JPH03123486A - Genetic engineering production process of membrane protein - Google Patents

Abstract

NEW MATERIAL:A cartridge gene produced by dividing a gene constituting a membrane protein into plural cartridge genes corresponding to plural polypeptides having helix structure and using one or adjacent two or more of said divided cartridge genes as constituent genes. EXAMPLE:The octopus rhodopsin gene coding the amino acid sequence of formu la and having cutting sites of restriction eznymes SphI, MluI, NdeI and NheI. USE:Genetic engineering production of membrane protein. PREPARATION:Octopus rhodopsin (OR) fragment gene synthesized by a solid- phase DNA-chain extension reaction using phosphor-amidite process is linked to a DNA linker T4 DNA ligase.

Description

[Detailed Description of the Invention] [Industrial Application Field] The present invention relates to a method for producing membrane proteins, partial structures thereof, and modified molecular structures thereof by genetic engineering, and in particular,
The present invention relates to a chemically synthesized gene corresponding to rhodopsin (hereinafter abbreviated as OR), an expression vector containing the same, Escherichia coli carrying the expression vector, and a method for producing OR by culturing these.

[Conventional technology]

A wide variety of membrane proteins exist on the cell membranes that make up living organisms, and are responsible for the acquisition of energy necessary for cells to survive, the permeation of substances, the characterization of cells, and the legacy of chemical information between cells. It controls functions such as picking. Examples include proton pumps, ion channels, and receptors. By exploring the physical properties and functions of these membrane proteins, we can elucidate the mechanisms of chemical information transmission in the body, investigate the causes of diseases, develop treatments, and even modify the functions of membrane proteins by modifying their molecular structures. Genetic engineering production of these membrane proteins is necessary to actively advance the development of new types of biosensors.

In fact, in recent years, attempts have been made to produce hormone receptors and the like in cultured cells using genetic engineering and cell engineering techniques. For example, a chimera of adrenergic receptors was expressed in African frog oocytes (Kobilka et al.

5science, 240. pl), 1310-1316
(1988)). In these methods, the main purpose is to elucidate the physiological functions of hormone receptors, etc., so they do not place emphasis on mass production of membrane proteins. Therefore, the gene encoding the amino acid sequence of the membrane protein is derived from cDNA obtained from the sample cell.

On the other hand, among a series of photoreceptors, Khorana et al.
Bacteriorhodopsin (hereinafter abbreviated as BR, Na5sal et al.
, J. Biol.

Chem, , 262. No, 19. pp, 9
264-9270 (1987)) and bovine rhodopsin, which is present on the retina of cows and plays a central role in vision as a light receptor (Ferretti et al., P
roc, Natl, Acad, Sci, US^, 83
．． We aim to completely synthesize the gene corresponding to the amino acid sequence of E. coli, pp. 599-603 (1986), and to elucidate its large-scale synthesis and function within Escherichia coli. but,
Even though rhodopsin is the same, there have been no reports regarding genetic engineering production of OR.

[Problem to be solved by the invention]

There are two problems that the present invention attempts to solve. First, the first
The point is that it is a method for mass production of membrane proteins, especially OR. Among the above-mentioned known techniques, in particular, when using cDNA, sufficient consideration must be given to ensuring that the base sequence of the gene used has a high translation efficiency in the host cell, and to using an expression vector with high expression efficiency. However, there was a problem in that it was difficult to make E. coli produce membrane proteins easily and in large quantities (Dunn et al., + J.
Biol, Chem, 262 No. 19. pp,
9246-9254 (1987)).

The first objective of the present invention is to chemically synthesize an OR gene with high translation efficiency into a polypeptide, and then to link the chemically synthesized OR gene to an expression vector that is stable and has high expression efficiency in E. coli cells. The object of the present invention is to provide a method for efficiently producing OR by a genetic engineering method by introducing the expression vector into E. coli and then culturing E. coli carrying the expression vector.

The second problem to be solved by the present invention is a method that facilitates the genetic engineering of membrane proteins, that is, the modification of their functions, the construction of chimeric molecules, and the like. Membrane proteins such as BR have a structure of multiple helices penetrating the cell membrane (7 in the case of BR and OR), which has been strongly conserved during molecular evolution.
It is assumed that books) are characteristic. Therefore, genetic recombination using the helix structure as a unit, production of chimeric rhodopsin by fusion with rhodopsin from other species, etc. are considered important in protein engineering research on rhodopsin. As mentioned above, Khorana et al. are aiming for protein engineering such as functional modification of BR, which is a type of membrane protein, through amino acid substitution etc.
hl et al,,J,Biol,Chem,+2
63+No, 25. pp, 13594-13601 (
(1988)), we are selecting gene codons and expression vectors that are compatible with E. coli in order to efficiently produce BR in E. coli. However, in the method of Khorana et al., no consideration is given at all to the production of helical BRs and the gene structure effective for chimeric BR production at the gene design stage.

