sequence up to the residue is Met.

ThrSPro, Leu, which is identical to the sequence predicted from the gene.

Furthermore, the purified polypeptide was dissolved in 6N-HCI and hydrolyzed at 105°C for 122 hours. The amino acid composition of this hydrolyzate was analyzed using a Hitachi 835 amino acid analysis system (manufactured by Hitachi, Ltd.). The results of the amino acid composition analysis are shown below, and the results were the same as expected from the gene structure. Table 2 below shows the types of amino acids and the actually measured values of the amino acid composition per molecule (the values in parentheses are calculated values expected from the sequence).

(Margins below this page) Furthermore, the expected molecular weight of this polypeptide is 48,000, which agrees well with the molecular weight results of Western PCR.

From the above results, it was confirmed that the obtained polypeptide had the amino acid sequence shown in FIG.

Example 3 Escherichia coli (K2) transformed with recombinant vector pHK2 was cultured using the same method as in Example 2 to produce a polypeptide.Hereafter, Western blotting was performed using the same method as in Example 2. The obtained polypeptide was found to have antigenic activity.

The amino acid sequence of this polypeptide is M
et, Ile, Thr, ProSSer,
The expected molecular weight is 12 compared to the molecular weight of 13 determined by SDS electrophoresis.
There was good agreement with 000. Furthermore, the amino acid composition values shown in Table 3 also agreed well with the theoretical values.

(Margins below the essence) From the above results, it was confirmed that the obtained polypeptide had the amino acid sequence shown in FIG. 3.

Example 4 In the same manner as in Example 2, E. coli HK3 transformed with the recombinant vector pHK3 was cultured to produce a polypeptide. Western blotting was then performed using the same method as in Example 2, and it was determined that the obtained polypeptide had antigenic activity.

The amino acid sequence of this polypeptide is M
et, lie, button r, Pro, Set, and S
, the expected molecular weight is 250 for a molecular weight of 25 by DS electrophoresis.
There was good agreement with 00. Furthermore, the amino acid composition values shown in Table 4 also agreed well with the theoretical values.

(Margin below the essence) From the above results, it was confirmed that the obtained polypeptide had the amino acid sequence shown in FIG. 4.

Example 5 In the same manner as in Example 2, E. coli HK4 transformed with the recombinant vector pHK4 was cultured to produce a polypeptide. Western probing was then performed using the same method as in Example 2, and it was determined that the obtained polypeptide had antigenic activity.

The amino acid sequence of this polypeptide is M
et, Ile, Thr, Pro, Ser, and the predicted molecular weight is 30 for the molecular weight of 31 by SDS electrophoresis.
There was good agreement with 000. Furthermore, the amino acid composition values shown in Table 5 also agreed well with the theoretical values.

(Margin below the essence) From the above results, it was confirmed that the obtained polypeptide had the amino acid sequence shown in FIG.

Example 6 In the same manner as in Example 2, E. coli HK5 transformed with the recombinant vector pHK5 was cultured to produce a polypeptide. Thereafter, Western PCR was carried out using the same method as in Example 2, and the obtained polypeptide was found to have antigenic activity.

The amino acid sequence of this polypeptide is M
et, Ile, ThrSPro, Ser, S
Expected molecular weight 2300 for molecular weight 25 by DS electrophoresis
It was in good agreement with 0. Furthermore, the amino acid composition values shown in Table 6 also agreed well with the theoretical values.

(Margins below the essence) From the above results, it was confirmed that the obtained polypeptide had the amino acid sequence shown in FIG.

Example 7 In the same manner as in Example 2, E. coli HK6 transformed with the recombinant vector pHK6 was cultured to produce a polypeptide. Western blotting was then performed using the same method as in Example 2, and it was found that the obtained polypeptide had antigenic activity.

The amino acid sequence of this polypeptide is M
et, Ile, ThrSProSSer, and S
Expected molecular weight 2300 for molecular weight 24 by DS electrophoresis
It was in good agreement with 0. Furthermore, the amino acid composition values shown in Table 7 also agreed well with the theoretical values.

(Leaving space below the essence) From the above results, it was confirmed that the obtained polypeptide had the amino acid sequence shown in FIG.

