JPH0297391A - D-helix-deficient phospholipase a2 - Google Patents

Abstract

PURPOSE:To provide a mutant phospholipase A2 having a natural-type bovine phospholipase A2 structure deficient in D-helix, having decreased antigenicity and preferable as a drug to be administered into a body. CONSTITUTION:A plasmid pBS PLA2-4.2-7 containing a DNA fragment coding a natural-type (wild-type) phospholipase (PL) A2 is digested with restriction enzymes HindIII and Nsp(7524)V to obtain a DNA fragment coding an amino acid sequence corresponding to the amino acid sequence of a natural-type PLA2 depleted with the amino acids of from 59th to 67th including the D-helix (corresponding to the amino acid sequence of from 59th to 64th) of bovine PLA2. The obtained DNA fragment is linked with a DNA fragment coding the amino acid sequence of from 59th to 61st in the corresponding amino acid sequence of the PLA2 of banded seasnake. The objective plasmid pBSPLA- D containing a DNA having prescribed depletion can be prepared by this process.

Description

DETAILED DESCRIPTION OF THE INVENTION "Field of Industrial Application" The present invention provides genetically engineered bospolypase A and its derivatives, specifically mutant phospholipase A2 in which the D-helix has been deleted from natural type (wild type) bovine phospholipase A2. The D-helix deleted phospholipase A is loaded (encoded) for production using a transgenic technology.
A DNA fragment, an expression plasmid incorporating the DNA fragment in an expressible form, a yeast cell transformed with the expression plasmid, and a method for producing D-helix deleted phospholipase A2 using the yeast transformant, and It relates to D-helix deletion type phospholipase A.

[Prior art and its problems] Phospholipase A2 (EC3,1,1,4) (hereinafter referred to as PI
, A, (abbreviated)) is an enzyme that specifically hydrolyzes a fatty acid ester at the C-2 position of a 1,2-diacylglycerophospholipid to produce a lysoglycerophospholipid and a fatty acid.

This enzyme exists in relatively large amounts as an extracellular enzyme in the pancreas of animals and in venoms such as snake venom and bee venom, and is also widely distributed throughout the living world, from higher animals to microorganisms, mainly as an intracellular enzyme. .

PLA 2 utilizes the specificity of its enzymatic reaction, and C2
Preparation of phospholipids by deacylating fatty acid esters,
It is used as a research reagent (Kobayashi (1987))
protein, nucleus, yeast, 1661-1667).

This enzyme is expected to be used primarily for research and treatment in the medical field related to fat metabolism, and its importance is expected to increase further in the future.

By the way, in order to more easily and stably supply natural PLA, we are using genetic recombination technology to produce natural PLA.
A plasmid containing a DNA fragment encoding Δ2
'pBsPLA2-/1. :2-7, then:
By incorporating the DNA fragment into an appropriate QM mother expression vector, an expression vector for expressing PLA in yeast was constructed [Tanaka et al. (] 9).
88) Gene64257-264]. The invention relating to this expression vector was also disclosed by the applicant
A patent application was filed under No. 00307 (filed on August 11, 1962).

In the second invention, the chemically synthesized bovine PLA2 gene is cloned and inserted into a yeast secretion vector, and bovine PLA2, which is the same as the natural one, is secreted and produced in the yeast culture solution. The present inventors have envisioned a wide range of uses for PLA, and have conducted extensive research with the aim of developing various derivatives by creating mutations in the natural type of PLA2. It's here.

Usually, the variation W in the amino acid sequence of the natural Haj4 polypeptide includes a deletion, substitution, or insertion in the amino acid sequence. Effects that may be induced by such mutations include increased activity, changes, increased stability or easier purification, and even improved yields. Due to the recent development of genetic recombination technology, methods for introducing various mutations at any location in a molecule are known to those skilled in the art and can be achieved using conventional techniques. However, it is an important issue to introduce appropriate mutations depending on the purpose.

Means for Solving Problem 1] In the process of conducting various studies to introduce appropriate mutations into the amino acid sequence of PLA2, the present inventors discovered that the combination of bovine-derived PLA and snake-derived PLA2 This led us to focus on the structural differences. That is, bovine PLA contains A,
, B, C, and D are known to exist [Dijkistra et al. (B, W, Dij
kstra) J, Mo1. Biol, (19
78) ↓■, 53-60]. On the other hand, some species of snakes, such as the P L A of the Elab Sea snake, have been shown to lack a D-helix [Nishita et al.
N15ida) Bioche, J, (] 98
2) 207.589-594. ]. The lack of such a -helix results in a decrease in molecular weight and makes its structure somewhat simpler, so that it
If the helix can be eliminated, antigenicity may be reduced, and it is thought that desirable properties will be imparted to the drug when it is administered into the body as a medicine.

