JPH02501192A - DNA sequences, recombinant DNA molecules and methods for producing soluble T4 protein - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] [Technical field of invention] The present invention provides DNA sequences, recombinant DNA molecules and Regarding the method. More specifically, the present invention relates to soluble T4, the surface of T4+ lymphocytes. When expressing the above receptor or its derivative in a suitable unicellular host, A DNA sequence characterized by: According to the invention, the DNA sequence of the invention , substantially free of other proteins of human origin, using recombinant DNA molecules and methods. Soluble T4 can be produced. This soluble protein is then used in the immunotherapy of the present invention. It can be advantageously used in therapeutic, prophylactic and diagnostic compositions and methods.

The soluble T4 protein-based immunotherapeutic compositions and methods according to the present invention Complications and complications related to infectious agent induced syndrome (AIDS) in which T4+ lymphocytes are Soluble T4 protein useful in preventing, treating or detecting and HIV infection The present invention relates to compositions and methods based on the present invention.

[Prior art] The type of immunoregulatory cells known as T-cell lymphocytes is divided into two broad functional types. The first type consists of T helper or inducer cells. and helper cell interactions for T cell proliferation, lymphokine release, and 1g release. The second type consists of T-cell toxic or suppressor cells that act as T-cell mediators. Involved in the death of cartilage and immune response suppression. Generally, these two types of lymphocytes Two surface glycoproteins [i.e., on T helper cells or inducer cells] T4 (molecular i55,000-62,000) probably expressed as a monomeric protein Dalton) or expressed as a dimeric protein on T cytotoxic or suppressor cells. T8 (molecular weight 32,000 Daltons)].

The main structures of T4 and T8 have been deduced from their respective CDNA sequences [P, J, Maton et al., “Isolation and Nucleotide of CDNA Encoding the T Cell Surface Protein T4” "A novel member of the immunoglobulin gene group", Cell, Vol. 42, No. 93-1 04 page (1985): D., R. Littmann et al., Gene encoding rT8 "Isolation and Sequence of Molecules Defining the Functional Types of Dual Lymphocytes", Cell, Vol. 40 , pp. 237-246 (1985)]. Both predicted protein sequences are A surface containing a transmembrane domain and an intracytoplasmic domain located at the carboxyl terminus A molecule with each predicted domain for an antigen is defined. In general, both proteins are immune. Highly similar to and targetable to the variable regions of epidermis globulin and TMi cell receptor It has an amino-terminal region that can act in cell identification [Matton et al., supra].

In immunocompetitive individuals, T4 lymphocytes interact with other specific cell types of the immune system. to confer immunity to or protect against infection [E, L, Reinhardt et al. Tsu and S,F.

Schlossmann, [Differentiation Function of Human T-Cells], Cell, Vol. 19, No. 821-82. 7 pages (1980)]. More specifically, T4 lymphocytes e.g. Acts to stimulate the progeny of B cells, that is, hematopoietic stem cells, which promote the production of human antibodies. do. In general, they activate macrophages (“killer cells”) and attack infected or otherwise abnormal host cells, as well as mononuclear cells (“scavenge”). invasive microorganisms are induced to encapsulate and destroy erosive microorganisms.

The main target or receptor for infectious agents in several species has been shown to be the T4 surface protein. I made it clear. These substances include, for example, viruses and retroviruses.

T4 lymphocytes become non-reactive when exposed to this type of substance. As a result, the accommodation The host's complex immune defense system is destroyed, leaving the host susceptible to a wide range of incidental infections. Become.

This type of immunosuppression is used in patients with acquired immunodeficiency syndrome (rAIDSJ). Can be seen. AIDS (AIDS) requires significant, typically complete, immunosuppression. A disease characterized by host resistance to a wide range of incidental infections and malignancies. With sensitivity. In some cases, AIDS infection is accompanied by central nervous system damage. AIDS The full clinical manifestations of AIDS are generally preceded by AIDS-related complications (rARcJ), i.e. symptoms such as general persistent lymphadenopathy, fever and weight loss. It is a syndrome associated with The human immunodeficiency virus (rHIVJ) retrovirus It is thought to be the causative agent of AIDS infection and its antecedent disease ARC [M G., Sarungadharan et al., “Cellular disease from patients with AIDS and pre-AIDS. Detection, isolation and continuous production of retrovirus (HTLV-III)” Sci. 224, pp. 497-508 (1984)]. [In this application , human immunodeficiency virus (rHIVJ), or human hypolymphotropic virus. virus type III (rHTLV-■), lymphadenopathy-associated virus (rLAVJ ), Human Immunodeficiency Virus (“HIv-1”) and AIDS-related For an independent isolate from an AIDS patient containing Torovirus (rARVJ) Adopted by the Human Retrovirus Subcommittee of the International Commission on the Classification of Viruses. use common terminology used].

AIDS/ARC Group 3 Test Niokel 85-100% seropositive for HIV [G., N., Shaw et al., "Human T-cell leukemia in acquired immunodeficiency syndrome" “Molecular characterization of (lymphotropic) virus type ■”, Science, Vol. 226, No. 1 165-1110 (1984)]. The number of adults in the United States infected with HIV is i, ooo, ooo ~ 2,500,000 [D, bar Johns, “Strategies for an AIDS Vaccine,” Science 1. Volume 233, No. 104 Pages 9-1053 (198B): M. Reese, “A Pessimistic Outlook on AIDS”, Neich. Journal, Vol. 326, pp. 343-345 (1987)].

These estimates represent 64,900 people who are not in groups identified as at risk for AIDS. Including individuals [S., L., Sibak and G.

P. Warmser, [How widespread is HTLV-I infection in the United States?] , New English Journal Medicine, Volume 313, Page 1352. (1985)]. What is the apparent diagnosis rate of patients infected with the IIV virus? 1-2%, and this percentage will increase significantly in the future.

For example, the genome of a retrovirus such as HIV consists of three components that encode structural proteins. It has an area of The qaQ region encodes the core protein of pirion. The p01 region is Encodes a pillion RNA-dependent DNA polymerase (reverse transcriptase).

The env region is a major component of the viral membrane envelope and the cytoplasmic membrane of infected cells. encodes a glycoprotein that Attach to target cell receptors and cause cell membrane fusion The ability of the virus to infect two types of HIV is controlled by the env gene. .

These properties appear to play a fundamental role in the pathology of the virus.

The HIV env protein arises from a precursor polypeptide, which is the mature form A large highly glycosylated outer membrane protein consisting of approximately 481 amino acids. white (gpl 20>) and a small protein consisting of about 345 amino acids that can be glycosylated. It is cleaved into a transmembrane protein (gp41) [L. Complete nucleotide sequence of TLV-II, Nature, Vol. 313, No. 277-2. 84 pages (1985)].

The host range of the HIV virus is associated with cells that have the surface glycoprotein T4. child The species cells include T4 lymphocytes and brain cells [P, J. Maton et al., rT4 The gene encodes the AIDS virus receptor and is also used in the immune system and brain. Cell, Vol. 41, pp. 333-348 (1986)].

When a host is infected with the HIV virus, T4 lymphocytes become non-functional. AI The progression of DS/ARC3 syndrome is due to the lack of T4+ lymphocytes exhibiting surface glycoprotein 14. Correlates to loss.

This T-cell deletion, with subsequent immunological concordance, leads to recurrent cycles of infection and viral can be associated with both lytic proliferation from cell-mediated transmission of Rough clinical observations , the HIV virus is the direct cause of central nervous system damage seen in many AIDS patients. This suggests that

The tropism of the HIV virus toward T4+ cells is due to membrane-bound viral receptors and This is thought to be due to the role of the T4 cell surface glycoprotein as a glycoprotein. T4 is HIV virus Since it behaves as a receptor, its extracellular sequence is likely <1 (binding IV play a direct role in the event. More specifically, the HIV envelope selectively targets T4 epitopes. appears to bind to the tope and uses this interaction to initiate integration into the host cell [A, G, Dalgricos et al., The rCD4 (T4) antigen is an AIDS retrovirus. "It is an essential component of the receptor for rus," Nature, Vol. 312, No. 763. -767 pages (1984); D. Clararaman et al. [Human Retrovirus LA "Behavior of T4 lymphocyte T4 molecules as receptors for V", Nature, vol. 12, pp. 767-768 (1984)]. Therefore, cellular expression of T4 is It appears to be sufficient for HIV binding, and the T4 protein is a lysate for the HIV virus. Acts as a puta.

The T4 properties of the HIV virus have been demonstrated in vitro.

HIV virus isolated from AIDS patients was transferred to preselected T4 on surface T4. When cultured with Luper lymphocytes, the lymphocytes are efficiently infected and form multinucleated syncytia. It exhibits cytopathological effects including tium formation and dies by lytic growth [D, Lalaraman et al. Selection Characteristics of Viruses (LAV)], Science, Vol. 225, pp. 59-63 (1 984): F. Wonggustahl and R.C. Gallo, [Human T-Lymph Trends] tropic retrovirus], Nature, vol. 317, pp. 395-403 (198 5)].

The cloned cDNA of human T4 has been cloned into non-human cells including murine cells and fibroblasts. ■ When expressed on the surface of transfected cells from a cell lineage, H It has been shown that T4 confers the ability to bind IV [P, J. Maton et al. Gene encodes AIDS virus receptor and is expressed in the immune system and brain Cell, Vol. 47, pp. 333-348 (1986) 1゜ During the course of HIV infection, the host mounts both a humoral and cellular immune response against the virus. increase. These reactions bind multiple viral products and have neutralizing or involves the generation of antibodies that exhibit antibody-dependent cytotoxic functions [M, Grofulover et al., “HTLV-Ill in patients with AIDS and AIDS-related complications” -Neutralizing Antibodies”, Nature, Vol. 316,! Pages 72-74 (1985); D, D, F, C)> etc., the viral envelope protein of rHTLV-m is "Identifying the main target antigens of antibodies in patients with AIDS", Science, Vol. 228, No. 10 pp. 94-1096 (1985); A, H,) Itsu'7, etc., rHTLV-1/ Serum from LAV antibody-positive patients has antibodies against HTLV-1/LAV-infected cells. "Mediating dependent cytotoxicity", Journal Immunology, Vol. 138, No. 1064-1068 (1987)]. 1-IIV envelope epitope is , has been identified as an important determinant in exhibiting neutralizing antibody responses. Zarani, anti The determining factor in body-dependent cytotoxicity (rADCCJ) activity is HIVenv and possibly the gag epitope.

To date, there is no effective treatment for AIDS, so there are many ways to prevent the disease. Many efforts are being made to This type of prophylactic measure includes whole blood, organs and spermatozoa. HIV antibody screening for patients and the transmission of this disease including education of high-risk groups.

Experimental and early stage clinical treatments of AIDS and ARC8 conditions include, for example: HPA-23, phosphonoformate, suramin, ribavirin, azidothymidine ( rAZTJ) and administration of antiviral agents such as dideoxycytidine. , these apparently inhibit viral replication by blocking reverse transcriptase. these Each drug has shown activity against HIV in vitro, but only AZT has been tested in clinical trials. showed a strong effect on However, administration of an effective amount of AZT is desirably There are no debilitating side effects, such as bone marrow depression. Therefore, hematology Clinical toxicity appears to be the major limiting factor in the long-term use of AZT.

Other proposed methods for treating AIDS involve viral replication services other than reverse transcription. The focus is on developing drugs that are active against processes in the brain. child Such methods include the administration of inkferons or the application of hybridoma technology.

Most of these treatment techniques involve immune modulators such as interleukin-2. appears to require simultaneous administration of data.

To date, AIDS, AR3C, HIV infection Effective immunotherapeutic agents and drugs to treat other immunodeficiency disorders caused by There is a need to develop methods and methods.

[Disclosure of invention] The present invention provides a receptor for infectious agents that primarily targets 14 surface proteins of T4+ lymphocytes. By providing large amounts of soluble T4 and its soluble derivatives, which act as a This will solve the above problems. Advantageously, the present invention also provides for the production of other proteins of human origin. Qualitatively free of viruses such as HIV or hepatitis B virus Provides a less contaminated form of soluble T4.

As will be apparent from the disclosure below, the DNA sequences and recombinant DNA molecules of the invention include: capable of directing the production of soluble T4 or its derivatives in a suitable host. Ru. The polypeptide of the present invention can be produced as it is produced in the host or can be roughly derivatized. caused by an infectious agent whose primary target is T4+ lymphocytes, or after modification. A variety of immunotherapeutic compositions and immunotherapy compositions for treating immunodeficiency patients with Useful for applications and methods. According to embodiments of the invention, such compositions and methods The method uses soluble receptors for HIV, soluble T4 proteins and polypeptides, and related to that antibody. The soluble T4 proteins and polypeptides of the invention are in monovalent form. , as well as multivalent forms.

Based on soluble T4 protein, polypeptide or peptide and antibodies against it Compositions and methods according to the present invention can be used to treat HIV-related infections AIDS and ARC. Particularly useful for prevention, treatment or detection. More specifically, the soluble T4-based compositions and methods utilize soluble T4-like polybebutides (i.e., 1 T by a competitive binding mechanism that blocks HIV infection of cells expressing the 4 surface protein. Polypeptides that advantageously inhibit the 4/HIV interaction are used. These soluble T4-like polypeptides are T4 lymphocytes and infectious agents that target T4 lymphocytes. and inhibit adhesion between T4+ lymphocytes and T4+ lymphocyte-mediated killing. prevents interactions between antigen-forming cells and targets. Soluble virus lyse By acting as a pig, the compositions of the present invention can inhibit HIV infection against T4+ cells. It can be used as an antiviral therapeutic agent to block receptor binding and to reduce the level of receptor binding. inhibits virus-induced syncytium formation in cells.

The present invention provides methods for expressing soluble T4 protein and its soluble derivatives in suitable unicellular hosts. We achieve these goals by providing DNA sequences that encode "Soluble T4 protein" as used in the specification, [Soluble T4J and [Soluble T4 proteins] The term "polypeptide-like polypeptide" all refers to natural or recombinant soluble T4 protein or is its soluble derivative and soluble T4 protein immunotherapeutic (anti-retroviral) ) or all proteins, polypeptides and peptides characterized by immunological activity. do. These are soluble T4-like compounds from various sources, e.g. Soluble T4 protein derived from soluble T4 protein].

In general, the present invention provides recombinant DNA molecules containing these DNA sequences and Also provided are transformed unicellular hosts. These hosts can be used for a wide variety of treatments, Novel soluble T4 proteins of the invention for use in prophylactic and diagnostic compositions and methods white, polypeptides, peptides and derivatives can be produced in large quantities.

The DNA sequence of the present invention is (a) p199-7, pBG377, I) BG380°1) BG381, p20 3-5, pBG391, pBG392, pBG393.1) BG394, pBG 395, pBG396, pBG397.1) 211-11, p214-10 and and p215-7 DNA insert: (b) hybridized to one or more of said DNA inserts and capable of expression; a DNA sequence encoding a soluble T4-like polypeptide: and (C) upon expression, the DNA inserts and sequences encoded by any of the above DNA inserts and sequences; DNA sequence encoding a soluble T4-like polypeptide upon expression selected from the group consisting of.

According to another embodiment, the present invention provides a D Regarding the NA sequence, this sequence encodes a T4-like polypeptide upon expression. The Furthermore, the present invention provides a recombinant DNA sequence for producing T4 protein using this type of DNA sequence. Also relates to NA molecules and methods.

[Brief explanation of the drawing] Figure 1 shows the elaboration of T4 protein from U937 cells by immunoaffinity chromatography. This is a radioactive photograph showing the product.

Figure 2 shows that immunoaffinity-purified solubilized native T4 protein binds to HI envelope protein. Radiophotographs and Western plot data showing how the cells fit together are shown.

Figure 3 shows the nucleotides of T4 cDNA obtained from PBL clone λ230-4. The sequence and derived amino acid sequence are shown; in this figure, the amino acids are Indicated by a one-letter code: *=Position where a stop codon exists.

In Figure 3, the T4 protein translation initiation region (AA23> is nucleotide 201-2 03 and the mature N-terminus is located at nucleotides 276-2 Located at lysine (AA3) at 78.

Figure 4 shows cDNA clone pBG312. T4 (also called pl 71-1) ) and p170-2.

FIG. 5 is a schematic diagram of the construction of plasmid pEC100.

Figure 6 shows the positions of 74 CDNA clones @3.64 and 231. A comparison of amino acids is shown.

Figures 7A and 7B show purified solubilized T4 protein and recombinant soluble T4 mutant. The protein domain structure of the mutant is shown.

Figures 8A-8D illustrate the methods used to express recombinant soluble T4 (rrsT4J) of the invention. 1 is a schematic diagram showing the construction of various intermediate and other plasmids used Ru.

Figure 9A is a schematic diagram of the construction of plasmid p199-7.

Figures 9B and 9C are schematic diagrams of the construction of plasmid p203-5.

Figure 10 shows synthetic oligonucleotide linkers used in various preparations according to the present invention. shows.

FIG. 11 shows p1997 (PL Mutit-rsT4) and its rST4. Nucleotide and rST4 sequences of the entire plasmid defined by the 2 inserts. The amino acid sequence deduced from It includes a CIaI-C1aI cassette that defines

Figure 12 shows proteins related to induction of rST4.2 expression from 5G936/p199-7. White plot indicates analysis.

Figure 13 is a schematic diagram of the construction of plasmid pBG368.

Figure 14A-100 is a schematic representation of the construction of various plasmids according to the invention.

Figure 15 shows the nucleotide sequence of plasmid pBG391.

Figure 16 shows the nucleotide sequence of plasmid pBG392 at nucleotide 120. 7-1209 and the mature N-terminus is located at nucleotide 12 Located at lysine (AA3) at 81-1284.

FIG. 17 is a schematic diagram of the construction of various plasmids according to the present invention.

Figure 18 shows synthetic oligonucleotide linkers used in various preparations according to the present invention. shows.

Figure 19 shows the nucleotide sequence of plasmid pBG394.

Figure 20 shows the nucleotide sequence of plasmid pBG396.

Figure 21 shows the nucleotide sequence of plasmid pBG393.

Figure 22 shows the nucleotide sequence of plasmid pBG395.

Figure 23 shows pBG38o transfected CHO cells of plasmid p196-10. Coomassie of rST4.2 purified from conditioned medium of cell line 8G380G. It is a stained gel.

Figure 24 is a schematic diagram of the construction of plasmid p196-1.0.

Figure 25 is a schematic representation of the construction of plasmid I) BG394.

FIG. 26 is a schematic diagram of the preparation of I) 211-11.

Figure 27 is a schematic diagram of the construction of plasmid p215-7.

Figure 28 is a schematic diagram of the construction of plasmid p21B-8.

Figure 29A shows the condition of E. coli transfected with pBG211-11. rsT4 purified from node medium. -113.1 Coomassie stained gel.

Figure 29B is a western representation of rs1'-4,-113,1 expressed in E. coli. -Radiophotograph showing plot analysis.

Panels (a)-(C) of Figure 30 show rST4,11 from E. coli transformants. 3.1 purification is shown.

Panels (a)-(C) of FIG. 31 show purified rsT4. -113.1 Reforge This indicates refolding.

Figure 32 shows a 335-metabolically labeled CHO cell line producing recombinant soluble T4. This is a radioactivity photograph showing immunoprecipitation of .

Figure 33 shows immunoplot analysis of the CO37 cell line producing recombinant soluble T4. show.

Figure 34 shows rST4.113.1 and rS binding to 0KT4A or 0KT4. Figure 2 graphically depicts the results of a competition analysis between T4.3 and T4.3.

Figures 35-37 bind to 0KT4A, Leu-3A and 0KT4, respectively. Figure 2 graphically depicts the results of a competition analysis between rST4.111 and rST4.3.

Figure 38 shows rsT4. -ELI for 113.1 The SA analysis is shown as a graph.

Figure 39 shows the results of p24 radioimmunoassay using recombinant soluble T4 according to the present invention. Shown as a graph.

FIG. 40 and FIG. 41 show syncytium using recombinant soluble T4 protein according to the present invention. The results of the system inhibition analysis are shown.

FIG. 42 is a schematic representation of the preparation of plus pBiV,1.

Figure 43 shows bivalent recombinant soluble T4 protein produced by pBiv,1.

[Detailed description of the invention] The DNA sequences of the invention were obtained from two libraries: the T-cell tumor line REX. λcat cDNA archive and λQt10 cDNA obtained from peripheral blood lymphocytes Separated from A preservation material. However, it is possible to create cells from other cells that express T4. Preserved materials could also be used. These are examples of H9 and U 937 included. In order to isolate various fragments of the TJi gene, Preserved materials were also used.

In order to screen these archives, the A series of chemically synthesized oppositely oriented oligonucleotides based on the T4 protein sequence D An NA probe was used.

Plaque-hybridize oligonucleotide probes for screening. hybridized to the cDNA library by hybridization and screening analysis. several kinds Clones were selected that hybridized to the probe. Roughly selected clone After isolating and subcloning the cDNA insert into a plasmid, the nucleus In addition to determining the leotide sequence, we also determined the amino acid deduced from these nucleotide sequences. The acid sequence was compared to the amino acid sequence given in Maton et al. (1985) (supra).

It was confirmed that the CDNA insert encoding the amino acid sequence was characterized.

Nucleotide sequence of full-length T4 cDNA obtained from deposited clone p170-2 , and the amino acid sequence deduced therefrom are shown in FIG. This CDNA sequence It is then subjected to in vitro site-directed mutagenesis and restriction fragment substitution. The cDNA sequence of Mutton was made to be the same as that of Mutton et al.

After modifying the T4 cDNA sequence to be identical to that of mutton, etc., the sample was Cut at various locations to remove coding regions for transmembrane and intracytoplasmic domains. I left. The remaining CDNA sequences encode soluble T4 and retain the extracellular region. It is thought to be responsible for HIV binding.

Then, a variety of proteins featuring this type of CDNA insert encoding human soluble T4 were prepared. Created a clone. These cDNA sequences can be obtained by various methods according to the present invention. can be used. More specifically, these sequences or parts thereof or By using synthetic or semi-synthetic copies of as DNA probes, other Screening human or animal cDNA or genomic archives for soluble T Other DNA sequences related to 4 can be selected by hybridization.

Typically, this type of selection involves conventional hybridization conditions (e.g., approximately below Tm). 20-27°C lower) is used.

However, the preserved material was obtained using a probe from a different species than the one from which the preserved material was obtained. For screening, for example, screening murine archives with human probes In this case, only less strict conditions are required.