Example 8 In the same manner as in Example 2, E. coli HK7 transformed with the recombinant vector pHK7 was cultured to produce a polypeptide. Western blotting was then performed using the same method as in Example 2, and it was determined that the obtained polypeptide had antigenic activity.

The amino acid sequence of this polypeptide is M
etSIleSThr, Pro, Set, S
Expected molecular weight 2700 for molecular weight 29 by DS electrophoresis
Furthermore, the amino acid composition values shown in Table 8 were also in good agreement with the theoretical values.

(Leaving space below the essence) From the above results, it was confirmed that the obtained polypeptide had the amino acid sequence shown in FIG.

Example 9 In the same manner as in Example 2, E. coli HK8 transformed with the recombinant vector pHK8 was cultured to produce a polypeptide. Western blotting was then performed using the same method as in Example 2, and it was determined that the obtained polypeptide had antigenic activity.

The amino acid sequence of this polypeptide is M
et, lie, Thr, Pro, Ser, and the predicted molecular weight is 13 for the molecular weight of 15 by SDS electrophoresis.
There was good agreement with 000. Furthermore, the amino acid composition values shown in Table 9 also agreed well with the theoretical values.

(Margin below the essence) From the above results, it was confirmed that the obtained polypeptide had the amino acid sequence shown in FIG. 9.

Example 10 In the same manner as in Example 2, E. coli HK9 transformed with the recombinant vector pHK9 was cultured to produce a polypeptide. Thereafter, Western PCR was performed using the same method as in Example 2, and it was determined that the obtained polypeptide had antigenic activity.

The amino acid sequence of this polypeptide is M
et, Ile, Thr, Pro 1Ser
The molecular weight of 11 determined by SDS electrophoresis was in good agreement with the expected molecular weight of 10,000. Furthermore, the amino acid composition values shown in Table 1O also agreed well with the theoretical values.

(Margins below the essence) From the above results, it was confirmed that the obtained polypeptide had the amino acid sequence shown in Figure 1O.

Example 11 By the same method as Example 2, the recombinant vector pHKIO
Escherichia coli HKIO transformed by the method was cultured to produce polypeptide. Hereinafter, by the same method as Example 2,
Western amputation was performed and it was determined that the obtained polypeptide had antigenic activity.

The amino acid sequence of this polypeptide is M
et, lie, Thr, Pro, Ser,
Molecular weight 24 by SDS electrophoresis has an expected molecular weight of 240.
There was good agreement with 00. Furthermore, the amino acid composition values shown in Table 11 also agreed well with the theoretical values.

(Margins below the essence) From the above results, it was confirmed that the obtained polypeptide had the amino acid sequence shown in FIG. 1I.

Example 12 By the same method as Example 2, recombinant vector pHK11
Escherichia coli HKII transformed with the above method was cultured to produce a polypeptide. Hereinafter, by the same method as in Example 2,
Western blotting was performed and it was determined that the obtained polypeptide had antigenic activity.

The amino acid sequence of this polypeptide is M
et , Tie , Thr , Pro , , Ser
The molecular weight of 17 determined by SDS electrophoresis was in good agreement with the expected molecular weight of 17,000.Furthermore, the amino acid composition values shown in Table 12 were also in good agreement with the theoretical values.

(Margin below the essence) From the above results, it was confirmed that the obtained polypeptide had the amino acid sequence shown in FIG. 12.

Example 13 By the same method as Example 2, recombinant vector pHK12
Escherichia coli HK12 transformed by the method was cultured to produce polypeptide. Hereinafter, by the same method as in Example 2,
Western probing was performed and the resulting polypeptide was found to have antigenic activity.

The amino acid sequence of this polypeptide is M
et, lie, Thr, ProSSer,
Expected molecular weight 240 for molecular weight 25 by SDS electrophoresis
There was good agreement with 00. Furthermore, the amino acid composition values shown in Table 13 also agreed well with the theoretical values.

(Leaving space below the essence) From the above results, it was confirmed that the obtained polypeptide had the amino acid sequence shown in FIG. 13.

Example 14 By the same method as Example 2, recombinant vector pHK13
Escherichia coli HK13 transformed by the method was cultured to produce polypeptide. Hereinafter, by the same method as in Example 2,
Western probing was performed and it was determined that the resulting polypeptide had antigenic activity.