The second purpose of the present invention is to not only produce the entire polypeptide chain of a target membrane protein by genetic engineering, taking the production of OR as an example, but also to utilize the structural characteristics of membrane proteins to improve the physical properties of membrane proteins. It is an object of the present invention to provide a genetic engineering production method for membrane proteins, which is characterized by facilitating protein engineering handling that is effective for functional analysis and functional modification.

[Means to solve the problem]

The present invention consists of dividing a gene constituting a membrane protein into a plurality of cartridge genes corresponding to a plurality of helical polypeptides, and creating a cartridge gene consisting of one type or two or more adjacent types.

A specific example of the membrane protein is octopus rhodopsin.

Further, the present invention resides in the octopus rhodopsin gene encoding the following amino acid sequence and having 5 phr, old ul, Ndel and Nhel restriction enzyme cleavage sites.

Met Val Glu Thr　Trp　Trp tlis Pro His Pro Asp Ala Phe Ile Gly Leu Gly Asn 5er Lys Thr Asn Met Phe Ser　Thr　Thr Tyr Asn Pr.

Trp Ala Lys Val Tyr Tyr Val　Val　Gly Gly Val Val Lys Ser Leu lie Ile Asn Leu Val 85n Thr Val Asp Phe Asp Pr.

Ser Val Gly He lie Gly 11e Tyr Leu Gin Thr Pr.

Leu Ala Met Asp Leu Ser Phe Ser Ala
Ile Asn Gly PhePhe Met
Ser Ile Asn5er Ile A
sp Arg TyrPro Met Ala
Ala SerArg Arg Ala
Phe LeuTrp Met Trp Ser
l1ePro Val Phe Asn Tr
pGlu Gly Ile Leu ThrTyr
Leu Ser Thr Asphr Asn Lys Met Val ty Ser Pr.

Met 81a Val　l1e Lys Met 11e 1ie Trp 5er Ala Tyr Cys 5er Ser　Thr Met Gly Ser Phe Val Val Phe Arg Ile Arg His Val 1y Pr.

Asp Ser His Glu Lys Glu Met Al
a Ala Met Ala LysAla
Lys lie Ser Met Val
Tie Tle Thr G1n1ie Al
a Glu Trp Pro Val His Asn 8 la Glu cly Gry Lys Glu Gin Ala Pro 9r.

Tyr Pr.

Gln　Gly Gin Gly Gin Gly Gln　Gly Gin 81a Leu Val Leu Pr.

Leu Thr Phe 1e Glu Glu Glu Ser Met　Met Gin Gin Pro Gln Pro Gln Tyr Pr.

Tyr Pr.

Ala Pr.

Ala Pr.

Tyr　Gln 81a Pr.

Ala Val Val Arg Ala Ala 1y Ty Pr.

Pr.

Pr.

Pr.

Ala Gin Tyr Lys Tyr Val 8sp Met 8 la Tyr Ala Gin Gin Gin Gin Phe Ala Ala Ser 1y Ala Ser Val 8 la 5er Ala　Ala Met　Gln Tyr　Gln Pro Pr.

Tyr Pr.

Gly Tyr Gly Tyr Vat Glu Gly Val Pr.

Glu ^1a Ser Glu Gin Lys Pr.

1n Pr.

Pr.

Pr.

Ala 8sp ^ “g Memu Met Pr.

1y Pr.

Pr.

Pr.

Pr.

Asn or, An octopus with the following DNA sequence B It's in the Dobusin gene.

