JP7344546B2 - APEH production promoter - Google Patents

Description

The present invention relates to an APEH production promoter characterized by containing a specific amino acid, and also to a pharmaceutical composition for preventing, improving, or treating diseases involving APEH.

APEH (Acylaminoacyl-peptide Hydrolase) is a type of enzyme that decomposes oxidized proteins. Specifically, it is a serine protease that releases acylated amino acids at the N-terminal portion of proteins, and includes OPH (Oxidized Protein Hydrolase), AARE (Acylaminoacid Releasing Enzyme), and APH (Acylaminoacid Releasing Enzyme). eptide Hydrolase Also called acylated peptide degrading enzyme). In addition, APEH is said to act not only on acylated (Acyl) amino acids, but also on acetylated (Acetyl), formylated (Formyl), butylated (Butyl), and Propylated (Propyl) amino acids; Involved in protein breakdown.

APEH is widely distributed in tissues such as the liver, brain, skin, and blood, and preferentially degrades oxidized proteins. In addition, in cooperation with proteasomes, it contributes to the degradation and removal of abnormal proteins, mainly oxidized proteins. It is known that the degrading activity of this abnormal protein decreases with age, leading to accumulation of abnormal proteins (Non-Patent Document 1). Increased abnormalities in enzymes (proteins) that catalyze various reactions in the body are thought to directly or indirectly reduce biological functions, so it is not possible to promote the production of APEH and increase the decomposition activity of abnormal proteins. , is expected to suppress the decline in biological functions mediated by protein abnormalities associated with aging.

It has also been reported that APEH reduces amyloid β, which is the cause of Alzheimer's disease (Non-Patent Document 2). Alzheimer's disease is an irreversible brain disease that progresses to amyloid-β deposition, neurofibrillary tangle formation, and neuronal cell death, leading to brain atrophy. Currently, no treatment has been established, but there are drugs that can alleviate the progression of symptoms, such as cholinesterase (such as donepezil) that inhibits the breakdown of acetylcholine, and NMDA receptors (N-methyl-D-apartate receptors and glutamate receptors). Memantine is used as a competitive inhibitor of Cholinesterase is associated with gastrointestinal symptoms such as vomiting and diarrhea, and neurological symptoms such as irritation and excitement, while memantine is associated with light-headedness, drowsiness, headaches, and increased blood pressure. There is a need for preventive, ameliorative, or therapeutic agents with fewer side effects.

Until now, as an activity enhancer for APEH, an extract of at least one plant selected from the group consisting of the genus Anthemis of the family Asteraceae, the genus Heterinaceae of the family Hecticaceae, the genus Crathorn of the family Rosaceae, and the genus Vitaceae of the family Vitaceae (Patent Document 1); Extract of at least one plant selected from the group consisting of water chestnut, stevia, rosemary, thyme, chrysanthemum, savory, mugwort, chestnut, spearmint, marjoram, peppermint, lemon balm, allspice, perilla, basil, and caraway ( Patent Document 2), 1 type of extract of burdock, oolong tea, roasted tea, lemongrass, aloe vera, kumazasa, chili pepper, barley, Jiaogulan, gymnema, Ebisugusa, safflower, mulberry, reishi, Pu-erh tea, bancha, Houtudyami, adlay, and Japanese cypress Plant extracts such as combinations containing the above (Patent Document 3) have been reported. Compounds such as methoxyflavonoids (Patent Document 4), rubusoside, and gallic acid (Patent Document 5) have also been reported as APEH activity enhancers.

Glutamine is a type of amino acid and is 2-amino-4-carbamoylbutyric acid. It is one of the amino acids that make up proteins, and has been suggested to have effects such as improving intestinal function and suppressing the occurrence of liver damage (Non-patent Documents 3 and 4). Leucine is a type of amino acid and an essential amino acid that cannot be synthesized in the body. It is one of the amino acids that make up proteins, and is known to have the effect of promoting protein synthesis and stimulating insulin secretion (Non-patent Documents 5, 6). However, the effect of glutamine or leucine on promoting APEH production has not been reported.

