JPH0376583A - Manifestation of human protein in blue-green algae - Google Patents

Abstract

PURPOSE:To obtain a human protein by transforming blue-green algae cell using recombinant plasmid incorporated with the DNA sequence coding a polypeptide having the same amino acid sequence as that for human superoxide dismutase. CONSTITUTION:Firstly, a recombinant plasmid (or a DNA fragment capable of manifesting it) incorporated with the DNA sequence coding a polypeptide having virtually the same amino acid sequence as that for human superoxide dismutase (h-SOD) is synthesized. Second, using this recombinant plasmid (or the DNA fragment capable of manifesting it), blue-green algae put to culture in a medium to manifest polypeptide. Thence, cells are collected from the resulting cultured product by e.g. centrifugation and then ground, and the resultant polypeptide is separated by means of e.g. salting-out and recovered. The polypeptide thus obtained is useful for e.g. the pharmaceuticals for the therapy or prevention of chronic articular rheumatism, osteoarthritis, etc.

Description

[Detailed Description of the Invention] [Industrial Application Field 1] The present invention relates to human superoxide dismutase (hereinafter referred to as
The present invention relates to a method for expressing in cyanobacteria cells a DNA sequence encoding a polypeptide having substantially the same amino acid sequence as h-SOD (abbreviated as h-SOD).

[Prior art] Human superoxide dismutase <h-5OD)
It is thought that it has the function of reducing the concentration of active oxygen (02-"0., OH-, etc.) generated in the living body and preventing biological components from being non-specifically oxidized. h-SOD is attracting attention as an effective therapeutic agent for diseases involving active oxygen such as inflammation (e.g., rheumatoid arthritis, osteoarthritis, disorders caused by radiation/ultraviolet irradiation, disorders associated with blood reflow to ischemic areas, etc.) has been done.

The amino acid sequence of human red blood cell Cu/Z n -S OD has been reported [Jabusch et al.
al.

Biochen+1strys 19 (1980)
2310-2316, Barraat al,, FE
BS Letters, 120 (1980) 53
~55] The base sequence of cDNA obtained from mRNA isolated from established cell lines derived from Down syndrome patients has also been investigated [Sherman,
L.

et al, Proc, Nat, Acad,
Sci, USA% 80 (1983) 5465-5
469]. In addition, h-5OD has also been reported to be expressed in the large intestine and yeast through genetic manipulation, and has been expressed in ER, -mu, Ha
llewell eL al, Nucleic Ac
1d Research 13, (6) (1985)
2017-2034, R,A.

Hallawell et al, Bio/Tec
hnology, 5 (1987) 363-366]
, it has also become possible to mass-produce i-recombinant b-S OD using Escherichia coli and yeast.

On the other hand, cyanobacterial cells can proliferate in the presence of light and water containing a small amount of inorganic salts, and are easy to culture, so they are considered suitable as hosts for genetic manipulation.

Conventionally, an example of genetic manipulation using cyanobacterial cells as a host is Anacystis nidulans (Anacys nidulans).
tis n1dulans) with ampicillin and chloramphenicol resistance genes, the rRNA gene of Anarchisteis nidulans, and the ribulose diphosphate carboxylase/oxygenase (RuB isCO) gene [C, J, Kuhlmeier
at al,, Mo1. Gan, Genet,
184:249 254 (1981); S, S, G
Oldenand, L., A., Sherman, J.
, Bacteriology 55:966
-972 (1983) ;H, Danielet
al., Arch, Mierobiol, 151
: 59-64 (1989)], Anabaena
chloramphenicol, streptomycin, neomycin, and erythromycin resistance genes were introduced into S. haena [C, P, Wolk et al.
, Proc, Natl, Acad, sei, UsA
81:1561-1565 (1984)], a kanamycin resistance gene introduced into Synechocystis [F, Chau
vat at al,, Mo1. Gen, Gon
et., 216:51-59 (1989)], but there have been no reports of successful integration of human or animal genes into cells of cyanobacteria, which are atomic animals, and their expression. .

The present inventors focused on the use of cyanobacterial cells as a host for the expression of h-sOD gene by genetic f recombination technology, and as a result of intensive research, this time, h-SOD
Species vectors containing genes or DNA capable of expressing them
Recombinant plasmid or DNA obtained by introducing the fragment into
We successfully transformed cyanobacterial cells with the fragment and expressed h-5OD, thus completing the present invention.

Thus, according to the present invention, a recombinant plasmid or a DNA fragment capable of expression into which a DNA sequence encoding a polypeptide having an amino acid sequence substantially identical to that of human superoxide dismutase is introduced is transformed. A method for expressing the above-mentioned polypeptide in cyanobacterial cells is provided, which comprises culturing the algal cells in a medium.

Human superoxide dismutase (h-5OD) is a polypeptide consisting of 153 amino acids, and the amino acid sequence of the polypeptide portion is as follows.