ATGGTAGAGTCTACTACTCTACAA
CCCGACCGTCGACATTCGATCCGAT
T CCGGACGCTGTTCATTGGCG
TGGTTGGTATGTGTAGTGAT TTA
CCTGTTCGACCCCGGCT AACATG
TTCAGATCTGTCTT TCTCTGCGA
TCTATCTCTGCTTTCATGAAAAGCA
TGCCAG CTGTACGGCCTTCATGTC
TA TTAACACTATGTTACAACGT
TATCGGCCGTAATGTCTCAT CGTC
GTGCATTGGATGTGGTCTATTGTT
TGACTGGGGTGCGTACGTACCGCTC
TTTCGACTACCTGTCTATTCATCCT
GT GCATGTACTTTCATTATTAT
CGCATTCTGTTGTTTCTAACCATGA
AAAAGCGTCTGAACGCTAAAGAGC
TGGTTAACCAG ACTTGGTGGTCAT
CCGCATT GGGCGA 88 TTT ACT
ACTCTGTAGGTATCCATTGGTATCC
TGGGTAACGTCCAAAACTAAATC
CCTGCATTATCAATCTGGCAATG
TCATAACGGTTTCCCGCTTAAG88A
To ATGGA T TCGGTAAAAGTTGCTG
GGCGG TATCTTCGGTGGCGATGAT
T TCTATCGATCCCGATGGCTG
CTTCTAAAAAATCCTGATGAT CATT
TTCGTGGTCTGTGGGCCCGGTCTTC
8GAAGGGCATCTGACCTCTTGCCGA
TCCGTCCACGCGTTCTCTGTGGCTT
CATGCTGCCGATACTTCAACATC
GTGATGTCA^8TGGCCGCAtoTGGCG
AAACCGTAAAGCA CAGGCGGGTGG Furthermore, the present invention provides a tryptophan regulatory gene in the tryptophan operon derived from Escherichia coli and a trp linked downstream thereof.
A base sequence comprising an L polypeptide translation regulatory base sequence and any of the above genes linked downstream of a DNA sequence corresponding to the N-terminal methionine of the trp L polypeptide;
A tryptophan regulatory gene in the tryptophan operon derived from Escherichia coli, a TRP E polypeptide translation regulatory base sequence linked downstream thereof, and any of the above genes linked downstream of a DNA sequence corresponding to the N-terminal methionine of the TRP E polypeptide; or a tryptophan regulatory gene in the tryptophan operon derived from Escherichia coli, which contains both the TRP L polypeptide translation regulatory base sequence and the TRP E polypeptide translation regulatory base sequence as translation regulatory base sequences, and its downstream. The linked trp L polypeptide translational regulatory base sequence and tr
p D corresponding to the N-terminal methionine of the L polypeptide
The nucleotide sequence includes one of the above-mentioned genes linked downstream of the NA sequence, and downstream of the trpE polypeptide translational regulatory nucleotide sequence and the DNA sequence corresponding to the N-terminal methionine of the trpE polypeptide.

Furthermore, the present invention resides in a transformant obtained by transforming an expression vector host cell obtained by incorporating the above base sequence into a vector such as a plasmid with the expression vector, and the present invention also relates to a transformant obtained by transforming the expression vector into a host cell obtained by incorporating the above base sequence into a vector such as a plasmid. By culturing, membrane proteins,
Preferably a partial structural polypeptide of octopus rhodopsin,
Alternatively, there is a method for producing the entire structural polypeptide.

The present invention will be explained in detail below.

OR consisting of 455 amino acids (Ovchinnik
ov etat,, FEBS Letters,
232. No. 1, pp. 69-72
(1988))'s bitorobacy analysis (Xyte et al.
al,, J, Mo1. Biol.

According to Gesho, 105 (1982)), OR has a seven-helix structure (A,
BC, D, E, F, G). Therefore, the part between the B helix and C helix of the OR that is thought to be exposed outside the cell membrane, similarly the part between the D helix and E helix, the middle between the F helix and C helix, and the part between the G helix and C helix. Separate the molecular structure in the middle of the terminal, and genes corresponding to the partial structures (1-5)
can be constructed. As a result, these five types of gene fragments can be expressed individually to produce OR fragments, or the fragment genes can be linked to produce larger OR fragments. At this time, as shown in FIG. 1, if the individual fragment genes are adjacent to each other and can be linked in all combinations, the individual fragment genes are called cartridge genes. O produced by expressing the linked genes in all combinations
By comparing the functions of R fragments or the entire OR, it becomes possible to elucidate the molecular mechanism, such as analysis of the functional center of OR. Note that the location and method of this fragmentation are not unique. That is, it is possible to express the helical structure in units of a helical structure, and the position of the division cannot be strictly defined. Specifically, it is performed as follows.