CDNA inserts of this kind, parts thereof or synthetic or semi-synthetic copies thereof may also be used for each It can be used as a starting material to create mutants of a species. this species mutants are degenerate (i.e. the mutations are (does not change the amino acid sequence) or non-degenerate (i.e. the mutation does not change the amino acid sequence) or non-degenerate (i.e. the mutation (altering the amino acid sequence encoded by) . Both types of mutations are useful for producing or using soluble T4 according to the invention. It's advantageous. For example, these mutations may result in high levels of soluble T4 production or allows easy purification or higher T4 activity.

For all these reasons, the DNA sequences of the present invention include (a) p199-7, pBG37 7, pBG380゜pBG381.1)203-5, pBG391, pBG39 2, pBG393, pBG394, pBG395, pBG396, pBG397 , p211-11, p214-105 and p215-7 DNA inserts: (b) hybridized to one or more of said DNA inserts and capable of expression; a DNA sequence encoding a soluble T4-like polypeptide: and (C) that upon expression may be encoded by any of the above DNA inserts and sequences; DNA sequence encoding a soluble T4-like polypeptide upon expression selected from the group consisting of.

Preferably the DNA sequence of the invention is Polypeptide of formula AA-23AA362 in Figure 3, polypeptide of formula AA1-362 in Figure 3 Polypeptide, polypeptide of formula Met-AA1 362 of Figure 3, formula of Figure 3 Polypeptide of formula Met-AA1-374 of FIG. Polypeptide of formula AA1-377 in Figure 3, Formula Met-AA1 in Figure 3 377 polypeptide, polypeptide of formula AA-AA in Figure 3, formula in Figure 3 selected from the group consisting of a polypeptide of AA-23AA377 or a portion thereof encodes a polypeptide.

Preferably, the DNA sequence according to the invention roughly corresponds to the point of formula AA - AA in Figure 16. polypeptide, formula AA1 in Figure 16, AAIB2 polypeptide, formula M in Figure 16 et-AA1　1B2 polypeptide, followed by AA　-AA　in Figure 16 Arrangement of amino acid asbaragine-leucine-glutamine-histidine-serine-leucine a polypeptide having a sequence; Formula AA1 in Figure 16 AA1B2 is followed by the amino acid asparagine-leucine a polypeptide having the sequence rutamine-histidine-serine-leucine; The formula Met-AA1.82 in Figure 16 is followed by the amino acid asparagine-leucine- a polypeptide having the sequence glutamine-histidine-serine-leucine; Polypeptide of formula AA-23AAll in Figure 16, formula AA1 AA in Figure 16 polypeptide of formula Met-AA1 111 of FIG. 16, Polypeptide of formula AA-23-AA131 in Figure 16, formula AA-23 in Figure 16 - Polypeptide of AA145, formula AAI of Figure 16 Polypeptide of AA145 , a polypeptide of the formula Met-AA1-145 in FIG. encodes a polypeptide selected from

In general, the DNA sequence of the present invention is or a portion thereof.

In general, the DNA sequence according to the present invention is It has a sequence of subaragin-leucine-glutamine-histidine-serine-leucine. polypeptide, formula of mature T4 protein AAI AA1B2 followed by amino acid As Has the sequence paragine-leucine-glutamine-histidine-serine-leucine polypeptide, The formula of mature T4 protein is Met AAl 1B2 followed by the amino acid asparagine-leu Polypeptide having the sequence: single-glutamine-histidine-serine-leucine , polypeptide with formula AA-23AA1'l'l of mature T4 protein, Polypeptide of formula AAI AAll, formula of mature T4 protein Mei-AA1 16 6 polypeptides or portions thereof. do.

■The amino terminal amino acid of mature T4 protein isolated from cells is lysine, Starting from the third amino acid of the sequence shown in Figure 16. Therefore, soluble T4 protein is In general, it also encompasses the polypeptide of formula AA3 AA377 in Figure 16 or a portion thereof. Contains. This type of polypeptide is a polypeptide of the formula AA3 AA113 in Figure 16. Tido, polypeptide of formula AA3 AA131 in Figure 16, Zaraani, soluble T4 protein White also includes the above polypeptides preceding the N-terminal methionine group.

The soluble T4 protein constructs according to the invention further include truncating the full-length T4 protein sequence at various positions. By cutting and removing the coding region of the eaves membrane domain and the intracytoplasmic domain, HIV It can also be created by retaining the extracellular region that is thought to be responsible for binding. can. More specifically, the soluble T4 polypeptide has oligonucleotide specificity. Mutation; restriction cleavage followed by linker insertion; or enzymatic cleavage of the long T4 protein It can be created using conventional techniques such as.

Alternatively, soluble T4 polypeptides can be synthesized by conventional peptide synthesis, e.g., in-phase synthesis. Synthesis technology [R. B. Merrifield, "In-phase peptide synthesis, engineering: Tetrapeptide synthesis technology" "Synthesis", Journal of the American Chemical Society, Vol. 83, No. 21 49-2154 (1963)].

The DNA sequences of the invention are suitable for major histocompatibility complex antigens and for species comprising A soluble protein that appears to bind to the envelope glycoproteins of viruses (e.g., HIV) Encodes proteins and derivatives. Preferably, they also contain intracellular HIV viruses. It also prevents syncytium formation, which is thought to be the propagation method of russ. Roughly, this et al. link T4+ lymphocytes with antigenic forms of living cells and targets for T4+ cell-mediated killing. It is also possible to prevent interactions between Particularly preferably these are roughly T4 + lymphocytes and viruses whose primary target is T4+ lymphocytes, such as the To IIV virus. It also prevents adhesion with infectious substances.

The DNA sequences of the present invention can be broadly defined as DNA sequences that can be transformed with these DNA sequences. Soluble T4 encoded by these or its induction in cellular animals It is also useful for making the body produce. As is well known in the art, the DN of the present invention To express the A sequence, insert the DNA sequence into expression control elements in a suitable expression vector. This expression vector can be operatively linked to a cell line and used with this expression vector to form a suitable unicellular host. It has to be transformed.

Of course, the operative linkage of the DNA sequences of the invention to the expression control sequences This includes incorporating a translation start signal into the correct reading of the text. The present invention is expressed If the specific DNA sequence does not start from a methionine, the starting signal is at the N-terminus of the product. It gives rise to other amino acids located at the ends (ie methionine). this kind of methi Although onine-containing products can be used directly in the compositions and methods of the invention, they are generally It is more desirable to remove methionine. Polypeptides expressed by these Methods for removing this type of N-terminal methionine from tide are known in the art.

For example, the host and fermentation conditions of the species are such that in vivo almost all N-terminal Allows removal of thionine. Other hosts have shown that the N-terminal methionine in vitro Removal of the component is required. However, these in vivo and in vitro The law is well known in the art.

A wide variety of host/expression vector combinations can be used to express the DNA sequences of the invention. It can be used when For example, useful expression vectors are chromosomal arrays, unstained Fragments of natural sequences and synthetic NA sequences, such as various known derivatives of SV40 and and known bacterial plasmids, such as CotEl, pcRl, pBR322, p Plasmids from E. coli containing MB9 and its derivatives have a broad host range. plasmids such as RP4, phage DNA such as many phage λ derivatives such as NM989 and other DNA phages such as M13 ．． B and filamentous single-stranded DNA phages, yeast plasmids, e.g. 2μ Plasmids or derivatives thereof, and combinations of plasmids and phage DNA vectors derived from, e.g., phage DNA or other expression control sequences. It can be constructed from a plasmid that has been modified for use. For expression in animal cells , plasmid pBG368, a derivative of pBG312 [R.

Kate et al., “Isolation of bovine and human genes and animal specimens for Miura inhibitors.” "Expression of human genes in cells", Cell, vol. 45, pp. 685-698 (198 6)], which is the main late protease of adenovirus 2. Contains a motor.

In general, there is a wide variety of expression control sequences (that, when operatively linked, control the expression of a DNA sequence). sequence) can be used in these vectors to express the DNA sequence of the invention. You can also do it. Useful expression control sequences of this type include, for example, SV40 or adenoma virus early and late promoters, Iac system, trp and promoter regions, f control region of d-coat protein, 3-phosphoglyceride 1-kinase or other Promoters of glycolytic enzymes, promoters of acid phosphatase (e.g. Ph 　5　＞.

Yeast α-mating factor promoter, baculovirus system and prokaryotic or eukaryotic cells. cells or other sequences known to control the expression of the viral genes. Includes polyhedron promoters, as well as various combinations thereof. Animal cell expression contains expression control sequences derived from the main late promoter of adenovirus 2. It is preferred to use

A wide variety of unicellular host cells can also be used with the DNA! of the present invention. ! fil! express the column It is useful for These hosts include well-known eukaryotic and prokaryotic hosts, such as E. coli, pseudomonas, bacillus, streptomyces, fungi (e.g. yeast) strains, as well as animal cells such as CHO and murine cells, African green monkey cells. cells, such as CO31, CO37, B5C1, B5C40 and BMTlo, insects. Includes insect cells, as well as human and plant cells placed in tissue culture. animal cells CHO cells and CO37 cells are suitable for expression.

Of course, not all vectors and expression control sequences express the DNA sequences of the invention. It should be understood that the functions may not necessarily function equally well. Also all hosts may not necessarily function equally well in the same expression system. However, those skilled in the art vectors, expression control sequences, and hosts without undue experimentation and within the scope of the present invention. can be selected without deviation. For example, when selecting a vector, The host must be considered since the vector must replicate within the host. Baek the number of copies of the vector, the ability to control this copy number, and the number of copies encoded by the vector. Expression of any other proteins involved, such as antibiotic markers, should also be considered. .

Various factors must also be considered when selecting expression control sequences. These are the shapes For example, the relative strength of the system, its regulatory properties and its effect on specific specific DNA sequences of the invention. compatibility, particularly with respect to the likely second structure. Unicellular hosts were selected Its suitability for vectors, encoded by the DNA sequence of the invention upon expression. The toxicity of the produced product, its secretory properties, its ability to precisely fold proteins, its fermentation requirements, and and the ease of purification of the products encoded by the DNA sequences of the invention upon expression. The choice should be taken into consideration.

Of these parameters the person skilled in the art will know whether fermentation or large-scale animal culture, e.g. Various vectors expressing the DNA sequence of the present invention in CHO cells or CO37 cells The target/expression control system/host combination can be selected.

The polypeptide produced upon expression of the DNA sequence of the present invention can be can be isolated from cell cultures and purified using a variety of conventional methods.

Those skilled in the art will be able to select the most suitable separation and purification techniques without departing from the scope of the invention. You can choose.

The polypeptide produced upon expression of the DNA sequence of the present invention is substantially of human origin. Contains no other proteins. Therefore, these are T made from human lymphocytes. 4? It is different from J White.

Polypeptides of the invention (; useful in immunotherapeutic compositions and methods; For example, the polypeptide of the present invention can be used to combat infection by agents whose primary target is T4+ lymphocytes. by inhibiting its interaction with these target lymphocytes. Useful. More preferably, polypeptides of the invention are used to target T4-targeted infections. The T44 receptor position of the substance can be saturated. Therefore, these are the cell surface It exerts antiviral activity by competitively binding to the T44 receptor site.

This effect is extremely effective against diseases such as AIDSlARC and HIV infection. It is clear that it is beneficial for the first time. Therefore, the polypeptide of the invention and AIDS, ARC1 HIV infection or HIV infection using the method Humans can be treated. Furthermore, using these polypeptides and methods, retroviruses (e.g., simian immunodeficiency virus) that cause damage to mammals, including humans. It can also treat AIDS-like illnesses caused by substances.

According to one embodiment of the invention, antibodies against soluble T4 protein and polypeptides are Can be used to treat, prevent or diagnose AIDS, ARC and HIV infections Wear.

The polypeptides of the present invention are particularly useful in the treatment of AIDS SARC, t; and HIV infection. It can also be used in combination with other therapeutic agents used. For example, soluble T4 The polypeptide is an antiretroviral agent that blocks reverse transcriptase, such as AZT.

HPA-23, phosphonoformates, suramin, ribavirin and dideoxysilane It can also be used in combination with tidine.

In general, these polypeptides include, for example, α-inkferon, β-inkferon, Ink ferons, including lon and γ-ink feron, or e.g. Used with antivirals such as glucosidase inhibitors like tanospermine You can also This type of combination therapy advantageously uses low doses of these drugs. This can prevent possible toxicity.

In general, the polypeptides of the present invention can be used to selectively remove viral contaminants from blood. It can also be used in plasma delivery techniques or blood bags. According to this embodiment of the invention If so, the soluble T4 polypeptide can be incorporated into, for example, a plasma delivery device. can be attached to solid supports consisting of blocks or glass beads or filters. Ru.

In particular, the compositions of the present invention prevent graft-host disease, autoimmune disease, and allograft rejection. It can also be used as an immunosuppressant, useful for therapy or treatment.

Compositions of the invention typically include an immunotherapeutically effective amount of a polypeptide according to the invention. and a pharmaceutically acceptable carrier. The treatment method of the present invention uses these compositions. and treating the patient in a pharmaceutically acceptable manner.

Compositions of the invention for use in these treatments can be in a variety of forms. . These include, for example, solid, semi-solid and liquid dosage forms such as tablets, pills, Includes powders, solutions or suspensions, liposomes, suppositories, injection solutions, perfusion solutions, etc. do. The preferred form depends on the intended mode of administration and therapeutic application. these pairs The compositions are preferably further carried in conventional pharmaceutically acceptable carriers and well known to those skilled in the art. Contains an adjuvant.

In general, the pharmaceutical compositions of the invention will contain other pharmaceutically important polypeptides, such as α- It can only be formulated using methods and compositions similar to those used for Ink Feron). One dose can be administered. Therefore, these polypeptides are stored in lyophilized form. Immediately before administration, reconstitute with sterile water and use the usual route of administration, e.g., parenteral, dermal. Administration can be by intravenous, intramuscular or intralesional routes. Effective pitch The dosage is 0.5-5. It can be within the range of Oma/body weight 1 kg/day, but It will be appreciated that lower or higher dosages may also be used.

In general, the present invention relates to soluble receptors and methods that target or bind to these receptors. It also relates to its use in diagnosing or treating viral agents.

This type of soluble receptor absorbs viral substances and helps spread viral infections. It can also be used as a means to prevent large-scale attacks.

Alternatively, virus-killing agents can be bound to these soluble protein receptors to kill viruses. It is also possible to provide a direct delivery system for these drugs.

In particular, the polypeptides of the invention are useful for detecting or monitoring the course of HIV infection. diagnostic compositions and methods.

Advantageously, these polypeptides are infectious)-IIV, regardless of the origin of the substance. Useful in diagnosing IV virus variants.

For example, the soluble T4 proteins and polypeptides of the present invention having high affinity for I(IV) Peptides are advantageously currently based on monoclonal or polyclonal antibodies. can be used to improve the sensitivity of existing HIV analysis systems. Yo In detail, these soluble T4 proteins and polypeptides are used to prepare test surfaces. Preparation treatment concentrates HIV present even in extremely small amounts, which can then be used with antibodies. can be confirmed more easily. Zara, soluble T4 protein and polypeptide The HIV envelope protein Cl120 can also be purified using a method.

Alternatively, various analyzes are currently being carried out using the soluble T4 protein and polypeptide of the present invention. It can also be used instead of the anti-HIV antibody used in . These soluble T 4 proteins and polypeptides are preferred over anti-HIV antibodies for two reasons. . First, soluble T4 exhibits an affinity for HIV of approximately 10-9, and this level higher than the 10-7 to 10-8 of anti-HIV antibodies. In general, there are various anti-HIV antibodies. Although there appears to be greater specificity for different HIV isolates, variation in type is observed in soluble T4 Does not affect protein-based assays. Because all HIV isolates are infectious This is because it must be able to interact with the T4 receptor as a prerequisite for this.

For example, a soluble T4 protein or polypeptide may be an indicator such as an enzyme. can be combined with data and thus used for ELISA analysis . Soluble T4 here advantageously contains HIV and free HIV envelope in the test sample. It acts as a measure of both RobC1p120 protein.

Furthermore, multivalent forms of soluble T4 proteins or polypeptides can also be bonded, e.g. or produced by gene fusion technology to eliminate the binding of soluble T4 to HIV. You can also increase it even more.

EXAMPLES In order to better understand the present invention, the following examples are used to explain the invention. Examples of these are for illustrative purposes only and should not be construed as limiting the scope of the invention in any way. do not have.

Great view of the sky Purification of naturally solubilized T4 Native T4 was derived from the T4+- promonocytic cell line U937 obtained from lymphoma. It was purified by immunoaffinity chromatography to approximately 0% purity as follows.

U937 cells [Scott Hammer, New England Deaconess Hospital] Donated by Dr. RPM I 1640.10% FC3 at 106 cells/Inl The cells were grown to 50%, harvested and washed with 1x PBS. The cell pellet was then incubated for 20 mM Tris-HCff (pH 7.7>, 0.5% NP-40 (non-ionic wash) agent), 0.2% NaDOC, 0.2mHEGTA, 0.2mM PMSF and 4X107 cells/mf in 5μi/miB PTI! The bacteria were lysed. this Purification was carried out in the presence of non-ionic detergents, so the generally hydrophobic light membrane domains were T4, which was membrane-bound through this method, was isolated as a solubilized protein. This lysate was added to G53. Centrifuge at 0°C for 10 minutes at OOOrpm, and cool the supernatant at -70°C. Pre-adsorbed with protein A sepharose and/or preadsorbed with protein A sepharose. 19Thy anti-T4 monoclonal antibody immobilized on Gel-10 [Masachu Dana Harbor Cancer Institute, Poston, SE. The cells were passed through an immunoaffinity column consisting of [a gift from Dr. Lis Reinhertz]. This card The ram was thoroughly washed and the bound material was removed with 50mM glycine-HCx (pH 2, 5), 0.15mM NaCl, 0.5% N P-40,5i19/mffP Elution was performed with 8TI and 0.2mM EGTA.

Ten fractions of each eluted fraction were then subjected to 10% 5DS-PAGE under reducing conditions. Each band was visualized by silver staining. As shown in Figure 1, the main A 55Kd silver-stained band can be seen. Next, two types per 55Kd protein We analyzed the amine terminus of this protein and determined that it was naturally solubilized T4. confirmed.

Sequencing of thermosoluble T4 Detergent extracts of U937 cells were determined by immunoaffinity chromatography as described above. The N-terminal amino acid sequence of the solubilized natural T4 isolated from the above was determined.

The technology for determining the amino acid sequences of various proteins and peptides obtained from these Well known in the industry. Automated Edman degradation was selected to prepare solubilized natural T4. The mino terminus was determined. More specifically, approximately 5 μ9 of purified and electroeluted The solubilized natural T4 is gelled and then transferred to a gas phase sequencing device (Applied Bio). Systems 470A> was subjected to automated Edman degradation. Then Edman The PTH-amino acids produced in each cycle of degradation are transferred online to a sequencer. A PTH-amino acid analyzer (Appla Ido Biosystems 120A>.

Direct analysis of the protein provided information on the amine terminal sequence, which was identified as human T4. The amino acid sequence determined from the cDNA sequence of human T4 in the purified protein [Main Tong et al. (1985) supra].

Radioimmunoassay of naturally solubilized T4 To confirm that T4 was enriched in the above purification process, immunoaffinity chromatography was performed. The fractions obtained from the elution step of P, E, Rao et al. Cellular Immunology, Vol. 80, pp. 310-319 (1983)] Based on <74-specificity sandwich radioimmunoassay was analyzed. Remobauer's Trip [Dynachik Lapus Co., Ltd., located in Alexandria, Virginia] wells in 0.05 M sodium bicarbonate buffer (pH 9.4) nI! 0KT4 antibody (AT CCNo, CRL8oo2> or MOPC1 95 (background binding comparison) overnight at 4°C. well and then fill them with 1% FC3 in PBS to remove the protein from the plastic. The binding capacity was saturated. After removing the 1% FC3 solution, add a volume of 50d to these wells. The test sample was added at The samples were then incubated at air temperature for 4 hours. Then the sample was removed and the wells were washed four times with 0.05% Tween-20 in PBS. then , 1125-labeled 19Thy antibody was added at 50,000 to 10 0,000 cpm) and the wells were cultured overnight at 4°C. Then, the well Wash 4 times and separate each well for binding 1125 detection using a Beckman T detector. I did it.

As shown in Figure 1, where the numbers after subtracting the background are plotted, The peak fraction of solubilized native T4 protein detected by radioimmunoassay was This coincided with the 55Kd protein eluate seen by staining.

Western blot analysis of T4 Many antibodies have been developed to detect the T4 antigen, but none of them are protein-produced. (Personal communication from Dr. Ellis Reinhertz). T4 and recombinant Antibodies useful for western blot detection of soluble T4 to follow the purification of soluble T4. Polyclonal antibody against three synthetic oligopeptides in rabbits to develop the body. Hyperimmune anti-T4 antibodies were generated.

These oligopeptides are shown in Figure 3 and were as follows: Oligopeptide amino acid coordination JB-144-63 JB-2133-156 JB-3325-343 These peptides were prepared in advance using conventional phosphoamide DNA synthesis techniques [e.g. Ron Letters, Vol. 22, pp. 1859-1862 (1981)] It was synthesized by These peptides were applied to Applied Biosystems 380A DN. It was synthesized using A synthesizer and purified by gel electrophoresis.

(i) Binding of T4 peptide to BTG Each of these peptides was Rothbard et al., Journal Experimental Methods, No. 1601, No. 2 08-221 (1984) and R. C. Kennedy et al. "Antiserum identifies HTLV-III envelope glycoprotein", Science , Vol. 231, pp. 1556-1559 (1986). Therefore, the carrier protein bovine thyrogobulin (rBTGJ) (Missouri, Sigma Corporation, located in St. Louis.

More specifically, 10 mg of BTG diluted in 117112 PBS was added to 1.3 m-maleimido-benzoyl-N-hydroxysuccinimide ester of mQ ( rMBsJ’) and 0.5 m dimethylformamide (rDMFJ). It matched. This reaction mixture was thoroughly mixed and reacted at 25°C for about 1 hour. I let it happen.

The mixture was then soaked in 0.1M PBS (pH 6.0>) equilibrated in advance. It was packed into a Dex G25 gel filtration column (Pharmacia, Sweden).

All 32 d elution fractions were then collected and 28 d for each fraction. Absorbance at 0 nm was measured (rAJ). Next, add 3 pieces of pea flour ( 15, 16 and 17) were collected to form activated carriers.

Dissolved to create a sodium borohydride solution. Then approximately 8 mCl of each synthetic T 4 peptides JB-1, JB-26 and JB-3 in 1 d of 0.1 MI salt buffer. dilute and then mix each solution with 200 μe of sodium borohydride solution and The mixture was incubated on ice for 5 minutes. Next, each peptide solution was heated to 25°C. Warm and add each solution to 1N HCJ! Therefore, p) is 11.0 and no foaming occurs during that time. ), then each solution was brought to pH 7.0 with 1N NaOH (after foaming had stopped).