Moreover, since it is derived from cows, it is considered suitable for use in mammals. Furthermore, it is expected that purification will become easier due to the reduction in molecule (2), and it is thought that it will be possible to obtain and supply highly purified PI7A2 in larger quantities.

That is, the object of the present invention is to obtain bovine phospholipase A lacking D-wax.

In order to achieve the object of the present invention, first, a plasmid T) BSPLA24.27 containing a DNA fragment encoding the natural PLA of the invention is treated with restriction enzyme Hin.
dll and N5p(7524)V, and from the amino acid sequence of the native PLA2 shown in FIG.
A DNA fragment encoding the amino acid sequence lacking the 59th to 67th amino acids including the D-helix (corresponding to the 59th to 67171st amino acid sequence, see Figure 5) of A was obtained, and this DNA fragment was ,handle"
A DNA fragment encoding the amino acid sequence of PLA2 of the Elab sea snake, that is, the amino acid sequence from position 59 to position 61 (see also Figure 5) (see Figure 6)
A plasmid, pBSPLA-ΔD, containing the DNA with the desired deletion was constructed by ligating.

The results of computer simulation analysis of the amino acid sequence encoded by this plasmid' supported that PLA2 corresponding to this amino acid sequence lacked the D-helix. In addition, in the sequence formula of FIG. 5, the upper row represents the amino acid sequence from No. 57 to 79 of the natural type PLA 2, and the lower row represents the amino acid sequence of the corresponding D-helix deletion type PLA 2. There is.

That is, the present invention provides D-hewax-deficient phospholipase A for producing D-hewax-deficient phospholipase A.
A DNA fragment encoding A2, an expression plasmid that uses yeast as a host that incorporates the fragment, yeast or transformants transformed with the plasmid, and D using the transformant.
The present invention provides a method for producing a -hewax-deficient PL, A, and a D-helix-deficient phospholipase Δ.

In the present invention, the term PLA2 refers to PLA2 of any mammalian origin, including bovine natural PLA2.
It refers to L A 2 and also includes variants of these natural P L A produced by genetic engineering. D encoding this natural PLA2
The NA sequence and corresponding amino acid sequence are shown in FIG.

A mutant PLA2 having the desired D-helix deletion in this amino acid sequence was constructed as described above.

The resulting DNA and amino acid sequences are shown in FIG.

In order to express the DNA fragment encoding the D-helix deleted PLA2 obtained in this way using yeast as a host, a gene expression system for performing mRNA synthesis and protein translation from the mRNA is required. need to be connected. In yeast, DNA fragments that have promoter activity and translation ability of genes functioning within the yeast cells are often used as gene expression systems. Such examples include the 3-phosphoglycerate kinase gene (PGK), the enolase gene (ENOl, ), the glyceraldehyde-3-phosphe-1 dehydrokenase gene (GPD), and the mating type α gene (
M F 1 ), repledge pull acid phosphatase gene (PH○5), galactokinase gene (
GALL), etc., are often used (Nakao, Matsubara (1986), Japanese Biochemistry Complete Edition ``Gene Research Methods n'' pp171-172, Tokyo Kagaku Doujin). PLA, encrypts D
If ligated before the NA fragment, P L A2 will be under its control.
will be expressed in yeast. Other DNA fragments having similar activity may also be used.

In order to introduce into yeast a DNA fragment configured to express the above-mentioned D-helix deleted PLA2 in yeast, yeast and Escherichia coli, which are classified into YEp type, YRp type, and YCp type, are introduced. Shuttle Vector (Higashie (1981)
The DNA fragment may be ligated to the DNA fragment (ed. Matsubara, Yano, pp. 205-207, Kyoritsu Shuppan). Furthermore, the DNA can also be introduced into yeast using YIp-type Hector (see the above-mentioned document), which cannot proliferate in yeast. In the present invention, a YEp-type hector, pA T 405 mata i; pM
Although it is preferable to use Fα-8, it is not limited thereto.

Although it is possible to directly transform yeast using the DNA linked in this way and obtain the desired product, - for boat fishing, it is necessary to transform dog enteric bacteria once to obtain the desired product, and then transform the yeast. Convert. The genetic manipulation method using E. coli is carried out using a device (Mani).
atis et al. (1982) Molecular Clone
ing: A Laboratory Manual
, ColdSpring Harbor Labora
The details are explained in the following.