The gene base sequence predicted from the OR amino acid sequence information consisting of 455 amino acids is 136×2 +S4X 336X 4164 due to degeneracy in gene codons.
×6']5ζ7 xlO""There are several ways. The genetic DNA of OR enables highly efficient production and effective protein engineering handling. (1) There are many restriction enzyme recognition sites inside the gene to enable the expression of partial structural units of OR. It is possible to divide genes according to the higher-order structure of the OR by setting the Please (geomaterials, cell engineering, 'l-, No,
13. pp, 154]-1552 (1983)),
(3) Is the structure difficult to cause incorrect connections when assembling the entire gene from gene fragments synthesized organically?
After considering whether or not the efficiency of the translation process on liposomes will be lowered due to the tendency of RNA to form secondary structures such as hairpin structures, select one base sequence that is considered to be the most appropriate, and add phosphorus. Organic chemical synthesis was carried out using the oramidite method. This method uses active trivalent phosphorus to bind a binding unit (modified base: phosphoramidite) and then oxidizes it to sequentially form phosphotriesters and synthesize oligonucleotides (Otsuka et al. Modern Chemistry, October issue,
11l), 24-30 (1988), Tokyo Kagaku Doujin). FIG. 2 shows the nucleotide sequence of the organic chemically synthesized OR structural gene, the corresponding amino acid sequence, and restriction enzyme cleavage sites that enable genetic recombination of each partial structural unit. 4
A nucleotide sequence from the restriction enzyme Hpa I recognition site shown in FIG. 8 to the translation start codon was also synthesized as a linker for connecting the gene corresponding to 55 amino acids to the expression vector. On the other hand, two translation stop codons, TAA and TAG, were ligated immediately after the base sequence, and a recognition site for the restriction enzyme BamHI was further provided for ligation to the vector.

FIGS. 3 to 7 show five types of OR cartridge genes that enable expression of each partial structure cleaved by each of the restriction enzymes described above. In other words, these cartridge genes are the genes shown in Figure 2 and the four types of restriction enzymes shown in the figure, 5ph.
It is divided into 5 parts: r, old uI, NdeT, and Nhel, and each can be expressed individually. That is, (1)
Cartridge gene fragment expressing the region (Met 1-Cys 109) containing the first and second helices from the N-terminus of OR (Figure 3(a)), (2) Region containing the third and fourth helices (Ala 108-A
Cartridge gene fragment (fourth
Figure (a)), (3) Cartridge gene fragment expressing the region containing the 5th and 6th helices (Thr 198-Ala 298) (Figure 5(a)), (4)
Cartridge gene fragment expressing a region (Tyr 297-Cys 398) that includes part of the C-terminal region of the 7th helix (Fig. 6(a)), (5) C-terminal region (8la 397-Ala 455) This is a cartridge gene fragment (Fig. 7(a)) that expresses . The 3' end region of these overlaps with the 5' end of the following gene by 2 amino acids, including the restriction enzyme recognition site that separates each partial structure, making it possible to construct the entire OR gene. There are characteristics.

Since each cartridge gene is a long double-stranded DNA, it cannot be synthesized as it is, so it is divided into several single-stranded oligonucleotides of several tens of bases according to a standard method, each is organically synthesized, and then phosphorylating enzyme and ligation are performed. A cartridge gene was constructed using enzymes.

Figure 8 shows the structure of the beginning of the tryptophan operon of E. coli. Tryptophan promoter/operator (
(hereinafter abbreviated as trp Plo) is often used as a strong promoter for the expression of foreign genes;
rpL (leader peptide) gene or trp E
A foreign gene can be expressed by linking it to an appropriate site within the gene in accordance with the reading frame of the gene codons. Furthermore, a foreign gene can be expressed by linking a foreign structural gene via the Shine-Dalgarnow sequence (hereinafter referred to as the SD sequence) using the restriction enzyme Hpar cleavage site in the pre-free box in the operator. .

The expression vector shown in Figure 9: pTRLE has a blunt-ended recognition site for the restriction enzyme EcoRI upstream of the trp Plo shown in Figure 8, and a restriction enzyme tlind [[ A 490 base pair (bp) DNA fragment having a recognition site was ligated between the blunt-ended EcoR1 site and the old ndI[I site of plasmid vector pBR322. The method for producing this vector will be explained using FIG. 9. First, the nucleotide sequence shown in Figure 8 from the 5' end to the Hpa 1 site was recovered from the plasmid containing trpP/Q, and
The region from the pa1 site to the old nd11 site is organically synthesized and then ligated to obtain a DNA fragment of 0.49 Kb (Figure 9(a)). On the other hand, plasmid pBR322 (
After cutting FIG. 9(b)) with the restriction enzyme EcoRI, D
Once blunt-ended with NA polymerase, then restriction enzyme 1
1indTII and cleavage vector No. 911k (C
). The above (a) and (C) are ligated using DNA ligase to create a vector pTRLE containing trp Plo.
(Fig. 9(d)) can be obtained. Furthermore, Escherichia coli H
BIOI or 6600 etc. to the vector pTRL
This vector can be prepared in large quantities by transforming E. and culturing in large quantities. An expression vector containing the OR cartridge gene can be obtained by integrating the OR cartridge gene into the above vector using the cleavage site of the restriction enzyme HpaT or old ndnl. E. coli JI8101 or 0600 is transformed with this expression vector to obtain a transformant. This transformant is cultured in a medium and the OR cartridge gene is expressed in Escherichia coli cells, thereby making it possible to prepare a large amount of OR partial polypeptide or complete OR polypeptide.