0 Asp Gly Pro Val Gln Gly
lie lie Asn Phe0 Glu Gin Lys Glu Ser A
sn Guy Pro Val Lys0 Vat Trp Guy Ser Ile L
ys Gly Leu Thr GLu0 Gly Leu His Guy Phe
His Val His Glu Phe0 Gly Asp Asn Thr Ala G
ly Cys Thr Ser AlaGly
Pro His pHe Asn Pro L
eu Ser Arg Lys0 His Gly Gly Pro Lys Asp G
lu Glu Arg His0 Val Gly Asp Lau Guy
Asn Val Thr Ala Asp0O Lys Asp Gly Vat Ala A
sp Val Ser lie Glu10 Asp Ser Vat lie Ser Le
u Ser Gly Asp His20 Cys lie [le Gly Arg Thr L
eu Val Van His30 Glu Lys Ala Asp Asp
Leu Gly Lys Gly Guy40 Asn Glu Glu Ser Thr Ly
s Thr Gly Asn Alal50 Gly Ssr Arg Leu Ala Cy
s Gly Vat lie Glylie
Ala Gin As used herein, "polypeptide having substantially the same amino acid sequence as human superoxide dismutase" means, in addition to h-5OD polypeptide having the above amino acid sequence, enzyme activity as h-SOD. Similar to h-S OD in which some of the above 153 amino acids (generally 5 or less, preferably 2 or less) are replaced with other amino acids without substantially losing The term "h-S OD analog" is also used to include polypeptides that contain (hereinafter referred to as h-S OD analogs). Specific examples of such h-S OD analogs include (a) the 6th cysteine residue of h-S OD (
Cys) is replaced with an alanine residue (Ala) (see Japanese Patent Application No. 63-311013), (b) the cysteine residue (Cys) at position I1 of h-S OD is replaced with a serine residue (S or) (Japanese Patent Publication No. 62-130681Ql [refer to the book), (c) h -S 6th cysteine residue of OD (
Cys) is replaced with an alanine residue (Ala), and the 111th cysteine residue (Cys) is replaced with a catherine residue (see Japanese Patent Publication No. 63-273473 specification).

A DNA sequence encoding a polypeptide having an amino acid sequence substantially identical to human superoxide dismutase (hereinafter referred to as the subject polypeptide) can be easily synthesized by genetic engineering techniques known per se;
For example, the following documents: (1) Edited by the Japanese Biochemical Society, "Sequential Biochemistry Course l Gene Research Methods", published by Tokyo Kagaku Doujin (1987)
Synthetic skin can be produced using methods described in experimental books such as ``Genetic Engineering in Medicine'' edited by Masami Muramatsu, published by Tokyo Kagaku Dojin (1987).

D which codes h-5OD which is synthesized in this way
An example of the NA sequence is as follows.

1
10GCT ACCAAAGCTG T
TTGCGTTCT GAAAGGTCGA TG
GTTTCGACAAAACGCAAGA CTTTC
CA0 GACGGCCCGGTTCAGGGTATCAT
CAACTTCCTGCCGGGCCCAAG TCC
CATAGTA GTTGAAG0 GAA CAGAAAGAAT CTAACGGT
CCGGTTAAAACT'r GTCT'l'TCT
TA GA'l"1"GCCAGG CCAAT'
M'GTT TGGGGTTCTA TCAAAG
GCCT GACCGAACAA
GA'l'AGT'l'TCCGGA CTGG
ATT0 GG'l' CTGCATGGAT? CCATG
TTCA TGAA'l"I'TCCA GACG
TACCTA AGGTACAAG'l' ACT
TAAA0 GGT GACAACACTG CAGGTTGC
ACCTCTGCACCA CTG'l'TGTGA
CG'l'CCAACG'l"G GAGACG'l
'0 GGG CCTCATTTCA ACCCGCTG
TCGCG'rAAACCCGGAGTAAAGT
TGGGCGACAG CGCATT'l'0 CATGGTGGGCGA AAGACGAAGA
ACG'l'CATGTACCACCCGGCT
TTCTGCTTCT TGCAGTA0 GTT 'GGTGAC'l'AGG TAACGT
TACCGCTGACCAA CCACTGATCC
ATTGCAATGG CGACTG00 AAAGACGGTGTCGCTGACGTTTCT
ATCGAAT? TCTGCCACAGCG AC
TGCAAAGA 'I'AGCTT10 GAC'l' CTGT↑A? CTCTCTGTCT
GG'l"GACCA'I'CTGA GACA
ATAGAG AGACAGACCA CTGGT
A20 TGCATCATCGGTCG TACTCTGGT
T GTTCATACGT'AGTAGCCAGCA
TGAGACCAA CAAGTA30 GAAA AAAGCGGATGA CCTGGGT
AAAGGTGGTCTTTTTCGCCTA
CT GGACCCAT'I"l' CCACCA
40 TTGCTCCTTAGA'l'G GTTT'I'G
GCCA TTGCGACCAA GAGCAGACC
G TACGCCACAA TAGCCAATCGCT
CAG ATGCGAGTC Note that it may be used as appropriate for the upstream end of the above DNA sequence.

The above DNA sequence is just one embodiment, and it goes without saying that the DNA sequence can be changed as long as it encodes the above amino acid sequence.

In addition, D encoding the h-S OD analog of (a) above
An example of the NA sequence is one in which the above h-5OD is replaced with .

The DNA sequence encoding the polypeptide synthesized in this manner is then incorporated into a suitable vector or DNA fragment capable of expression. Vectors or expressible DNA fragments that can be used for this purpose are not particularly limited as long as they can be introduced into cyanobacterial cells, and can be selected from a wide variety of vectors or DNA fragments, including plasmids and viruses. ε can be derived from ε as necessary. The vector may be a single copy vector or a low copy or high copy vector, and is functional for cloning and/or expression. Much literature exists regarding vectors, and many vectors or DNA fragments are commercially available. These vectors or expressible DNA fragments usually contain markers that allow selection, such as cytotoxin resistance, auxotrophy, etc., and often a large number of markers conferring different properties can be combined in one vector or l. Used for DNA fragments. In addition, in the case of an expression vector or an expressible DNA fragment, signals for re-regulating transcription initiation and termination are present.

