JPH0195778A - Heat-resistant protease and its production - Google Patents

Abstract

PURPOSE:To obtain a heat-resistant protease of a specific enzyme-chemical properties such as molecular weight or pH stability, by culturing a strain of Bacillus stearothermophilus and collecting protease from the culture mixture. CONSTITUTION:A strain in Bacillus stearothermophilus such as Bacillus stearothermophilus MK-232 (FERM 9645) is cultured and the subject heat- resistant protease is collected from the culture mixture. The heat-resistant protease has the following enzymatic and chemical properties: 34,400 molecular weight (gel filtration, SDS-PAGE), pH stability where it keeps more than 90% activity, after treatment with 6-9pH at 17 deg.C for 30 minutes, 6.5-8.5 optimal pH (60 deg.C, in the presence of 2mM Ca<2+>), 75-80 deg.C optimal temperature, 100% residual activity after heat treatment at 80 deg.C for 30 minutes, and containing 1 atom zinc each protein molecule.

Description

[Detailed description of the invention] ・　　−　6　1 “Industrial application field” The present invention relates to a thermostable protease and a method for producing the same.

For more information, see the moderate thermophile Bacillus stearothermophilus.
A thermostable protease (hereinafter referred to as
The present invention relates to protease TOS 011-1) and its production method.

[Prior Art] Conventionally, as a thermostable protease, a moderate thermophilic bacterium Bacillus thermoproteolyticus has been used.
Thermolysin produced by P. thermoproteolyticus is common and widely used industrially. This thermolysin is extremely stable not only against heat but also against organic solvents, urea, and the like. Therefore, it can be used not only as a research reagent, but also in a wide range of fields such as various food processing and detergent additives, and can withstand long-term use without decreasing its potency.

[Problem to be solved by the invention] As described above, thermolysin is an excellent proteolytic enzyme with heat resistance, but if an enzyme with higher heat resistance and specific activity exists than this enzyme, the range of use would be limited. is more widespread and also shows higher enzymatic response when used in small amounts.

It is an object of the present invention to provide such an enzyme.

[Means and actions for solving the problem] The inventors of the tree focused on the above points, and as a result of studying proteases with higher heat resistance and higher specific activity than thermolysin, they found that they have a structure similar to thermolysin. Furthermore, they discovered a protease with high heat resistance and increased specific activity, leading to the present invention.

The present invention relates to such a protease and a suitable method for producing the same.

That is, the present invention is a protease having the following characteristics.

Molecular weight: 34400 (gel filtration method, 5DS
-PAGE) 34176 (Amino acid composition) pH stability = After treatment at 37°C for 230 minutes, the pH is stable with an activity of 90% or more in the range of i to 9.

Optimum pH: 6.5-6.5 (H'C, 2m1c
(in the presence of a2+) Optimal temperature = 75-80°C (when reacting for 20 minutes using casein as a substrate in the presence of 2m1ca2+) Temperature stability = residual activity after heat treatment at 80°C for 30 minutes;
100% Residual activity after heat treatment at 90°C for 30 minutes: Approximately 45% (10InMTris-HCl, 2mMCaCl2
．． (at pH 7.0) Metal content: 1 atom of zinc per protein molecule Inhibitor: ethylenediaminetetraacetate (EDTA),
1.10-0-phenanthroline, phosphoramidone ultraviolet absorption spectrum: Substrate specificity around 280 nm:
In the decomposition of oxidized insulin β chain, the following parts are decomposed:

Nl2 ++1H25O3)! ↑ S O3H -Leu-Va1-Glu-A1a-Leu-Tyr-
Leu-Val-Cys-G1y↑
↑ ↑ ↑−Glu−Arg−Gl
y-Phe-Phe-Tyr-Thr-Pro-Lys
-Ala↑ ↑ ↑ ↑Amino acid sequence: 11eThrGIyThrSerThrValG1yV
alG1yArgG1yValLeuG 1 yAs
pGlnLysAs n l 1 eAs nTh r
Th rTy rSerTh rTy rTyrTyr
LeuGInAspAsnThrArgGIyAsnG
IyllePheThrTyrAs pA 1 aLy
sTyrA rgTh rTh rLeuProG
1ySerLeuT rpAlaAspAlaAspA
snGlnPhePheAlaSerTyrAspAl
aPro.