WO2011-004733 WO2014-126199 JP2017-178970 JP2017-178889 JP2018-002631

Satara Goto, Journal of the Japanese Society for Mibyo Systems, 10(1), p18-20, 2014 Yagi M. et. al. , Glycative Stress Res. , 3, p152-155, 2016 Boza J. J. etc. al. , Am. J. Physiol. Gastrointest Liver Physiol. , 281(1), pG267-G274, 2001 Hiroo Sanada, Clinical Chemistry, 29, p123-131, 2000 Fumiaki Yoshizawa, Journal of the Japanese Society of Nutrition and Food Science, 56(2), p117-125, 2003 Sener A. et. al. , J. Clin. Invest. , 11, p455, 1981

An object of the present invention is to provide an APEH production promoter that is effective and has few side effects.

In order to solve this problem, the present inventors have conducted intensive research and have discovered that glutamine and/or leucine have an excellent APEH production promoting effect, and have completed the present invention.

That is, the present invention is as follows.
(1) An APEH production promoter characterized by containing glutamine and/or leucine.
(2) An agent for preventing or improving accumulation of abnormal proteins, comprising the APEH production promoter described in (1).
(3) A prophylactic, ameliorating or therapeutic agent for Alzheimer's disease, comprising the APEH production promoter described in (1).

The APEH production promoter of the present invention, which is characterized by containing glutamine and/or leucine, has an excellent APEH production promoting effect, is safe, and prevents and improves abnormal protein accumulation or Alzheimer's disease related to APEH. Or a therapeutic effect is expected.

APEH (Acylaminoacyl-peptide Hydrolase) of the present invention is an enzyme that decomposes oxidized proteins. Specifically, it is a serine protease that releases acylated amino acids at the N-terminal portion of proteins, and includes OPH (Oxidized Protein Hydrolase), AARE (Acylaminoacid Releasing Enzyme), and APH (Acylaminoacid Releasing Enzyme). eptide Hydrolase Also called acylated peptide degrading enzyme).

The abnormal protein of the present invention is an oxidized protein that is degraded by APEH, and is an acylated (Acyl), acetylated (Acetyl), formylated (Formyl), butylated (Butyl), or propylated (Propyl) protein. be.

Alzheimer's disease of the present invention is an irreversible brain disease that causes brain atrophy. This progresses to the deposition of amyloid-β, the formation of neurofibrillary tangles, and the death of nerve cells, impairing the brain's cognitive functions.

Glutamine of the present invention is an amino acid and has a molecular formula of C ₅ H ₁₀ N ₂ O ₃ . There are L-glutamine and D-glutamine, either of which may be used.

Leucine of the present invention is an amino acid and has a molecular formula of C ₆ H ₁₃ NO ₂ . There are L-leucine and D-leucine, either of which may be used.

There are various grades of glutamine or leucine used in pharmaceuticals, foods, cosmetics, etc., and any of them may be used. It can be used as it is or in the form of a salt. Examples of the salt include pharmaceutically acceptable acid addition salts and base addition salts. Specifically, acid addition salts include salts of inorganic acids such as hydrochloric acid, sulfuric acid, and phosphoric acid, and salts of organic acids such as acetic acid, propionic acid, succinic acid, malic acid, tartaric acid, and citric acid. Examples of base addition salts include metal salts such as sodium salts, potassium salts, and calcium salts, and amine salts such as ammonium and ethanolamine.

The APEH production promoter of the present invention characterized by containing glutamine and/or leucine can be used in any of pharmaceuticals, quasi-drugs, foods, and cosmetics. When used as an internal preparation, the dosage form includes powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions, solutions, emulsions, and the like. It can also be used as an injection solution, suppository, etc. When used as an external preparation, creams, gels, aerosols, ointments, poultices, etc. may be used. It can also be used as external preparations for the eyes, such as eye drops and eye washes. Well-known dosage forms other than these dosage forms can be used, and may be appropriately selected depending on the intended use.