Expression vectors that can be advantageously used include:
For example, ptac 11 (ATCC37145), p
Lac12 (ATCC37138), pKK 22
ptac promoter such as 3-3 [H, A, deB
oer e3t, al,, Proc, Natl.

Aeid, Sei, USA 78.21 (19
83)], vectors containing the ADC1 promoter such as pAH5 and pAH9: SV 40-based vectors such as plasmid pSV 2, and the like. Furthermore, as vectors for cyanobacterial cells, plasmids pBAs18, pUc104, and pUC105, which are described in "Plant Genetic Manipulation Technology - Genetic Recombination Self-Cell Fusion" edited by Hikoyuki Yamaguchi (published by CMC), pages 98-110, are used.
, pUc303, etc. can also be used.

Vector or expressible DNA fragment promoter, operator SD (Shine-D
algarno) sequence, translation initiation codon; termination codon,
It is necessary that the terminators be arranged in this order. It is not necessary to use only one promoter, and it is also possible to use two promoters in tandem. Promoters include tac promoter, glnAln promoter (Anabaena), ps2 B promoter (Fremilla), and rbc promoter (Anabaena).
acysc, is), rRNA promoter promoter (Calothrix), cpc promoter (Synechococeus, Anabaena)
, sod promoter (A nacystis), etc. [N, E, Tumer et al.
, Nature, 306: 337-342
(1983): B., Mulligan et.
at,,Proe.

Nat, 1. Aead, Sci, USA, 81 (9
): 2693-2697 (1984); Masanobu Kumano, Hatakehiro Sugiura, "Genetics J 38 (12) 26-31
(1984); S. E., Curtis.
Photosynthesis Re5earc
h, 18:223-244 (1988);
J.V.

D., Plas et al., Pho.
tosynthesis Re5earch18
:179-204 (1988) 8N, T, D.

Marsae et al., Photosy
nthesisRe5earch18: 9
9-132 (1988); D, E, Laude
nbaeh et al., Mo1. Gen, Gene
t, 2 16: 455-461 (1989
)].

On the other hand, examples of cyanobacterial cells into which a recombinant vector or an expressible DNA fragment into which the present polypeptide has been introduced include A. nacystis n1dulans, A. gmenelRu.
m quadruplicatum), Anabaena (
A 1abaena), Nostoe
, Oseil 1atoria, Spirulina, Ca
loLthrix), Fremyera (F rem+y
ella), A phanoth
eee), Aimidori (B raehytriehi)
a) S synechocystis
tis), etc., and by selecting and using vectors or expressible DNA fragments suitable for each host, transformed cyanobacterial cells can be prepared.

The production of recombinant plasmids or expressible DNA fragments from a DNA sequence encoding the subject polypeptide and a suitable vector or DNA fragment can also be carried out using well-known techniques in genetic engineering. For example, the following documents: (1) T. ManiaLis et at.
Mo1ecular Cloning-a Labo
ratory Manual-ColdSpring
Published by Harbor Laboratory, (2)
L, G, Davis et at, Ba5ic.
Methods in Molecular Biol
ogy, published by Elsevier (3) Ray Wu
et al., Methods in Enzym
ology.

101, published by Acade+mic Press, etc., by the method described in the experimental book.

For example, a gene encoding the polypeptide chemically synthesized into an appropriately selected vector or an expressible DNA fragment, a DNA fragment containing a gene regulating gene expression, a combination of
The desired recombinant DNA can be obtained by correctly integrating the ltDNA fragment. Its outline is shown in attached Figure 1. D.N.
The order in which the A fragments are linked is not particularly limited as long as the structure of the recombinant DNA finally obtained is the desired one.

The recombinant plasmid or expressible DNA fragment thus obtained is used to transform the above-mentioned cellulose algae.

Transformation of a host with the obtained recombinant DNA can be performed by methods known per se.

For example, a large number of publications on genetic manipulation include (1)
Takagi Touta et al., “Gene Manipulation Manual” published by Kodansha, (2) Takagi Touta et al., “Gene Manipulation Experimental Method” published by Kodansha, (3) T, ManiaLis et al.
Mo1ecular cloning-a Labo
ratory Manual-ColdSpring
Published by Hart+or Laboratory, (4)
L, G., Davis et al., Ba5i
c Metbodsin Molecular Bio
This can be carried out in accordance with the method described in experimental books such as Logic, published by Elsavier.

For example, p with a DNA sequence encoding b-SOD
KK223-3 is introduced into Anarchisteis nidulans by electroporation and transformed. After selecting the transformants based on ampicillin resistance or the like, it can be confirmed by immunoblotting that the desired transformants have been obtained.

The transformant thus prepared is cultured under irradiation with light in a known medium suitable for the growth of host cells, thereby allowing expression of the polypeptide of the present invention. Preferably, the medium contains appropriate amounts of steel and/or zinc ions.

In the case of Anarchisteis nidulans, the medium is B.
G-11 medium, MDM medium, etc. are suitable, and the culture temperature is generally 10 to 30°C, preferably around 25°C, the pH is usually in the range of 7 to 8, and the luminous intensity is 1000°C. A range of ~3000 lux is suitable. Cultivation can be carried out for about 5 to 20 days under such conditions.

In addition, the culture is performed by standing still or under stirring. Induced synthesis may be performed by adding 1-2 mM isopropyl-β-D-thiogacladopyranoside (IPTG) during early logarithmic growth phase.