Yeast transformation was performed using the competent cell method (Rodri
guez and Talt (] 983) Recombina
nt DNA Techniques: An
1ntroduction I) I), ] 86-1
87, Addison-Wesley publish
ing Co.), Protoplus 1-method (Beggs (
1978) Nature275. ]04~]08),
Electroporation method (Inaba et al. (1, 987) protein nucleus, until Ensai, 10
~21) can be achieved. The host is Saccharomyces cerevisiae (Saccharomyces c
It is preferable to use Y. erevisiae), but it is also possible to use other types of yeast.

If the obtained transformant is cultured using a known medium,
PLA 2 lacking wax to D- can be obtained. When the D-helix deleted Hq p LA is secreted and produced outside the bacterial cell, yeast minimal
Yeast Minimal Mediu
m) or YNBD medium (Rodriguetz and Ta1l
(1983) Recombinant DNA Tec
hniques: An 1ntroduction,
ppl 51- ] 53, Addison-Wes
It is preferred to use a minimal medium such as leyPublishing Co.). Also PH05 and GAI-
When promoter No. 1 is used, PLA 2 production can be induced by removing phosphorus from the cultured cells or by using galactose as the carbon source.

P1. When A2 is secreted and produced, yeast is removed from this culture solution and then conventional protein purification methods such as salting out, ultrafiltration, ion exchange chromatography,
By using affinity chromatography, high-performance liquid chromatography, electrophoresis, or a combination of these methods, a pure specimen of PLA lacking Tux can be obtained.

In the present invention, as described in the Examples, a medium-sized standard was prepared using Sephadex G-25, reverse phase 1 (PLC) and cation exchange II PLC.

In addition, the D-helix deleted PL accumulated in the bacterial body
A. can be extracted and purified by the method described above after disrupting the yeast by treating it with a cell wall digesting enzyme or glass heath.

[Effects of the Invention] The present invention provides a method for secreting and producing PLA2 lacking the D-helix using yeast as a host, and is applicable to the medical and research fields of conventional natural PLA. This can be said to further develop the applications of

The present invention will be explained in more detail with reference to Examples below. The general methods of genetic manipulation described below are explained in the manual (
Maniatis et al. (1,982), Molecula
r Cloning: A Laboratory
Manual, ColdSpring J(arb
or Laboratory) and reagent specifications.

Preparation of a DNA fragment encoding the known bovine PL A2 amino acid sequence (F 1eer et al. (1978) Eur, J. Biocham, -f52
−． 26 ] ~ 2G9), the DN to encrypt it
The A fragment was designed as shown in FIG. This DNA fragment contains not only the active form of Lan PLA and the part encoding the protein, but also the seven residues of the precursor PLA2 at the front.
tiorIpeptide) (Dutilh et al. (197
5) Eur, J. Biochem, 5391-97), and before that, dog P L
The DNA that encrypts the sigpur peptide of A
(Ohara et al. (1986), 1.Biochem9
9.733-739) are connected. In addition, stop codons TAA and TAG are added consecutively to the rear,
In addition, !'EcoR1 and Sa Volume 1 are placed on the 5'' and 3' sides of all DNA fragments.In designing, care was taken to ensure that the degree of codon usage was close to that of yeast, and Care was taken to ensure that unique restriction 11\ element cleavage sites exist throughout.

The DNA fragment thus designed was divided into 22 DNA oligomers having an average chain length of 42 mar as shown in FIG. 3 and synthesized. DNA orycomer is Applied Bio
Instrument38 ] A-type fully automatic DNA
After synthesis using the phosphoramitite method using a synthesizer,
It was treated with a solution of triethylammonium, thiophenoxide, and dioxane for 1 hour at room temperature, and then treated with concentrated aqueous ammonia for 1 hour at room temperature and then at 55°C for 6 hours. Transfer this specimen to reverse phase 1]P1. .

After fractionating the target product using C, it was treated with 80% acetic acid,
Purified by polyacrylamide gel electrophoresis (PAGE) and further reversed phase I-i I) 1. The purified product was freeze-dried and dissolved in 25 nt11o1/mQ distilled water to obtain an oligomer for producing DNA fragments.

FIG. 4 shows an outline of the method for creating a DNA sequence for encoding PL, A, from a DNA orycomer.