〔Example〕

Examples of the present invention will be specifically described below, but the present invention is not limited thereto in any way. The restriction enzymes used in the examples are manufactured by Takara Shuzo Co., Ltd. and New England Biolapse, and E. coli II 8101 is manufactured by Takara Shuzo Co., Ltd.

FIG. 2 shows the amino acid sequence of OR and the nucleotide sequence of the corresponding gene. 0R(7)cD obtained from octopus photoreceptor cells
The base sequence and amino acid sequence of NA are 0vchjnni
Ovchinnikov et at.
FEBS Letters.

232 No. 1, pp. 69-72 (1988
)), a structural gene suitable for chemical synthesis can be designed by referring to the amino acid-gene coton correspondence table.

However, this correspondence is not unambiguous because there is some overlap on the gene codon side. Therefore, the gene codon appearance frequency table by host (Gizai 1.Cell Engineering, vo!, 2Nα13.
pp. 78-89 (1983)) and selected gene codons that appear frequently in E. coli for each amino acid.
First, a full-length DNA base sequence of 1341 bases including a structural gene of 1335 bases consisting only of these and a linker-1 translation stop codon for cloning this into a plasmid was designed. However, in a series of DNA chain elongation reactions (Figure 11) using the phosphoramidite method, which is a known DNA synthesis method, long-chain DNA as shown in Figure 2
cannot be synthesized all at once. That is, even if the yield of the elongation reaction for the base component is 99%, if it is repeated 100 times, the final yield will be about 37%, making purification difficult. Therefore, in reality, the long double-stranded DNA shown in Figure 2 is converted into the long double-stranded DNA shown in Figure 3 (
A'l is divided into five OR fragment genes (OR cartridge genes) that overlap each other by two amino acids as shown in Figure 7(a), and at the beginning of each gene codon for methionine, a translation initiation signal, is inserted into R. At the rear,
Stop codon and restriction enzyme B for introduction into the expression vector
We decided to synthesize OR fragment genes in which linkers of amt (I) were linked. These five sets of OR fragment genes (ORF
I (337bp), 0RP2 (289bp), OR
F3 (313bp), 0RF4 (205bp), 0
RF5 (310bp)) has 12 lines and 10 lines, respectively, as shown in Figure 3(b) and Figure 7(b).

It was divided into a total of 48 blocks of 10, 6, and 10 single-stranded oligonucleotides, each of which was synthesized by a solid-phase DNA chain elongation reaction using the phosphoramidite method.

That is, a nucleotide monomer with a protecting group (Fig. 11 (b)) is linked to 0.2 micromoles of a nucleotide monomer (Fig. 11 (a)) immobilized on a resin in each reaction cycle to form a nucleotide to a predetermined length. was extended.

When creating blocks of this gene fragment, when these blocks are combined into one to create an OR gene, inappropriate interactions such as the formation of a hairpin structure occur within the bronc and between the blocks, resulting in an incorrect structure. The base sequence of each block was optimized to prevent the formation of genes. In other words, it is possible to predict the possible secondary structure of an oligonucleotide and calculate its energy while changing the base sequence little by little, and to find a high degree of homology between the base sequences of multiple oligonucleotides used simultaneously when constructing each fragment gene. In this case, the base sequence of one oligonucleotide was partially changed.

Figure 12 shows the gene of the tryptophan operon shown in Figure 8, which contains an SD sequence below the cleavage site of the restriction enzyme 11pal in the operator, and which contains a methionine gene at the N-terminus of the protein to be expressed at the 3' end. The structure and blocking method of two types of DNA linkers having cohesive ends complementary to codons are shown. These syntheses were carried out according to the conventional method shown in FIG.

Figure 13 shows an example of the procedure for linking blocked oligonucleotides using T4 DNA ligase when the gene fragment (ORFI) shown in Figure 3 is combined with the DNA linker 1 shown in Figure 11(a). Shown as

The reaction followed a conventional method. That is, DNA linker-1 (LINK-1, LINK-2, 20
nmol (approximately 250 μg)), OR fragment gene (ORF
I-1~0RFI-12゜20nmo+ (approximately 350
All ug) were purified by electrophoresis on 8% polyacrylamide gels containing 8M urea.

After recovery from the gel, A z b. Synthesized gene fragment L
INK-1, LINK-2, 0RFI-1~0RFI-
The recovered amount of 12 was quantified. As a result, LINK-1 approximately 1
00μg, LINK-2 approx. 100μg, 0RFI-
1-0RFI-12 was approximately 150 μg each.