Al aV, al AspAl aHi 5TyrT
yrA 1 aG 1yVal ThrTyrAspT
yrTyrLysAsnValHisAsnArgLe
uSerTyrAspG1yAsnAsnA1aA1a
11eArgSerSerValH1sTyrSerG
InGIyTyrAsnAsnA1aPheTrpAs
nG1ySerC1nMetValTyrG1yAsp
GlyAspG1yG]nThrPhe1ePro
LeuSerG1yG1ylleAspValVal
A 1at(1sG1uLeuTh rtli sA
1aValTh rAs pTyrThrA laG
1 yLeu l ]eTyrGlnAsnG 1u
SerG1 yA la I le AsnG 1uA
Ia11eSerAspl1ePheG1yThrL
euValG1uPheTyrA1aAsnLysAs
nProAspTrpG1ul1eG1yG1uAsp
ValTyrThrProGlylleSerG1yA
spSerLeuArgSerMetSerAspPr
oAspLysTyrG1yAspProAspHis
TyrSerLysArgTyrThrGIyThrG
]nAspAsnGlyG1yValHislleAs
nSerGlyllelleAsnLysA 1aA
laTyrLeu I 1eSerG 1nGIyG1
yTh rHi sTyrGlyValSerVal
ValG1ylleG1yArgAspLysLeuG
1yLys11ePheTyrArgA1aLeuTh
rG1nTyrLeuThrProThr'SerAs
nPheSerG1nLeuArgA1aA1aA1a
ValG1nSerAIaThrAspLeuTyrG
1ySerThrSerG1nG1uValA1aSe
rValLysGInA]aPheAspA1aVal
G1yValLys base sequence: ATAACAGGAACATCAACTGTCGGAG
TGGGAAGAGGAGTACTTTATTGTCC
TTGTAGTTGACAGCCTCACCCTTCT
CCTCATGAAGGTGATCAAAAAAATA
TTAATAACAACCTACTCTACGTACTA
CCCACTAGTTTTTTTTATAATTATGT
TGGATGAGATGCATGATGTATTTAC
AAGATAATACGCGTGGAAATGGGAT
TTTCACGTATATAAATGTTCTATTA
TGCGCACCTTTTACCCTAAAAGTGCA
TAGATGCGAAATACCGTACGACATT
GCCGGGAAGCTTATGGGGCACTACGC
TTTATGGCATGCTGTAACGGCCCT
CGAATAACCCGTGATGCAGATAACCA
ATTTTTTGCGAGCTATGACGCTCCA
GCGCTACGTCTATTGGTTAAAAAAAC
GCTCGATACTGCGAGGTCGCGTTGA
TGCTCATTATTACGCTGGTGTGACA
TATGACTACTATCAACTACGAGTAA
TAATGCGACCACACTGTATACTGAT
CATAAAAAATGTTCATAACCGTCTC
AGCTACGACGGAAAATAATGCATTTT
TACAAGTATTGGCAGAGTCGATGCT
GCCTTTATTACGTGCTATTAGATCA
TCCGTTCATTATAGCCAAGGCTATA
ATAACCGATAATCTAGTAGGCAAGT
AATATCGGTTCCGATAATTATTGGCA
TTTTGGAACGGTTCGCAAATGGTGT
ATGGCGATGGTGATCGTAAAACCTT
GCCAAGCGTTTACCACATACCGCTA
CCACTAGGTCAACATTTATTCCAC
TTTCTGGTGGTATTGATGTGGTCC
AGTTTGTAAAATAAGGTGAAAGACCA
CCATAACTACACCAGGCTCATGAGT
TAACGCATGCCGTAACCGATTATAC
AGCCGGACGAGTACTCAATTGCGTA
CGGCATTGGCTAA'TATGTCGGCCT
CTCATTTATCAAAACGAATCTGGTG
CAATTAAATGAGGCAATAGAGTAAAT
AGTTTTGCTTAGACCACGTTAATTA
CTCCGTTATTCTGATATTTTGGAA
(JTTAGTCGAATTTTACGCTAACAA
AAGACTATAAAAACCTTGCAATCAG
CTTAAAATGCGATTGTTTAATCCAG
ATTGGAAAATTGGAGAGGATGTGTA
TACACCTGGTTTTAGGTCTAACCCTT
TAACCTCTCCTACACATATGTGGAC
CAATTTCAGGGGATTCGCTCCGTTC
GATGTCCGATCCGGACAAGTAAAGT
CCCCTAAGCGAGGCAAGCTACAGGC
TAGGCCTGTTCTATGGTGATCACGA
TCCATATTCAAAGCGCTATACAGGC
ACGATACCACTAGTGCTAGGTATAA
GTTTCGCGATATGTCCGGT(iCCAAG
ATAATGGCGGGGTTCATATCAATAG
CGGAATTATCAACGTTCTATTACCG
CCCCAAGTATAGTTATCGCCTTAAT
AGTTGAAAGCCGCTTTATTGATTAG
CCAAGGCGGTACGCATTACGGTTTT
CGGCGAATAAAAACTAATCGGTTCCGC
CATGCGTAATGCCAGTGAGTGTTGT
CGGAATCGGACGCGATAAATTGGGG
AAAATTCACTCACAACAGCCTTAGC
CTGCGCTATTTAACCCCCTTTTAATT
CTATCGTGCATTAACGCAATATTTA
ACACCAACGTCCAACAAGATAGCAC
GTAATTGCGTTAAAAATTGTGGTTG
CAGGTTGTTTTAGCCAAACTTCGTGCT
GCCGCTGTTCAATCAGCCACTGACA
AATCGGTTGAAGCACGACGGCGACA
AGTTAGTCGGTGACTGTTGTACGGT
TCGACAAGCCAGGAAGTCGCTTCTG
TGAAGCAGAACATGCCAAGCTGTTC
GGTCCTTCAGCGAAGACACTTCGTC
GCCTTTGATGCGGTAGGGGTGAAAC
GGAAAACTACGCCATCCCCACTTTThe present invention also relates to a preferred method for producing protease TOSOH-1, in which a bacterium belonging to Bacillus stearothermophilus that produces protease TOSOH-1 is cultured, and protease TOSOH is extracted from the culture solution. O■ The present invention relates to a method for producing protease TOSOH-1, which comprises collecting protease TOSOH-1.