When using the APEH production promoter of the present invention, which is characterized by containing glutamine and/or leucine, as an internal preparation, the amount of amino acids to be taken is appropriately selected depending on the dosage form, purpose of use, age, body weight, etc. Generally, 0.1 to 5,000 mg/day is preferred, and 1 to 500 mg/day is most preferred. Moreover, it can be administered once to several times a day. Of course, as mentioned above, the administration method and dosage vary depending on various conditions, so there may be cases where an amount smaller than the above-mentioned administration range is sufficient, and there may be cases where it is necessary to administer an amount exceeding the above range. In addition, the method of adding medicinal ingredients during formulation may be added in advance or during production, and may be selected as appropriate in consideration of workability.

When the APEH production promoter of the present invention, which is characterized by containing glutamine and/or leucine, is used as an internal preparation, it may be used as it is, depending on its specific form, without impairing its effect. Diluents such as excipients, fillers, binders, wetting agents, disintegrants, surfactants, lubricants, dispersants, buffers, fragrances, preservatives, solubilizing agents, and solvents are used within the range. be able to. Specifically, lactose, sucrose, sorbitol, mannitol, starch, precipitated calcium carbonate, heavy magnesium oxide, talc, calcium stearate, magnesium stearate, cellulose or its derivatives, amylopectin, polyvinyl alcohol, gelatin, surfactant. agents, water, physiological saline, ethanol, glycerin, propylene glycol, cacao butter, lauric fat, vaseline, paraffin, higher alcohols, and the like.

When the APEH production promoter characterized by containing glutamine and/or leucine of the present invention is used as a topical preparation, the amino acid content can be selected as appropriate depending on the dosage form, application, etc. Specifically, it is preferably 0.00001 to 10% by weight, most preferably 0.04 to 4% by weight, based on the entire agent. If this content is less than 0.00001% by weight based on the entire agent, it is difficult to fully exhibit the effect, which is not preferable. Further, even if the content exceeds 10% by weight, it is difficult to expect the effect to increase commensurate with the increase in content, which is not preferable. Further, the method of addition may be either added in advance or added during production, and may be appropriately selected in consideration of workability.

When the APEH production promoter of the present invention, which is characterized by containing glutamine and/or leucine, is used in external preparations, it may be used as a solid or powder depending on the specific form, or it may be used as a solution. May be used. In addition, within the range that does not impair the effectiveness, ingredients used in pharmaceutical compositions and external preparations such as oils and fats, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, and pH adjustment. It can contain ingredients such as agents, preservatives, fragrances, humectants, powders, ultraviolet absorbers, thickeners, pigments, antioxidants, whitening agents, and chelating agents.

Next, in order to explain the present invention in detail, a formulation example of the present invention will be given as Example 1, and an experimental example will be given as Example 2, but the present invention is not limited thereto.

Prescription example 1 Tablet prescription Content (g)
1. Glutamine 5.0
2. Corn starch 10.0
3. Refined white sugar 20.0
4. Carboxymethyl cellulose calcium 10.0
5. Microcrystalline cellulose 40.0
6. Polyvinylpyrrolidone 5.0
7. Talc 10.0
[Manufacturing method] Components 1 to 5 are mixed, then an aqueous solution of component 6 is added as a binder, and the mixture is granulated by a conventional method. Ingredient 7 is added as a lubricant to this, and the mixture is then compressed into tablets each weighing 100 mg. By taking 10 of these tablets a day, you can take in 50 mg/day of glutamine.

Prescription example 2 Ointment prescription Content (g)
1. Glutamine 0.5
2. Leucine 0.5
3. Polyoxyethylene cetyl ether (30E.O.) 2.0
4. Glyceryl monostearate 10.0
5. Liquid paraffin 5.0
6. Setanol 6.0
7. Methyl paraoxybenzoate 0.1
8. Propylene glycol 10.0
9. Purified water 65.9
[Manufacturing method] Components 3 to 6 are dissolved and mixed by heating, and kept at 70°C to form an oil phase. Components 1, 2, and 7 to 9 are mixed by heating and kept at 75°C to form an aqueous phase. The aqueous phase is added to the oil phase to emulsify it, and the mixture is cooled to 30° C. while stirring to form a product.