Purified synthetic gene fragment LINK-2,0RFI-1~
After phosphorylating the 5' end of each fragment by treating 1 mol of 0RFI-11 with T4 polynucleotide kinase, 1 mol of LINK-1 and 0RFI-
12 and DNA ligase buffer (100mM
Tris-HCl (pH 7,6), 5mM MgCIz
) and heated to 70°C to inactivate T4 polynucleotide kinase and further destroy the higher-order structure of the DNA, and then slowly cooled to room temperature for annealing. These steps are taken to prevent self-concatenation of generated fragments. Next, LINK-1, LINK-2,0RFI-1~0R using 700 units of T4 DNA ligase.
A total of 14 fragments of FI-12 were ligated. Next, the reaction solution was
% acrylamide gel, and 60 μg of a 374 bp DNA fragment, which was considered to have been correctly ligated, was recovered from the gel. This was again treated with 100 units of T4 polynucleotide kinase to phosphorylate the 5' end of the fragment to facilitate cloning into a vector.

Organic chemical synthesis OR fragment gene 10 obtained as above
Expression vector with μg shown in Figure 10: pTRLE (
4,82 kilobase pairs (Kb) using restriction enzymes Hpa I and B
The cleavage vector (4,28Kb) generated by cutting with amH1
) and an expression vector containing the OR fragment gene: p
TRLORF1 (4,66 Kb, Figure 14(a)) was constructed. Similar operations were performed on other OR fragment genes, pTRLO1? F2 (4,61Kb, Fig. 15 (
a)), pTRLORF3 (4,64 Kb, Fig. 16 (a)), pTRLORF4 (4,53 Kb, Fig. 17
Figure (a)), pTRLORF5 (4,63Kb, first
Figure 8 (a)) was constructed. By transforming Escherichia coli with these, ampicillin-resistant and tetracycline-sensitive Escherichia coli HBIOI [pTRLORF1] and the like were obtained. Furthermore, by culturing this in a normal E. coli culture medium, a large amount of OR fragments were stably obtained. This Escherichia coli HB 101 [pTRLORF1] has been deposited with the Institute of Microbial Technology, Agency of Industrial Science and Technology (hereinafter referred to as FERM) as FERM P-11043.

On the other hand, LINK-1, LINK-2, LINK-3, L
A gene fragment obtained by linking DNA linker-2 (Fig. 12 (b)) consisting of INK-4, LINK-5, and LINK-5 with the above gene fragments (ORFI-1 to 0RFI-12) in a similar process. 507bp expression vector:
By inserting pTRLE into a cleavage vector generated by cutting pTRLE with restriction enzymes HpaI and BamHI, an expression vector containing an OR fragment gene: pTREORPl (4,79
Kb, Fig. 14(b)) was obtained. Similarly, pTREO
RF2 (4,75Kb, Figure 15(b)), pTREO
RF3 (4,77Kb, Figure 16(b)), pTR
EORF4 (4,66Kb, Figure 17(b)), p
TREORF5 (4,77 Kb, FIG. 18(b)) was obtained. By transforming E. coli with these, a large amount of OR fragments were stably obtained.

(1) First, OR fragment 1 expression vector prepared in Example 1: pTRLORFl (Figure 19(a)) 30
After cutting μg with 30 units of restriction enzyme sph I, 0
．． Performed 8% agarose gel electrophoresis and obtained 4.45Kb D
The NA fragment (Figure 19(b)) was recovered.

(2) Next, the OR fragment 2 expression vector prepared in Example 1: pTRLORF2 (Figure 19 (C)) approximately 30
After cutting μg with the restriction enzyme Sph r, 6% acrylamide gel electrophoresis was performed to generate a 480 bp [
Sph 1sph I ] fragment (Figure 19(d)) was obtained.

(3) Next, the 2 DNA fragments were mixed with DNA ligase reaction buffer (100mM), lithium-hydrochloric acid (pH 7.6), and 5m
The DNA was dissolved in Mgcl□) and ligated using 700 units of T4 DNA ligase.

(4) E. coli) IB 101 was transformed with approximately 1 μg of the DNA mixture obtained in this way, and 0RFI and 0RF
2 and ligated in the normal order: pTRLORF
E. coli HBIOI harboring l2 (Figure 19(e))
Unintended complex plasmid in which [pTRLORF12], 0RFI, and 0RF2 are linked in reverse order: pTRLO
E. coli tlB harboring RF21 (Figure 19(f))
101 fpTRLORF21] was obtained. Both are 0RF
Distinction was made by comparing the sizes of the fragments produced when digested with the restriction enzyme BgIn, which exists only within I, and the restriction enzyme old ul, which exists only within ORF2.