The protease TOSOH-1 producing microorganism used in the present invention is Bacillus stearothermophilus (Bacillus stearothermophilus) which can produce protease TOSOII-1.
llus stearothermophilus
), including mutant strains and variants. Among these, a particularly preferred strain is protease TOSOH-1, which the present inventors isolated from soil.
Bacillus stearothermophilus MK-232, a strain with extremely high productivity.
thermophilus MK-232) (Feikoken Bibori No. 9645).

The mycological properties of this strain are shown below.

Morphology Cell shape Bacillus cell size 1. OX 1.2μ×3.0~5.
0μ Polymorphism None Motility Yes Spore Form of spore formed Circular spore size 0.6-1.0μ x 1.2μ Acid-fast
None Durham staining 10 Growth status ■ Quality of growth on broth agar plate Good colony shape Surface shape of circular colonies Smooth, raised condition of heavy-ringed colonies Periphery of flat colonies Contents of gold-rimmed colonies Color tone of uniform colonies Transparency of cream-colored colonies Opaque ■ Quality of growth on gravy agar slant culture Good - 15 = Colony shape Surface shape of filamentous colonies Transparency of smooth colonies Color tone of opaque colonies Cream color ■ Growth on gravy liquid culture surface None Turbidity Slightly cloudy sediment Viscosity ■ Meat juice gelatin Puncture culture gelatin Liquefaction Yes, 50℃, 5 days ■ Lidomus milk Physiological properties without liquefaction coagulation Reduction of nitrate Negative denitrification reaction Negative MR test Positive UP test Negative Indole generation Negative Hydrogen sulfide generation Positive Starch hydrolysis Positive citric acid utilization Negative Pigment production None Urease Negative oxidase Negative catalase Range of positive growth Optimum pH around 7.0, optimal attitude towards oxygen around 50℃ Negative Whether or not acid and gas are generated from sugars Acid from arabinose, xylose, mannose, fructose, galactose It does, but it does not produce gas.