First, I assembled three fragments, A, B, and C. Mix 250 pmol (picomole) of each oligomer for A flocs with ■~■, B flocs with ■~■, C pro, and @~ [phase], heat at 70°C for 3 minutes, and then rapidly rinse with cold water. Annealing was performed by cooling, heating again at 70'C for 3 minutes, and then gradually cooling to room temperature over about 3 hours. Next, a kinase buffer, D'FT at a final concentration of 5mM, and ATP at 1mM were added to this solution, and then 20 units of polynucleotide kinase was added and the mixture was reacted at 37°C for 1 hour. After further heating at 700C for 3 minutes, 25Qpm○1 of olicomer (■) was added to the sample in the block, and 25Qpm○1 of olicomer (O) was added to the block C. Furthermore, for each sample, ATP and T4 DNA licase were added at a final concentration of 1mM. was added and reacted at 8°C overnight.

The following samples were subjected to PAGE with a gel concentration of 8% and a thickness of 2 mm.
The electrophoresis was carried out at 80 to 120 V for 4 hours.

The resulting gel was soaked in TB containing EtBr (0,5 μg/m
DNA bands were detected by staining in E buffer for 20 minutes and irradiating with ultraviolet rays. Referring to the value of the molecular weight marker that was electrophoresed at the same time, cut out a section of about 160 bp for A pro, about 170 bp for B flock, and about 1.30 bp for C flock, and elute the DNA fragment. , collected and dissolved in 20 μa TE buffer. 10 μρ of DNA from each block was mixed and ligated by reaction using T4 DNA Licase overnight at 8°C, followed by PAGE at 35% gel concentration, 2 mm thickness, and electrophoresis at 60-100 μι for 3 hours. Referring to the value of the molecular weight marker that was electrophoresed at the same time, a DNA band around /1.60 bp was cut out, and the DNA fragment was eluted.

The obtained DNA fragment was further digested with NAC3PREPAC (B
(manufactured by RL) according to the method in the manual, and after precipitation with ethanol, it was dissolved in 2011θ TE.

Next, Plasmi I<'pUc 119 (purchased from Takara Shuzo)
was completely digested between EcORIXSa and this DNA20
Mix 5μρ of the DNA fragment synthesized with T4 DN
The mixture was incubated at 8°C for 16 hours using AN calise. Using 5 μρ of this ligation mixture, E, co
li JM ] 05 (Amajam Nyapan(
(transformed manually). 200 strains were selected from the obtained transformed strains exhibiting ampinrin resistance, and the colonies were transferred to a Whatman 541 filter, followed by colony hybridization according to a conventional method (Gergen et al. (1979) Nucleic Ac1
ds Res, 7.2 ] ] 5-2136). As probes, we used DNA oligomers (Fig. 3) labeled at the 5'' end using T4 polynucleotide kinase and purified by span column chromatography.

6xSSC, 0.1% S D S , ] X D
enhF4rdt's.

in a solution containing 25 μg/mg salmon DNA at 42°C.
After prehybridization for 4 hours, each probe was added to the same solution at 7-8 x 1, 05 cpm/mQ, and hybridization was performed at 42°C overnight. Then, 2XSSC101%S at 42°C
Wash the filter twice with a solution containing DS and then twice with a 2x SSC solution at 42 °C.
0 minutes). The filter was then dried at room temperature and autoranography was performed.

For the nine clones that were positive for the three probes, single-stranded DNA was isolated using a known method (Takara Shuzo, PUC] 19 manual) using helper phage M13 and 07.
A was fractionated and the nucleotide sequence was determined using the M13 N-Quen Sync Kit (manufactured by Ama7Yam Japan Co., Ltd.), and it was confirmed that the 200 residues at the 5' end were the desired product. Furthermore, EcoRT in the synthetic gene, Sa book, X
Using the ho1 site, convert each DNA fragment into M]3mp1.
], and the entire region was sequenced, and deletions or substitutions in the nucleotide sequences were found in all clones. Therefore, the plasmid l”pBSP, which has a synthetic gene in which the 370th G residue counting from the 5° end is deleted,
The deletion was corrected using LA, -4,2 and replaced with the correct sequence. First, pBsPLA, 4.2 was digested with 5tul and XbaT, and a DNA fragment of about 3.7 kb was fractionated by agarose gel electrophoresis. In addition, in order to reconstruct the deleted part, 250 pmo of each oligomer of O to 0 was added.
After 5'-end phosphorylation, annealing, and ligation as described above, XbaI
and 2 cells with 5 tul, and about 5 cells by 12% PAGE.
A DNA fragment of obp was obtained. This DNA fragment is about 2p
Mix 5 tul of pBSPl, A, -4,2 and about 100n9 of the Xbal fragment with T4. D N
ligated using A ligase, E. coli MC]
06] (Casadaban et al. (1980) J, M
o1. Biol, 138, 179-207). When 68 strains were selected from the obtained ampicillin i transformants and plasmid DNA was extracted and digested with 5tuT and Xbal, 28 strains had incorporated a DNA fragment of about 80 bp. Therefore, the Pstl-Xba1 fragment of 8 representative strains was extracted into M1 and 3 mpH Xb.
It was recloned into al and Pstl and the nucleotide sequence was determined. As a result, the deleted portion was recovered in 4 clones, and the correct base sequence was maintained in the other portions. Furthermore, we selected pBSPLA, -/1.2-7 as a representative of the clones that had the gene with the correct sequence, and determined the entire nucleotide sequence of the part encoding PLA, as shown in Figure 1. We were able to obtain a DNA fragment that completely matched the sequence shown and encoded the desired bovine PLA2.