(5) Next, pTRLOR12 (FIG. 19(e)) was cut and cleaved with restriction enzymes old ul and Bamt ([).

(6) OR fragment 3 expression vector prepared in Example 1
: pTRLORF3 (Figure 16(a)) approximately 30 u
OR gene fragment 3, which was obtained by cutting g with restriction enzymes old ul and BamHI and purified by 6% acrylamide gel electrophoresis.
A 310 bp [M]ul-BamHI] fragment was obtained.

(7) This [old uI-Bam[l I ] fragment was ligated to pTRLOR12 from (5) above to obtain an expression vector, and E. coli 11BIOI was transformed to obtain 0RFI,
A complex plasmid in which 0RF2 and PRF3 are linked in the normal order: Escherichia coli HBIOI carrying ρTRLOR123 [
pTRLORF123] was obtained. This E. coli HBIO
I [pTRLORF123] has been deposited with FIKEN as FEI Microtechnical Research Institute No. 11044 (FERM P-11044).

(8) After that, the same process was repeated twice, and finally a composite plasmid: pTRLORFl2345, i.e., pT
E. coli HB 10 holding RLOR (Figure 18 (powder)
1 cpTRLOR] was obtained. This E. coli 118IOI
[pTRLOR]
ERM P-11045).

(9) DNA linker-2 [LI
NK-1 to LINK-6] was connected to the beginning of the OR gene: pTREOR was also obtained through a similar construction process.

Among the expression vectors prepared in this way, one in which the OR fragment genes are ligated in the normal order (pTRLORFl(
Figure 14(a)), pTRLORF2 (Figure 15(a)), pTRLORF3 (Figure 16(a))
, pTRLORF4 (Figure 17(a)), p
TRLORF5 (Figure 18(a)), pTRLO
RFl2 (Fig. 19(e)), pTRLORF23.
pTRLORF34, pTRLORF45. pT
RLORFl23. pTRLORF234. pTR
L.

RF345. pTRLORFl234. pTRLOR
F2345. pTRLOR (Figure 19 ((to)),
pTREORF 1 (Figure 14(b)), pTR
EORF2 (Figure 15(b)).

pTREORF3 (Figure 16(b)), pTRE
ORF4 (Fig. 17(b)), pTREOR5 (first
8(b)), pTREORPl2. pTREO
RF23. pTREORF34. pTREORF4
5. pTREORPl23. pTREORF234
．． pTREORF345. pTREORPl234.
pTREORF2345. pTREOR) A total of 30 types of expression vectors were all capable of OR fragment or OR expression.

Example 3 OR of and its E. coli HBI
3 ml of one platinum loopful of O1 [pTRLOR] stock strain
1 of M9 medium (HN4C11g, NazHPOn6g
, KHzPO43g, NaC10.5g, CaC
Iz・2Hz00.015g, MgSO4・7l1□
O0.1g, casamino acid 2.5g, glucose 5g, thiamine 0.1g, proline 1g, ampicillin 50
■.

Water 142. pH 7.4) and cultured with shaking at 37°C overnight. Next, 2 mfl of the main culture solution was inoculated into 38 ml of M9 medium having the above composition, and cultured with shaking at 37°C for 4 hours.

After the culture was completed, the bacteria were collected. The method for extracting and regenerating OR from bacterial cells was according to the method of Braimant et al.
ant et al,,J,Biol,Chem,, 2
62. No, 19. pp, 9271-9276 (198
7). An ELTSA assay was performed to confirm the production of OR.

The ELrSA test was performed as follows. (1) First, dispense 50 ul of purified OR (approximately 0.02 mg/d) solution into the wells of an immunoplate (manufactured by Dainippon Pharmaceutical Co., Ltd.), and
"C.

1 hr release. (2) Next, dispense 50 μl of 1% glutaraldehyde, and after 2 ml, wash with PBS buffer.

(3) Dispense 100 μ2 of horse serum-containing pBs buffer into each well and leave it for 1 hour at 37°C. (4) Dispense 50 μp each of OR antibody solution purified from bilidoma culture solution, which is the next antibody. (5) After washing with PBS buffer, add 50 μλ of secondary antibody (biotin-conjugated anti-mouse IgG antibody)
(6) After washing with PBS buffer, dispense 50μ2 each of avidin and biotinylated peroxidase solution, leave for 30ml at 37°C, and then rinse again with PBS 35 buffer. After washing, a substrate solution containing hydrogen peroxide (0-phenylenediamine dihydrochloride) was dispensed in 50 μm portions to develop color.A4
5. The amount of OR produced by genetic engineering was determined by comparison with the results of a test using OR extracted and purified from octopus photoreceptor cells as a sample.