Maltose, sucrose, trehalose, sorbitol, mannitol, inosit, glycerin, starch Does not produce acid or gas Growth on medium supplemented with 7% sodium chloride No growth Phenylalanine deaminase Tyrosine degradation Negative Casein degradation Positive 0.02% This strain does not grow in sodium azide-supplemented media. Therefore, this strain is not recommended for growth in Bergey's Manual of Determinative Bacteriology.
Manual of determinativeba
cteriology) 8th edition, it was identified as a strain belonging to Bacillus stearothermophilus (Bacillus stearothermophilus).
acillus stearothermophilus
) It was named MK-232.

To produce the protease TO8OH-1 of the present invention,
Among the Bacillus mentioned above, Stearothermophilus (Bacillus)
lus stearothermophllus )
Protease TO
3OH-1 may be collected. For example, Bacillus stearothermophilus MK-2
32 is inoculated into a medium containing a carbon source, nitrogen source, salts, and other substances, and shaken or agitated with aeration at an appropriate temperature, for example, about 50 to 60°C, for an appropriate time until the enzyme titer reaches its maximum. There is a method of culturing and producing it.

The culture solution cultured as described in Section 2 above can be clarified by centrifugation, filtration, or the like, and then, for example, ammonium sulfate may be added to the clarified solution to precipitate the enzyme of interest, and the enzyme can be collected. Furthermore, the above precipitate can be purified using an ion exchange resin and a gel filtration method to obtain extremely highly active protease TO3OH-1.

The novel protease TO8Oi thus obtained
(The physical and chemical properties of -1 are shown below.

(1) Preferred p for proteolytic action using casein as a substrate
H is 6 to 8 as shown in Figure 1, and optimal 1) H8,5
~7.0 neutral protease. In addition, protease TO8OH-1 and thermolysin were added to TSKgelG-2.
Purification was performed by gel filtration using a 000SW column (trade name, manufactured by Tosoh ■) until a completely single band was obtained by 5DS-PAGE and HPLC analysis, and the specific activities of both cases when casein was used as a substrate are shown in Table 1.

It can be seen that the specific activity of protease TO8OH-1 is about 40% higher than that of thermolysin.

Table 1 Specific activity of each enzyme (2) Substrate specificity Characteristics of protease TO8OH-1 As shown in the "Substrate specificity" column, when decomposition was carried out using oxidized insulin β chain as a substrate, His-Leu, Ala-Le
u.

Tyr-Leu, Leu-Val, Gly-P
he, Phe-Phe, Phe-Tyr,
Decomposes the portion where hydrophobic amino acids such as Lys-Ala are present.

(3) Optimal 1)H The influence of I)H on proteolysis using casein as a substrate is shown in Figure 1. Optimum pH is 6.5-6.5
It is.

(4) pl+stability The residual activity after treatment at various pH values (pH 5-8 diphosphate buffer, pH 6-11 nigericin-NaOH buffer) at 37° C. for 60 minutes is shown in FIG. 4. Almost 100% residual activity was shown in the pH range of 6 to 9.

(5) Method for measuring titer 1 ml of 2% casein solution (50111M Tris-
hydrochloric acid.

5mMcac12. 1 ml of each sample was added to the solution (pH 7.5), and after a certain period of time, the reaction stop solution (0.33M acetic acid,
2 ml of 0.22M sodium acetate, 0.1M dichloroacetic acid) was added, and the mixture was allowed to stand at room temperature for 30 minutes. This was filtered through Whatman NO.1 filter paper. Separately, a reaction stop solution was added to the casein solution, a sample was added, and A nm was measured using the filtered sample as a reference. A calibration curve of A was prepared using the tyrosine solution as a reference to measure protease activity. One unit was defined as the amount of enzyme that liberated 1 μg of a substance equivalent to tyrosine into the trichloroacetic acid soluble fraction in 1 minute at 37°C.

(6) Optimal temperature The temperature dependence of proteolytic action using casein as a substrate is shown in Figure 2. The optimum temperature for the action of this enzyme is approximately 75°C.