Example 2 A DNA fragment encoding D-helix deleted PI-A2 A gene encoding the D-helix deleted PI-A2 was a synthetic gene encoding wild-type bovine PLA2 prepared in Example 1. gene I(1ndlTI-N5p(752
4) Obtained by replacing the DNA sequence between V with a sequence encoding the deletion type. The amino acid sequence of the deleted portion is shown in Figure 5, and the base sequence is shown in Figure 6. FIG. 7 shows an outline of the method for producing a gene encoding D-helix deletion type PLA.

The deleted portion was divided into four DNA segments 1j to 1 shown in Figure 6 and synthesized. DNA oligomer is Appli
ed Bio Instrument 381 A
After synthesis using the phosphoramitite method using a molded automatic DNA synthesizer, it was treated with triethylammonium, thiophenoxide, and dioxane solution at room temperature for 1 hour, then treated with concentrated aqueous ammonia at room temperature for 1 hour, and then It was treated at 55°C for 6 hours. This sample was subjected to reverse-phase HPLC to separate the target product, then treated with 80% acetic acid, purified by polyacrylamide gel electrophoresis (PAGE), and purified by reverse-phase HPLC and frozen. Dry, 25
The solution dissolved in nmol/mc distilled water was used as an oricomer for producing DNA fragments.

Next, 250 pmol of each oligomer was mixed in Kinase buffer, heated at 70°C for 3 minutes, and then quenched with cold water.
Annealing was carried out by heating again at 70°C for 3 minutes and then gradually cooling to room temperature over about 3 hours. Next, to this solution, 5mM final concentration of DTT and 2.5mM ATP were added, and then 20 units of polynucleotide kina was added.
The reaction was allowed to take place at °C for 40 minutes. This reaction solution was heated at 70°C for 3
After heating for minutes, 2mM ATP and T4. DNA ligase was added and reacted at 20°C for 2 hours. This reaction solution was subjected to phenol-chloroporm extraction and ethanol precipitation.
．． The DNA fragment recovered from ft-1 was further digested with N5p (75
24) The V-digested product was synthesized and used as an NA fragment.

The final product was extracted with phenol-chloroform, precipitated with ethanol, and then dissolved in 10 μm of TE buffer before use.

Next, PBSPLAI 4.2 73I obtained in Example 1
Lg was digested with Hindl, N5p(7524)V,
% agarose gel electrophoresis to excise the vector DNA fragment and a DNA fragment of approximately 280 bp, and the DNA was recovered by electroelution. Of these, vector DNA
For fragments, bacterial alkaline phosphatase (bac
terial alkaline phospatas
e, ) (B AP) After processing, 10 μQ of TE
Dissolved in buffer. Other DNA fragments were directly dissolved in 10 μρ TE buffer.

Next, 1 μg of the synthesized DNA fragment and 5 μQ of a fragment of about 280 bp were mixed, ligated using T4 DNA ligase, and then digested with HindIII. This reaction solution was subjected to 8% polyacrylamide gel electrophoresis to obtain a D of around 330 bP.
The NA band was excised, and the DNA was recovered by electroelution and finally dissolved in 5 μρ TE buffer. Next, this recovered DNA fragment 5 μρ and BAP-treated Hector DNA
A ] mix μρ, T 4. After ligation using DNA ligase, E. coli JM105 was transformed. Approximately 86 transformants showing ampinone resistance were obtained.
After transferring the colony to a straw 1-man 54 strain for strain 0, colony hybridization was performed according to a conventional method [Gerken et al. (19
79) Nucleic Ac1ds Res, 1
21] 5-2136]. As a probe, the 5' end was labeled using T4 polynucleotide kinase, and then the DNA oligomer shown in Figure 6 (■), which had been purified by span column chromatography, was used.