After culturing, the produced polypeptide of the present invention can be collected by a method known per se. For example, after culturing, cells are collected by centrifugation, disrupted, and then processed using commonly known methods such as salting out, precipitation, ion exchange chromatography, gel filtration chromatography, chromatography, hydro7 orbital The subject polypeptide can be separated and recovered by appropriately combining operations such as lactation chromatography, affinity chromatography, and electrophoresis.

The polypeptide produced in this way can be used as a medicine or cosmetic for the treatment, treatment, or prevention of diseases involving active oxygen, such as chronic rheumatoid arthritis, osteoarthritis, disorders caused by radiation/ultraviolet irradiation, and blood circulation disorders. It can be used for fees, etc.

Next, the present invention will be explained in more detail with reference to Examples.

Example 1 [1] Chemical synthesis of h-3OD gene (I-1) Synthesis and purification of oligonucleotide 1
The 17 oligonucleotides (35b to 61b) were separated into 7 fragments (see Figure 2) using a DNA synthesizer 380.
A (manufactured by Applied Biosystems Japan) was used to perform mari synthesis using the phosphoramidite method. Add 2m12 of ammonia water (
27% or more) was added every 5 minutes in 0°5-minute increments, and the oligonucleotide was cut out from the silica support and collected in a vial.

Add another 1 Ild of ammonia water to this vial,
Seal with cap and loose film etc. and heat to 55℃
The mixture was heated for 8 hours or more to remove the protecting group (acyl group) from the base moiety. The vial was taken out from the thermostatic bath and returned to room temperature, then the cap was removed and the solution was concentrated to dryness under reduced pressure. After drying, the residue was dissolved in 200μQ of 0.01M triethylamine-acetic acid solution (TEAA).

pH 75) and analyzed by HPLC using an AM-313-ODS (manufactured by Yamamura Kagaku Kenkyushin) column.
．． Elution was performed using a concentration gradient of 1M TEAA, and the main beak was collected. After concentrating the separated main beak to dryness under reduced pressure, 80% acetic acid (acetonyl solution)
00 μQ was added, mixed, and left at room temperature for 30 minutes to remove less than 5' dimethyltrityl (DMTr) and convert it into an OH group. After 30 minutes, it was quickly dried and the residue was dissolved in 0.01M TEAA CpH7,5)20
Dissolve in 0μQ, add an equal volume of diethyl ether,
The MTr group was extracted and removed. This solution was concentrated to dryness under reduced pressure, and then 110 PQ of 0. OIM TEAA(
pH 7.5) and fractionated using HPLC again.
Refined. After drying the solution containing the fractionated oligonucleotide under reduced pressure,
It was dissolved in EDTA solution (TE, pH 8.0) and used in the following experiment.

(X-2) Phosphorylation of synthetic oligonucleotides with kinase The purified oligonucleotides were phosphorylated at the 5' end of No, 1, and No. 17 located at the 5' end of the full-length human SOD gene. Ta. 4μg of each oligonucleotide was added to 50mM Tris-HCl-10mM MgCQ.
zO, 1mM EDTA-5mM dithiothreitol (DTT)-0, 1mM spermidine-1,7, uMA
Mix with 120 pQ of TP solution (pH 7,6), add T, 9 units of polynucleotide kinase (manufactured by Takara Shuzo Co., Ltd.),
Incubated for 15 minutes at 37'O. Next, ATP was added to a final concentration of 1 mM, 9 units of T, polynucleotide kinase were added again, and the mixture was incubated at 37°C for 25 minutes. After the reaction, T polynucleotide kinase was inactivated by treatment at 90°C for 5 minutes. Add an equal volume of phenol to this solution, stir, and then turn the mixture at 15,000 rpm.
After centrifugation at 4°C for 2 minutes, water was collected. Add an equal volume of chloroform-isoamyl alcohol (24:l) to this aqueous layer.
was added, stirred, and centrifuged to extract and remove phenol. Add 3M sodium acetate (pH 4) to this aqueous layer.
,8) Add j-r and 2.5 volumes of ethanol, -20
It was left at ℃ for more than 2 hours. Precipitate at 15000 rplT
The cells were collected by centrifugation at 4°C for 17 minutes, washed twice with 70% ethanol cooled at -20°C, and the alcohol content was removed under reduced pressure. The residue was dissolved in 10μQ of 10mM Tris-HCl-1g.
It was dissolved in aMEDTA solution (TE, pH 8,0) and used in the next experiment.

(I-3) T, ligation of synthetic oligonucleotides using DNA ligase (preparation of DNA block!-V) For full-length gene synthesis, 17 oligonucleotides were divided into 5 blocks (IV), T, They were ligated using DNA ligase (see Figure 3).

Oligonucleotide 1 located at the 5' end of each upper and lower strand among the oligonucleotides constituting each block
．． 5 μg 1 μg of other oligonucleotides in 50 m
M Tris-HCl-10mM M gCQx warm solution pH 7
, 6) mixed in 80μα. This solution was heated to 90°C for 5 minutes, then slowly cooled to 4°C over 2 hours, and
M dithiothreitol (DTT) and lOmMATP at 1
0 μQ each was added, and 2.5 units of T and DNA ligase (manufactured by Takara Shuzo Co., Ltd.) were added and incubated at 4° C. for 15 hours.