(7) Temperature stability -21= Temperature stability is shown in FIG. Protease T OS OH
-1 has a very stable residual activity of 100% after heat treatment at 80℃ for 30 minutes.While thermolysin has a residual activity of about 35% after heat treatment at 90℃ for 30 minutes, protease TO8OH-1 has The thermostability increases by about 45% and about 10%, making it an extremely thermostable enzyme.

(8) Conditions for inactivation due to pH As shown in Figure 4, inactivation begins at around pH 5;
Approximately 30% of the activity was inactivated at 0.37°C for 60 minutes. On the other hand, on the alkaline side, deactivation begins around pH 10, and pH 11
, about 40% was deactivated in 37°0160 minutes. (pH 5
~8 Niphosphate buffer, pug~11 Nigericin-Na
OH buffer) (9) Influence of inhibitors The influence of inhibitors is shown in Table 2. Furthermore, Table 3 shows the influence of metal salts.

Table 2 EDTA: Ethylenediaminetetraacetate acid DFP diisopropylfluorophosphate PMS
P: Phenylmethylsulfonyl fluoride Table 3 (lO) Molecular weight The molecular weight measured by gel filtration method and 5DS-polyacrylamide gel electrophoresis method is approximately 34,400. The molecular weight from the amino acid sequence is 34,176.

(11) Ultraviolet absorption spectrum As shown in Figure 5, the absorption maximum of the aqueous solution is around 280 nm, and the absorption minimum is around 245 to 255 nm.

(12) Amino acid composition Characteristics of protease TO9OH-1 As shown in the "Amino acid sequence" column, from the N-terminal amino acid to l1e-Thr-
Taking the amino acid sequence of Gly-Thr-8er-Thr---., position 37: Asn, position 119:
The amino acids of Gin are the amino acid sequence of thermolysin (3
7th: Asp, 119th: Glu). The amino acid composition is as follows, consisting of 316 amino acids in total.

Aha 2g, Arg 10. Asn 20. A
sp24. Cys O.

Gin 14. Glu 7, Gly 3B, H
is 8, lle 18゜Leu l[i, Ly
s 11. Met2, Phe10. Pro
8.

Ser 2B, Thr 25. Trp3, T
yr, 26. Val 22 (13) Base Sequence Characteristics of Protease TO8OH-1 As shown in the "base sequence" column, the structural gene of protease TO8OH-1 consists of 948 base pairs.

(14) Specific activity Table 1 shows the specific activity when casein was used as a substrate. The enzyme of the present invention is approximately 40% more active than commercially available thermolysin.
% is also an enzyme with high specific activity.

(15) Heat resistance The results of the heat resistance test at 90° C. for up to 30 minutes are shown in FIG.

The enzyme of the present invention is an enzyme with approximately 10% higher heat resistance than commercially available thermolysin.

[Effects of the Invention Coprotease ToSOH-1 has high heat resistance and high specific activity, so it is a protease that can be used in a wide range of applications. Furthermore, protease TO8OH-1 can be produced by the method of the present invention.

[Examples] Next, examples will be shown, but the present invention is not limited to these examples.

Example 1 Table 4 500 ml of a medium having the composition shown in Table 4 was placed in a 21 volume Sakaro flask and sterilized at 120°C for 15 minutes. Bacillus stearothermophilus MK-23 cultured in a medium with the same composition
Add 50 ml of preculture solution from step 2, and incubate at 37°C, 150 rpm,
Culture was carried out with shaking for 24 hours. The protease in the culture solution was approximately 5000 units/ml. After culturing, ammonium sulfate was added to 70% saturation to precipitate the enzyme active fraction, followed by centrifugation (10,000 rpm,
10 minutes) and collected. Transfer the collected enzymes to as small a quantity as possible.
0mM Tris-HCl, 5mM CaCl2 (poy
, o), packed in a cellophane tube for dialysis, tied both ends, and dialyzed in the same buffer at 15° C. or lower for 24 hours.