6x SSC, 0.1% SDS,] × Tenhal 1-solution, 37 °C in a solution containing 25 μg/mρ salmon DNA.
After another hour of prehybridization, the probe was added to the same solution at 5 x 105 cpm/i4 and hybridized overnight at 37°C. Thereafter, the filter was washed twice at room temperature with a solution containing (3xSSC, 0.1% SDS) and further washed with a solution containing 3M tetramethylammonium chloride [Wood et al.
5) Proc, Natl, Acad, SciU
SA 82 1.585-15881 at 37°C15
Washed twice at 50°C for 15 minutes. The filter was then dried at room temperature and autoradiographed.

Thirty-eight positive strains were obtained. Plasmid DNA was prepared for this Uji12 strain, and 5ca1, N5p (7524
) When a restriction enzyme map was prepared using V and Pstl, three strains showed a pattern with 1'' target. Furthermore, these 3
From the strain, single-stranded DNA was extracted using helper phage M]3KO7 according to a known method (Takara Shuzo pucl19 manual).
Separate and M13 N-Quen/Ngkisoto (manufactured by Takara Shuzo)
When the base sequences were determined using PLA2, it was confirmed that two strains had the desired sequence for the 50 bp surrounding the deletion site. LΔ-
ΔD was obtained.

Example 3 Construction of D-helix deleted PLA2 expression plasmid pEK20]-ΔD in yeast D-helix deleted PLA in yeast, expression plasmid pEK201-Δ
The outline of D construction is shown in FIG. pAT405 is known (T
anaka et al. (1988) Gene 64 257
264), and can be performed manually by a professor at Tokyo Stock Exchange (Hiroshima University, Faculty of Engineering, Class 3 Fermentation Engineering Department).

pBSPLA-ΔD obtained in Example 2 is Ec.

After digestion with RI and 5all, E. coli DN
Klenow fragment of A polymerase I (hereinafter referred to as Klenow fragment)
The protruding ends were made blunt using a gel (abbreviated as "low"), and a DNA fragment of approximately 450 bP was fractionated by agarose gel electrophoresis. Next, after digesting pAT4.05 with XhoI,
The protruding ends were made blunt by K lenow treatment. These two DNA fragments were ligated using T4 DNA ligase, and the ligation mixture was used to create E,
E. coli MC1061 was transformed.

Two of the obtained transformants exhibiting ampicillin resistance
Colony hybridization was performed on strain 00 in the same manner as shown in Example 2. The probe is 5”-CTCATGACAACT G CTA CA
An oligomer represented by AGC was used. Plasmid DNA was extracted from the 31 strains that tested positive, and when Pstl digestion was performed to search for plasmids that had inserted a DNA fragment encoding PLA2 in the desired direction, 8 strains were identified as a plasmid with the desired structure, pEK20]-△D. was held.

Production and purification of D-helix deleted PLA2 using real part 4-pEK20]-ΔD Production of D-helix deleted PLA2 pEK20 obtained in Example 3
]-ΔD using the known protoplast method (Beggs
(1978) Nature 275. ]04 108)
by Satucharomyces cerevisi xDC-5 (Bro
ach et al. (1979) Gene 8, 121-133)
was transformed.

As a selective medium, I, -histidine 20 μg/m2, 1
．． YNBD medium containing 2M Sorchi River Glue was used. The obtained Leu+ transformed strain was treated using a known method (T
anaka et al. (1988) Gene 64 25726
4) to obtain two supernatants containing PLA2.

2. Purified yeast culture of D-helix-deficient PLA, SP-
Elution was carried out by applying a linear concentration gradient of sodium chloride from 0 to 05M on a Sephadex (23 (manufactured by Pharma) column) (1,5 x 9 cm) (Figure 9). Lyophilize the portion and O
After desalting with a Sephadex G-25 column using 1M acetic acid as a developing solvent, the product was freeze-dried again to obtain about 20 mg of crude aliquots.

Approximately 8 mg of the obtained phase fraction was dissolved in 5 mM Tris-HCl buffer (pH 8,0) 10πQ, and loaded onto a D E 52 (Whatman) column (manufactured by Whatman) equilibrated with the same buffer.
15X 4. cm) and eluted using a linear concentration gradient elution method of sodium chloride from 0 to 0.3M (E
Figure 101). Peaks a and b are the active form and precursor of ΔI], respectively, and the two could be completely separated.