The reaction solution was treated with an equal volume of phenol, and extracted with chloroform twice to remove phenol. Three times the volume of n-butanol was added to this solution, stirred and concentrated by centrifugation, and the remaining n-butanol was extracted and removed with chloroform. Add X volumes of electrophoresis markers (0.25% bromophenol blue, 0.25% xylene shear tool, 3
0% glycerol) and loaded on an 8% polyacrylamide gel, 89mM Trisborate-2mM EDTA
(TBE, pH 8,0) buffer solution f200V, electrophoresis was performed for 4 hours. After electrophoresis, the gel was immersed in a 0.5 μg/mQ ethidium bromide solution (in TBE) for 15 minutes.
DNA staining was performed. The stained gel was placed on a transilluminator, and a band containing the target DNA was cut out by applying ultraviolet light.

This gel was placed in a disposable syringe for 5T1111, an 18G needle was attached, and the gel was crushed into pieces by pushing it out from the needle tip. 1゜5m12 of finely crushed gel
Add 20n+M Tris-HCl-1,5mM EDTA solution (pH 8,0) 500
The DNA of interest was extracted by adding μQ and soaking at 37°C overnight. Triethylamine was added to the extract so that the final concentration was 10mM, and 0.1M) lithium-hydrochloric acid-1
0mM) ethylamine-1mM EDTA solution (p
Cartridge for nucleic acid purification equilibrated with H7,7)
DNA was adsorbed by passing it through 5orb20 (manufactured by Dupond). 311IQ 0 in the cartridge
．． 1M Tris-HCl-IMEDTA solution (pH 7,7) $
After washing with 5 and sterile water, the DNA was eluted as a 50% methanol (for high performance liquid chromatography) solution. After the eluate was concentrated to dryness under reduced pressure, the residue was dissolved in 10 μa of sterile water.

(I-4) Ligation of blocks using T4 DNA ligase - Production of full chain length gene The five DNA blocks ligated in (1-3) above (■,
■, ■, ■, ■) as shown in Figure 3.
They were ligated using NA ligase to create a full-length human SOD gene.

0.5μg each of 2 adjacent blocks at 5QmM
) Liss hydrochloric acid-10mM M g CQx bath solution pH 7
.

6) After mixing at 40 μa and incubating at 37°C for 30 minutes, the mixture was slowly cooled to 4°C for 30 minutes.

To this solution, 5 μα of each of loOmM DTT and lOmMATP were added, and 10 units of T and DNA ligase (manufactured by Takara Shuzo Co., Ltd.) were added and reacted at 4° C. for 15 hours. An equal volume of phenol-chloroform-isoamyl alcohol (25:24:l) was added to this reaction solution, stirred, and centrifuged to obtain an aqueous layer.

An electrophoresis marker was added to the tail, placed on a 6% polyacrylamide gel, and electrophoresed with THE buffer at 200V for 6 hours. After electrophoresis, the gel was stained with ethidium bromide, and the desired D
Cut out the NA band. From the cut out gel (1-3
) DNA was extracted and purified using Nen5orb20.

(1-5) Cloning of full chain length gene 1) Approximately 1μg of full chain length human SOD gene is cloned into 120μQ of 53m
M Tris-HCl - 10mM M gCQx -0.1m
M EDTA-5mM DTT-0, 1mM spermidine-1, mixed with 7°C M ATP solution (pH 7,6), T4 polynucleotide kinase (manufactured by Takara Shuzo Co., Ltd.)
9 units were added and incubated at 37°C for 15 minutes. Next, ATP was added to a final concentration of 1 mM, T and polynucleotide kinase 9 units were added again, and the mixture was incubated at 37°C for 25 minutes. After the reaction,
After adding equal amounts of phenol:chloroform:isoamyl alcohol (25:24:l) and stirring,
An aqueous layer was obtained by centrifugation at rpm for 2 minutes. An equal amount of chloroform was added to this aqueous layer, and the remaining phenol was extracted and removed by stirring and centrifuging. A tail volume of 3M sodium acetate (pH 4,8) and 2.5 volumes of ethanol were added to this aqueous layer, and the mixture was left at -20°C for 2 hours or more.

The precipitate was collected by centrifugation at 1500 rpm for 7 minutes at 4°C and washed twice with 70% ethanol cooled to 20°C, and the alcohol content was removed under reduced pressure. In this way, a 0°8°Cg phosphorylated human SOD gene was obtained, dissolved in 40 μa of TE, and used in the next experiment.

2) 30 ng of phosphorylated human SOD gene and 280 ng of puc13 cut with restriction enzymes, 141ndllT, and BallHI were mixed in 7-5 μc of 0.1M Tris-HCl-5mM MgCQz solution, and 60p
Q's T akaraligation K it (
Solution A (manufactured by Takara Shuzo Co., Ltd.) was added and stirred well. 7 in this solution
．． After adding 5ttQ of ligation K iLB solution and stirring well, incubation was performed at 16° C. for 30 minutes. After the reaction, this solution was converted into E.

It was used for the transformation of Eoli JM109 strain.

3) pUc1340ng with human SOD gene inserted
(10pQ') with 50mM CaC (2, treated E
.

Cell suspension 200/JI2 of coli JM109 strain was added and mixed gently. The mixture was incubated in ice water for 30 minutes, and then further incubated at 42°C for 3 minutes to incorporate the DNA into the cells.

Add 1 ml of 2 X Y TmediuIl to this suspension.
l (15g/Q Bactodryptone, lOg/Q yeast extract, 5g/Q NaC (1) was added and incubated at 37°C for 1 hour with shaking. This cell suspension was incubated at 25.50.100 ,200 and 400/71
2ε2XYT agar medium (50μg/+mff ampicillin, 40n+g/Q5-bromo4-chloro-3-indolyl-β-D-thiogalactoside (X-gal)
, 23.83 mg/Q inglovir-β-D-thiogalacitoside (IPTG) containing 1.5% agar). The plate was incubated at 37°0 for 24 hours and the resulting white colonies were placed on fresh 2XYT agar (ampicillin, X-gal, IPTG, 1.5
% agar) and cultured overnight at 37°C.