The amino acid sequence of this polypeptide is M
et, 1ieSThr, Pro, Set, and S
Expected molecular weight 7200 for molecular weight 80 by DS electrophoresis
They were in good agreement. Furthermore, the amino acid composition values shown in Table 14 also agreed well with the theoretical values.

(Margin below the essence) From the above results, it was confirmed that the obtained polypeptide had the amino acid sequence shown in FIG. 14.

Example 15 By the same method as Example 2, recombinant vector pHK14
Escherichia coli HK14 transformed by the method was cultured to produce polypeptide. Hereinafter, by the same method as in Example 2,
Western probing was performed and it was determined that the obtained polypeptide had antigenic activity.

The amino acid sequence of this polypeptide is M
etSIle, Thr, Pro, Set,
Expected molecular weight 200 for molecular weight 20 by SDS electrophoresis
There was good agreement with 00. Furthermore, the amino acid composition values shown in Table 15 also agreed well with the theoretical values.

(Margin below the essence) From the above results, it was confirmed that the obtained polypeptide had the amino acid sequence shown in FIG. 15.

Example 16 By the same method as Example 2, recombinant vector pHK15
Escherichia coli HK15 transformed by the method was cultured to produce polypeptide. Hereinafter, by the same method as in Example 2,
Western probing was performed and the resulting polypeptide was found to have antigenic activity.

The amino acid sequence of this polypeptide is M
etllieSThr, Pro, Set, 5
Expected molecular weight 2200 for molecular weight 23 by DSt aerophoresis
It was in good agreement with 0. Furthermore, the amino acid composition values shown in Table 16 also agreed well with the theoretical values.

(Margins below the essence) From the above results, it was confirmed that the obtained polypeptide had the amino acid sequence shown in FIG. 16.

Example 17 By the same method as Example 2, recombinant vector pHK16
Escherichia coli HK16 transformed by the method was cultured to produce polypeptide. Hereinafter, by the same method as in Example 2,
Western probing was performed and it was determined that the obtained polypeptide had antigenic activity.

The amino acid sequence of this polypeptide is M
et, Ile, Thr, Pro, Set,
Molecular weight 30 by SDS electrophoresis has expected molecular weight 280.
There was good agreement with 00. Furthermore, the amino acid composition values shown in Table 17 also agreed well with the theoretical values.

(Margin below the essence) From the above results, it was confirmed that the obtained polypeptide had the amino acid sequence shown in FIG. 17.

Example 18 By the same method as Example 2, recombinant vector pHK17
Escherichia coli HK17 transformed by the method was cultured to produce polypeptide. Hereinafter, by the same method as in Example 2,
Western amputation was performed, and the resulting polypeptide was found to have antigenic activity.

The amino acid sequence of this polypeptide is M
et, [le, ThrSPro, Ser, S
Expected molecular weight 1100 for molecular weight 12 by DS electrophoresis
It was in good agreement with 0. Furthermore, the amino acid composition values shown in Table 18 also agreed well with the theoretical values.

(Margin below the essence) From the above results, it was confirmed that the obtained polypeptide had the amino acid sequence shown in FIG. 18.

Example I9 By the same method as Example 2, recombinant vector 1) HK1
E. coli HK18 transformed with E. 8 was cultured to produce polypeptide. Thereafter, Western PCR was performed using the same method as in Example 2, and it was determined that the obtained polypeptide had antigenic activity.

The amino acid sequence of this polypeptide is M
etSIleSThr, Pro, Mai “There, SDS
The molecular weight of 13 determined by electrophoresis was in good agreement with the expected molecular weight of 12,000. Furthermore, the amino acid composition values shown in Table 19 also agreed well with the theoretical values.

(Margins below the essence) From the above results, it was confirmed that the obtained polypeptide had the amino acid sequence shown in FIG. 19.

Example 20 The recombinant vector pl (K1
E. coli HK19 transformed with E. 9 was cultured to produce polypeptide. Western probing was then performed using the same method as in Example 2, and it was determined that the obtained polypeptide had antigenic activity.

In addition, the amino acid sequence of this polypeptide is
et, lie, Thr, Asn5Ser,
Expected molecular weight 110 for molecular weight 12 by SDS electrophoresis
There was good agreement with 00. Furthermore, the amino acid composition values shown in Table 20 also agreed well with the theoretical values.