The 1.2d peptide solution was then added to the activated carrier solution of 6- Each peptide was then bound to BTG.

The binding reaction was allowed to proceed overnight by incubating the reaction mixture at room temperature.

(ii) Inoculation of test animals Each of the BTG-binding peptides created above was added to a sterile Freund-completed Ajoba tube. The bound peptide was dissolved in PBS to a final concentration of 1 μ9/d. Then, Each of the above-mentioned conjugated peptides was administered intramuscularly to three rabbits (New Zealand White breed). 500i was inoculated. Do the same for the fourth rat (New Zealand White). and inoculated with a mixture of three binding peptides. All rabbits are pre-bleeded before boosting An average baseline was established for each response to be measured. 5004 rabbits boosted for 6 weeks in incomplete Freund's adjuvant with the binding peptide of .

Serum was collected monthly from each rabbit for 4 months after immunization (iii) Peptide ELISA with anti-peptide serum against target plate In this analysis, peptides JB-1, JB-26, and JB-3 were activated. It was confirmed that the antiserum generated within the product bound to the peptide. therefore , these peptides are immunogenic and induce a response in test animals.

In order to conduct the analysis, Imulon-2 (Alexandria, Virginia, Dy. (Nachik Lapus) Micrometer plate was placed in one well of 50 ml of unbound chloride in PBS. 50tI9/mi and incubated the plates overnight at 4°C. Ta. Peptide 46R acts as a comparison [Peptide 46 is en Corresponds to amino acids (rAAJ　’) 728-751 in the v gene, and the amino acids Number Hashi, Ratner, etc., complete information on rAIDS virus, HTLV-Ill. "Reotide Sequence", Nature, Vol. 313, pp. 271-284 (1985). Corresponding to that shown, peptide 46 has the sequence: Plates coated with [with] were treated similarly. Then these plates Washed 4 times with PBS-Tween (0.5%) and 4 times with water. Lightly press the boot Pat it dry with a paper towel. After blotting the plate, add 200 1II! of 5% FC3/PBS solution and incubated the plates at room temperature. It was cultured for 1 hour.

Serum samples from rabbits were then analyzed on precoated plates prepared as described above. . Analyze the antibody response to the immunogen peptide at the initial dilution of i:ioo, A series of 10-fold dilutions in 5% FO3/PBS were then analyzed.

After incubation for 2 hours at room temperature, the plates were washed and blotted dry as above. Ta. Horseradish peroxidase (rHR) in 5% FC3/PBS was then added. PJ)-conjugated goat anti-rabbit IC7G [Malvern, Pennsylvania; 1: Add 5Qd at 1500 dilution to each well. and the plates were incubated for 1 hour at room temperature. PBS-Tweet these plates 0.5% and then a 50 μe plate reader [Alexan, Virginia]. Spectrophotometrically analyzed at 450°C by Dynachik Lapus, Doria.

Antisera against each of peptides JB-1, JB-26 and JB3 were prepared using the corresponding peptides. was observed to bind to peptide.

In general, the antiserum against the mixture of peptides JB-1, JB-2, and JB-3 was It was also observed to bind to peptides JB-16 and JB-3 under the conditions described above. solid phase Measured values for each of the four antisera tested for Vepti r by ELISA is shown below, where rNDJ is an approximate titer whose numerical value has not been determined. JB 1 > 1150,000 0 NDJB-201150,000ND J3-3 0 0 1/10,000 JB-1+JB-21/4,000 ND 1/7,000+JB-3 1 g fractions of 3 anti-peptide sera generated against individual peptides was eluted from the 19Thy (anti-74) monoclonal antibody affinity column described above. The 55Kd T4 antigen band of naturally solubilized T4 was determined by Ustan blot analysis of the isolated protein. identified. As in the radioimmunoassay of native solubilized T4, the 55Kd assay The output value was consistent with its appearance eluate from the affinity column. This is because the T4 purification process This provides further evidence that solubilized T4 has been concentrated.

These polyclonal sera are therefore T4 (native) by Western analysis. and recombinant).

Binding of cell-free T4 to the 1-IIV envelope then from U937 cells. The isolated purified solubilized native T4 was converted into H1v envelope protein gp160/gp120. The binding ability of Surso to was tested. To perform this direct binding analysis, recombinant Cell line 7d2 [Danaf 1-Barr Cancer Institute, Mar. 33 obtained from contributions from Dr. Ku Kowalski and Dr. William Habilchin. 5-labeled gp160/gp120 detergent cell extracts were pretreated with monoclonal antibodies. A sample of solubilized native T4 was preincubated with one species.

More specifically, 5 components of solubilized T4 were collected in a microcentrifuge tube at 0KT (approximately 311f). 4 (ATCCNαCRL8002), i.e. T that does not inhibit HIV binding A monoclonal antibody that recognizes an epitope on 4 [J. A. Hoxsey et al. Null Immunology, Vol. 136, pp. 361-363 (1986) is 5 horses 0KT4A (Ortho Diagnostics Nα7142), Suna Specifically, a monoclonal antibody that inhibits HIV binding to T4-positive cells [J, Ste. Even McDougall et al., Journal Immunology, Volume 137, No. 29 37-2944 (1986)]. Alternatively, 50 μe of solubilized T4 5 horses αHTLV-III gp120 (Dupont No. N-E N-928 4).

These mixtures were then incubated on ice for 1 hour.

Next item, 150/f (7) S35-F identification gp160/c + p12011 extract or 535-labeled comparative cell extract (prepurified with protein A Sepharose). solubilized T4/monoclonal antibody mixture and bring the tube to 4°C. and shaken overnight.゛Then add 30 μe of protein-sepharose to each tube. Conjugate Sepharose to protein by adding and rocking at 4°C for 2 hours. Precipitate T4/C1p160/gp120 immune complexes by binding to I let it happen. The beads were then centrifuged in an Etzbendorf microcentrifuge and vigorously shaken. After washing thoroughly, elute with 40 μe of SDS sample buffer at 65°C for 10 minutes. Ta. The eluted material of 201Ji was then loaded onto a 7.5% 5DS-PAGE gel. and operated under reducing conditions.

Figure 2 shows radioactivity photographs and wafers of T4/Ql)160/Qp120 co-immunoprecipitates. Shows the stamp plot results. In Figure 2, lanes 1 to 5 have 40% support. This is a radioactivity photograph after treatment with sodium ricylate, lanes 6-7 are rabbit anti- This is a Western blot analysis of serum JB-2.

As shown in Figure 2, the Cl1)160/C1p120 protein is 0KT4A (lane 4) was co-immunoprecipitated in the presence of T4 with 0KT4A (lane 4). was not precipitated in the presence of T4. Lane 3 is αHTLV-ICJ Positive for gp160/(7p120 using pI20 monoclonal antibody) Showing a comparison. 335-labeled comparison extract (lane 1) or protein-hesepha Negative comparisons using loose alone (lane 2) are based on gp160/C1p120. The position showed no moving bands. Based on the bands developed in the Western plot and T precipitated with 0KT4 (lane 6) or 0KT4A (lane 7). The amounts of 4 appear to be the same.

This indicates that native membrane-bound purified solubilized native T4 is still in solution with HIV glycoproteins. Indicates that they interact. Therefore, cell-free soluble T4 can be used to treat HIV and T4+ may be useful in preventing binding interactions with T4 receptors on lymphocytes. It will be done. Competes with cell surface T4 for binding to HIV envelope protein (H) 120. Together, soluble T4 is useful in blocking HIV infection.

Synthesis of an oligonucleotide DNA probe said to encode the fully human T4 protein. The nucleotide sequence and deduced amino acid sequence of the cDNA have been reported. [Mutton et al. (1985) supra]. The predicted main structure of T4 protein is shown below. Divided into domains that indicate hydrophobic/secretory signals -23 to -1 Similarity to V-region/extracellular +1 to +94 Similarity to J-region/extracellular Glycosylation region +95 to +109 / Extracellular +110 to +374 Hydrophobicity / Light membrane sequence +375 to +395 extremely hydrophilic/in cytoplasm +396 to +435 upper Based on the sequence of this domain, conventional phosphoamide DNA synthesis techniques [e.g. Rahedron Letters, Vol. 22, pp. 1859-1862 (1981)] was used to chemically synthesize opposite oligonucleotide DNA probes. applied ・Synthesize the probe using Biosystems 380A DN A synthesizer, These were purified by gel electrophoresis.

Generally speaking, the amino acid sequence should be complementary to the DNA sequence encoding the amino acid sequence. Pro-identification is performed so that the probe is in the opposite direction, and hybridization can be made to this. I did it. Nucleotide sequences in 11 selected regions of T4 protein [Matton et al. 1985) (corresponding to the nucleotide numbers shown above) are as follows: Met: 2 742-765 3 1414-1440 6 427-453 7 1303-1329 8 1012-1038 9 97-118 10 10-36 11 1698-1724 12 397-423 14 261-28ma Before using the above DNA probe for screening, -terminal strand DNA probe using [γ-P32]-ATPt3 and σT4 polynucleotide kinase, - Each of the end-strand DNA probes was substantially A, M, Maxam and W, Gilbert. "A Novel Method for Sequencing rDNA", Proceedings National Le Academy Science USA, Vol. 74, pp. 560-564 (197 7)].

Creation of λQt10 terminal' blood lymphocyte cDNA preservation 1 Peripheral blood lymphocytes (PBL) PBL from a single leucophoresis donor to create a cDNA archive. Mononuclear cells were removed by one absorption process. Non-adherent cells were then treated with IFN Stimulated with -γ1000U/d and 10u9/rnllP HA for 24 hours.

Phenol extraction [Maniatis et al., Molecular Chloratory (1982)] RNA was isolated from these cells using PolyA+mRNA was created by matography. RNA was ethanol precipitated This was dried in a speed vac, and the RNA was reconstituted with 101III H20. Suspended (0.51 #e). This RNA was incubated with CH3H for 10 min at room temperature. gOH (final concentration of 5 mH) and β-mercaptoethanol (0,26 M). Processed. The Q-methylmercury-treated RNA was then incubated at 43°C in iM human-H Cff (pH 8,3>, 0.01MfV1g, 0.01M DTT12mH buffer Nazir complex, 5JI9 oligo”12-18.20mHKCl, 1mHdCTP SdGTP, dTTl), 0.5mHdATP.

2 μc i [α-P32] dATPctjJ: 30 units (D L5pl It was added to AMV reverse transcriptase (Seikagaku America Inc.) at all times of 50 days. This mixture After incubating the mixture at air temperature for 3 minutes and then at 44°C for 3 hours, the reaction was The reaction was stopped by addition of 0.5M EDTA.

The reaction mixture was extracted with an equal volume of phenol:chloroform (1:1) and the aqueous layer was precipitated twice with 0.2 volumes of 10M NH4AC and 2.5 volumes of ETOH, This was dried under reduced pressure.

The yield of cDNA was 1.5 cycles.

Okayama and Hertz's method [Molecular Cellular Biology, Vol. 2, 161 (1982)] and Gabler and Hoffman [Gene, Vol. , pp. 263-269 (1983)]. was synthesized, however, a large fragment of DNA polymerase was used for this synthesis.

80% TA buffer (0,033M Tris acetate (pH 7,8): 0, 066M K acetate: 0.01M Mg acetate; 0.001M D TT:50u9/mffBsA) and 5mRNase A and 4 units of RNase H and 5 0 MM β-NAD and 8 units of E. coli ligase and 0.3125 mH dA TP, dCTP.

Resuspend the DNA in 12 units of dGTP and dTTP and T4 polymerase. The double-stranded DNA was plant-terminated by Incubate for 90 minutes, add 1/20 volume of 0.5M EDTA, and add phenol. Le: Extracted with chloroform. The aqueous layer was separated using a G150 Sephadex column. 01 M Tris-HCl (pH 7.5>) and 0.1 M NaCl and 0.001 The leading peak containing double-stranded CDNA was chromatographed with M EDTA. Collect the following, and combine it with two fAcDNA linkers - 35/36: 5 parts MT TCGAGCTCGAGCGCGGCC to C3'3'GCTCGAGCTCG It was bound to CGCCGGCG51 using a conventional method. Then 800bp and above The long fragments were then size-selected on a 5500 Cefacrylic column, which was then subjected to E C0RI-cleaved bacteriophage vector C1tlO [Ellis Ry Donated by Dr. Nherz]. Manufactured by Gigapack (Strategene) One portion of the coupling reactants was charged according to the manufacturer's instructions. Using loaded phage Infect E. coli BNN102 cells and inoculate the cells into plates to proliferate. I set it. The obtained preservation product is 1.125x 1. Contained QB independent recombinants .

In addition, bacteriophage vector gtio [Dr. Ellis Reinhertz] We screened the PBL cDNA archives, which were donated by REX and Synthesized from mRNA obtained from a T4+ tumor cell line called [0. Act et al., [Human T cell receptor: IL-2 dependent Clone and TI [ontogeny and "Biochemical Relationships", Cell, Vol. 34, pp. 717-726 (1913)].

Screening of preserved items Three types of p32-labeled synthetic oligonucleotide opposite direction probes ( That is, probes 3.6 and 9) were used to detect two λQtlOC DNA conservancies. In parallel screening, R. Kate et al. "Isolation of Bovine and Human Genes and Expression of Human Genes in Animal Cells", Cell , Vol. 45, pp. 685-698 (1986)'. A modified screening technique was used with slight modifications. Tetramethylammony chloride Modifying Kate et al.'s method by hybridizing without using to test plaque filters by using unique probes rather than mixtures. did.

Preliminary A, Maxam and W, Gilbert, Methods Enzymology, Vol. 68 , pp. 499-480 (1979)] [λ-p32]AT Using three probes 5' end-labeled with P, PBL cDNA stocks and The REXC DNA library was screened in parallel.

Screening of PBL archives revealed that the A nearly full-length soluble 74 CDNA clone containing a cleavable 3,064 Kb insert. λ203-4 (i.e. λQt10.PBL, T4). Ta.

Screening of REX cell stocks containing a 1200 bp CDNA insert An incomplete T4 cDNA clone was isolated. Then, rough DNA sequencing DNA from these clones was characterized by analysis.

Bacterioff created in Vector EMBL3 by Mark Zarani and Dr. Pasek Argis Human Genome Archive (Biogiers, Cambridge, Massachusetts) Inc.) [N, Murray, Lambda 2nd edition, R, Hendrick Su, J., Roberts, F., Stahl, R., Weisberg, pp. 3935-3422. (1983)] was screened. This archive is a human lymphoblast cell library. GM'1416.48, xxxx in Camden, New Jersey, Hiyuma. Chromosomes obtained from the Genetic Mutant Cell Depository DNA was partially cleaved with 5au3a and described in Maniatis et al. (1982) (above). Bind to the EMBL3 arm pre-cleaved with BamHI according to the method described above. Contains DNA fragments created by Plate inoculation of phage stocks, lysis and Transfer of phage DNA to and nitrocellulose was performed using W.

Benton, D. and David, R.W., “In situ hybridization of single plaques.” ``Screening of λgt recombinant clones by transfection'', Science, Vol. 196, p. 180 (1977) and Maniatis et al. (1982). I did as I said. The hybridization conditions were as per Kate et al. (1986) (above). The conditions were as described above, except that tetramethylammonium chloride (TMACJ 2) was omitted from the washing buffer.

Approximately 2,000,000 plaques were hybridized in parallel to the above probe 1. and probe 3. Probe with main screening substance A type of phage called 0M47 hybridized with 3 was subjected to DNA sequence analysis. between the coding sequences for predicted extracellular and transmembrane domains. The presence and location of introns were determined.

Phage clones with the T4 sequence were screened with probe 1. Not found. This is probably because it contains sequences interrupted by introns. It seems [0. R.

Littmann and S.N. Gelatner, Nature, vol. 325, no. 453-4. 55 (1987): and observations of the inventors].

Partial sequence analysis of 0M47 revealed that the main sequence valine (amino acid 3) predicted for T4 63), indicating that the intron interrupts the sequence corresponding to the codon for (3rd (indicated by solid intron lines in the figure). This intron introduces a stop codon forming a potential site for expressing the soluble form of T4. Code for T4 Other introns found within the sequence are for arginine (amine 1295> The third intron at 0M47 interrupts the arginine codon ( exists between the codons for amino acid 402) and arginine (amino acid 403). (Figure 3).

Sequencing of cDNA clones Next, the EC0RI cut DNA from clone λ203-4 was transformed into an animal expression vector. pBG3'l2 [R, Kate et al., supra] and sequence analysis. Made it easier. More specifically, as shown in FIG. 4, λC1t10. PBL, T 4 was cut with EC0RI to obtain a 3,064 kbp fragment containing the full length 74 cDNA. The EcoRI-EcoRI fragment was excised.

This cDNA sequence containing the entire coding region for soluble T4 and full-length T4 was It was deposited as pl70-2. This fragment was pre-isolated using T4 ligase. By ligating to the RI-cut animal expression vector pBG312 (described above). pBG312. T4 and p170-2 were created (Fig. 4 λ, then maki Sam Gilbert's technique [A, M, Maxam and W, Gilbert, rDNA "A Novel Method for Sequencing", National Academy of Proceedings ・Science USA, Vol. 74, pp. 560-564 (1977)] pBG312. The nucleotide sequence of the EC0RI fragment of T4 was determined [Mato (1985) (supra). (see Figure 3).

This analysis was carried out using a 3.064 kb [) PBL full-length complementary DNA copy of T4 cDNA. - approximately 200 bp of coding sequence and 5' non-coding sequence for T4 and 3' non-coding sequence. It was shown that it contained about 1500 bp of a unified sequence. Next, by Pst engineer pBG312. T4 was cut and the resulting 3' overhanging end was removed with Klenow, A fragment of about 2.5 kbp was roughly separated. This fragment was then inserted into pBG312. Plasmid p17 was inserted into the relinker (previously restricted at the SmaI site). 0-2, which has the full-length PBL T4 cDNA sequence (see Figure 3). ).

As shown in Figure 3, PBL T4 cDNA was derived from Mutton et al. (1985) (upper It has a nucleotide sequence almost identical to the approximately 1,700 bp sequence reported in Ru. However, this PBL T4 cDNA is a translation product of this cDNA. A protein with three amino acid substitutions compared to the sequence reported by Mutton et al. It has three nucleotide substitutions that produce .

As shown in Figure 3, these differences exist at amino acid position 3, where mutton Asparagine is substituted by lysine, and at position 64, tryp in mutton Tophane is replaced by arginine, and matophane is substituted at position 231. Phenylalanine, such as , is substituted with serine. Mutton instead of Sujin The asparagine reported at position 3 in et al. is the result of a sequencing error [Richard et al. Dr. de Axel personal communication].

Meaning of amino acid substitutions at positions 6421”3 and 231 that may exhibit allelic polymorphism [T., C. Fuller et al., Human Immunology, Vol. 9, pp. 89-102 (1982): W, Stoll and H, G, Kunkel, Scandinavia, J. Null Immunology, Vol. 20, pp. 273-278 (1984): N. Amino et al., The Lancet, Vol. 2, pp. 94-95 (1984): and M., Sa. Toh et al., Journal Immunology, Vol. 132, pp. 1071-1073 ( 1984) is unknown.

DNA sequence analysis of the insert in pEcloo of the REX clone [Maxam and and Gilbert, supra] suggest that this represents the product of a cleavage error.

This is because the 5' non-coded sequence is the GGT code for glycine (amino acid 49). This is because it seems that the cleavage occurs due to the coding sequence starting with and Figure 5). Glycine (amino acid 49) to isoleucine (amino acid 435) The T4 coding sequence in pEC100* up to (above) [*Incomplete T4 cDNA clone from REX archive] Cut the loan with EC0RI and isolate the 1.22 bp cDNA insert. to create pEoloo, which was then cut in advance with EC0RI to create pEC pUcl2 with loo formed (based in Indianapolis, Indiana) (Ringer Mannheim).

For comparison, the initial N-terminal protein sequence of native T4 protein purified from U937 cells was Column analysis shows T4 expression products with asparagine as amino acid 3. this The differences between the two are also shown in Figure 6, which roughly shows the λqt10 conservation in REX cells. Genome clone from λEMBL archive; murine T4 sequence [Tourbieri et al., Science, Vol. 234, p. 610 (1986)]: and ovine T4 sequences [Klatsson et al., Immunogenetics, Vol. 23, Vol. 129 (1986)] also shows a comparison of partial clones at corresponding positions. ing.

Creation of soluble T4 mutants Then, using in vitro site-directed mutagenesis and restriction fragment substitution techniques, , in sequential steps the T4C DNA coding sequence of p170-2 was reported by Maton et al. The sequence was modified to be identical to the sequence given. First, oligonucleotide specificity test Amino acids at positions 3 and 64 were modified using natural mutations. Then T4 Positive lymphocyte line [0, Kakto et al., Cell, Vol. 34, pp. 717-726 (1 983)] λQt11 isolated from preserved material (to Dr. Ellis Reinhertz) Based on the fragment containing the serine 231 codon of the partial molecule 4 cDNA in Restriction fragment substitution was used to change the amino acid at position 231. Next, the revision The altered 74 CDNA sequence was cut to create a link between the transocular domain and the intracytoplasmic domain. The coded area was removed. The full-length T4 clone is then inserted by linker insertion between the restriction sites. Three different soluble T4 mutants were created from PBL T4, and stable fractions were obtained. The probability of experimentally finding 14 secreted molecules has been increased. The structure of each of these mutants The structure is shown in Figure 7A.

Line A in Figure 7A is J, Kite and R, F, Doolittle, Journal Model. Recula Biology, Vol. 157, pp. 105-132 (1982) It is called Gaubeplot (Rice Kongsin University, Genetic Computer Group). Humanopathic analysis of full-length soluble T4 using a computer program It shows. Line B shows the protein domain structure of full-length T4 [Matton et al. (1985 ) above], where rSJ represents a secretory signal sequence and rVJ represents an immunological signal sequence. Robulin-like variable region sequence is shown, rJJ is immunoglobulin-like binding region. rUJ indicates a unique extracellular region sequence, and rTMJ indicates a transocular sequence. and rCJ indicates a cytoplasmic region sequence. In line B, the ocular amino acid sequence and The aligned sequences of the following species are shown below the TM domain. Line C is a recombinant soluble T4 protein. rsT4.1 in natural mutant pBG377, rsT4.1 in p8G380. Figure 2 shows the protein domain structure of rST4.3 in pBG381 and pBG381.