The isolated white colonies were added to 2 mQ of 2YT solution medium (50
Contains μg/mQ ampicillin) with platinum loops 3
Cultured overnight at 7°C. Transfer 1 m+2 of the culture solution to a 1.5 volume Etsubendol 7 tube, and adjust to 1500 Orpm.
Cells were collected by centrifugation for 30 seconds. Collected cells to 1+++
Q's SET buffer (20% sucrose, 50%
I! 1M Tris-HCl, 50mFvi EDTA, pH
7°6) and washed by centrifugation at 15,000 rpm for 1 minute. This cell was again treated with 150μQ of 5ETbuff.
RNase solution (10 mg/L).
- Ribonuclease A (manufactured by Sigma), 0.1M sodium acetate, 0.3mM EDTA, pH 4.8) were added and thoroughly mixed using a portex mixer. 35 for this
0 μa of lysing solution (1% SDS, 0.2 N NaOI4) was added and gently stirred by inverting the tube to completely lyse the tube. After incubating this lysate in ice water for 10 minutes, 2FiOpQ sodium acetate (pH 4,8) was added, mixed thoroughly, and further incubated in ice water for 30 minutes.
It was left for 0 minutes.

This mixture was centrifuged at 15,000 rpm+ at 4°C for 10 minutes to remove SDS and chromosomal DNA as a precipitate. Place the upper groove in another Eppendorf tube with SL, add an equal amount of Improper Tool, mix well, and mix at 15,000 rpm.
The plasmid DNA was precipitated and collected by centrifugation at 4°0 for 7 minutes. The precipitate is dissolved in the seedlings and a portion is added to the control enzyme Hind.
lll, BamHI treated, 1.2% agal-ose
After gel electrophoresis, a 475 bp DNA fragment was identified as pUC1.
I confirmed that it has been installed in 3. The recombinant plasmid thus obtained is named pUC13-h-5OD.

■. Construction of h-S OD expression vector (11-1) h
Preparation of -3OD gene pUCl 3-h-9OD DNA was prepared by 5DS-alkali method and cesium chloride edidium bromide equilibrium density centrifugation method (B, PerbaLA).

Practical Ga1de to Mo1
ecular Cloning140-144, J
ohon W 1ley and S onsI
It was prepared in large quantities by the company (Published by NC, Inc.). Prepared pUC1
3-h-5OD DNA 80ttQC40pg)
and 5X H1ndlu cleavage buffer (50mM Tris-HCl, 35mM MgCO2, 300+nM
NaCQ.

pH7,5) 30μl! Ten Ebbendorf tubes (for 1.5 m12) were prepared by adding water to 80 units of Hindll (manufactured by Takara Shuzo Co., Ltd.) and made to 150/7Q, and the reaction was carried out at 37″0 for 3 hours.After the reaction, phenol: Aroform (181), a chloroform-treated sample, a round volume of 3M sodium acetate (pH 4,8), and 2.5 volumes of ethanol were added and left at -20°C for more than 2 hours.The resulting DNA precipitate was heated at 15,000 rpm. .

After centrifuging at 4°C for 10 minutes and washing with 70% ethanol,
It was dried under reduced pressure. Dissolve the residue in 550μQ sterile water,
110 μα was dispensed into 5 tubes. A 5X EcoRI cutting buffer (250m) is attached to each tube.
M Tris-HCl, 35mM MgCl2! , 500mM
NaCQ, 35mM 2-mercaptoethanol, 0.05% bovine serum albumin) 30μff and Ec
Water was added to 100 units of oRI (manufactured by Takara Shuzo Co., Ltd.) to make 150 μQ, and the mixture was reacted at 37° C. for 3 hours. After the reaction,
DNA was recovered by phenol:chloroform (l:l) treatment and ethanol precipitation.

Target h-3OD gene (HindI[-EcoR
(approximately 500 bp) was separated by electrophoresis using a 2% agarose gel, and then separated using a nucleic acid purification cartridge Nen5.
It was purified using orb20 (Dupond).

■-2,) (ilcll-Hindl [[Fragment of synthetic leather S
hine D algarno (S/D)
Four oligonucleotides (see Figure 4) for the synthesis of the expression control region containing the sequence were chemically synthesized by the phosphoramidite method and purified by high performance liquid chromatography. T at 5' end, polynucleotide kinase and ATP
Phosphorylated with c, 1.53 μg, c.

1.83 μg, Vl O, 73 μg, V2 0.
56/Jg to 80pQ 50mM Tris-HCl-IQmM
Mixed with MgCQ2 solution. This solution was heated at 90°C for 5 minutes, then slowly cooled to 4°C over 2 hours, and 100mM
Add dithiothreitol and 10mM ATP in an amount of 1Oμα, and then add T and DNA ligase (manufactured by Takara Shuzo Co., Ltd.) 2
．． 5 units were added and incubated at 4°C for 15 hours. The reaction solution was treated with 7 enol:chloroform and chloroform, and the DNA was recovered by ethanol precipitation.