(Blank below this page) From the above results, it was confirmed that the obtained polypeptide had the amino acid sequence shown in FIG. 20.

Example 21 By the same method as Example 2, the recombinant vector pHK2O
Escherichia coli HK20 transformed by the method was cultured to produce polypeptide. Hereinafter, by the same method as in Example 2,
Western amputation was performed, and it was determined that the obtained polypeptide had antigenic activity.

The amino acid sequence of this polypeptide is M
etllie, Thr, Pro, Set,
Molecular weight 30 by SDS electrophoresis has expected molecular weight 280.
There was good agreement with 00. Furthermore, the amino acid composition values shown in Table 21 also agreed well with the theoretical values.

(Margin below the essence) From the above results, it was confirmed that the obtained polypeptide had the amino acid sequence shown in FIG. 20.

Example 22 By the same method as Example 2, recombinant vector 1) HK1
E. coli HK14 transformed with 4 was cultured to produce polypeptide. Western blotting was then performed using the same method as in Example 2, and it was determined that the obtained polypeptide had antigenic activity.

The amino acid sequence of this polypeptide is M
etSrle, ThrSProSSer, 5D
The expected molecular weight is 3000Q for the molecular weight 31 determined by St aerophoresis.
They were in good agreement. Furthermore, the amino acid composition values shown in Table 22 also agreed well with the theoretical values.

(Margin below the essence) From the above results, it was confirmed that the obtained polypeptide had the amino acid sequence shown in FIG. 22.

[Brief explanation of the drawing]

FIG. 1 is a diagram showing the entire open reading frame region of the HCV gene, and FIG. 2 is a diagram showing the open reading frame of a polypeptide exhibiting HCV antigenic activity produced by gene expression from E. coli fKl.
Figure 3 shows H produced by gene expression from E. coli HK2.
FIG. 4 is a diagram showing the oven reading frame of a polypeptide exhibiting CV antigen activity, and FIG. The figure shows the open reading frame of a polypeptide showing HCV antigenic activity produced by gene expression from E. coli HK4, and Figure 6 shows the open reading frame of a polypeptide showing HCV antigenic activity produced by gene expression from E. coli HK5. FIG. 7 is a diagram showing the oven reading frame of a polypeptide showing HCV antigen activity produced by gene expression from E. coli HK6, and FIG. 8 is a diagram showing the oven reading frame of E. coli HK7.
FIG. 9 is a diagram showing the oven reading frame of a polypeptide exhibiting HCV antigenic activity produced by gene expression from Escherichia coli HK8. FIG. FIG. 10 is a diagram showing E. coli H
FIG. 11 is a diagram showing the oven reading frame of a polypeptide exhibiting HCV antigenic activity produced by gene expression from E. coli HKIO, and FIG. 11 is an oven reading frame of a polypeptide exhibiting HCV antigenic activity produced by gene expression from E. coli HKIO. FIG. 12 is a diagram showing the open reading frame of a polypeptide exhibiting HCV antigen activity produced by gene expression from E. coli HKII, and FIG. 13 is a diagram showing the open reading frame of a polypeptide produced by gene expression from E. coli HK12. 1 is a diagram showing the open reading frame of a polypeptide exhibiting HCV antigenic activity,
FIG. 14 is a diagram showing the open reading frame of a polypeptide exhibiting HCV antigen activity produced by gene expression from E. coli HK13, and FIG.
14 is a diagram showing the oven reading frame of a polypeptide exhibiting HCV antigenic activity produced by gene expression from Escherichia coli HK15, and FIG. 16 is an oven reading frame of a polypeptide exhibiting HCV antigenic activity produced by gene expression from E. coli HK15. FIG. 17 is a diagram showing the open reading frame of a polypeptide exhibiting HCv antigen activity produced by gene expression from E. coli HK16, and FIG. 18 is a diagram showing the open reading frame of a polypeptide produced by gene expression from E. coli HK17. 1 is a diagram showing the open reading frame of a polypeptide exhibiting HCV antigenic activity,
FIG. 19 is a diagram showing the open reading frame of a polypeptide exhibiting HCV antigen activity produced by gene expression from E. coli HK18, and FIG.
21 is a diagram showing the oven reading frame of a polypeptide exhibiting HCV antigenic activity produced by gene expression from Escherichia coli HK20. FIG. FIG. 22 is a diagram showing the open reading frame of a polypeptide exhibiting HCV antigen activity produced by gene expression from E. coli HK21, and FIG. 23 is a diagram of recombinant vector construction.