The shaded portion in the figure was collected as a precursor fraction, lyophilized, desalted, and lyophilized again to obtain precursor 31. The obtained precursor was subjected to 5DS-polyacrylamide electrophoresis (SDS-P) using 15% polyacrylamide as a support.
abbreviated as AGE) (Laemmli, U, K, (
1970) Nature 227. 6806
85) showed a single punt and was pure without any active form.

In addition, bovine phospho-11per7A2 which does not have the D-helix deleted was produced by yeast, and the culture-1 supernatant was SP
- When the fraction obtained by applying the above method to a D E 52 column was applied to a D E 52 column under the same conditions, the precursor and active form were not separated and eluted as the same peak ([Figure 11] ).

Next, the precursor of D-helix deleted PLA was activated as follows. 1.5 mg of precursor was added to 1.5 mg of precursor.
After dissolving in 50 mM Lis-HCl buffer (pH 8,0) containing 0 mM calcium chloride, 3 times of trypsin was added and the mixture was digested at 0°C for 90 minutes. After digestion,
Door J-pusin activity was stopped by adding 15 μC of 0.1 M diisopropyl fluorophosphate (DFP) isopropanol solution, ]M acetic acid as the developing solvent, Sephadex G-25 column (1,2x 25
At the same time, the peptide fragments cleaved by tryptopine were removed, and then lyophilized to obtain the active form of D.
-15 mg of helix-deficient PLΔ was obtained.

The obtained active D-helix deleted PLA.

It was pure, showing a single band with a lower molecular weight than the precursor on 5DS-PAGE. In addition, activity measurement using dipalmitoylphosphatidylcholine labeled with '4c (Tanaka et al., (] 988) Gene64.2
57-264), active type ΔD had an activity comparable to that of natural bovine phospholipase A2.

[Brief explanation of the drawing]

Figure 1 is a schematic diagram showing a DNA fragment encoding the D-hewax-deficient bovine PLA2 amino acid sequence and the amino acid sequence encoded by it, and Figure 2 is a schematic diagram showing the natural type bovine PLA2. D encodes the amino acid sequence
FIG. 3 is a schematic diagram showing a synthetic gene useful for the expression of the bovine PLA2 containing an NA fragment and the significant amino acid sequence coated by the gene. FIG. 22 DNA olicomers
Schematic diagram showing the structure of plasmid pBSPLA, Figure 4
24, , 2-7, and Figure 5 shows the amino acid sequence of the deleted portion of the D-helix deleted PLA, which is not shown in Figure 1, and the amino acid sequence of the native PLA. A schematic diagram shown in comparison with the sequence (Nos. 57 to 79), Figure 6 is the D for synthesizing the DNA fragment of the deleted part shown in Figure 5.
A schematic diagram showing the structure of the NA oligomer, FIG. 7 is a schematic diagram of the construction of plasmid pBSPLA-ΔD, FIG. 8 is a schematic diagram of the construction of plasmid pEK20]-ΔD, and FIG. 9 is a schematic diagram of the construction of plasmid pEK20]-ΔD. Cefazo the culture solution of D. Figure 10 is a graph showing the elution pattern of the fraction that flows out after being applied to the column.
1 is a graph showing a chromatogram obtained by subjecting an A2-rich fraction to DE52 column chromatography,
FIG. 11 shows natural type P L A . Patent applicant Protein Engineering Research Institute Co., Ltd. Representative Patent attorney
Blue and white 葆 (2 others) Fig. 1 -'
54 steps included A cM
:AACππaAαλαincludeαπzuπαko0stoneπ℃N) Fly Tαπα1 purchase Am Ala Leu Leu TEπ
Val Ala ALa Ala0 Ding αD (mGACT
IGAGAGCTα1(ATxGIT<'I'IGα:
ATAC'IX; TileACGCMGCCCCcc (
:'1lffAACrOJ(χ?rCa α℃A)AT
ICAACCKRMG 8ICAAG π℃Glu A
la Gly Leu Asrz Ser Arg A
la Leu Trp Gin I'he ASn G
Ly Mll! T Engineering 1e Lys Cysl
10ff
%ffAGA'仄:ACTrα:IG GAG AA
! L'C'lGA<'l'IG TIG a C
O3AO3X Darkness AAAG MCCCA TCI'
AGr GAAα℃0℃NAαc'r'cucAAC'
xαeTGC' [X し■πLys工1e E'ro S
er Ser Glu Pro Lal Leu As
p phe Asn Asn γGly Cys TF
CYS2゜α)3GAT CCG(nAGG CCA'Imαr
CAGe5AAI'$'1fflAC! :ACA(7I
C'laα℃−αI(m!αrACCCCA GIlc
GAT(', WmGACAGA'KC'l0II'CA
GACTGly Leu Gly Gly Serσy
Thr pro Val Asp Asp Leu
Asp Ar9 cy, C% GIJI Thr mark A
CIG TIG NX, ATG TK: GICαC
TICT'E: CM' CCA ACI; A'IA
CGr: Aa πTIGCATGACAAC'm
'm AAG %α'i:, AAG AAG CIA
GST'IGCTie CCA TM: ACCA
rcHie Asp ASn Cys Tyr Lys
Gln Ala LF LYS Leu Gly C
YS Tar Pro TF k AsnFigure 1-2 TIG AIIG fl A'IG fl fl AG
Cff; TIG CIT '11! <'IOC6f
f 'I'CA CrT TIIG 'ff;AACT
Ac'i! ['I'CC9'ff, AACAACG
M A[ACGπf'1mAGr store, AKMCA5n
Tyr ser Tyr ser CF Ser A
Sn Asn Glu Ile 'Ihr cys S
er Ser Glu All AsnαQACACT
CnAV'IX;AO3WACACIG(flW$GE
'I! MACA<dGCT 'IGI'<:, l'
lflαD ff Al 'IGCAAC'IGI'
GACαzMCca:αT a '11:πN℃formula℃A
la Oys Glu Ala Pbe Ile ay
s ASn Cys 714 AI"qAsn Ala
Ala engineering 1e Cys phe 5er9Q
100υ℃
CX Beχta Nta TICυ℃a Ding seal U-Ding-G4 (?IG
9℃τ℃4℃Nλ Shoulder center AAGσrα: c 'x AAC
AAG CMcx m z C'lA c;< AAG
AAG z 'm 'm 'IGALys Val
Pro 1ryrAsn I, ys Gluin S LY
S Aan Leu Asp I,% LYE ASn
C.F. Figure-20
-1OHKFLVLAALLTVA
AAEA-AATTCATCGATGAAATTCCTAGTT
CTAGCTGCTCTGTTGACAGTTGCTG
CTGCAGAAGCC;TCGACGAGACAAC
TGTCAACGACGACGTCTTCGGEcoR
I C1a engineering