(n-3) h-5OD gene (H1ndI[I-E
coRI) and synthetic skin DNA fragment (Hincl[-Hln
Synthetic skin DNA fragment (Hincn-H
lndlll) 0.6 ttg and h-S OD gene 4.1℃g in 50mM Tris-HCl-10mM MgC
121-10mM dithiothreitol-11M AT
P solution (pH 7.

6) and added 3 μn and 1 L of T and DNA ligase to give a total volume of 20 μa. This reaction solution was incubated at 10°C for 15 hours, and then heat-treated at 65°C for 1 hour to stop the reaction. The desired DNA fragment (approximately 570 bp) was separated by 2% agarose gel electrophoresis, and DNA purification was performed. Purification was performed using a commercial kit Geneclean@ (manufactured by B10101).

(If 4) Regulation of tac promoter gene L
Vector pKK for colonic expression with ac promoter
223-3 (purchased from Pharmacia) was prepared in large quantities by the 5DS-alkali method and the cesium chloride-ethidium bromide equilibrium density gradient centrifugation method. pKK223-3DN
A solution 3ON4 (80itg DNA), 5XBa
o+HI cleavage buffer (50IIIM Tris-HCl,
35mM MgCI21.5゜OmM NaCL
I 0mM 2-mercaptoethanol, 0.05%
Bovine serum albumin, pH 8,0) 40ttQ and Ba
Ten Etsupendol 7 tubes were prepared by adding water to 240 units of mHI (manufactured by Takara Shuzo Co., Ltd.) to make 200 μQ, and reacted at 30'O for 3 hours. After the reaction, the mixture was treated with phenol:chloroform and chloroform, and the DNA was precipitated with ethanol and recovered. Target DNA fragment (269bp
) was separated by 2% agarose gel electrophoresis, the DNA was electrically eluted from the gel, and the DNA was transferred to a nucleic acid purification cartridge N.
It was purified using en5orb20 (manufactured by Dupond).

8 μg of the purified DNA fragment was added to 5X Hincl [cleavage buffer (50 mM Tris-HCl, 35 mM Mg
CL300mM NaCQ, 35a+M2-
Mercaptoethanol, pH 8,0) 9. uffi and HinclI (manufactured by Takara Shuzo) 30 units H!
O was added to make the thickness 45 μm 2 , and the reaction was carried out at 37° C. for 2 hours. After the reaction, the target DNA fragment (191b
p) was isolated and purified using Nen5orb20.

(II-5) tac promoter gene (BamH
I-HlncI[) and Hinclr-EcoRI fragment tac promoter gene (191bP) 0.5. ug
.

1.5 μg of H1ncl[-E coRI fragment at 10 mM
) Liss hydrochloric acid-1mM EDTA-300mM Na
Mix with CQ solution (pH 8,0) 9.68#Q, Ta
Kara ligation kit (Takara Shuzo) 9.68 μg of Solution B was added and reacted at 26° C. for 1 hour. After the reaction, the DNA was collected by ethanol precipitation. The obtained DNA was diluted with 20EQ of BamHI cleavage buffer (lo+nMh Lis-HCl, 7IIIMMgCQ2, l
OOmM NaCff, 2111M 2-mercaptoethanol, 0.01% bovine serum albumin, pH 8,
0), add unit, s to BamHI, and add 30
The reaction was carried out at ℃ for 2 hours. After the reaction, the reaction was stopped by heat treatment at 60°0 for 10 minutes.

(n-6) Alkaline 7 male 7 atase treatment of plasmid (pKK223-3) Approximately 43
5011 of 100μa of 20bp DNA fragment 10μs
Mix with IM Tris-HCl (pH 8.0") and add 10 μQ of alkaline 7-osbuatase solution (0.5 unit S alkaline phosphatase (manufactured by Takara Shuzo Co., Ltd.), 10 mM
Liss hydrochloric acid, 50mM NaCQ, l
Add IIIM Zn5O (pH 7,5),
Incubate for 1 hour at 37°C. After the reaction, 1 more
Add 0 μQ of alkaline 7-osphatase solution and incubate for 15 min at 65°C, add 2pQ of 250 mM E
DTA was added to stop the reaction. The DNA was precipitated with ethanol and collected to give a concentration of 0.2 μg/μa in lQmM Tris-HCl-1 + nM EDTA (TE, pH 8,0).
and used in the next experiment.

(II-7) pKK233-3 and BamHI-BamH
I (promoter and h-S OD gene) linked BamH1-BamHI 7 fragment (prepared in ■-5) 5ODg, pKK223-3 (prepared in IN-6) 280 ng was mixed with l l, 4 pQ of TE,
Takara ligation K of 5.6pa
It A solution and 8 solutions of 11° 4 μQ were added and reacted at 16° C. for 2 hours.

After the reaction, this solution was used to transform E. eoli 1M105 strain.

IIl, large scale preparation of pKKh-5ODlO (Il
l-1) E. coli JM10 with pKKh-5OD 10
Transformation of 5 strains LB medium (10 g Baeto tryptone, 5 g Baeto yeast extract, 10 g
Escherichia coli JM105 strain cultured with NaCQ) to O, D, 6 O0 = 0.3 to 0.5 was incubated at 800 Orpm.
Collected by centrifugation for 5 minutes at 4°C and diluted with 25 mL of 10mM
Washed with NaCQ. After washing, cells were suspended in 25ml of cold 50mM CaCQ2. This suspension was left in ice water for 20 minutes, and then the cells were immediately centrifuged (
500Q rpm, 10 minutes). The collected cells were gently suspended again in 5ml of cold 50mM CaCL and cooled with water for 4 hours to obtain competent cells. 5ODg in 200μQ of this competent cell suspension
I) Add KKII-SOD 10, 60 at O″0
The vector was incorporated into the cells by heat treatment at 42°C for 2 minutes. In this cell fluid, 2-1-B
After adding the medium and culturing with shaking at 37°C for 1 hour, 50/J
2YT agar containing g/mQ of ampicillin (1
5g Baeto tryptone, lOg Baeto
Yeast extract, 5 g NaCQS 1.5% agar) was plated and cultured overnight at 37°C. Plasmids were prepared from the colonies thus obtained, and restriction enzyme map analysis confirmed that they contained the desired plasmid.