Claims (1)

[Scope of Claims] 1. A gene derived from hepatitis C virus, comprising a base sequence encoding at least one amino acid sequence selected from the following amino acid sequences (1) to (21). Amino acid sequence (1) [There is a gene sequence] Amino acid sequence (2) [There is a gene sequence] Amino acid sequence (3) [There is a gene sequence] Amino acid sequence (4) [There is a gene sequence] Amino acid sequence (5) [ There is a gene sequence] Amino acid sequence (6) [There is a gene sequence] Amino acid sequence (7) [There is a gene sequence] Amino acid sequence (8) [There is a gene sequence] Amino acid sequence (9) [There is a gene sequence] Amino acid sequence Sequence (10) [There is a gene sequence] Amino acid sequence (11) [There is a gene sequence] Amino acid sequence (12) [There is a gene sequence] Amino acid sequence (13) [There is a gene sequence] Amino acid sequence (14) [Gene Amino acid sequence (15) [Gene sequence available] Amino acid sequence (16) [Gene sequence available] Amino acid sequence (17) [Gene sequence available] Amino acid sequence (18) [Gene sequence available] Amino acid sequence (19) [There is a gene sequence] Amino acid sequence (20) [There is a gene sequence] Amino acid sequence (21) [There is a gene sequence] 2. At least one type selected from the following base sequences (1) to (21) A gene derived from hepatitis C virus containing the nucleotide sequence. Base sequence (1) [There is a gene sequence] Base sequence (2) [There is a gene sequence] Base sequence (3) [There is a gene sequence] Base sequence (4) [There is a gene sequence] Base sequence (5) [ There is a gene sequence] Base sequence (6) [There is a gene sequence] Base sequence (8) [There is a gene sequence] Base sequence (9) [There is a gene sequence] Base sequence (10) [There is a gene sequence] Base Sequence (11) [There is a gene sequence] Base sequence (13) [There is a gene sequence] Base sequence (14) [There is a gene sequence] Base sequence (15) [There is a gene sequence] Base sequence (16) [Gene There is a sequence] Base sequence (17) [There is a gene sequence] Base sequence (18) [There is a gene sequence] Base sequence (19) [There is a gene sequence] Base sequence (20) [There is a gene sequence] Base sequence (21) [There is a gene sequence] 3. A recombinant vector obtained by incorporating the hepatitis C virus-derived gene according to claim 1 or 2 into a vector capable of expressing the gene in E. coli. 4. E. coli transformed with the recombinant vector according to claim 3. 5. A method for producing a polypeptide having HCV antigenic activity, which comprises culturing the E. coli according to claim 4 in a medium to produce a polypeptide having HCV antigenic activity, and collecting the polypeptide from the culture. 6. A hepatitis C virus antigenic active polypeptide comprising at least one amino acid sequence selected from the following amino acid sequences (1) to (21). Amino acid sequence (1) [There is a gene sequence] Amino acid sequence (2) [There is a gene sequence] Amino acid sequence (3) [There is a gene sequence] Amino acid sequence (4) [There is a gene sequence] Amino acid sequence (5) [ There is a gene sequence] Amino acid sequence (6) [There is a gene sequence] Amino acid sequence (7) [There is a gene sequence] Amino acid sequence (8) [There is a gene sequence] Amino acid sequence (9) [There is a gene sequence] Amino acid sequence Sequence (10) [There is a gene sequence] Amino acid sequence (11) [There is a gene sequence] Amino acid sequence (12) [There is a gene sequence] Amino acid sequence (13) [There is a gene sequence] Amino acid sequence (14) [Gene Amino acid sequence (15) [Gene sequence available] Amino acid sequence (16) [Gene sequence available] Amino acid sequence (17) [Gene sequence available] Amino acid sequence (18) [Gene sequence available] Amino acid sequence (19) [There is a gene sequence] Amino acid sequence (20) [There is a gene sequence] Amino acid sequence (21) [There is a gene sequence]