Line D is the E. coli rsT4 gene lacking the T4 N-terminal signal sequence (S). The protein domain structure of the child (Met complete structure) (p199-7> is shown.

Full-length soluble T4 cDNA analyzed for intron/equilan boundaries or human lobulacy Cut at a position corresponding to one of the protein domain boundaries defined by the prediction As a result, three types of soluble T4 mutant gene fragments were first created. Than Specifically, the synthetic linker has a unique A into the vaI site to generate an in-frame translation stop codon, thus creating a full-length T4 sequence. An R4 gene was created in which the transocular domain and cytoplasmic domain of the column were deleted.

For example, the mutant rsT4.1 in pBG377 was That is, it corresponds to the position of the intron that separates the extracellular and transocular domain exilans. cleaved by insertion of a stop codon after the lysine). This intron and meridian The position of both the domain and the adjacent intron separating the cytoplasmic domain is shown above. DNA sequence of chromosome T4 clone isolated from the λEMBL3 genome archive Determined by analysis.

Although the significance of the intron positions that align the T4 transmembrane domain is unknown, the gene structure The determination of provides important information for designing rST4 mutants. Because, This is because ekilans often form functional domains [W. Gilbert, " "Why genes are divided", Nature, vol. 271, p. 501 (1978) ].

The T4 cDNA was then inserted into the transocular and extracellular domains at amino acid 374. mutant rsT4.2 in pBG380 by cutting at the border of It was created.

Roughly, amino acid 377 (i.e., 3 amino acids from the transocular/extracellular domain border) By cutting the T4 cDNA at a position downstream of the amino acid and within the transocular domain) From this, a mutant rST4.3 in pBG381 was created.

D., Schdraus et al., “Active site of triose phosphate isomerase: modification. In vitro mutagenesis and characterization of enzymes,” Proceedings National Academy Science USA, Vol. 82, pp. 2272-2276 (1985 ) using oligonucleotide site-specific mutator technology according to A fourth soluble T4 mutant was created from T4 clone PBL T4. This sudden The structure of the natural variant is shown in Figure 7A, line D, which includes the T4 N-terminal signal sequence ( E. coli rsT4 gene deleted (Met-complete rsT4.2) construct (Deposited as p199-7).

In addition, various other soluble T4 deletion mutants were created to eliminate any small portion of the T44 region. It was determined whether the fragments produced proteins that bind to HIV. The creation of these Based on the finding that the amine terminal sequence of T4 is required for binding to HIV Ta. This finding indicates that the monoclonal antibody 0KT4A is T4 positive due to HIV. Block infection of cells and identify epitopes in the amino portion of T4 It is based on the observation [Fuller et al., supra] that it appears to be. Deficient in glycosylation Fragments of scale species T4 that bind HIV and inhibit infection are found in E. It can be produced in coli or chemically synthesized.

The structures of each of these deletion mutants are shown in Figure 7B. In this drawing, line A shows the protein domain structure of full-length T4 [Matton et al. (1985), supra, Figure 7A]. show. In line B, the protein structure of the recombinant soluble T4 mutant is as follows: Shown: rST4.7 at p203-5, rS in pBG392 T4.7, rsT4.8.1 in pBG393) rST in BG394 4.9, rsT4.10. in pBG395. rsT in pBG397 4.11, rsT4.12 in pBG396, r in pBG215-7 sT4.111, rsT4.113.1 and pB in pBG211-11 rsT4.113.2° in G214-10 5t at amino acids 183 and 264 of rST4.2 By cutting after the uI site, the soluble T4 derivative p203-5, DBG3 92, pBG393, pBG394 and pBG396 were constructed.

More specifically, by cleaving rsT4.2 cDNA at amino acid 182, p203-56 and I) BG392 derivative rST4.7 was created. . Roughly, rsT4.2 cDNA was synthesized with amino acids 113 and 166, respectively. rST4.9cl'' in derivative pBG394 by cleaving; and p rST4.12 in BG396 was created. Zarani, rsT4.2 cDN By cleaving A at amino acids 131 and 145, respectively, the derivative pBG rsT4.10 in pBG395 and rs74.11 in pBG397 were created. accomplished.

Expression of T4 and Soluble T4 Polypeptides in Bacterial Cells cells to transform eukaryotic and prokaryotic host cells using techniques well known in the art. recombinant soluble T4 polypeptide in clinically and industrially useful amounts. can be produced.

For example, create the expression vector p199-7 as shown in Figure 9A as follows. Ta.

First, by creating various intermediate plasmids as shown in Figures 8A to 8D. The preparation shown in FIG. 9A was carried out. These are created using conventional recombinant techniques. became. The linker used to create them is shown in FIG.

As shown in Figures 8A and 8B, the arrangement of Mutton et al. (1985') (supra) A long T4 DNA sequence encoding T4 characterized by three different amino acids from the sequence Starting from p170-2 with Created. Some of these constituents have one or more of their amino acids It is characterized by being changed to correspond to each amino acid such as ton. This drawing and In the and other figures, amino acid changes are indicated by arrows.

Plasmid 1) 192-6 contains all 74 N-terminal signal sequences as shown in Figure 8C. Met induced by oligonucleotide site-directed mutagenesis to remove columns Complete rST4.2 by performing the steps described in Figure 8D to A plasmid containing the complete Met rsT4.2 sequence aligned with the C1a restriction site. ) was created. Optimize the spacing between p195-8 and the Met codon. 8th In Figure D, 5T8rC1- is pAT15, which encodes tetracycline resistance. 3-based plasmid with rop-mutants allowing for high plasmid copy numbers. Natural mutations and promoter and ribbon genome connections from batatteriophage gene 32 It has a binding site and a gene 32 transcription termination sequence.

Cleavage of p195-8 with C1aI is the fragment used to create p199-7. fragment, whose creation follows the expression of Met complete rST4.2 under the control of the PL promoter. (Figure 9A). As a first step, the expression of rST4.2 is p1034 (p1muGcsF ) was used to create vector p197-12 (Figure 9A).

Next, I) 1034 was cut with ECOR and [3BmHI, and GC3F The cDNA insert and a portion of the phage mu liposome binding site sequence were excised; This was then rearranged with oligonucleotides. The synthetic linker used was 57-60 (Figure 10).

A synthetic linker was then attached to the EcoRI/BamHI cut p1034, p197-12 was created. Alternatively, these steps can be replaced with promoters and promoters. Any suitable E. coli with a ClaI site appropriately positioned between the sequences with the It is also possible to start from a reexpression vector. Cut p197-12 with C1aI , or') cDNA sequence of rST4.3 in pBG381 and I) from 1034 Insert the C1aI-C1aI cassette containing the obtained phage transcription terminator. I entered. The arrangement of this cassette is shown in FIG. The resulting plasmid p199- 7 has the rST4.2 rMet complete gene in its vector.

Alternatively, the complete Met rST4.2 sequence can be found in plasmid pBG, which has been deposited with this application. p192-6 can also be derived from p192-6, and the signal sequence can be excised to form p192-6. It would also be possible to do so.

The expression of p199-7 was tested as follows.

5G936, i.e. Eco+) l on htpr duffle mutant (A TCo 39624) [S, Bot and A, Goldherk, “E. "ATP-dependent protein degradation in the body", Maximizing Gene Expressi John, W., Retznikov and Tori, Gold (eds. (1986)) using the conventional method [ 5G93 was transformed with p199-7 according to Maniatis et al. (1982) 1. 6/p199-7, i.e. Met-complete rST4.2 behind the PL promoter A mutant was formed that carried a plasmid containing the gene. These mutants 10mcg/rail tetracyclycium (selected on LB agar plate containing teB) did. After plating several single colonies to isolate single colonies, rST4 ．． One species was randomly selected to test for induction of 2-synthesis. Single colony LB- From agar tet+ plate, 20th Ruri in 125d shake flask Catch Abros (LB) and tet of 10mca/me, and shake it. New Prunswick Science, Jersey, aerated culture device The cells were grown overnight at 30°C (Fick & Co.).

The 0.5 m overnight culture was then grown in a 50 d LB and a 50 d flask. Induced culture was started by adding tet and tet, and the culture was incubated at 30°C with shaking. It was grown in an air incubator. After the culture reached an OD of 0.4 (600), it was Transfer to a 2°C water bath and shake gently for approximately 20 minutes. After heat induction at 42°C Place the flask in an aerated incubator at 39°C in New Brunswick, New Jersey. Shake vigorously at 250 rpm. Ta. Immediately after heat shock at 42°C and at each time point over 4 hours and then overnight growth. Let it grow.

After that, samples were taken. Proliferation of these samples was measured by OD (600). Coomassie blue protein staining and rabbit anti- 5OS-PA by Western blot analysis with the peptide antibody probe (described above). Analyzed after GE. Based on relative molecular weight and protein plot analysis, rs74 ．． Expression of 2 was induced from 5G936/p199-7 after heat induction at 42°C ( Figure 12).

Transformation was performed using Nucleotide and amino acid sequences of p199-7 is shown in FIG.

Expression of soluble T4 from p199-7 in E. coli was determined by 5DS-PAGE. Determined by subsequent Western blot analysis of whole cell extracts, during which rabbit polyculture Using local anti-peptide JB-1 or anti-peptide J8-2 antibodies as probes. (Figure 12).

Furthermore, expression vector 1) 203-5 shown in FIG. 9B was created as follows.

Starting from p197-7, this is the PL mu vector p197-12 (Fig. 9A ), but with the 5' non-coding region following the PL promoter. There is a single nucleotide deletion in . Nucleotide Nα40 of p197-12 This deletion (see Figure 11), which is a deletion of (i.e. adenine) It is caused by a deletion in the region created from 4 to 60 (see Figure 10). p 197-7 has an rsT4.2 gene consisting of 374 amino acids.

Alternatively, p197-7 can be used as a starting plasmid.

p197-7 was cut with CIaI. Furthermore, p195-8 (Figure 8D and (see Figure 9A) was also cut with C1aI to create C containing the cDNA sequence of rST4.2. The 1aI-CIaI force set was removed. Then the C1aI-C1aI cassette was inserted into p197-7 to create p19B-2.

pi9B-2 was then cut with 5tuI to remove 800 ml of the mature T4 protein coding sequence. (Amino acids of [il (amino acids 185 to 264) were removed. However, unexpected methylation prevented cleavage at the second 5tuI site. As a result, only the Stu site at amino acid 184 was cleaved. After the join, The plasmid DNA was transformed into E. coli, and the deletion was performed using a conventional method. plasmid clones were examined. None of these plasmids contained the expected Stu There were no defects.

Subsequent DNA sequences for one of these plasmids, called p203-5. The analysis revealed two guanine residues (amino acids 183 and 1) in the 5tuI identification sequence. 84; nucleotides 818 and 819 in Figure 3) are exonuclease contaminants. cleavage based on exonuclease cleavage caused by the use of Stu engineered enzymes. It was later shown that it was deleted. This dinucleotide deletion is amino 11182 (glutamine) resulting in a translational frameshift after and from the frameshift We wanted to introduce a stop codon consisting of 6 amino acid codons downstream (Figure 9C). Second The unexpected methylation of the 5tuI site and the deletion resulting in a new stop codon are identical. Together, the genes encode a truncated form of recombinant soluble T4 called rST4.7. formed a child. The rsT4.7 sequence is the 182 amino acids @N-terminal of the mature T4 sequence. 6 amino acids of the non-T4 sequence at the end segment and the C-terminus (i.e. lagin-leucine-glutamine-histidine-serine-leucine) and finally TA It encodes the A stop codon.

Expression of soluble T4 from p203-5 in E. coli was determined using the Western method described above. Determined by plot analysis.

Expression of T4 and soluble T4 polypeptide in animal cells Soluble T4 gene and membrane Both the unmodified gene encoding conjugated T4 and the animal expression vector pBG36B inserted into. More specifically, each of the soluble gene constructs was isolated from an adenovirus. Plasmid pBG37 was inserted into pBG368 under the transcriptional control of the late promoter. 7, pBG380 and pBG381 were constructed. Zarani, pBG378 and We created two pBG312-based constructs called pBG379, which are Directs the expression of recombinant long T4 protein.

pBG378 and pBG379 encode the same full-length T4 protein, but pBG3 In No. 79, a portion of the 3' untranslated string has been removed. Then recombinant soluble T 4. To test the expression of lj and recombinant full-length T4, Chinese hamster ovary cells (r cHOJ) simultaneously with one of the above plasmids and plasmid pAdD26. transfected.

First, pBG368 was created as follows. As shown in Figure 13, Cellular expression vector pBG312 [R.

Kate et al., “Isolation of bovine and human genes and animal specimens for Müller inhibitors.” "Expression of human genes in cells", Cell, vol. 45, pp. 685-698 (198 6)] EC0RI and the resulting plasmid pBG368 contain the cloned region left in.

More specifically, the restriction enzymes EC0Ri and 4 were filled in with Klenow, respectively. After recombining T4 nucleotides and demonstrating the temporal origin of soluble T4, soluble A stable cell line continuously expressing T4 was created. To do this, a stable A cell expression host, i.e. dihydrofolate reductase deletion mutant (D HFR″″) Chinese hamster ovary cell line [F., Cao et al., “Mammalian Cell Remains” "Complementary analysis of genetic and glycine-requiring mutants", Proceedings National. Le Academy Sciences, Vol. 64, pp. 1284-1291 (1969) : L, Chesin and G, Aarab, “Dihydrofolate reductase activity. "Isolation of a Chinese hamster cell mutant lacking the Null Academy Science, Vol. 77, pp. 4216-4280 (1980 )] was used.

By using this system, pAdD26 [R , J. Kaufman and P.A. Sharp, “Modular dihydroforate Propagation of sequences co-transfected with reductase complementary DNA genes and "Expression", Journal Molecular Biology, Vol. 159, No. 601-62. 1 (1982)] and co-transfected with the T4 gene construct. At the same time Prior to transfection, all plasmids were linearized by restriction enzyme digestion. 1~ Before transfection, each plasmid is mixed with pAdD26 and pAdD The molar ratio of 26 to T4 was 1:10. This is per transfectant. Maximized T4i gene copy number.

These plasmids combine with each other inside the cell, and through abnormal recombination, the host chromosome structure is A polymer was formed that could be integrated into columns [J. Hynes and C. Wiseman, “Cloned ink by hamster cells with multiple copies of the Feron gene” “Constitutive long-term production of human interferon”, Nucleitsu Acid Research , Vol. 11, pp. 687-706 (1983): S., J., Scahill et al. Product of human immune interferon cDNA gene in hamster ovary cells "Expression and Characterization", Proceedings National Academy of Sciences USA, Vol. 80, pp. 4654-4658 (1983)].

Transfection expressing Mizumi DHFR gene in nucleotide-free medium I chose the font. These transfectants were then subjected to a series of increasing concentrations. of methotrexate (i.e., a toxic fluorate congener that binds DHFR). to select cellular levels of DHFR.

Resistance to methotrexate due to increased expression of DI-IFR is often associated with DHF. It is the result of R gene proliferation, which consists of large chromosomal segments called proliferation units. May contain repeats [R.

Kaufman, J. and Sharp, P.A., “Chinese hamster ovary cell line. ``Proliferation and loss expression of the dihydrofolate reductase gene'', Moreki Cellular Biology, Volume 1, Pages 1069-1076 (1981) ]. Therefore, simultaneous incorporation of DHFR and rsT4 sequences results in rsT4 Enabled gene proliferation. Select stably transfected cell lines isolated by cloning in standard growth medium and then isolated by T4 antigen (RIA>[D, Tara Tsukman et al., Nature, Vol. 321, pp. 767-768 (1984)]. 144 shots were screened using cysJ) isolated by immunoprecipitation from conditioned medium after metabolic labeling. Ta.

In general, the soluble T4 derivative rST4.7 gene was inserted into an animal cell expression plasmid as follows. I inserted it like this.

As shown in Figure 14C, plasmid pBG381 (Figure 14A) was Cut with RI and NheI. Next, F186-6 was subjected to ECOR engineering a and Nh The 786 base pair fragment was removed by cutting with eI. Cut this fragment into p8G381 They were ligated to create plasmid pBG391. .

The T44 portion in pBG391 is located at positions 64 (tryptophan) and 231 ( (1985) (supra) and I ) are identical to both sequences of BG381. However, in position 3 the mutton and I) the asparagine present in BG381 is replaced with lysine. It is. The nucleotide sequence of pBG391 is shown in FIG.

p203-5 was then cut with NheI and OxanI. plasmid pBG392, i.e., rsT4.7, by inserting it into pBG391. A cell expression construct was formed. The T4 sequence in rST4.7 consists of amino acid positions In positions 64 (tryptophan) and 231 (phenylalanine), Mutton et al. Contains the same amino acids as the full-length sequence of However, at position 3, mat The asparagine reported by N et al. was replaced with lysine. pBG392 The nucleotide sequence is shown in FIG.

Figure 14D shows rST4.9 in p8G394 and pBG396. Creation of other animal cell expression constructs with sequences encoding rsT4.12 deletions It shows. These preparations were performed using conventional recombinant techniques. These works Figure 18 shows the linker used for the construction. Nucleus of pBG394 and pBG396 The leotide sequences are shown in FIGS. 19 and 20.

The plasmid pBG393 shown in FIG. 17 is rST4.8, ie, rST4. It has 7 complete types. pBG393 has 182 amino acids of mature T4 sequence. , the C-terminus following amino acid 182 does not contain the non-4.6 amino acids.

The nucleotide sequence of pBG393 is shown in FIG.

Other animal cell expression plasmids according to the invention are constructed as shown in Figure 17. You can also do that. These are rsT4.10 in pBG395 and pBG3 97 (see Figure 18 for specific linkers) .

The nucleotide sequence of BG395 is shown in FIG.

Purification of recombinant soluble T4 Recombinant soluble T4 constructs expressed in DHFR-CHO cells 1) BG380 was 0% fetal bovine serum and 1mH glutamine and antibiotics penicillin and strep α-Modified Eagle medium supplemented with mycin (10075/m & each) (Gibco) until fusion. These cells were divided into two The cells were grown at 37°C in a Tri-system (Nuk). Then, a solution containing fetal bovine serum was added. The fused cells were washed with α-modified Eagle's medium without fetal bovine serum and cultured. The cells were cultured in α-modified Eagle's medium at 37°C for 4 days. Then conditioned medium Collect it and use it in a Millibore/Millidisc 0.22μ hydrophilic filter cart. Filtered with Ridge (Millibore NαMCGL 305-01> and secreted protein A rapid S-ion exchange column (S-Sepharose rapid flow type, Pharmaci 7No. , 17-0511-01) with 20 ml of MES buffer (pH 5, 5). Shrunk.

The binding protein was then mixed with 20 mH Tris-HCj2 (pH 7.7) and 0.3 M It was eluted with NaCl. The elution pool was then diluted with 2 volumes of 20mM Tris-H. Cl(1)H7,7> and then bound this to Affigel-10. 19Thy anti-T4 monoclonal antibody [Poston, Massachusetts; Dana-Farber Cancer Institute, Ellis Reinhertz Expo (Donated by Mr.

The column was thoroughly washed and the bound material was separated into 0.5rd fractions. and 50mH glycine-HCj! (p)-12,5> and 150mH NaC J2 and 0.1 mH EGTA and 5i/mff bovine pancreatic trypsin inhibitor approach (Sigma N (lA1153)) for peptide JB-2. Purification was followed using Western blots developed with different rabbit antisera. . Binding of rST4.2 was determined during chromatography using a silver-stained gel following binding. The incorporation and elution were followed. Figure 23 shows a Coomassie-stained gel of purified rST4.2. It shows.

Sperm from BG380G CHO cells transfected with pBG380 Made r! Gel sizing column chromatography analysis of ST4.2 revealed that rsT4 It is suggested that it is monomeric under physiological II and salt concentrations.

Group: Distribution of soluble T4 protein Recombinant soluble T4, specifically rsT4.2 (i.e. in trans. Purified from conditioned medium of the infected CI-I O cell line BG80G. The N-terminal amino acid sequence of the molecule) was determined as described above, using Applied Automated Edman degradation was performed on a Biosystems 470A gas phase sequencing device. [R, B, Pepinski et al., Journal Biological Chemistry, vol. 61, pp. 4239-4246 (1986)].

This amino-terminal sequence was added to solubilized native T4 isolated from U937 cells (described above). The sequence matched the previously determined sequence. Natural solubilized T4 (sT4) and sperm @ The 7-minoterminal sequence of the rsT4 protein was predicted by Maton et al. (1989) (mentioned above). The mature amino terminus of this sequence Exists at position 3. Solubilized native T4 (Sr1) and C containing pBG380 Recombinant solubilized T4 (rsT) secreted by HO transfectant BG380G 4.2> and Mutton et al. (1985) is as follows: In the above sequence, amino acids are indicated by single letter codes as follows: X: Undetermined or unknown.

Characterizing a single disulfide bridge between cysteine at amino acid positions 13 and 86 This construct encoding a characteristic protein is conveniently expressed in E. coli.

As shown in Figure 24, in order to create p211-11, first p195 -8 (see Figures 8D and 9A) was cut with CIaI to generate rS■4.2. The C1aI-CIaI cassette with the CDNA sequence was removed. Then pA Tl 537”3SH16ΔAm1d, i.e. γ-interface and γ-inkf The cDNA encoding Elon was removed.

Next, this C1aI-C1a1 cassette was converted into C1aI-cleaved E. colipla. inserted in front of the tryptophan operon promoter and linked to p 196-10 was produced.

As shown in Figure 25, then 1) BG380 was added to 7 encoding amino acids -23 to 113 in pBG380 due to natural mutation. 4 By inserting three tandem translation stop codons following the CDNA sequence, pB Created G394.

Then, as shown in FIG. 26, p196-10, pBG394 and p1034 p211-11 was constructed from each fragment. First fragment with vector sequence The fragment was prepared by restricting pi96-10 with HindIll and CIaI to rST4.2. The T4 coding sequence was removed from amino acids 161-374 of the rsT43m gene. It was created by inserting the vector sequence after the 3' end of the child. Second fragment That is, there is a direct stop immediately following the codon for T4 amino acids 61-113 of rST4.9. )-1indl-BgI II upper segment with a stop codon triplet It was isolated by cutting pBG394 with HindIII/Dandan. Third fragment Batatteriophagy T4 transcription stop signal [H, N, Kirushiro and B, Pret , “Nucleotide sequences involved in bacteriophage T4i gene 32 translational autoregulation.” 'Column', Proceedings National Academy of Sciences USA, No. 7 BamHI-c I with Volume 9, pp. 4937-4941 (1982)] aI fragment) was separated by the BamHI-ClaI fragment of p1034. then , these three fragments are combined to create p211-11, i.e., amino acid position 3. T4 construct encoding a 113 amino acid soluble form of T4 protein with sparagine (i.e. rsT4.113.1).