Prescription example 3 Beverage prescription Content (g)
1. Leucine 0.1
2. Citric acid 0.7
3. Fructose glucose liquid sugar 60.0
4. Fragrance 0.1
5. Purified water 39.1
[Manufacturing method] Components 1 to 4 are added to component 5, stirred and dissolved, filtered, heat sterilized, and then filled into glass bottles. By ingesting one bottle of this drink a day, you can ingest 100 mg/day of leucine.

Prescription example 4 Cream prescription Content (g)
1. Glutamine 0.1
2. Squalane 5.5
3. Olive oil 3.0
4. Stearic acid 2.0
5. Beeswax 2.0
6. Octyldodecyl myristate 3.5
7. Polyoxyethylene cetyl ether (20E.O.) 3.0
8. Behenyl alcohol 1.5
9. Glyceryl monostearate 2.5
10. Fragrance 0.1
11. Methyl paraoxybenzoate 0.25
12.1,3-butylene glycol 8.5
13. Purified water 68.05
[Manufacturing method] Components 2 to 9 are dissolved and mixed by heating, and the mixture is kept at 70°C to form an oil phase. Components 1 and 11 to 13 are heated and dissolved, mixed, and kept at 75°C to form an aqueous phase. Add the aqueous phase to the oil phase and emulsify, cool while stirring, add component 10 at 45°C, and further cool to 30°C to obtain a product.

Prescription example 5 Gel formulation Content (g)
1. Leucine 0.001
2. Ethanol 5.0
3. Methyl paraoxybenzoate 0.1
4. Polyoxyethylene hydrogenated castor oil (60E.O.) 0.1
5. Fragrance 0.1
6.1,3-butylene glycol 5.0
7. Glycerin 5.0
8. Xanthan gum 0.1
9. Carboxyvinyl polymer 0.2
10. Potassium hydroxide 0.2
11. Purified water 84.199
[Manufacturing method] Components 2 to 5 and components 1 and 6 to 11 are each uniformly dissolved, and the two are mixed to form a product.

Experimental examples will be given below to effectively explain the present invention. Note that the present invention is not limited to this.

Experimental Example 1 Effect of glutamine or leucine on APEH production in human skin fibroblasts DMEM supplemented with L-glutamine, L-leucine, L-valine or L-glutamic acid (final concentration 0.4, 4 and 40 mg/mL) Confluent human skin fibroblasts (NB1RGB) were cultured for 24 hours at (-), and total RNA was extracted. Note that L-valine and L-glutamic acid were used for comparison. RNAiso plus (Takara Bio Inc.) was used to extract total RNA. APEH mRNA expression level was measured by real-time RT-PCR method based on total RNA. SYBR Select Master Mix (Life Technologies) was used for the real-time RT-PCR method. Note that the expression level of β-actin mRNA was also measured as an internal standard, and the expression level of APEH mRNA was determined as a ratio to the expression level of β-actin mRNA, which was the internal standard. The primers used in the experiment are as follows.

Primer set for APEH TGGCAGCCCTCCAGATAAGA (SEQ ID NO: 1)
GAACAGCATCCAGGCAGTGA (SEQ ID NO: 2)
Primer set for β-actin CACTCTTCCAGCCTTCCTTCC (SEQ ID NO: 3)
GTGTTGGCGTACAGGTCTTTG (SEQ ID NO: 4)

The results obtained are shown in Table 1. Addition of L-glutamine or L-leucine to human skin fibroblasts increased APEH mRNA expression. Therefore, L-glutamine or L-leucine promoted the production of APEH.

Similar experiments were conducted using D-glutamine or D-leucine, and the amount of APEH mRNA expression increased.

Glutamine or leucine has the effect of promoting the production of APEH, which is an enzyme that degrades oxidized proteins and amyloid β. A composition containing glutamine and/or leucine can suppress the accumulation of abnormal proteins by promoting the production of APEH, and can suppress the decline in biological functions mediated by protein abnormalities associated with aging. Furthermore, by promoting the decomposition of amyloid β, Alzheimer's disease can be prevented, improved, or treated with fewer side effects.

Claims (1)

An APEH production promoter characterized by containing 0.4 to 4% by weight of glutamine and/or leucine.