After dialysis, insoluble matter was removed by centrifugation and freeze-dried, and the resulting powder was used as a crude enzyme sample. The crude enzyme sample was separated and purified using the following method. That is, 1 g of crude enzyme sample was mixed with 10 ml of 10111M Tris-HCl, 5IIIMCa.
Toyopearl-l (W2O (trade name, Tosoh ■) dissolved in C1□ (pH 7,0) and equilibrated with the same buffer
Pour the solution gently onto the top of a column (1.5 x 80 cm) packed with 100% of the same buffer solution and elute with the same buffer. The active fraction obtained here is further applied to TSKgel-G2000SW (trade name, manufactured by Tosoh ■), and a peak fraction is collected. The active fraction was collected by ammonium sulfate salting out (70% saturation).
After dialysis, it is freeze-dried. Purified according to the above method, 0.1 g of protease TO8O was obtained from the culture solution of 11.
H-1 was obtained.

Example 2 Protease TO8OI purified according to Example 1! -1
The protease activity was examined in high concentration NaCl. 10111M Tris-HCl, 5mM CaC12 (
pH 7,0) with NaCl concentration of 0.5M, LM,
The concentration was increased to 2M, 3M, and 5M, and the residual activity was measured. The results are shown in FIG.

As is clear from the figure, the activity increases at 0.5M compared to when no addition is made, and the remaining activity is 50% even at around 3M, making protease TO8OH-1 a very salt-tolerant protease compared to other proteases.

Example 3 Protease TO8OH-1 purified according to Example 1
The bacteriolytic activity of this enzyme was measured using various microorganisms. Each cultured bacterial cell was dried using acetone and powdered as a substrate, and the present enzyme, lysozyme, and achromopeptidase were used as enzymes, and a decrease in turbidity of 0.001 per minute was defined as 1 unit, The lytic activity of each enzyme against each microorganism was compared.

Table 5 Substrate Staphylococcus aureus IP03761
Substrate Satucharomyces cerevisiae HUT 7119
In this way, compared to the existing lytic enzymes, lysozyme, and achromopeptidase, it showed the same or higher lytic activity.

[Brief explanation of the drawing]

FIG. 1 is a diagram showing the optimum pH of protease TO8OH-1. FIG. 2 is a diagram showing the optimum temperature of protease TO8OH-1. FIG. 3 is a diagram showing a comparison of the temperature stability and heat resistance of protease TO3OH-1 and the commercially available enzyme thermolysin. FIG. 4 is a diagram showing the I)H stability of protease TO3OH-1. FIG. 5 is a diagram showing the ultraviolet absorption spectrum of an aqueous solution of protease TO8OH-1. FIG. 6 is a diagram showing the degree of resistance of protease TO8OH-1 to salt.

Claims (3)

[Claims] (1) A thermostable protease having the following enzymatic chemical properties. Molecular weight: 34400 (gel filtration method, SDS-PAGE)
34176 (Amino acid composition) pH stability: Stable with 90% or more activity in the pH range of 6 to 9 after treatment at 37°C for 30 minutes. Optimum pH: 6.5-8.5 (60℃, 2mMCa^2^
+) Optimal temperature: 75-80°C (when reacted for 20 minutes using casein as a substrate in the presence of 2mMCa^2^+) Temperature stability: Residual activity after heat treatment at 80°C for 30 minutes:
100% Residual activity after heat treatment at 90°C for 30 minutes: Approximately 45% (10mM Tris-HCl, 2mMCaCl_2, p
H7.0) Metal content: 1 atom of zinc per protein molecule Inhibitor: Ethylenediaminetetraacetate (EDTA), 1,1
0-O-Phenanthroline, Phosphoramidone Ultraviolet absorption spectrum: Around 280 nm Substrate specificity: Decomposes the following parts in the decomposition of oxidized insulin β chain. ▲There are mathematical formulas, chemical formulas, tables, etc.▼ Amino acid sequence: [There is a gene sequence] Base sequence: [There is a gene sequence] (2) Bacillus stearothermophilus (￥Baci
llus\stearothermophilus\)
1. A method for producing a heat-stable protease, which comprises culturing a strain belonging to the following: and collecting the heat-stable protease according to claim 1 from the culture solution. (3) The strain is Bacillus stearothermophilus MK-
232(￥Bacillus￥￥stearother
mophilus\MK-232).