Next, p211-11 was subjected to oligonucleotide site-specific mutagenesis (Figure 27). By changing the amino acid at position 3 from asparagine to lysine, In this case, oligonucleotides were used. C31・ This is plasmid 214-10. That is, T with lysine at amino acid position 3 A fully modified 113-amino acid protein that encodes a 113-amino acid soluble form of 4 proteins. A soluble T4 vector (i.e. rsT4.113.2) was generated. p214-10 was subjected to oligonucleotide site-directed mutagenesis as shown. glutamine and glycylate at amino acid positions 1 and 2, respectively, of the T4 sequence. The oligonucleotide T4AI D-87 was used: this 215-7, i.e. the 111 amino acid of T4 protein with lysine at amino acid position 3. A 111 amino acid soluble T with a trp promoter directing expression of the acid-soluble form. 4 constructs (ie rST4.1'11) were generated.

Then, p218-8, 1 of the T4 protein with lysine at amino acid position 3 The 111 amino acid construct directs the expression of the 11 amino acid soluble form (i.e. rsT 4.111> was created under the control of the PL promoter as shown in Figure 28. .

More specifically, p197-12 (Figure 9A) was cut with CIaI to obtain linker and Generated 101 bp-8 with terminator sequence.

To express rsT4.113.1, E. coli A89 was grown using conventional techniques [mania E. coli A was transformed with p211-11 according to Chiss et al. (1982) supra]. 89/ml IJ SG 936 is a tetracycline-sensitive derivative. stomach - Cori A89 from 5G936 to S, R, Malloy and W.

D. Nunn's method [“Selection for loss of tetracycline resistance by Escherichia coli”, Journal Batteriology, Vol. 145, pp. 110-112 (1981) This method uses a lipophilic chelate that selectively blocks resistant bacterial strains. based on the ability of fusaric acid. In more detail, E. coli 5G936 , 5 g tryptone and 5 g yeast extract and iog NaCj and 109 per J2. of NaH2PO4・H20 and 50 mg of chlortetracycline-HCj2 and 1 A medium containing 2 mg of fusaric acid, 0.1 ml of ZnCj2 and 15 g of agar smeared on the ground. Colony grown at 30°C (presumed tetracycline-susceptible strain) was incubated with tetracycline on an agar plate containing 5 μa/rd of tetracycline. Retested for icrin sensitivity.

One tetracycline-sensitive strain, designated A89, grew on LB agar at 42°C. was shown to be infertile, thus proving the presence of the htpR mutation.

Transformants were selected by tetracycline resistance. Single colony at 20μ Minimal medium + 0.2% casamino acids + tryptophan (100 horses/ml) + Tetrasa Caught in ichrin (1aIg/d) and put it in a 100d shake flask. Cells were grown overnight by culturing at 30°C in an aerated shaking incubator.

The next morning, add 40d of minimal medium + 0.2% casamino acids + 1 to liptophan (100μ9 /d)+tetracycline (iotI! 4~ml) in a 500d flask. An overnight culture of 6oo=0.05 was inoculated. Cells were grown to mid-log phase and then pelleted in water, washed once with minimal medium, then treated with minimal medium + 0.2% Casamino. Resuspended in the absence of tryptophan with acid detetracycline (10, fl/d) Induction was performed by making it cloudy. 0.1.2.3 and 4 hours after incubation and After overnight growth, 0.6-0D cells were removed.

Centrifuge these and boil the cell pellets in Laemmli gel loading buffer. This resulted in bacteriolysis. After centrifugation to remove cell debris, half of each sample was DS-PAGE followed by Western with rabbit anti-peptide antibody probe. Plot analysis or Coomassie blue protein staining (Figure 29A) and Figure 29B).

was purified in two essentially quantitative steps, which were performed under normal and denaturing conditions. Anion exchange chromatography and gel filtration chromatography performed under Including fees.

In more detail, 14 (J) wet cells from 41 shake flask fermentations were DNase of μ9/mi, RNase of 20J19/d, and phenyl of 111IH 100 ml of 2 containing methyl sulfonyl fluoride (rPMSFJ) It was suspended in 0 mH Tris (pH 7,5) buffer. This suspension at 1000 ps I passed it twice through a French press, then passed it through an AS600 type rotor. Centrifuged at og for 15 minutes at 4°C. The resulting pellet was treated with 7M urea. and 10m)1 of 2-mercaptotanol. The suspension was dissolved in a buffer solution (pH 7.5>).Then, this suspension was G ultracentrifugation for 40 minutes at 4°C. The supernatant was diluted with 7M urea and 10mH. 807 20 mH Tris (pl-17, 5> Dilute by adding buffer and pre-equilibrate the 407 sample with the same buffer 3X4Cm Q-Sepharose fast flow column (St. Louis, Missouri) (currently located at Sigma Corporation). This column was replaced with the same Tris/urea/2-mercapto Increasing NaCj from 0 to 0.3 M in ethanol buffer! has a concentration gradient of All fingers were expanded with 400rnll. Open column fraction at 280nm Monitor absorption and perform 5DS-PAGE (15% acrylic) for protein content. amide). Furthermore, these fractions were analyzed by Western plot. It was analyzed. Panel (a) of Figure 30 shows the results obtained by ion-exchange chromatography. Figure 3 is a chromatograph showing the purification of rsT4.113.1. In this drawing, A peak containing rsT4.113.1 is confirmed.

rsT4.113.1 eluted first in the Nacgs gradient and was a low molecular weight stain. It was found that it was sufficiently separated from the dyed material.

To separate rsT4,113.1 from high molecular weight contaminants, rsT4.113. Gel filtration chromatography was performed on the stock containing 1 to finally determine the protein The white was purified to near homogeneity (>95% purity). More specifically, 20 mg of protein 507 in a stirred cell ultrafiltration device (Masachu). PM-30 membrane (Amicon) was used at Amicon, Damper, Setts. It was concentrated to 1 od by . Next, 5. (Equilibrated concentrate of 7 , 5x95cm 300 column (Sigma) and the same Tris/urea/2-mercaptoeta Developed with Nord buffer. Monitor absorption of column fractions at 280 nm and protein content was monitored by 5DS-PAGE. These fractions It was analyzed by rough Western blotting. rsT4.113.1 (about 4111 A stock containing 0) in 157 was thus created.

Panel (b) of Figure 30 shows gel filtration separation of rsT4.113.1 stock. 1 is a chromatograph showing the purification of rsT4,113.1. In this drawing, A peak containing rST4.113.1 is confirmed.

Panel (C) of Figure 30 shows the centrifugation and chromatography step pause. 5DS-PAGE analysis showing the purification of rsT4 derivatives. No. In panel (C) of Figure 30, the lanes indicate: Lane A: molecular weight standard; quasi Lane B: Cell extract Lane C: Cell pellet after solubilization of cell extract under non-denaturing conditions. Lane C: supernatant after solubilizing cell extract under non-denaturing conditions. Lane E: Supernatant after ultracentrifugation step Lane F: Q-Sepharose stock Lane G: 5-33 gel filtration stock.

Lefoulgin of purified rsT4.113.1 Purified rsT4.113 ．． 1 was subjected to non-denaturing conditions and oxidation. More details: 0.5 0D (280) Refolding of proteins at a concentration of /d was performed using 500 volumes of 3M urea, 20 m)l Tris (pH 7,5): 500 times the volume of 1M urea, 0.1M acetic acid ammonium (pH 6,8): and finally to the same volume of phosphate buffered salt aqueous solution. This was achieved by stepwise dialysis. protein throughout the lefoulgin purification process. Samples were analyzed using a 150A liquid chromatography system (California Applied Biosystems, Inc., Hoster City, AL By high performance liquid chromatography (rHPLCJ) carried out by Relative concentrations were monitored. Octasilyl column (Aquabore RP-300,0 , 46x3, Ocm) with 80% o, i% trifluoroacetic acid (rTFA'' )/water (solvent A) and 20% of 0.085% TFA/70% acetonitrile (solvent B) and immediately increase acetonitrile concentration from 20% to 80%. Developed with a linear concentration gradient (solvent B) at a flow rate of 0.5 d/min for 45 minutes. Ta.

As shown in panel (a) of Figure 31, 7M urea, 10mH2-mercaptoester Protein in tanol and 20 mH Tris (pH 7.5) was added to a 49% concentration gradient. Eluted from the HPLC column with acetonitrile. In the next step, 1M urea/ 1mM ammonium acetate (pH 6,8> (panel (b) of Figure 31) to phosphoric acid rsT4.113.1 at increasing rates up to salt-buffered saline (panel (C) of Figure 31). was found to elute first in the HPLCiQ gradient of 47% acetonitrile. Ta. Confirmation of peaks that elute first as oxidation products is a non-chaiotropic solution. evidenced by the reduction of rsT4.113.1 in the solution and treated in this way. The sample was subjected to HPLC under the same conditions.

Oxidized rsT4 before subjecting the reduced protein to HPLC. The elution of -113.1 is a single suggests that the formation of disulfide bridges reduces the relative hydrophobicity of proteins [J , L. Blawing et al., Analytical Biochemistry, Vol. 155, No. 1 23-128 (1986)]. Review of spectrum analysis of rsT4.113.1 It is carried out throughout the folding process to determine the relative concentration of soluble protein in this process. The target yield was monitored. The refolding method is approximately 20% of the time in rsT4.113.1. gave the yield. HPLC analysis revealed less than 15% reduced protein contamination in this preparation. The staining is shown (panel (C) of Figure 30, lane G).

Screening of regenerated rST4.113 then 900A data system Automated with Applied Biosystems 470A gas-phase sequencing system equipped with Amino acid analysis of rsT4.113.1 was performed by Mann degradation.

Online separation of phenylthiohydantoin amino acids generated during the degradation reaction. At that time, PTH-018 type 2. Applied column with lX220mm column A Biosystems Model 120A PTH analyzer was used. Proteins for sequence analysis (10 μg) was applied to 5DS-PAGE (15% acrylamide), P, Matsudai LA, Journal Biological Chemistry, Volume 262, No. 10035~ 10038 (1987). He was an electrician at Millipore Corporation in Bedford.

Amino acid analysis of protein samples was carried out in 6N HCl under reduced pressure at 100°C for 24 hours. This was done by "hydrolyzing" the protein over a period of time. The hydrolyzate is then treated with garlic. The test was carried out on a Beckman 6300 analyzer equipped with a post-column detection section using Drin. . Performed by standard techniques using 5DSJB-1. Sequence analysis: Met- The amino terminal sequence of 1y-Asn-Lys-Val-Val+++ is shown at 1n-. did.

The purified rsT4.113.1 protein was constructed using a protein construct for expression in E. coli. The amino-terminal methionine present in the product matches the sequence resulting from plasmid construction. It was found to contain a stoichiometric amount of a complete polypeptide chain. The first stage of the degradation reaction The recovery of phenylthiohydantoinyl-methionine in oil is automated The yield was 60%, consistent with the initial normal yield obtained with Mann degradation. This observation shows that r This excludes the possibility that a significant proportion of sT4.113.1 lacks the starting methion, and all That is, NH2-methionine affects the expression of rsT4.113.1 in E. coli. or sequence analysis indicates that glutamine is present in the first cycle of the degradation reaction. was not inhibited by the presence of Sequence analysis was performed for 40 cycles and No evidence of carbamylation of gin was observed. Amino acid analysis is the actual measurement of amino acids shows a close correlation between the values and the theoretical values and therefore indicates whether expression or purification or This shows that there is clearly no proteolytic degradation in both processes.

Immunoprecipitation of a CHO cell line producing soluble T4 T4 mutagen pBG3 77, I) BG380, pBG381, full-length recombinant T4 construct 1) 1 of BG379 535-CyS metabolic label transfected with species, invention or vector only Conditioned medium from CHO cells was tested to detect anti-T4 monoclonal antibody 19T. It was determined whether hV produced the molecules identified. to conduct this test , pBG380. pBG381, pBG377, pBG379 or I) BG Approximately 107 CHO cells transfected with either 312 180 μCi/in 4 d RPMI CVS-medium (Gibco) for 5 hours. mi 335-labeled cysteine [DuPont, New England Nuclear Company] cultured together. After labeling the cells, add 1 d of filtered conditioned medium to phenyl Methyl-sulfonyl fluoride at 0.5mM and 0KT4 and protein Immunoprecipitated with A Sepharose [P, H, Cyre and E, L, line base. Lung, European Journal Immunology, Volume 15, Nos. 291-29. 5 pages (1985)]. The medium from the 335-labeled cells was then transferred to 0KT4 (A Cultured with TCCN (lcRL8002). Then, with protein A Sepha0-se immunoprecipitate and run the immunoprecipitate on a 10% polyacrylamide gel under reducing conditions. [U., Laemmle, Nature, Vol. 227, No. 6] 80-685 (1980)]. ]X-Omat X-ray film Eastman Radioactivity photographic measurements were performed using Kodak Co., Ltd.

pBG380(rsT4.3) and pBG381 (rsT4.3>) were both identified by 0KT4 anti-T4 antibody. The secreted immune system directed the synthesis of 335-labeled T4 protein. The immunoprecipitated cleaved molecules are It migrated as a 49Kd protein, a result consistent with its predicted molecular weight. In contrast to this , soluble R4 antigen was pBG377 (rsT4.1) or pBG379 (r The conditioned medium of the cell line stably transfected with f. I couldn't get it out. Cell extraction of cell lines transfected with pBG377 Immunoprecipitation analysis of the rsT4.1i gene shows that the rsT4.1i gene is misfolded and that [M, J., Gessing et al., Cell, vol. Volume 46, pages 939-950 (198B)].

In Figure 32, these lanes represent: Lane 1: Vector pB of CHO cells stably co-transfected with G312 and pAdD26. Immunoprecipitation from conditioned media. Lane 2 blank. Lanes 3 and 4: p'B Stably co-transfected with G380 (EGTA, 2> and pAdD26) Immunoprecipitation from conditioned medium of CHO cells. Lanes 5 and 6: pBG3 81 (stably co-transfected with EGTA, 3> and pAdD26 Immunoprecipitation from conditioned medium of CHO cells.

Lane 7: Stably co-triggered with recombinant full-length T4 (pBG379) and pAdD26. Immunoprecipitation from conditioned medium of transfected CHO cells. In Figure 32 and arrows indicate pBG380 or pB relative migration of standard molecular weight markers. The predicted location of soluble T4 from G381 is shown.

G, Chew et al. Electrolysis for efficient transfection of mammalian cells with rDNA "Poration" Nucleitsk Acid Research, Vol. 15, No. 1311-1 326 (1987)] by electroporation. Recombinant soluble T4 derivatives pBG392, pBG393 and pB in CO57 cells. G394 was expressed. More specifically, 20μ9 Kaida-type plasmid DNA and 3 80j19 carrier (sonicated salmon sperm DNA) and 3 x 107 CO 37 cells. These cells were placed in a gene pulser set at 300 volts. Electrovolley 1~ was performed using (Biorad). Then CO37 cells, Cultured for 24 hours in Jurbetsko's modified Eagle medium supplemented with 10% fetal bovine serum. did. The conditioned medium was then harvested and transformed into Millibore millidiscus 0.22 For μ hydrophilic filter cartridge (Millibore No., McGL305-01) Therefore, the secreted protein is filtered and the secreted protein is transferred to a rapid S-ion exchange column (S-cephalometric column). Fast flow type, 20 mH Y at Pharmacia N (117-0511-01) Concentrate with ES buffer (pH 5,5>).

The bound proteins were then treated with 20 mH Tris-HCJ! (p) (7,7> and Elution was performed with 0.3M NaCl. The elution stock was then diluted to 2x volume) 20ml) Tris-HC! (pH 7,7>), then this was diluted with 19Thy anti-T4 Monoclonal antibody and protein A sepharose or 0KT4A and protein A sepharose A column consisting of either phallose was packed. Wash this column definitively. , and the binding substance was 50m)i of glycine-HCffl (pH 2,5>, 15 0 mH NaCl, 0,1 mH EGTA and 5iI9/- bovine pancreatic trypsin. Aprotinin (Sigma NαA1153) is a 0.5-d fraction. It was eluted as a fraction.

The immunoprecipitate was subjected to 5DS-PAGE (10% gel) and then peptide J8- Immunoblots were performed against a rabbit antiserum raised against 1. using silver-stained gel The binding and elution of EGTA was followed during chromatography.

Figure 33 shows transiently expressed pBG392 (EGTA, 7>[lane 10 and and 11]: pBG393 (EGTA, 8>[lanes 4.7 and 8], and pBG394 (EGTA, 9 > [lane 5]. There is. Standard is purified rs74.3 of 5009 (lane 'l); 150ng of purified rsT4.3 (lane 2) and 250 ng of purified IJrsT4.3 ( Lane 3). The arrow indicates the relative molecular weight of EGTA, 7, i.e. 21,000 The predicted position of movement of proteins with daltons is shown. The sample filled in lane 4 The sample is lost and lanes 6 and 9 are blank.

As shown in lanes 10 and 11 of Figure 35, pBG392 (EGTA, 7) is a secreted immune protein identified by anti-T4 antibodies 0KT4A and 19TM. ordered the synthesis of Rough lanes 4.7 and 8 show pBG393 (EGTA, 8) directs the synthesis of secreted immune proteins identified by 0KT4A and 19Thy. It shows what was done. This analysis shows that EGTA, 7 contains the 0KT4A epitope. It shows that it has. Roughly speaking, this is the binding domain for HIV envelope binding. This suggests that a region exists at the amino-182 easternmost residue of T4.

In contrast, cells transfected with pBG394 (EGTA, 9) No soluble T4 could be detected in the culture medium (see lane 5). however , Immunization of Cell Extracts in Cell Lines Transfected with pBG397 Precipitation analysis shows that EGTA,9 was identified by 0KT4A. E GTA, a 9 or 113 amino acid composition, binds to the HIV virus. Seem. Roughly, this represents a second expression of soluble T4, with only two cysteine and one of three disulfide bridges. Therefore, EGTA, 9 is - Easily produced in E. coli or yeast systems.

Similarly, cell lineage transfected with pBG396 (EGTA, 12) Although no soluble T4 was detected in the culture media of these cell lines, cell extracts from these cell lines Analysis of EGTA, 12, showed that it was identified by 0KT4A.

Therefore, EGTA, 12 can also bind to the HIV virus.

Radioimmunoanalysis and epitope analysis of EGTA, 113 0KT4A, Leu- Does the 113 fragment of EGTA contain structural determinants that bind to 3A and 0KT4? Competitive inhibition radioimmunoassay [C, J. Newby et al. "Phase Radioimmunology Analysis", Handbook of Experimental Garbage 1 Science -, D. M. Ware (ed.), No. 1, pp. 35.1-34.8 (198B) Radioimmunoanalysis and epitope analysis of EGTA, 113 were performed using . 0KT4A and Leu-3A blocked HIV infection in vitro [dal Gleish et al., supra] and block T4 binding to CIp120/160. [McBegal et al., supra], this analysis suggests that EGTA, 113, interacts with HIV. This helps in first estimating whether you have the structural elements you want to use.

First, a 96-well micro measurement plate (Falcon) with a U-shaped bottom was placed in PBS. (50 JIR/well of goat anti-murine IoG (Utah) at pH 7.0> 50i/IRR by Hyclone Typing Kit Co., Logan, State. The plates were coated to a concentration and the plates were incubated overnight at 4°C. Then these Plates were rinsed with IXPBS and blotted dry. Then the plate and 100 tlj/well of 1x PBS solution containing 5% bovine serum albumin. The mixture was blocked for 1 hour at air temperature. PBS these plates. ), blot dry, then pour into (0KT4) block buffer for 10 minutes. /m! ”): 0KT4A (500n (1/r/d; or eu-3A (Becton-Jikinlan) (500% in blocking buffer) 50d of one of the three antibody solutions containing either 0g/d) was spotted. . These plates were allowed to stand at air temperature for 2 hours. Then, the plate was washed with PBS/ Wash 3 times with 0.05% Tween-80 solution and 2 times with 1x PBS; was blotted dry.

In a separate plate, final volume of 20 tts/ml and 25 volumes per well. Unlabeled rsT from a series of 2-fold dilutions (not including competitive comparisons) at A competitive sample of 4.113.1 was titrated. The positive comparison for this analysis was unlabeled r Competition against ST4.3 (375 amino acids). Then io, oo.

cpm/25. 25t11 of 125-rsT4.3 containing S [A, E.

Polton and W. M. Hunter, "Radioimmunoassay and related methods", 2C. [Created according to the chapter] was added. Then, the total volume of 50μe in each well was Each antibody solution was spotted onto an analysis plate containing three types of antibody solutions, and these were incubated at air temperature for 2 days. Cultured for hours. The plate was then soaked with PBS/0.5% Tween-80 solution for 3 washed twice with IXPBS and blotted dry, then washed with radioactivity. Wells were counted using a Beckman gamma counter.

As shown in Figure 34, rsT4.113.1 has an absorption for 0KT4A in-phase. competes with 1125-rsT4.3 for yield in a dose-dependent manner. Zarani, r sT4.113.1 showed dose-dependent absorption on Leu-3A solid phase. 1125-rsT4.3. rsT4 compared to unlabeled rST4.3 ．． 113.1 exhibits a molar affinity within a factor of 3 for these antibodies. Tested 0 , in the concentration range of 4 to 25119/rdl, rsT4.113 is relative to 0KT4. did not compete with radiolabeled rST4.3 for binding. In the same analysis, rs T4.111 is also 112 for binding to 0KT4A and 1eu-3A. 5 It was observed that it competes with rs74.3 but not with 0KT4 (3rd 5-37).

Based on these results, the epitopes of 0KT4Acl and 1eu-3A are similar to those of T4. It is thought to be included in the amino terminal 11 amino acids. Furthermore, the epitope of 0KT4 binding The loop appears to be located at the carboxy terminus of the T4 polypeptide.

Therefore, the gpl20-binding domain is located at the amino terminal 113 of the T4 protein. appears to be located within the 111 amino acids. Based on this knowledge, the structure Various constituent oligopeptides having sequences within the main were synthesized. . These ori Oligopeptide amino acid coordination JB-144-63 rsT4No, 6 18-29 rST4N (175-56 rST4NQ8 84-97 rsT4Nc9 30-63 These peptides were synthesized using conventional phosphoamide DNA synthesis techniques [tetrahedron 22, pp. 1859-1962 (1981)]. . Furthermore, these peptides were synthesized using Applied Biosystems Type 380A DNA synthesis. Synthesized on-instrument and purified by gel electrophoresis.