IV, h-5OD gene blue-green algae A naey
Expression by S. stisnidulans 6301s R2 (IV-1) A, n1dulans6
301 (SynnechocoeussP CC6
301) and R2 strain (Synneehoeoeuss P CC7942
) Transformation using 7511IQ liquid medium (BG-11)
Cells cultured for 1 day are collected by centrifugation at 8000 rpm for 5 minutes and transferred to fresh 75rnQ medium. This is cultured for 1 to 3 days under light irradiation. The cells were collected by centrifugation at 800Q rpm for 5 minutes and treated with 1mM llepes (pH 7).
, 0) 20 apical Q and io+d, and centrifugal washing with 5 ml of transformation buffer (272II+M sucrose, 3 mM potassium phosphate (pH 7-4), 15% glycerol). The resulting cell pellet was transformed with buf for transformation.
The cells were suspended in fer and adjusted to a concentration of IO" cells/m0 or more (preferably 2 X IO" cells/mQ), and used as a sample for transformation.

Transformation was performed using Tsushima Seisakusho's cell fusion device S S H-1.
This was done by the electroboration method using

Dispense 50 μα of the sample prepared above into Etzbendorf tubes and cool on ice. Add 1 to 2 μQ of DNA solution (pKK to a final concentration of 20 to 30 μg/mQ) to this.
h-5ODIO dissolved in TE buffer) was added,
After stirring, transfer to an electrochamber. Immediately for 500μsec.

7. Apply pulses at 5 kV/cm to remove DNA.
be taken up into cells. Transfer the pulsed cells to BG-11 medium (1,9+n12) and culture with shaking in the dark for one night.
-11 agar medium (1mM Na,S,0,.1,o
Pg/mff ampicillin, containing 1.5% agar)
The seeds are sown for 7 to 10 days under light irradiation (2000 lux). Once colonies appear, they are transferred to a new agar medium and the expression of h-SOD is examined.

Composition of this BG-11 medium (in 112) NaNO, 1.5g Kz HP O440mg Mg5017 Hzo 75mgCaC (
2,・ 2 HIO36mg EDT A 1m
gNa2CO35ng Ammonium iron citrate 6mg Citric acid 6mg Hs B Os 2-86mgM
nCff, ・4H,01,81mgZn5O,・7
HzoO, 222mgNa, MoO1
2H! 0 0.021+ogCuSO15Hz
o 0.08mgCo (N Ori! ・6
Hzo 0.0295mg (IV-2)
Detection of h-S OD 1mM isopropyl-β-D-
Nitrocellulose membrane impregnated with BG-11 containing thiogalactoside (IPTG) (manufactured by Amajam Co., Ltd., Hyb
ondC) and cultured for one day under light irradiation.

After culturing, the peeled nitrocellulose membrane was soaked in 0.3% H,O.
, for 20 minutes to deactivate endogenous peroxidase. Furthermore, this film is 0.5
% glutaraldehyde, 0.05% Nonidet P-40
Proteins on the membrane were immobilized by treatment with lomM PBS containing PBS at 4° C. overnight.

h-5OD in the A, n1dulans protein immobilized on the membrane was detected with an enzyme antibody using anti-human SOD. The above membrane was soaked in 5% skim milk, TBS containing 0.1% Tween 20 (20mM Tris-HCl, 0.9% Na).
Cff1 pH 7,4) at 37°C for 2 hours. This membrane was washed with a washing solution (TBS containing 0.1% BSA) for 15 minutes (5 minutes x 3), 1/1000 anti-h-3OD (Goat IgG GS Binding 5ite), 1% BS
A and incubate for 2 hours at room temperature. Next, after washing the membrane in the same manner, 1/1000 peroxidase anti-goat IgG (manufactured by Cappe 1), 1% BS
The cells were incubated in TBS containing A for 2 hours at room temperature. After washing the membrane with washing solution for 20 minutes (5 minutes x 4), 10 mg
Diaminobenzidine (DAB) 15μ (l of 32% H2
40 mQ of 0.1 M Tris-HCl (pH 7,
4).

As a result, 23 colonies out of 100 were stained brown, confirming the expression of h-SOD.

[Brief explanation of drawings]

Figure 1 is a diagram of the manufacturing process for preparing a recombinant plasmid, Figure 2 is a diagram of the base sequence of the DNA fragment of the h-S OD gene in the chemical synthesis of the gene, and Figure 3 is a diagram of the DNA fragment of the h-S OD gene.
FIG. 4 is a process diagram showing a method for producing an OD gene, and FIG. 4 is a process diagram for synthetic skin of the expression regulatory region.

Claims (1)

[Claims] 1. D encoding a polypeptide having an amino acid sequence substantially identical to human superoxide dismutase
A method for expressing the above-mentioned polypeptide in cyanobacteria cells, which comprises culturing in a medium a cyanobacteria cell transformed with a recombinant plasmid or an expressible DNA fragment into which an NA sequence has been introduced.