(Effects of the Invention) According to the present invention, Escherichia coli HBIOI carrying the OR gene
[pTRLORFl] and E. coli HBIOI [p
Since one TREORF can be obtained, the E. coli can be cultured and OR can be produced in large quantities. In addition, in the helix unit that penetrates the cell membrane, which is a common structural unit of membrane proteins,
Not only can R fragments be synthesized, but OR partial structures can be produced in numerous combinations, so this method is effective for analyzing the functions of various regions in the OR molecule. In addition, by matching the reading frames of gene codons, it is possible to construct chimeric molecules with rhodopsin molecules from other organisms, or even molecules that have no relation to rhodopsin. It also becomes possible to create proteins with new functions. Furthermore, by applying the present invention to other membrane proteins, it is possible to contribute to the development of protein engineering for membrane proteins.

[Brief explanation of drawings]

Figure 1 is a diagram showing the helical structure of the octopus rhodopsin molecule, Figure 2 is a diagram showing the entire base sequence of the OR gene, the restriction enzyme recognition site, and the corresponding OR amino acid sequence.
Figures 3 to 7 show the correspondence between the base sequences of OR fragment genes synthesized individually and the amino acid sequences of OR, and
A diagram showing a block of oligo DNA actually synthesized by organic chemistry, Figure 8 shows the promoter of the tryptophan operon,
Figure 9 shows the base sequence of the region including the operator (trp Plo), the trpL structural gene, and the beginning of the trpE structural gene. Figure 9 shows the construction of the expression vector pTRLE. Figure 10 shows the structure of the expression vector pTRLE. Figure 11 is a diagram showing the synthesis flow of oligonucleotides, Figure 12 is a block diagram of the base sequence from the trp Plo SD sequence to the N-terminus of the structural gene, and Figure 13 is the procedure for linking oligonucleotide blocks. Figures 14 to 18 are diagrams showing the structures of expression vectors containing various OR fragments, and Figure 19 is a diagram showing the procedure for producing expression vectors for composite OR fragments. A...Adenine, C...Cytosine, G...Guanine, T...Thymine, trp Plo...]-Lyptophane promoter operator, PB...Privnowbox, SD...Shine Dalgarnow sequence, Ap
r: ampicillin resistance gene, Tcr: tetracycline resistance gene, OR: octopus codophysin, 0RFI: 1st octopus codon. Shin 1 prayer piece, DMTr...dimethyltrityl group.

Claims (1)

[Scope of Claims] 1. A cartridge gene consisting of one type or two or more adjacent types, which is obtained by dividing a gene constituting a membrane protein into a plurality of cartridge genes corresponding to a plurality of helical polypeptides. 2. The gene according to claim 1, wherein the membrane protein is octopus rhodopsin. 3. Encodes the following amino acid sequence, and Sph I,
Octopus rhodopsin gene with Mlu I, Nde I and Nhe I restriction enzyme cleavage sites. [There is a gene sequence] [There is a gene sequence] 4. The gene according to claim 3, wherein the octopus rhodopsin gene consists of the following DNA sequence. [Gene sequence is available] 5. The tryptophan regulatory gene in the tryptophan operon derived from E. coli, the trpL polypeptide translation regulatory base sequence linked downstream thereof, and the DNA sequence linked downstream of the DNA sequence corresponding to the N-terminal methionine of the trpL polypeptide. A base sequence comprising the gene according to any one of claims 1 to 4. 6. The tryptophan regulatory gene in the tryptophan operon derived from E. coli, the trpE polypeptide translation regulatory base sequence linked downstream thereof, and the DNA sequence of claims 1 to 4 linked downstream of the DNA sequence corresponding to the N-terminal methionine of the trpE polypeptide. A base sequence containing the gene described in any of the sections. 7. The tryptophan regulatory gene in the tryptophan operon derived from E. coli, the trpL polypeptide translation regulatory base sequence linked downstream thereof, the downstream of the DNA sequence corresponding to the N-terminal methionine of the trpL polypeptide, and tr
A base sequence comprising a pE polypeptide translation regulatory base sequence and the gene according to any one of claims 1 to 4, each of which is linked downstream of a DNA sequence corresponding to the N-terminal methionine of the trpE polypeptide. 8. An expression vector comprising the base sequence according to any one of claims 5 to 7 and the vector. 9. A transformant obtained by transforming a host cell with the expression vector according to claim 8. 10. Partial structure polypeptide or whole structure polypeptide of membrane protein, characterized in that the transformant according to claim 9 is cultured in a medium, and the partial structure polypeptide or whole structure polypeptide of membrane protein is collected from the culture. Method for producing polypeptide.