ELISA analysis of rsT4.113 Additionally, rsT4.113 produced by p211-11 transformed E. coli ．． ELISA analysis was performed on 1.

Dilutions were made and varied for the blocking solution throughout this analysis. More specifically, The well of Immulon 2 (Dynachiku, Candili, Virginia) was 0.0 0,005 0D (280nm>/d OK in 5M bicarbonate buffer) T4 (IgG2b) was coated to a volume of 5011ff/well, and these Plates were incubated overnight at 4°C. The plate was then diluted with 5% bovine serum solution in PBS. Blocked with rubumin (250 m/well) and incubated for 30 minutes at air temperature.

Then, 5Otte of 50n(]/d rST4.3 was added to each well and incubated at 4°C. The cells were cultured overnight. Then 50111/well of rsT4.113.1 and 10n A mixture with g//d of 0KT4A was added and incubated for 2.5 hours at air temperature.

The following steps were performed using a Hyclone kit (Banclone). first of all , add 1 drop of rabbit anti-murine IgG2a to each well, and leave the plate at room temperature. and cultured for 1 hour. Then, 100t1j of peroxidase-labeled anti-cow Add Sagi IgG and dilute each well 1:4000 with blocking buffer; The cells were cultured at air temperature for 1 hour.

A substrate reagent was prepared as follows. Dilute the substrate reagent 1:10 with distilled water, And substrate 107! 2 O-phenyl-ethylenediamine (rOPDJ) per ) Chromogenic tablets were added. By mixing while rotating, the mixture is sufficiently dissolved. I let it happen.

Alternatively, the TMB peroxidase substrate system (Kirkegaard and Perry Kata) Log Nα5O-76-00) can also be used. Then each well contains 10 0μ! chromogenic solution and incubate for 10-12 minutes at room temperature, then 1oot1 Color development was stopped with 1 part of 1N H2SO4. Then the ELISA plate reader The OD was measured at 490 nm using a vacuum cleaner.

The results of the analysis are shown in FIG.

Next, the soluble T4 protein produced by the T4-operating animal of the present invention was subjected to various functional assays. I put it on.

Analysis of antiviral activity of soluble T4 The antiviral activity of solubilized 4 according to the present invention can be enhanced by antiviral agents and neutralizing antibodies. It was evaluated by modifying various in vitro methods used in the test [D, D, Two, etc. , [Recombinant human alpha intaferon (A> Lancela 1-, pp. 602-604 (1985)]: K, Ha Toschone et al., “Phos:·, noformate and recombinant alpha interferon-A Synergistic suppression of HTLV-ml replication in vitro by antimicrobial A. CI Chemotherapy, Vol. 30, pp. 189-191 (1986)].

For each of these analyses, graded concentrations of soluble T4 were created and these were H9-induced lll5 isolate of V [National Cancer Institute, Bethesda, Maryland] With contributions from Dr. Sir Institute, M. Povic and R. Gallo] Precultured. This isolate was maintained in H9 cells as a chronically infected culture. cell Free HIV stocks were obtained from the supernatant of HTLV-III-infected H9 cultures (medium Nutrient conditions: IX 106 cells/m1 with 75% viable cells, 10p Mmff ~io4. A series of 10-fold dilutions of recombinant soluble T4 were made in the range /i. , these were combined with 50 pieces of HIV 50% Tissue Infection Dose (TCI Dso). Supplementation with 20% heat-inactivated fetal bovine serum (Fe2) for 1 hour at 37°C. The cells were cultured in RPM l-1640. Then, 150 μj of H9 cells were of recombinant soluble T4/HIV mixture to a final concentration of 0.5 x 106 cells/d. Wells containing cells were not infected with HIV.

Each virus inoculum was adjusted to a concentration of 250 T CI Dso/mff.

A viral inoculum of 1001 IR was inoculated with 200 recombinant soluble T4 or 100 recombinant T4. Prepare for 1 hour at 37°C with immunoglobulins made in three 2-fold dilutions. After culturing, add fetal bovine serum (20%), HEPES (10ml) and penicillin. (250U/mf, streptomycin (250119/rd) and L-glue 1.5-2x106 H in 5d RPMI supplemented with tamin (2mM). Up to 9 cells were inoculated. On the 5th, 6th, 7th, 10th and 14th day, Cultures were examined for characteristic cytopathological effects (rcPEJ). Neutralization Compare defined as the inhibition of syncytium formation as opposed to

The positive comparison used was HIV seropositive neutralizing serum, which was described by Hari, D., Tsu et al. Human Immunodeficiency Virus Neutralizing Antibodies are Retained by Several Retained Donors in Envelope Glycoproteins "Identifying the Main" J, Pyrology, Vol. 61, pp. 2024-2o28 (1 987)]. The negative comparison used was only HIV seronegative sera. Alternatively, the buffer solution alone was used.

Analysis of cytopathological effects (CPE) For this analysis, the conventional cytopathological analysis method [Claraman et al. (1984)] ) and Woongostahl and Gallo (1985) (supra)]. Then, To19 cells were examined microscopically to demonstrate the cytopathological effects of HIV.

CPE is rated on a 4-point scale ranging from 10 to 4+, with 4+ indicating the highest degree of CPE.

On the 14th day, 10/! Recombinant soluble T4 according to the invention (pBG380) at i/d rsT4. derived from BG380 transfected CHO cells. Wells containing >2 showed no presence of CPE, whereas negative comparisons Showed CPE of + to 3+.

p24 radiation epidemic analysis Tsugiri, D., Tsu et al., Journal Pyrology, Vol. 61, No. 2024-2. 028 (1987) and J. Sodorowsky et al., Nature, Vol. 322, No. 470-474 (1986). Soluble T4 was tested as an inhibitor of virus replication. This analysis is substantially based on the above literature. Microassays containing 200 cultures were carried out as described in Breeded in wells. In this analysis, the methods of the present invention that inhibit HIV replication were evaluated. The potency of soluble T4 polypeptide was measured by HIV p24 antigen production. the below described Supernatants were sampled twice weekly for the 1-IIV p24 antigen as follows. .

Analysis kit [HTLV-I [11) 24 radiation immunoassay system, catalog no. , NHK-040A, Biotechnology Systems, New Research Project DuPont Products], and this kit is an affinity purified ■125-standard. Precipitate the identified HIV p24 antigen, rabbit anti-p24 antibody, and antigen-antibody complex. Contains a second goat anti-rabbit antibody that is commonly used. Instructions included within the kit The analysis was conducted according to the following.

Therefore, a predetermined amount of one of the samples to be analyzed or a batch of unlabeled p24 antigen is 125-labeled p24t3 and a predetermined limited amount of rabbit anti-p24 antibody. child These samples were incubated overnight at air temperature and then goat anti-rabbit immunoglobulin preparation. The mixture was added over 5 minutes at 40°C. Centrifuge these samples in a microcentrifuge and the supernatant was aspirated. Add pelleted ■125-labeled 1) 24 to each sample. A known amount of antigen was added to a standard tube. A standard curve for 25-p24 was created. Then, the antigen present in the unknown sample A known amount of f)24 antigen contained in a standard sample containing 1125-labeled p24 displaced by Calculated by interpolation using a standard curve created from Below these results Shown in the table.

HIV? ! p24 analysis of inhibition of production rST4.2 Patient average % binding/count (I1g/d) Serum CPM Unbound 7 - Negative 344 8.5 -Positive 2.237 112.4 0.5" 551 19.9 5.0"-1,76686,6 10 negative 230 2.2 14 Negative 221 1.8 -Positive 2,284 115.0 These results demonstrate that the soluble T4 of the present invention at a concentration of 5ji9/d It has been shown to completely inhibit viral replication as determined by a 4-day assay.

These results are roughly shown as a graph in FIG. In Figure 39, the numerical value is Calculated from the p24 standard curve according to the instructions of the assay kit.

Umbrella: First of all, this concentration is 1 unit of absorbance at 280 nm (rA J). Reserve 2.80 equal to 1mg rST4.2 Based on a rough estimate, it seems to be 1,0fl/d. at 280nm Absorbance is a commonly used first approximation of protein concentration. However, protein Based on the amino acid analysis of , which has a higher extinction coefficient than initially estimated, It was found that 1 A unit of rST4.2 corresponds to 5 mg of protein.

**: This concentration is initially determined by one unit of absorbance at 280 nm (“A”) im 1h9/me based on a preliminary approximation that g is equal to rsT4.2. be exposed. Absorbance at 280 nm is a commonly used first approximation of protein concentration. be. However, based on amino acid analysis of the protein, this was initially estimated to be It also has a high extinction coefficient, and the IA unit of rST4.2 is equivalent to o, smg of protein. It turns out that it does.

p24 replication analysis was then performed as above, except that soluble T4 was added on day 3; Added to infected cultures on day 7 and day 100 refeeding and throughout the infection period. The concentration of 7prST4 was maintained constant. The results of this analysis are shown in the table below.

Blocking of HIV replication by a fixed concentration of rsT4 rsT4.2 p24 0.008 770 0.031 970 0.125 85 Uninfected O These results demonstrate that the soluble T4 protein according to the present invention maintains a constant concentration over the infection period. If it is maintained, the amount of protein as low as 0.125119/d is 250T of HIV-1. This shows that replication of CI Dso/rrIIl was substantially inhibited.

Advantageously, the soluble T4 protein according to the invention is Three lymphocyte proliferation assays (i.e., mixed lymphocyte reaction, phytohemagglutinin, and tetanus toxin stimulation reaction). Inhibition analysis To roughly evaluate the effect of soluble T4 on HIV env-T4 binding, the same 2 of soluble T4 protein on the syncytium-forming properties of HIV in time-incubation analysis. The effect of seed preparations was determined. B., D., Walker et al., no proceedings. National Academy of Sciences USA, Volume 84, Pages 8120-8124. C8166 cell fusion analysis was performed as described in (1984).

1 x 109 89I[ilm] chronically infected with HTLV-IIIB were added to 20% of the fetuses. rST4.2 in 150ml RPMI-1640 medium supplemented with calf serum. Incubate for 1 hour at 37°C in 5% CO2 with various concentrations of one of the seeds in the seed preparation. fed. Then, 50. 3X104 08166 cells (T 4+ transformed human Inio blood lymphocyte line [Sodorowski et al., supra]. Wells were added to a final volume of 0.2rd. The final well concentration of soluble T4 was adjusted. 0.5/d" and 5.O1l!g/rd per product Nα1, and 1.25 fl/d* and 12.5 for product Nα2. ci/rd* Ta. The total number of syncytia per well was then cultured at 37°C with 5% CO2. 08166 cells were counted 2 and 4 hours after addition. parallel simultaneous Cultures were grown in buffer alone (negative comparison) or in 25IJ9/d of 0KT4A (@sex ratio (Comparison) was used as a comparison. At least 100 cells per 104 infected H9 cells. At the time when syncytia are present in the comparison culture, A 50% reduction is considered a positive result. The results of this analysis are shown in the table below and Figure 40 ( 2 hours of data).

*: These concentrations are based on 1 unit of absorbance at 280 nm (rA J) of 1 mg. Based on a preliminary estimate that rST is equal to 4.2, 1 round/d, 10 no. /d12.5μ9/I and 25μ/Inl1. however , has a light coefficient of protein, and 1 A unit of rST4.2 is equal to 0.5 mg of protein. It turned out that it was.

Blocking C8166 fusion analysis [rs74.2] Blocking%* Preparation (tI9/I) 2 hours 4 hours buffer OO0 rsT4.2 0.5** 30 42rsT4.2 5.0** 54 47 rsT4.2 1.25** 16 21rsT4.2 12.5** 77 550KT4A O100100 (25/d) *: All analyzes were performed in triplicate, and syncytial cells were counted per well. The percent inhibition was calculated by averaging the number of samples. % inhibition is determined by the negative comparison (rST4 or The average number of syncytia in 0KT4A (without rsT4 or is the average number of syncytia counted when either 0KT4A is present. The difference is divided by the average number of syncytia for the negative comparison and multiplied by 100. .

**: For these concentrations, 1 unit of absorbance at 280 nm (rA J) is 1 m 1 u9/ml, respectively, based on preliminary estimates. , 10μ9/rIdl, 2.547m1 and 25μ9/rnll. I was disappointed. However, based on amino acid analysis of the protein, this was initially estimated 1 A unit of rST4.2 is comparable to 0.5 mg of protein. It turned out to be true.

As shown in this table and Figure 40, s, o, c6/7 and 1265μ9/ Soluble T4 according to the invention in d showed syncytium in 2 hours compared to buffer alone. This prevents the formation of gums. 4 hours after adding C8166 cells, 12.5JI9/ d soluble T4 continued to inhibit syncytium formation by more than 50% compared to the negative control. I got it.

In addition, similar co-culture assays showed that the syncytium-forming properties of HIV Inhibition in C8166 fusion analysis of two preparations of the T4 protein rST4.7 Analysis mortar: 1 day average syncytium rsT4.7 150 μff 2 hour oral preparation (μ9/dl) parts Inhibition %H9 cells 0ON/A (comparison) C8166 cells 0ON/A (comparison) Added to C8166 cells 0118 0 HIV-infected H9 cells (comparison) OKT4A OO100 *: For this concentration, 1 unit of absorbance (rA J) at 280 components is 1 m Based on a preliminary approximation that rST of O is equal to 4.2, it is 10/Inl1. It seems to be that. However, based on amino acid analysis of the protein, this was initially estimated to be 1 A unit of rST4.2 has a higher extinction coefficient than that of 0.5 mg of protein. It turns out that it corresponds to white.

BAKAJITAN TOYU DANDAN■ average syncytium rsT4.7 150 years old 2 hours mouth Preparation (lI9/d!’) Partial inhibition % H9 cells 0ON/A (comparison) C8166 cells 0ON/A (comparison) Added to C8166 cells 0141 0 HIV-infected H9 cells (comparison) OKT4A OO100 (comparison) rST4.7 creation 2 Sa5.0*27 Bo,9*: This concentration is initially One unit of absorbance at 280° (rA2B□J) is equal to rST4.2 of imp. Based on a preliminary approximation that it is 1 ojIg/d. but However, based on amino acid analysis of proteins, this is more recent than initially estimated. Yudandan average syncytium rsT4.7 150μ9 2 hours mouth Preparation (% inhibition of μ9/rIII part H9 cells 0ON/A (comparison) C8166 cells 0ON/A (comparison) Added to C8166 cells 0128 0 HIV-infected H9 cells (comparison) OKT4A OO100 (comparison) rST4.7 creation 1 = 5.0 * 35 72.7 rST4.7 creation 2 =5. O*2 98.4*: This concentration is initially the absorbance at 280 components. To a preliminary approximation that 1 unit of (rA28QJ) is equal to 1 mg of rST4.2. Based on the standard, it seems to be 101I9/d. However, 0.5 mg of protein It was found to be equivalent to

As shown in these tables, the soluble T4 protein rST4.7 is present in HIV-infected H9 cells. syncytium formation was inhibited in cells.

In general, rsT4 on the syncytium-forming properties of HIV in co-culture assays. ．． The effects of 113.1 and rsT4.111 were evaluated. Walker et al. (above) C8166 cell fusion analysis was performed as described.

1 x 104 (7) H9 cells chronically infected with HTLV-I [IB, 20% fetal 5-5015/d in 150 μe of RPMI-1640 medium supplemented with bovine serum. 96-well micro measurement with rsT4.113.1 or rsT4.111 The cells were cultured for 1 hour at 37°C in 5% CO2 using a fixed plate. Next, these works/L k: 3×104 08166 cells were added in 50n portions.

The plates were incubated in 5% COZ at 37°C for 2 hours and after this incubation Count the number of syncytia per cell. Syncytia is calculated from the diameter of 3 cells. Also defined as cells with large and swollen cytoplasm. Twice for every sample I counted. Parallel co-culture was performed using 0KT4A alone or rST4.3 alone at 25μ9. positive comparison), or H9 cells alone or C8166 cells Alone (negative comparison).

Blockage in C8166 fusion analysis H9 cells (comparison) O0 C8166 cells (comparison) OO rsT4.113.1 1.25 35rsT4.113.1 2.5 63 rsT4.113.1 4.25 63rsT4. ．． 113.1 6.25 8 2rsT4.113.1 12.5 96rsT4.3 12.5 100 0KT4A (25i/, d> 0 100 as shown in this table and Figure 41) In addition, rsT4.113.1 caused a dose-dependent blockade of HIV-induced syncytium formation. showed that. The molecular inhibition specific activity of rsT4.113.1 is higher than that of the longer recombinant soluble T4. It is thought that the antiviral activity is considerably reduced compared to the antiviral activity of . Therefore, rsT4. 113.1 is effective at neutralizing HIV-dependent cell fusion in vitro. In contrast, its molecular inhibition specific activity decreases by a factor of 10. The degree of this decrease is Incomplete neutralization of rST4.2 or rST4.2 produced in mammalian cells contains three additions at the N-terminus of rsT4.113.1 that are missing in rST4.3. Presence of amino M (Met-Gln-Gly) or against HIV Based on the absence of additional structures in rsT4.113.1 required for high affinity binding. It has not yet been decided whether or not it will be implemented.

In general, as described for rsT4.113.1, regarding rsT4.111. C8166 cell fusion analysis was also performed. The results of this analysis are shown below.

Blockage in C8166 fusion analysis Preparation rsT4 (li9/ml> Inhibition % H9 cells (comparison) 00 C8166 cells (comparison) O0 rsT4.111 1.25 0 rsT4.111 2.5 40 rST4.111 4.25 20 rsT4.111 6.25 67 rsT4.111 12.5 100 rsT4.111 25.0 100 rsT4.3 12.5 100 rsT4.3 25.0 100 0KT4A (25 μg/mf! > 0 100 As shown in this table, rsT 4.111 showed dose-dependent inhibition of HIV-induced syncytium formation. 12 ．． Complete inhibition of cell fusion was obtained at concentrations of 5x/d and 25.0t19/Ini. It was done. Kinetics of intramuscular injection of soluble T4 in serum after intramuscular injection Recombinant soluble T4 protein according to the invention (particularly in pBG381 transfected cells) The kinetics of appearance of rsT4.3) from cell line BG381 was examined as follows. I investigated.

Two 7-year-old cynomolgus monkeys (Musca) without infectious diseases and in good health. Obtained Clarice. Each monkey was isolated for 6 weeks before administration of soluble T4 protein. throw Throughout the feeding period, each monkey was maintained on a conventional monkey diet supplemented with fresh fruit. Ta. A catheter and venous insertion port were surgically placed in the femoral artery of each animal prior to treatment, and the blood Easier to collect liquid.

For 28 days, each animal received recombinant soluble T by intramuscular injection into the thigh and buttock muscles. 4 protein was inoculated twice daily. Each animal was given an injection every 8 hours, and each injection Total amount: 0.5n+g/kM day/monkey 0.1s d/kg (0,25 mc+/+++g) of rST4.3. Serum test for comparative measurements Collect samples one day before the first treatment, and at 1, 2, and 4 o'clock before the first injection. between and 8 hours later, and 1, 2, 4, and 14 hours after the second injection. and 16 hours later on days 7, 14, and 28.

Soluble T4 injected intramuscularly reaches peak serum levels 1-2 hours after injection. It was found that this level gradually decreased and reached a maximum approximately 6 hours after injection. reached half the value.

Data obtained for intravenous administration (not shown) indicate that rST4.3 in serum levels than those obtained by intramuscular injection approximately 2 hours after intravenous injection. It is expected to decrease.

Therefore, the maximum rsT4-3 level in serum after intramuscular injection is However, this is gradually released into the bloodstream over a long period of time. can be detected in serum. This slow release associated with the intramuscular injection route The mechanism of release is to maintain high levels of soluble T4 protein at a given concentration for an extended period of time. Advantageously, the level can be maintained. Soluble T Intramuscular administration of the 4 protein is effective against early stage HIV infection to prevent the virus from infecting the patient. Treating infected patients or patients who have been exposed to the virus but are not yet seropositive. Particularly useful for treating.

Serum levels of rsT4.3 were measured using ELISA analysis. This analysis dilutions were made in blocking solution, and the plate was washed with PBS/0.0% between each step. Washed with 05% Tween 20. In more detail, Imulon 2 play 1 ~ 0,010D (280nm)/d in 0.05M bicarbonate buffer 0KT4 (IgG2b) to a volume of 50 cells/well, and The plates were incubated overnight at 4°C. The plates were then diluted with 5% bovine serum in PBS. Blocked with albumin (200 μe/well) and incubated for 30 minutes at room temperature.

Then, 50με of sample or standard was added to each well and incubated for 4 hours at room temperature. did. Then, 5hj/well of 0KT4A was added to 0. Added in an amount of IIj9/m, and cultured overnight at 4°C. Next, using the Hyclone Kit (Hyclone) , the following steps were performed. First, add 1 drop of rabbit anti-murine IgG2a to each well. and the plates were incubated for 1 hour at room temperature.

Next, ioom's pel diluted to 1:4000 in 5% BSA/PBS. Oxidase-labeled anti-rabbit IQG was added to each well and incubated for 1 hour at room temperature. .

A substrate reagent was prepared as follows. Dilute the substrate reagent 1=10 with distilled water and 2 O-phenyl-ethylene-diamine (rOPDJ) colors per 10rd Tablets were added. By rotating and mixing, the mixture was sufficiently dissolved. Some Yes, TMB peroxidase substrate system (Kirkegaard and Berry Catallo) No. 50-76-00> can also be used. Then 100μe Add the coloring solution to each well, incubate for 10-15 minutes at room temperature, then add 100 μQ Color development was stopped with 1N of 2304. Then, the ELISA plate was read. Monkey Nα7-91 using a sampler rST4 level 0 22.7-96.5 158.0 19.81 27B, 8 199.6 360.7 238.32 2B1.8 366.8 306.4 441. 14 214.9 246.6 363.9 393.25 290.4 8 72.3 105.0 199.49*-246,2 10259,6 Monkey Nα7-92 rST4 level 0 6.7 $ 56.0 106.3 60.91 87.2 225.8 1 78.0 437.72 254.2 377.9 253.2 770.64 170.0 167.3 308.2 821.55 898.3 8 11B, 9 101, 2 176.59** 405.1 10 523.5 *Second background **Second injection after 28 hour sample collection.

valent form of recombinant-soluble T4 Receptors have specific [Rf] and [Lf] properties due to their affinity for specific ligands. Here, [RL] is the receptor (R > and [Rf] and [Lf] are free receptor and receptor concentrations, respectively. [P, A, Underwood, Atopansis in Virus. Research, K., Maramoros et al., eds., vol. 34, pp. 283-309 (1988) ].