PsjikoGLNSRALWQFNG) (IK CK
Engineering PSGGCCTGAACTCTCGAGCT
CTATGGCAATTCAACGGTATGATCA
AGTGCAAGATCCCCATCTCCGGACTT
GAGAGCTCGAGATAACCGTTAAGTTG
CCATACTAGTTCACGTTCTAGGGTA
From GASac, CL S E P L L, D F N
N Y G CY CG L G G
S GAGTGAACCCCTCTTAGACT
TCAAACAACTACGGCTGCTACTGTGG
CCTAGGCGGTTCCGGTTCACTTGGG
GAGAATCTGAAGTTGT'LT P V D
DL Y) RC, CQ T) (D N CY
K Q-inACCCCAGTCGATGATTTAGAC
AG'ATGCTGTCAGACTCATGACAAC
TGCTACAAGGC GGCCTGGGGTCAGC
TACTAAATCTGTCTACGACAGTCTG
AGTACTGTTGACGATGTTCGTCCG
Figure 6-2 ◎ ◎ [Phase] ACAAAGAGGTTCCAGGGGATGTTGT
TCCTTGTGTGAGATCTG ACTCTAGACAGCT-5 Fig. 8 EcoR engineering aoRI Fig.

Claims (1)

[Claims] 1. A DNA fragment encoding D-helix deleted phospholipase A_2. 2. The DNA fragment according to claim 1, which consists of a DNA sequence encoding the amino acid sequence from No. 1 to No. 117 shown in FIG. 3. A recombinant plasmid containing the DNA fragment according to claim 1 under the control of a yeast gene expression system. 4. The plasmid according to claim 3, which is pEK201-ΔD. 5. A yeast strain transformed with the plasmid according to claim 3 or 4. 6. Saccharomyces cerevisiae DC5 (pEK20
1-ΔD) according to claim 5. 7. Cultivating the transformed yeast strain according to claim 5 or 6 to accumulate D-helix deleted phospholipase A_2 in a culture medium, and recovering D-helix deleted phospholipase A_2 from the culture medium. A method for producing D-helix deleted phospholipase A_2, characterized in that: 8. A D-helix deleted phospholipase A_2 polypeptide consisting of the amino acid sequence from No. 1 to No. 117 according to claim 1.