A multivalent receptor (with a charge of n) that binds a multivalent ligand (with a charge of m) ), the functional affinity is defined as n[Rb]/n[Rf]m[Lf]. where [Rb] is the concentration of bound receptor sites and n[Rf ] and m[Lf] are the concentrations of free receptor and ligand binding sites, respectively. Ru. The effect of increasing charge (number of binding sites) is to increase the safety of the ligand-receptor complex. You can become a market by improving your qualifications. The affinity of a multivalent receptor for a multivalent ligand is It depends on three factors: the intrinsic binding constant of each binding site, the charge (the number), and the positional relationship between the receptor, binding site, and ligand binding site. Growth Under certain conditions, multivalent binding interactions result in higher functional affinities. polyvalent Reduced dissociation rate of ligand and multivalent receptor results in increased functional affinity [C, L, Hornig and F, Karsch, Immunochemistry, Vol. 9@, Vol. pp. 325-340 (1972): ■, Otelnes and F. Karsch, “Antibodies "Principle of Reaction", Antibody as a Tool, J. J., Marchalone and G. W. Wahl, eds., pp. 97-137 (1982)].

The simplest case of multivalent receptors that increase functional affinity is that each independently Two identical ligand binding sites capable of binding antigen with equal affinity soluble receptors (eg, antibody molecules). Antigen exhibits multivalent , for example, by chemically bonding to a solid support so that the distance between the antigen sites is When cross-linked by binding arms, the functional parent of the antibody directed against the antigen bound to the solid support compatibility is greater than the intrinsic affinity of the antibody combining site for the -valent antigen [D.

Crothers and H. Meztzger, Immunochemistry, Vol. 9, No. 341- 357 pages (1972)]. Since virus particles exhibit multivalent antigens, The high functional affinity of antibodies to Ru.

The binding of recombinant soluble T4 to HIV major envelope glycoprotein c+p120 is Figure 3 is an example of a monovalent septa binding to a ligand. The affinity of this interaction is measured The bond between T4 and (H)120 has a dissociation constant Kd=4X10-9M. [L, Lasky et al., Cell, Vol. 50, pp. 975-988 (1987)] .

Using antibody similarity, multivalent rsT4 shows C1p120 in HIV-infected cells. C11 on the viral particle appears to exhibit greater affinity than monovalent rST4. ) 120 and the infected cell surface. Determine the extent to which it exhibits higher functional affinity than the An example of multivalent rST4 is amino acid 3-178 followed by the C-terminal 199 amino acids of rST4.3. The production of recombinant bivalent rsT4 consisting of: According to the present invention, “multiple valence receptors have two or more binding sites for a given ligand. Ru. Roughly speaking, the intrinsic affinity of each ligand binding site in a given multivalent receptor is They don't have to be the same.

As shown in FIG. 42, to generate bivalent rST4, pBG391 was Cut it with I, cut it with the barin blade at position 178 in rs knife 4, and cut it with green beans. The NheI 5' portion was removed using bean nuclease. Then in BCIII 1) Remove the C-terminal half of the rST4 coding sequence in BG391 by cutting Ta. Finally, regarding rST4 amino acids 3 (lysine) to 377 (isoleucine) The [)ra mini-81IF fragment carrying the coding sequence was ligated to the cut pBG391. p8iv, 1 (i.e. following the N-terminal 176 amino acids of rsT4 <rsT4 ．． encodes a fusion protein with a tandem complex with the C-terminal 176 amino acids of 3. A plasmid) was formed. Therefore, the protein produced by this plasmid White indicates two adjacent N-terminal gp120-binding domains or 0KT4A-binding domain (defined by amino acid residues 3 to 111 of rsT4.111) followed by It contains one 0KT4-binding C-terminal domain (Figure 43).

pBiV,1 was transfected into CO37 cells by electroporation. The expression of bivalent rsT4 protein was tested. After 3 days, transfect The conditioned medium of the cells was subjected to immunoprecipitation followed by Western blotting of the precipitated proteins. were tested for the presence of rST4 bivalent protein. Both 0KT4A and 0KT4 At least one of the 0KT4 epitope and the 0KT4A epitope is used for immunoprecipitation. Determined whether the folded correctly. Both waveforms have the predicted apparent molecular weight (60,0OOd) of precipitated protein was precipitated from the conditioned medium of the cells.

Bivalent rsT4 can be purified from an 0KT4 column by immunoaffinity purification, Quantitative competition analysis against rST4.3 can then be performed using the purified protein. Wear. Bivalent molecules show equivalent competition for rST4.3 for 0KT4A binding. However, there is much greater competition for m rsT4 for 0KT4A binding. Indicates compatibility. The ability of bivalent recombinant soluble T4 to block syncytium formation also 66 fusion analysis. Furthermore, divalent recombinant soluble T4 is also syncytial. It appears to inhibit formation at significantly lower concentrations than mrsT4. This is C112 It is based on the high functional affinity of bivalent recombinant soluble T4 to 0.

According to other embodiments of the invention, other methods of producing multivalent rsT4 can also be used. Ru. For example, rST4 can be combined with any clinically acceptable carrier molecule, i.e. selected from the group consisting of cole, polyethylene glycol and dextran Polyvalent rsT4 is produced by chemically bonding it to a polymer using conventional bonding techniques. can occur. Alternatively, rsT4 can be chemically coupled to biotin and then biotin The tin-rsT4 conjugate is conjugated to avidin to form a tetravalent avidin/biotin/rs T4 molecules can also be generated. Zarani, rsl”4 is dinitrophenol (DNP) or trinitrophenol (TNP). , and the resulting conjugate with anti-DNP or anti-TNP-IClm, or The variable domains of one or both of the heavy and light chains of immunoglobulin molecules are Recombinant chimeric antibody molecules can also be produced with substituted rsT4 sequences. . Since recombinant soluble T4 has gp120 binding activity, two soluble T4 domains Creation of chimeric antibodies with Cl12 and unmodified constant region domains It could act as a vehicle for targeted killing of HIV-infected cells expressing 0.

Clc) and 41 heavy chain chimeras on rST4/S (rsT4. Bacteria for selection in animal cell hosts against quality G418 or mycophenolic acid Animal cell selection vectors containing either neo resistance or bacterial gpt markers subcloned to the target.

and the N-terminal 110 amino acid residues of the splice donor or splice donor sequence. The rsT4ft gene fragment containing a portion of fragment 16 and a certain domain exon of be located upstream of

within the intron downstream of the desired rsT4 coding sequence using a suitable restriction enzyme. can be cleaved to form a donor splice site. Then a suitable restriction enzyme Using an intron to cut within an intron upstream of the coding region of γ-1 and γ-1. I can do it. The rST4 sequence is then linked to the or to the constant region sequence of γ-1. so that the rsT4 intron sequence is continuous with γ-16 and the intron. do. In this way, accession by the T-1 constant region intron or The part to be spliced is formed. Alternatively, the rsT4 chimeric gene may be a suitable rs T4 cDNA gene fragment is fused directly to the coding region of γ-1 or It can also be created without using Tron.

Alternatively, they can be co-transfected into non-lymphoid host cells. 2 types After transcription and translation of the chimeric gene, the gene product is incorporated into the chimeric antibody molecule. You can

You can also do it. The activity of rsT4/IC+G1 chimeras distinguishes them from HIV-infected cells. Both were cultured in the presence of human complement and then complement-mediated lysis of these cells was quantified. can be measured.

Alternatively, activity can be measured in HIV replication and HIV syncytium assays as described above. You can also.

To determine whether bivalent rST4 has greater capacity than monovalent rST4, 0KT4 at various concentrations with a constant concentration of rsT4: molar of rsT4 The mixture was mixed so that the ratio varied from 0.2 to 4. Reserve this mixture overnight at 4°C. After culturing, aliquots were subjected to the HIV syncytium analysis described above.

0KT4 had no observed effect when used alone in this analysis. Roughly , the selected concentrations of recombinant soluble T4 showed no inhibition in this assay. Therefore This suggests that the 0KT4/rsT4 mixture has greater potency than rsT4 alone. are doing. At a ratio of 0KT4:rsT4 higher than 0.2, the syncytial form Partial to complete inhibition of formation was observed. Two rST4 molecules form one 0KT4 The greatest blocking effect appears to be obtained under conditions where it binds to the molecule.

Recombinant soluble T4 in polyvalent and monovalent forms is therefore useful in the compositions and methods of the invention. Useful for law.

Microorganisms and recombinant DNA molecules produced by the method of the present invention were introduced on September 2, 1987. As of the date of In Vitro International, Lynchcoum, Maryland. Illustrated by cultures deposited in the Incorporated Culture Collection. , is identified as follows: BG378: E. coli MC1061/pBG378199-7: E. coli MCl061/p199-7170-2: E. coli JA221/p170- 2EC100: E. coli JM83/pEC100BG377: E. coli MC 1061/pBG3778G380: E. coli MC1061/pBG380 Granted.

Toro International Inc. Power Culture Collection Illustrated in a culture deposited with the Institute and identified as follows: 203-5: E. coli 5G936/p203-5 These cultures each The accession number iv1oisi-10156 has been assigned.

Mouth International Inc. Culture Collection Illustrated in the deposited culture and identified as: These cultures were given accession numbers @Iv110183-10185, respectively. ing.

The present invention has been described above with reference to a number of embodiments, but the present invention can be realized by modifying this basic configuration. It will be appreciated that other embodiments utilizing the methods and compositions may be constructed. death Therefore, the scope of the present invention is not limited only to the specific examples shown in the examples. That will be understood.

FIG./ FIG2 FIG.3 DTV! LTCTASQICKS! QFHWX-K L N D I A D ! RRS L RD Q G N F F! , -XXKHLKXEDMDT YXC11VEDQ-jCE! VQ! , LVFG! ,? ANSDT) ILL-o aos Lrztzzsppass Psvo-F/θ3(conl’d) ELQDSGTVTC? VLQNQKKVE-FW! D! VVLAFQICAS +! ! VTKK-! G E Q V E F g F P L A F T V E x L T G-! GELif supportoxzytxsss*swx〒5-DL KNKEVSVKRV? QDPKLOM-ONL? ! , ALKAIC? GK! , HO! VNL-VVMRATQLOK)r! ,TC! VWGP? -5P　K　L HL 1 f, K L Tomi M K! A K V S K R-EXAV VV! , NPtAGM%FQ(:LLID-sa　Q　v　!,!1　zswx K vr, prws’rpv-OPMAL! VLGGGVAGLLLLF! 0L- G! FFCVRCRMRRIQA! R)l! JQ-APjLFLPADOMNV ADPRP! , AS-Cgl’PLQFA! VSPGLGPOF? G-Q ↑ )! ! ! , 〒〒〒 LIIKQPL　ガ〒〒　　　　　　　11　V　　　　　　　CF　-F/θ3 (con/d) HGKGPSQRrTEQG*RPP(:LK-Flo, 3(coni’d) FL! IIFSQDP! ,! SYPSSPLPS-hpBG312- EcoR I (4,75kbp) F/65 ”numbers 1nparenfheses refer circle L T4 c DNA Coortltnafes1 general cod 1so parturition f, 3kbPfra3 operation 'Me/-, oerfed'cassefle f;pr E, coh' ex Pression of rsT4IG9C F/G10 5’rGCCCACA? (,GτCC^CCCCGG)CCAC(CAATCT CA3゜S'　TCCccACAG　(ic　C':G　CTCCAA　TC CAACATCAACTCA A 3 '3' (:Tc TCC 8CC entered C A (CTTA 00 by-A'r TCA CT': CTA C; S’5’ CAG CCA CCCAAACCAAλCA AAG TIJ 31 S’TCCG enter CACCTCCT’CCTC; CAJi TCC enter AC enter rc input AG r 3゜F/θ10 (conl d) 5’　AGCTTCACTCC GC person TCGAG GcA AACAAA σTCC; TG 3’AGC input τCCATTTCC input TC4G! uPh *LauM1sLauValLysL*uL*u! leL generation! zd:isτ1 le yst, *yamagLysS・fuxj　-τ’xAyuas@ra1azylys! a r! knee + Lt) halifi↑rpLysJun! arAa+s(:la!1 sLys! Knee | L11+aOIY island-nOLnCLy! arPh*Lau? hrLy＊GyuyP ro! 5rLysLauJa-^1p^shi(;Iyuyama?-1ljr 11ga rF@t - 琐ufufufuucho2kol=+Gly enternaPh*ProLau! i s! l*LyaAaaLauLy*! lE　- Gi mountain p! @rAap? ! , r? yrZlzaki5GluVaiGluJu%l≦y scLu(:1uVaWl!*uLau -ValPheC1yLsu?hrA 1i misanthropy alsrAmpτkrilLmuLauG1s(lyclBsmtL ay-, pg:au-? 5rL*vdl*5*rP:oP:edLyS@rSe :1'=al*rValGLa:ys enter rd@rPra enter z9cyuyyyuki-to 5aILdL2G1yGyuyLymτhrL*u! *rVal! *r1m*uG luLa+, +d1. 8mp to a% YuYfu 5; -? Q? '-rCys-, mr ValbuGl mountain QCLeLysLysVa101uPhaLym: i mountain p: i*VaLVaL -1・-Artificial aP+561=2y-^yuaSgarS*rH YuaVaYufyr:ys=ysGlu(:YYGYu*GL2VaLG-=PTh e@− 5*rP 慕5P=oLauJuaPheτhrVaIGluLysLau? mr OLyS*rC1yC1uLat? -, τfu Lrs -! 1isVaL! adG laLau Engineering 1a! la＾5pLy meeting Lag person LaL@uA@b enter rg! ＋、ri He! Engineering・〒-alLys-Cy Soiri; gA=gAz9PTO! l@P5ζys L*uProP=6λ;9v-kia5er,^;gcysMs:OL*Pr o-G YulliaL@v course, 5pLauJuaC1y$ar; 9 people z+JL sLau enters two mountains: C1yPh*τhrfu*=Pro enters zq-eyl'lis1m =Lau! arVaLS*ILyeys enter r%', gGyu;fu mrS*rP=a ! QrC1y entered HrJ&2S+r-royu YCys? r;In:gVa15*:GL y input: qS*:MLsλmp? = oVa: F = 1 = 1 person z; fy 4 people rgS*r Va: -FIG, / oni’d) Enter rgP: o? :Ro entered spe, Yu fan=mHii=ys entered 19; 9 people:';S@ :S@rGhW enter; Kufu-, Asps:,? =s? ,knee! ;Fist=M=? :oV aL enter rgMim^5pLsus*=P=oLauλ1也也入yua enter1afu*:G Ly contains 1 unit = g engineering 1 esaz - person; 9 people enters ``F'' ValGLycAy 21τ'-:C:*? heLav=,y3τ;af7p:eAj-ri:/? (L Y) y-GlySykspAlaGLnT:'PAJrsGL-person5rssar Enter rgEa! cLy! l*cauvalx*c included rgLauser-Lys included: g: Yu Ph-τ2rtpd! l*Lsu'ha containing r9s bite: pro containing*pLa u! *! sul*rfu*p’-*in La-CYmAn! LHL m? YTM L 1 company F l v ho C; E 11 (!Aj ElS 41 ni l aM i - P=oCy*G1%ap entered rgPhaJu+zValΣxd entered 1aGL2Lym Enter; 9^nnMigEpcJIinLY-5Red 5er-PrυzglunL generation S@rC1sτhrArg? r% Lr Tsunny S @rCLsu1aLauV alLsu’7rLau -Pa・wo enteryu aj@rM*:! Ii*! =astLa u! 1e) hrP=oH1sCysLauGL2LysP! +a5erLysL eu −F/θ//(conl d) Val(:yssarAre, Beniru @uGLuVJlls@Sekizurus@f?hrL A bet on 4uPh work Ph4 *zPhaJqgGLi -Gl! IJP=o! ,Ys LydraVaL! l*-ullimS梼r+JyLcloudyw enter:gLauLy*V aL! L-ku Pro! +xcJ=o@− )Iis(:1pGLa in LaProS@rC1a in 1aPh@Lauτhrl :LuCytEadh・Sar! , su) 2rLa*5*r@− ArqLt*LauSa=GLko Va1! l*5aH included 1-aE2d? τRo included M pL@’AGLyV&L morningtS@neemu? :05Ia: | People; 9 people 1nΣ2d2aaGyuy::a enteryuaVaLλ:gysP? , e? y r input acHistr4τ9;9j-ass:τrevised G-2-LYl, input r98: gLauAlaJupAr%La(:1yVaLLauVaLGly enter aΣ: seJ, ag engineering 1@τ2=IL meeting Giu@− ? = o enter sa enter ant J, ip: oLau (L! L! + y mark! la enter ms * r1 −Yzotysr, ysnsmτ5: °in 1pλ−aMisk*u − F/G, //(conl’d) σ1ySsr 1mL 25*r included; 9 people rgLsu; pGlyv11! :td Fyrl:lu? 59ysFIim7?7 -F/θp /ane / = Pre-tndt4cedFIG, 14B bg3B! , seq L@ngth+ 61511 GAATTAATTCCA GCTTGC Ding G TGG^^ Ding GTGT GTCAGT Ding^GG G Ding GTG Ga^^G51 TCCCCAGGCT CCCCAGCAGG CAG^^G TATG C^^^GCATGC^DingCTC^^TT^101 GTCAGCA ACC, AGGTG Ding GGAA AGTCCCCAGG CTCCCCAGCA GGCAGAAGT&151 7GCAAAGCAT GCATCTC^^T 　TAGTCAGC^^　CCATAQτccc　ccccccτ^^Cτ201 　CCGCCC＾Ding CCCGCCCCCT＾＾C ding CCGCCCAcT τccc ccc^TT CTCCGCCC^251 TGGCT(aAcTA ATT TT Ding TT Ding A TTTATG(, A(mA GCaCCGAG(aCCGCC TCGGCCT301 CTGAGCTATT CCAG^^GTACt TQ AGG^GGCT TTTTTGGAGG GGTCCτCCτ [351 GT ATAGAAAACTCGGACCACT CTGAGACG^^ GGC Ding C ( acc, Tc CAC, (accAGc^401 CGAAQGAGCsCTA A(aTGGGAG GO(aTAGc(aGT CG7+aTCCACTA GGGGGTCC451acTcGcTcci GQGvcTG^^G ACA CATQTCQ CCCTCTTCGG CATCAAGGA^SQL CCT GATTGQT TTATAGGτGT AQQCCACQTG ACCGQG Ding GTT CCTG^^acGG551 (JGCTAT^^^^G1.(a GGTGGGGGGCGCGTTCGTCCTCACDCCTTCCGCA TCG601 CTGTCTCC(, A C+, CCCA(licTG TTG GGCTCGCGGTTGAGGAC^^^^CTCTTCQ651 CGGTC TTTCCAGTACTCTTG GATCGG^^^CCCGTCGGCCT CCG^^CG(aT^fu01 CTCCGCACCGAGGGACCTG AGCGAGTCCG CATCGACCGG ATCGG^^^^C751 (TCTC(JAG^^　^GGCGTCT^^　CCAGTCACAG　TC GC^^GGTA GGCTGAGCAC801CGTGGCGGGCGGCA GCGGGT GGCGG Ding CGGG GTTGTTTCTG GCGGAGG TGC851TGCTGATGAT GTAATT^^^G TAGGCGGT CT Ding GAGACGGCG GATGGTCGAG901 G Ding GAGGTG TG GCAGGCTTGA GCCATACACT TGAGTGAC＾＾951　TGAC＾τCCACTTTGCCTTTTCTC CeCACAGG　TGTCCACTCCCAGGTCCAAClool　TG GATCCAAG CTT (:GAC CG AGGAaTTCCCCG^^G GAAC＾　＾＾GCACCCTC1051CCCACTGGGCTCCTGG T-cho GCAGAGGC-CC^^ GTCCTCACACAGATACGCC-1 101 GTTTGAG^^G CAGCGGGCAA GAAAGACGC^ ^GCCCAGAG CCCτGCCAT 1151 TCTGTGGGC T CAGGTCCCTA CTGGCTCAGG CCCCTGCCTCCC TCGGC^^G1201　GCCAC^^TG^　^CCGGGGGAGT　C CCTT Ding TAGG CACTTGCTTCTGGTGCTGC^1251　^ CTQQCGCTCCTCCCAGCAG CCACTCAGGG ^^^G^ ^^GTG GτGCTGG (aC^1301 ^^^^^GGGGA TAC AGTGQ^^ CTG^CCTG ding^ CAGCτTCCC^ G^^G^^ GAGC1351ATAC^^TTCCACTGG^^^^^^CTCC^^CC AG ＾τ＾^^＾G＾TTCTGGG＾＾＾τC＾uu=c, cccTCCT TCTTAACT^^^G GTCCATCC^A GCTlaAATQAT CGCGCT+aACT 501 CTT^^GA ding^G ^^GACTCAG A TACT Ding^CATCTGTG^^GTGG AGGACCAG^^155 1　GGAGGAGGTG　C^^TTGCTAG　TGTTCGGATT　G ACτGCC^^CTCTGACACCC1601ACCTGCTDing CA GG GGCAGAGCCTGACCCTGA CCTTGGAGAG CCCCCC TGGT1651 AQTAGCCCCT CAGTGC^^TOTAGGAG TCC^^GG(aGT^^^^ACATACAISGG1701 GGQGA AQACCCTCTCCGTGTCTCAGCTGGAGCTCCAGGA T AGTG(iCACCT1fu54 GGACAT(, CACTGTCTT( acAG ^^CeAG^^G^^ GGTGGAGTT C^^^^TAGA C11101^τCGTGGTGCT^GCTTT((^　G^^G(aCC ding CCAGCATAGTCT ATAAAGAAAI:i^La5t C, GGQG AACAG GTGGAGTTCT CCTTCCCACT C (sccTTT AcA GTTG^^^^GC1901TGACGGCCAG TGGCGAQ CTG TGGTGGCAGG CGGAGAGGGCTτCCTCCCding CC1 95 pieces AAGTCTTQGA TCkCCτTTGA CCτG^^G^^C ^^GG^^GTGT CTGτ^A^^C62001GGTTACCCAG GkCCCTAkGCTCCkG^τGGQ CMG^^GCTCCCGCTC CACC2051TCACCCTGCCCCAGGCCTTGCCTCAGT LTG CτGGCTCTGG A^^CCTCACC2101CTGGCCC TTG ^^GCG^^^^^CAGG^^^G-DINGTOCATCAGQ^^GTG ^^CCTGGT2151 GGTGATGAGA GCCACTCAGCTC CAG^^^^^^ TT Ding GACCTGT GAQCtTGTQGG2201 GACCCACCTCCCCTAAGC ding G ATGCTGAGTT TGAA ACTGGA GAACAAGQAG2251 GC^^AQGTCT CGA AGCGGGA G^^GGCGGTG TGGGTGCTG^　^CCCTG AGGC2301GGGGATGTGG CAGTG Ding CTGC Ding GAGTGA CTCGGGACAGGTCCTGCTGGG^^T2351 CCAACATC AA GGTTCDingGCCCACATGGTCGACeCCGGTGCAG CC^^TGGCC2401CTGATTTGAG ATCTTTGTGA A GGAACCTTA CTTCTGTGGT GTGACAT^^T24S1 Ding GC, AC^^AC Ding ^CCTACAGAG ATTT^^^GCT CT ^^GGT^^^　Ding^T^^^^^TTT2501 TTAAGTGTAT A ATGTGTTT＾＾　＾CTACTGATT　CTAATTGTTT　GTG ding ^TTTT^2551 GATTCCAACCTATGG^^C-cho G ATG^ ^TGG(aA GCAGTGGTGG AATGCCTTTT^2601 ^T GAGGAA^^ CCTGTTTTGCTCAGAAG^^^ TGCCAT CTAG Ding G^ Ding GATGAQ2651 0CTACTOCTG AC Ding CT CAAC^Ding TCDing^CDingCCTCC^^^^^^GA AGAGAAAG GT2701 AG&AGACCCCAAGGACTTTCCTTCAGAAT TCICT Ding AQ TAATAG^^CT CTTGCT Ding GCT TTGCTATTTA CACCAC^^^G2801 GAAAAAAGCTG CaCTGCTaT a CAAG^^^ATT ATGGAAA^Aτ ATTCTG Ding^^C28 51CTT^TAAG^GGCAT^^CA GTTAT^^TCA T AACATACTG dingTTTT(:T↑^2901 CTCCACACAG GCATAGAGTG TCTGCTATTA ATAACTATG (: T CAAAATTG2951 TGTACC Dinghu TA GCTTTTTT^^T TTG ding^^^GGG GTT^^TAAG (a ^^ TATT ding G^ ding 3 (1 01GTATAG GCCTTGACTAGAG ATCAT^^TCA GC CATACCACATTDing GTAG^G3 (is) GTτ--4CTTQ ( TT↑^A^^^^　CCTCCCACACCTCC(:CCTGA　ACCT G^^^C^F　/G　15(conj’d) 3101 T^^AATGAA Ding GC^^TTGTTG TTGTT^^CT T GTTTATTGCA GCTYAT^^TQ470: c insect GCQAGG τ^　TGTAGGCGGT　GC ding^CAGAGT　TCTTG^^GTG　 GTGGCCT^^CF/G, 15 (conf’d) 135U ^TAC^^TTCCACTGQ^^^^^^CTCC^^CCAG AT^^^GATTCTGGG^^^Te^3001 ATAGTGCCTT 　GACTAGAGAτCATAATCAGCCATACCACAT　TTGτ AGAGQT3101 ^^^TG^^TGC^^TTGTTGTT G7 Ding^ ^CTTGT TTATTGCAGCττ^TA^TGOT3151 TAC^ ＾＾T＾＾＾　；＾＾TAG(:AT　CAC＾＾＾T Ding TCAC＾＾＾T＾＾ ^G CATTT Ding τTTC3201ACTGCATTCT AGTTGTGG TT TG Ding CC^^^CT CAT (^^TGTA TC Ding TATC^τG3 251　TCTGGATCCT　CTACGCCGGA　CGCATCGTGG CCGGCATCACCQGCGCCAC＾3301 GGTGeGGT ding G CTGGCGCCTA TAACGCCGACATCACCGATG GGG AAGATCG3351 GGCTCGCCACTTCGGGCTCA TGA GCG (:T Ding G TTTCGGCGTG GG Ding^TGGTGG34Ql ( AGGCCG Ding G GCCGGGCI:, ACTG Ding TQGGCGCCATC TCC Ding TG CATGCACCAT3a51 TCCTTGCGGCGGGCG GTGCTC＾＾CGGCCT（：＾　＾CCTACTACT　GGGCCTGC TTC3501CTAATGCAGG AGTCGCATAA GGGAGAG CGT　CGACCGATGCCCTTGAGAGC3551CTTC^^CC CA GTCA (aCTCCT TCCGGTGGGCGCGGGGCATG ACTATCGTCG3601 CCGCACTTAT GACTGTCTTC TT Ding^TCATGC^^CTCGTAGG ACAGG DingGCCG3651 GCAGCGC ding CT GGGTCATTT C:GGCGAGGACCGC CCrCGCT GGAGCGCGAC3701GATGATCGGCCTGT CGCTTG　CGGT＾DingTCGG　^^TCTTGCACGCCCTCGC Ding C375 engineering ^^GCCTTCGT CACACCTCCCGCCACC^^ ^CGTTTCGGCGA G^^GCAGGCC31101ATTATCGC CG GCA 1:1 GCGI: iCCGACGCGC GGCGCCGT CT TGCTGGCG Ding T3951 GACGACCATCAGGGACAG CT　TC^^GGATCG　CTCGCGGCTCTTACCAGCCT40 01　^^CTTCGATCACTGGACCGCTG^GCCTCACGGC GATTTAT GCCGCCTCGG4051 CGAGCACATG G^ ＾CGGGTTG GCATGGATTG Ding＾GGCGCCGCCCTATA CCTTAiOI GTCTCCCTCCCCGCGTdingGCG TCGCGG TGC^　DingGGAGCCGGG　CCACCTCGAC4151CTGAAT GG^^　ccccccccccA　cctcccv^^CGG^DingTCACCA CTCC^^G^^T4201 TGG^CICC^^TC^^TTCTTG CGGAG^^CTGT G^^Ding GCGC^^CC^^CCC Ding T425 1 GGC^G^^CAT ATCCATCGCG TCCGCCATCT C CAGCAGCCG CACGCGGCGC4301ATCTCGGGCCGC G Ding τGCTQQ C (iTTTTTcca Ding AGGCTCCGCCCCCC TGACG4351 ^GCATC^C^A ^^ATCGACGCTC^^Q T(AQA　GGTGGCG＾^＾　CCCGACAGG＾44ot　CτAτ ^^AGAT　ACCAGGCGTT　TCCCCCTGGG^　^GCTCCC TCQ TGCGCTCTCC4601CGACCGCTGe GCC ding TA ding CCG GTAACTATCG TCTTGAGTCCAAACCCGGTAA4 651　QACACGACTT　ATCGCCACTG　GCAQC＾GCC＾ CTGGT^^CAG G^Tτ^GCAQ^4701 GCGAGGTAT G TAGGCGGTGC ding^CAGAGTTCTT(a^^G ding GGT GG CCTAACT＾4751　CGGCTACACT　AGAAGGACAG　Ding ^TTTGCTAT CTGCCCTCTG CTG^^GCCAG41i10 i TTACCTTCGG A^^^AGAGTT (aGTAQc Engineering CTT G^TCCC, GC^^^C^^^CCACC485k (aCτGGTAGC G GTGGTTTTTT TGTTTGC^^GC^GCAGATτ^ccc cca(,^^^4901　^^AAGGATCT　C^^G^^GATCCT TTGATCTT DingTCTACQC+G(li τCTGACGCTC495 1^GTGGAACGA　^^^^CTCACGT　T^^^QQQATTT　TG GTCATGAG ATTATCAAA＾5OOL AGQATCT CA C CCAGATCCT　TTTAAATTAA　AAAAAAAGTT　TTAA ATCAA 5051 CTAAAGTATA TATGAGTA^^CTTG GTCTGA CAGTTACC^^TGCTTAATC^5101 G-cho GA GGCACCTATCTCAGCG ATCTGTCT＾Ding TCGTTCA TCCATAGTT GCC5151TGAC CCCCG TCGTGTAGA T　^^CTACG^Ding^　CGGGAGGGCT　TACCATCTGG52 01 CCCCAGTGCT GCAATGATACCGCGAGACCCAC GCTCACCG GCTCCAGAT 5251 TATCAGCAAT ^ ^^CCA(,CCA GCCGG^^GGG CCGAGCGCAG ^^G TGG Ding CC Ding 5301 GCAACTTTAT CCGCCTCCAT CC AGTCT＾DingT＾＾TTGTTGCCGGGAAGCTAG5351AG TAAGTAGT TCGCCAGTT＾　＾TAGT TGCG CAACG TTGTT GCCATTGCTG5401 CAGGCATCGT GGTG TCACGCTCGTCGTTTQ GTATGGCTTCATTCAGCTC C5451GGTTCCCAAC (aATcAAGGcG AG dingTACATG A　TCCCCCATGT　TGTGCA＾＾＾＾5501　＾GCGGTTA GCTCCTTCGGTCCTCCGATCGT　TGTCAG^^GT　^^ GTTGGCCG5551 CAGTGTTATCACTCATGGTT AT GGCAGCACTGCAT^^TTC Ding CTTA (Ding QTC5601ATGC CATCCG　TAAGATGCTT　TTCTGTGACT　GGTQAGT ACT CMCCAAGTC5651^TTCTGaG^^TAGTGT^Ding GCG+li(:CACCQAG　TTGCTCTTGCCCGGCGTC^^ 5701 CACGGGATAA TACCGCGCCA CATAGCAG^ ^CTTTAAAGT GCTCATCATT5751 GGAAA(QT τ CTTCGI:, GGCG aAAACTC7CA AGGATCTTAC CQCTGT dingGAG5801 kTckGTτCG ATGTa^CCCA CTCGTGCACCCAACTGATCTTCAGCATCTT5B51 ττACTTTCACCA(aCGTTTCT GG(IIτGAGC^^) ^axcAGGAAQ GC^^^^dingGCC5901GCAAAAAAGG GAATAAGGGGC(aAcAcG'(aAAA TGTTGAATACTC ATAC CTT5951CCTTττTCAAτATTATTGAA GCA TTTATCA GGGTTATTGT CTCATGAGCG6001 GA TACATATT TGAATGTATT TAGAAAATA AACAA ATAGG GGTTCCGCGC6051^C^CTTCCCCGAAAAG TGCCACCTGACGTCTAAGAAAACC^ DingTATTATCAT6 101 GACATTAACCTAT^^AAAATA GGCGTATCACG AGGCCCT Ding T CGTCTTC＾^g,・C:Acc? -CCA GA G　A　3’S’CAτCTCACτ ＾υ心3′ And 5'(,50CτGAτ included Cτ^　^　3〕

Claims (1)

[Claims] 1. (a) DNA inserts of P199-7, pBG377, PBG380,0, pBG381, P203-5, pBG391, pBG392, PBG393, PBG394, pBG395, PBG396, pBG397, P211-11, P214-10 and P215-7 (b) a T4-like polypeptide hybridized to one or more of the DNA inserts and soluble upon expression; and (c) a DNA sequence which upon expression may be encoded by any of said DNA inserts and sequences. A DNA sequence selected from the group consisting of: A DNA sequence that encodes a soluble T4-like polypeptide upon expression. 2. The DNA sequence (b) is a sensitizer that targets T4+ lymphocytes and T4+ lymphocytes. Soluble T4- compounds that prevent adhesion between T4+ lymphocytes and antigen-forming cells and targets for T4+ lymphocyte-mediated killing. A DNA sequence according to claim 1, which upon expression encodes a similar polypeptide. 3. It has a DNA sequence selected from the group consisting of the DNA sequences set forth in claim 1 or 2, and this DNA sequence is created as an expression control sequence in a recombinant DNA molecule. 1. A recombinant DNA molecule characterized in that it is linked to 4. Expression control sequences are SV40 or adenovirus early or late promoters main operators of phage λ, Iac system, trp system, TAC system, TRC system, and promoter region, control region of fd coat protein, 3-phosphoglyceratequina promoters for enzymes or other glycolytic enzymes, acid phosphatase promoters, 4. The recombinant DNA molecule according to claim 3, wherein the recombinant DNA molecule is selected from the group consisting of a baculovirus polyhedron promoter and a yeast α-mating factor promoter. 5. A recombinant DNA molecule selected from the group consisting of recombinant DNA molecules according to claim 3 or 4. A unicellular host transformed with a recombinant DNA molecule. 6. 6. The host according to claim 5, which is selected from the group consisting of E. coli, Pseudomonas, Bacillus, Strebtomycetes, fungal strains, animal cells in tissue culture, plant cells, insect cells, and human cells. 7. A polypeptide coded for expression by a DNA sequence selected from the group consisting of the DNA sequences according to claim 1 or 2 and substantially free of other proteins of human origin. 8. A polypeptide of the formula AA-23-AA362 in FIG. 3, a polypeptide of the formula AA1-362 in FIG. 3, a polypeptide of the formula Met-AA1-362 in FIG. 3, a polypeptide of the formula AA1-374 in FIG. polypeptide, a polypeptide of formula Met-AA1-374 in FIG. polypeptide of formula AA1-377 of FIG. 3, polypeptide of formula Met-A A1-377 of FIG. 3, polypeptide of formula AA-23-AA374 of FIG. 8. The polypeptide of claim 7, which is selected from the group consisting of polypeptides of formulas AA-23-AA377 in FIG. 9 Polypeptide of formula AA-23-AA182 in Figure 16, polypeptide of formula AA1-AA182 in Figure 16, polypeptide of formula Met-AA1-182 in Figure 16 AA-23-AA182 in Figure 16 is followed by the amino acid asparagine - A polypeptide having the sequence 1-glutamine-histidine-serine-isocysine, the formula AA1-AA182 in FIG. 16 followed by the amino acids asparagine-leucine. A polypeptide having the sequence of luteamine-histidine-serine-leucine, a polypeptide having the formula Met-AA1-182 of FIG. 16 followed by the sequence of the amino acids asparagine-isocycine-glutamine-histidine-serine-leucine, FIG. A polypeptide of the formula AA-23-AA113 of FIG. 16, a polypeptide of the formula Met-AA1-113 of FIG. 16, a polypeptide of the formula AA-23-AA111 of FIG. Peptide, polypeptide of formula AA1-A A111 of FIG. 16, polypeptide of formula Met-AA1-111 of FIG. 16, polypeptide of formula AA-23-AA131 of FIG. 16, polypeptide of formula AA1- of FIG. 16 Polypeptide of AA131, polypeptide of formula Met-AA1-131 of FIG. polypeptide of formula AA-23-AA145 of FIG. 16, polypeptide of formula AA1-AA145 of FIG. 16, polypeptide of formula Met-AA1-145 of FIG. a polypeptide of formula AA-23-AA166 of FIG. 16, a polypeptide of formula AA1-AA166 of FIG. 16, a polypeptide of formula Met-AA1-166 of FIG. 1-6, or a portion thereof. 8. The polypeptide according to claim 7. 10. Polypeptide of mature T4 protein formula AA-23-AA362, Polypeptide of mature T4 protein formula AA1-362, Polypeptide of mature T4 protein formula Met-A A1-362, Polypeptide of mature T4 protein formula AA1-374 polypeptide, mature T4 protein formula Met-AA1-374 polypeptide, mature T4 protein formula AA1-377 polypeptide, mature T4 protein formula Met-AA1. -377 polypeptide, mature T4 protein polypeptide of formula AA-23-AA374, mature T4 protein polypeptide of formula AA-23-AA377, or a portion thereof. polypeptide. 11. Polypeptide of formula AA-23-AA182 of mature T4 protein, Polypeptide of formula AA1-AA182 of mature T4 protein, Polypeptide of formula Met-AA1-182 of mature T4 protein, Polypeptide of formula AA-23-AA182 of mature T4 protein Continued Amino acids asparagine-leucine-glutamine-histidine-serine-leu The formula of the mature T4 protein is AA1-AA182, followed by the amino acids asparagine-leucine-glutamine-histidine-serine-leucine. A polypeptide having the sequence of Amino acids asparagine-leucine-glutamine-histidine-serine-leu polypeptide having the sequence of syn, a polypeptide with the formula AA-23-AA113 of the mature T4 protein, a polypeptide with the formula AA1-AA113 of the mature T4 protein, a polypeptide with the formula Met-AA1-113 of the mature T4 protein, a polypeptide with the formula Met-AA1-113 of the mature T4 protein. Polypeptide of protein formula AA-23-AA111, polypeptide of mature T4 protein formula AA1-AA111 polypeptide, mature T4 protein formula Met-AA1-111, mature T4 protein formula AA-23-AA131 polypeptide, mature T4 protein formula AA1-AA1 31 polypeptide, mature T4 protein formula Met- Polypeptide of AA1-131, polypeptide of mature T4 protein formula AA-23-AA145, polypeptide of mature T4 protein formula AA1-AA145, polypeptide of mature T4 protein formula Met-AAl-145, mature T4 protein A polypeptide of formula AA-23-AA166, 8. The polypeptide of claim 7, which is selected from the group consisting of a mature T4 protein polypeptide of formula AA1-AA166, a mature T4 protein polypeptide of formula Met-AA1-166, or a portion thereof. 12. When producing a polypeptide selected from the group consisting of the polypeptides according to any one of claims 7 to 11, the recombinant DNA molecule according to claim 3 or 4 is used. Transformation with a silk-transforming DNA molecule selected from the group 1. A method for producing a polypeptide, which comprises culturing a transformed unicellular host. 13. An immunotherapeutically or immunosuppressively effective amount of a polypeptide selected from the group consisting of polypeptides according to any one of claims 7 to 11 and a pharmaceutically acceptable amount. A pharmaceutical composition comprising a compatible carrier. 14. A method of treatment comprising treating a specimen in a pharmaceutically acceptable manner with a composition selected from the group consisting of the compositions of claim 13. 15. 15. The method of claim 14, wherein the subject is treated by intramuscular injection of the composition. 16. HIV infection characterized by comprising a diagnostically effective amount of a polypeptide selected from the group consisting of polypeptides according to any one of claims 7 to 11. A diagnostic composition for detecting or monitoring the course of infection. 17. A method for detecting or monitoring the course of HIV infection, characterized in that a composition selected from the group consisting of the compositions according to claim 16 is used as a diagnostic agent. 18. A means for detecting or monitoring the course of HIV infection, characterized in that it comprises a composition selected from the group consisting of the compositions according to claim 16. 19. An immunotherapeutically or immunosuppressively effective amount of an antibody against a polypeptide selected from the group consisting of polypeptides according to any one of claims 7 to 11. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and a pharmaceutically acceptable carrier. 20. Treating a specimen with the composition according to claim 19 in a pharmaceutically acceptable manner. A method for treating a specimen, characterized by: 21. Use of a polypeptide selected from the group consisting of polypeptides according to any one of claims 7 to 11 for purifying an HIV virus. 22. The use according to claim 20 for purifying HIV virus from a biological sample. for. 23. A method for purifying an HIV virus from a sample, comprising exposing the sample to a polypeptide selected from the group consisting of polypeptides according to any one of claims 7 to 11. 24. 23. The method according to claim 22, wherein the sample is a biological sample. 25. A DNA sequence containing a P170-2 DNA insert and encoding a T4-like polypeptide upon expression. 26. A DNA sequence selected from the group consisting of the DNA sequences according to claim 25. a recombinant DNA molecule, the DNA sequence being operably linked to an expression control sequence in the recombinant DNA molecule. 27. A single cell host transformed with a recombinant DNA molecule according to claim 26. main. 28. encoded and implemented by the DNA sequence according to claim 25 upon expression. A polypeptide that is qualitatively free of other proteins of human origin. 29. Immunotherapeutic or immunosuppressive doses of soluble protein receptors and pharmaceutically acceptable drugs. A pharmaceutical composition comprising: 30. A method for treating a specimen, which comprises treating the specimen in a pharmaceutically acceptable manner with the pharmaceutical composition according to claim 29. 31. A viral infection characterized by comprising a diagnostically effective amount of soluble protein receptors. A diagnostic composition for detecting or monitoring the course of infection. 32. 1. A method for detecting or monitoring the course of viral infection, which comprises using a diagnostically effective amount of soluble protein lysate as a diagnostic agent. 33. A means for detecting or monitoring the course of a viral infection, characterized in that it consists of a soluble protein receptor. 34. (a) pBiv. (b) pBiv. 1 and encode a multivalent soluble T4-like polypeptide upon expression. (c) PBiv. A DNA sequence selected from the group consisting of: A DNA sequence that upon expression encodes a multivalent soluble T4-like polypeptide encoded by a DNA insert of 1. 35. A DNA sequence selected from the group consisting of the DNA sequences according to claim 34. sequence, and this DNA sequence is operably linked to an expression control sequence in the recombinant DNA molecule. A recombinant DNA molecule that is 36. A single cell host transformed with a recombinant DNA molecule according to claim 35. main. 37. A DNA sequence selected from the group consisting of the DNA sequences according to claim 34. A polypeptide encoded upon expression by a protein sequence and substantially free of other proteins of human origin. 38. 8. The polypeptide of claim 7, wherein the polypeptide is multivalent. 39. (a) Transformation with the recombinant DNA molecule according to claim 3 or 4. 1. A method for producing a multivalent polypeptide, comprising: culturing the transformed unicellular host to produce the polypeptide; and (b) binding the polypeptide to a carrier to produce the multivalent polypeptide. 40. (a) a first portion consisting of a DNA sequence encoding a certain region of an immunoglobulin heavy chain; (b) consisting of a DNA sequence or a portion thereof according to claim 1 or 2; A DNA sequence characterized in that it consists of a second part linked upstream. 41. (a) a first portion consisting of a DNA sequence encoding a certain region of an immunoglobulin heavy chain; (b) consisting of a DNA sequence or a portion thereof according to claim 1 or 2; A DNA sequence characterized in that it consists of a second part linked upstream. 42. An expression vector having the DNA sequence according to claim 40. 43. An expression vector having the DNA sequence according to claim 41. 44. An expression vector having the DNA sequence according to claim 40 and the DNA sequence according to claim 41. 45. A host cell is co-transfected with the expression vector according to claim 42 and the expression vector according to claim 43. Method for producing rsT4/1gG1. 46. Transfecting a host cell with the expression vector according to claim 44 A method for producing chimeric rsT4/1gG1, which comprises: 47. ．． Chimera rsT4/1gG1 produced by the method according to claim 45 or 46. 48. A pharmaceutical composition comprising an immunotherapeutically or immunosuppressively effective amount of the polypeptide according to claim 37 or 38. 49. Treating a specimen with the composition according to claim 48 in a pharmaceutically acceptable manner. A method for treating a specimen, characterized by: 50. A diagnostic composition for detecting or monitoring the course of HIV infection, comprising a diagnostically effective amount of the polypeptide according to claim 37 or 38. 51. A pharmaceutical composition comprising an immunotherapeutically or immunosuppressively effective amount of the chimeric rsT4/1gG1 according to claim 47. 52. Treating a specimen with the composition according to claim 51 in a pharmaceutically acceptable manner. A method for treating a specimen, characterized by: