JP2021031472A - APEH production promoter - Google Patents

Abstract

To provide APEH production promoters that are effective and have few side effects, and to provide prophylactic, ameliorating, or therapeutic drug compositions for APEH-related diseases.SOLUTION: The present invention is an APEH production promoter containing glutamine and/or leucine as an active ingredient. By using glutamine and/or leucine of the present invention, the production of APEH, which is an enzyme that degrades oxidized proteins and amyloid β, can be promoted. The APEH production promoter of the present invention can safely and effectively prevent, ameliorate, or treat abnormal protein accumulation and Alzheimer's disease associated with aging.SELECTED DRAWING: None

Description

The present invention relates to an APEH production promoter characterized by containing a specific amino acid, and also relates to a preventive, ameliorating or therapeutic drug composition for a disease in which APEH is involved.

APEH (Acylaminoacyl-peptide Hydrolase) is a type of enzyme that decomposes oxidized proteins. Specifically, it is a serine protease that releases an acylated amino acid at the N-terminal portion of a protein, such as OPH (Oxidized Protein Hydrolase), AARE (Acylaminoacid Releasing Enzyme, acyl amino acid free enzyme), and APH (Acylpeptide Hydro). , Also called acylated peptide degrading enzyme). In addition, APEH is said to act not only on acylated (Acyl) amino acids, but also on acetylated (Actyl), formylated (Formyl), butylized (Butyl), and propylated (Propyl) amino acids, and is widely oxidized. It is involved in the breakdown of proteins.

APEH is widely distributed in tissues such as liver, brain, skin and blood, and preferentially decomposes oxidized proteins. In addition, it contributes to the decomposition and removal of abnormal proteins, mainly oxidized proteins, in collaboration with the proteasome. It is known that the degrading activity of this abnormal protein decreases with aging and the abnormal protein accumulates (Non-Patent Document 1). When abnormalities increase in enzymes (proteins) that catalyze various reactions in the living body, it is thought that biological functions are directly or indirectly reduced. Therefore, it is not possible to promote the production of APEH and enhance the decomposition activity of abnormal proteins. It is expected to suppress the decline in biological function due to protein abnormalities associated with aging.

APEH has also been reported to reduce amyloid β, which is the cause of Alzheimer's disease (Non-Patent Document 2). Alzheimer's disease is an irreversible brain disease that progresses to amyloid β deposition, neurofibrillary tangle formation, and neuronal cell death, causing brain atrophy. Currently, no cure has been established, but as drugs that alleviate the progression of symptoms, cholinesterase (donepezil, etc.) that inhibits the degradation of acetylcholine, NMDA receptor (N-methyl-D-aspartate receptor, glutamate receptor, etc.) Memantine, which antagonizes and inhibits (a type), is used. Cholinesterase is effective because it suggests gastrointestinal symptoms such as vomiting and diarrhea and neurological symptoms such as irritability and agitation, and memantine suggests light-headedness, drowsiness, headache, increased blood pressure, etc. Moreover, there is a demand for a preventive, ameliorating or therapeutic agent having few side effects.

So far, as an activity enhancer of APEH, an extract of at least one plant selected from the group consisting of the genus Asteraceae, the genus Asteraceae, the genus Dokudami, the genus Savory, and the genus Vinegar, Extracts of at least one plant selected from the group consisting of Hishi, Stevia, Rosemary, Thyme, Kiku, Savory, Yomogi, Kuri, Sparemint, Majorum, Peppermint, Lemon Balm, All Spice, Perilla, Basil and Caraway ( Patent Document 2), Gobo, Oolong Tea, Roasted Tea, Lemongrass, Asteraceae, Kumazasa, Togarashi, Omugi, Amachazuru, Gymnema, Ebisugusa, Benibana, Kuwa, Reishi, Phuar Tea, Bancha, Dokudami, Hatomugi, Habusou Plant extracts such as combinations containing the above (Patent Document 3) have been reported. Further, as an activity enhancer of APEH, compounds such as methoxyflavonoid (Patent Document 4), rubusoside, and gallic acid (Patent Document 5) have also been reported.

Glutamine is a type of amino acid, 2-amino-4-carbamoyl butyric acid. It is one of the amino acids that make up proteins, and has been suggested to have actions such as improving intestinal function and suppressing the occurrence of liver damage (Non-Patent Documents 3 and 4). Leucine is a type of amino acid and is one of the essential amino acids that are not synthesized in the body. It is one of the amino acids constituting a protein, and is known to have an action of promoting protein synthesis and an action of stimulating insulin secretion by itself (Non-Patent Documents 5 and 6). However, the effect of glutamine or leucine on promoting APEH production has not been reported.

WO2011-004733 WO2014-126199 JP 2017-178970 JP 2017-178889 JP-A-2018-002631

Satara Goto, Journal of Japan Society for Mibyou Systems, 10 (1), p18-20, 2014 Yagi M. et. al. , Glycative Stress Res. , 3, p152-155, 2016 Boza J. J. et. al. , Am. J. Physiol. Gastrointest Liver Physiol. , 281 (1), pG267-G274,2001 Hiroo Sanada, Clinical Chemistry, 29, p123-131, 2000 Fumiaki Yoshizawa, Journal of Japanese Society of Nutrition and Food Science, 56 (2), p117-125, 2003 Sensor A. et. al. , J. Clin. Invest. , 11, p455, 1981

An object of the present invention is to provide an APEH production promoter that is effective and has few side effects.

As a result of intensive studies to solve this problem, the present inventors have discovered an excellent effect of promoting APEH production on glutamine and / or leucine, and have completed the present invention.

That is, the present invention is as follows.
(1) An APEH production promoter containing glutamine and / or leucine.
(2) A preventive or ameliorating agent for the accumulation of abnormal proteins, which comprises the APEH production promoter according to (1).
(3) A prophylactic, ameliorating or therapeutic agent for Alzheimer's disease, which comprises the APEH production promoter according to (1).

The APEH production-promoting agent containing glutamine and / or leucine of the present invention has an excellent APEH production-promoting effect, is safe, and prevents and improves the accumulation of abnormal proteins associated with APEH or Alzheimer's disease. Or a therapeutic effect is expected.

The APEH (Acylaminoacyl-peptide Hydrolase) of the present invention is an enzyme that decomposes an oxidized protein. Specifically, it is a serine protease that releases an acylated amino acid at the N-terminal portion of a protein, such as OPH (Oxidized Protein Hydrolase), AARE (Acylaminoacid Releasing Enzyme, acyl amino acid free enzyme), and APH (Acylpeptide Hydro). , Also called acylated peptide degrading enzyme).

The abnormal protein of the present invention is an oxidized protein decomposed by APEH, and is an acylated (Acyl), acetylated (Actyl), formylated (Formyl), butylated (Butyl), or propylated (Propyl) protein. is there.

Alzheimer's disease of the present invention is an irreversible brain disease that causes atrophy of the brain. It progresses to amyloid β deposition, neurofibrillary tangle formation, and neuronal cell death, impairing cognitive function in the brain.

The glutamine of the present invention is an amino acid, and its molecular formula is C ₅ H ₁₀ N ₂ O ₃ . There are L-glutamine and D-glutamine, and either of them may be used.

The leucine of the present invention is an amino acid, and its molecular formula is C ₆ H ₁₃ NO ₂ . There are L-leucine and D-leucine, and either of them may be used.

There are various grades of glutamine or leucine such as pharmaceuticals, foods and cosmetics, and any of them may be used. It may be used as it is, or it may be used in a salt state. Examples of the salt include acid-added salts and base-added salts that are acceptable in the formulation. Specific examples of the acid addition salt include salts of inorganic acids such as hydrochloric acid, sulfuric acid and phosphoric acid, and salts of organic acids such as acetic acid, propionic acid, succinic acid, malic acid, tartaric acid and citric acid. Examples of the base addition salt include metal salts such as sodium salt, potassium salt and calcium salt, and amine salts such as ammonium and ethanolamine.

The APEH production promoter containing glutamine and / or leucine of the present invention can be used for any of pharmaceuticals, quasi-drugs, foods and cosmetics. When used as an internal preparation, the dosage form includes powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions, liquids, emulsions and the like. It can also be used as an injection solution, a suppository, or the like. When used as an external preparation, creams, gels, aerosols, ointments, poultices and the like can be mentioned. Further, it can be used as an external preparation applied to the eyes such as eye drops and eyewash. Well-known dosage forms other than these dosage forms can be used and may be appropriately selected depending on the intended use.

When the APEH production promoter containing glutamine and / or leucine of the present invention is used as an internal preparation, the amount of amino acid intake is appropriately selected according to the administration form, purpose of use, age, body weight and the like. In general, it is preferably 0.1 to 5,000 mg / day, most preferably 1 to 500 mg / day. It can also be administered once to several times a day. Of course, as described above, since the administration method and dose vary depending on various conditions, an amount smaller than the above-mentioned administration range may be sufficient, or it may be necessary to administer beyond the above-mentioned range. Further, the method of adding the medicinal ingredient in the formulation may be added in advance or may be added during the production, and may be appropriately selected in consideration of workability.

When the APEH production promoter containing glutamine and / or leucine of the present invention is used as an internal preparation, it may be used as it is depending on these specific forms, and the effect is not impaired. Diluents such as excipients, bulking agents, binders, wetting agents, disintegrants, surfactants, lubricants, dispersants, buffers, fragrances, preservatives, solubilizers, solvents, etc. are used within the range. be able to. Specifically, lactose, sucrose, sorbitol, mannitol, starch, precipitated calcium carbonate, heavy magnesium oxide, talc, calcium stearate, magnesium stearate, cellulose or its derivatives, amylopectin, polyvinyl alcohol, gelatin, surface activity. Examples thereof include agents, water, physiological saline, ethanol, glycerin, propylene glycol, cocoa butter, laurin fat, vaseline, paraffin, higher alcohol and the like.

When the APEH production promoter containing glutamine and / or leucine of the present invention is used as an external preparation, the amino acid content can be appropriately selected according to the dosage form, application, etc., and is generally used. The content is preferably 0.00001 to 10% by weight, most preferably 0.04 to 4% by weight, based on the total amount of the agent. If this content is less than 0.00001% by weight based on the total amount of the agent, it is difficult to sufficiently exert the effect, which is not preferable. Further, even if the content exceeds 10% by weight, it is difficult to expect the enhancement of the effect corresponding to the increase in the content, which is not preferable. Further, the method of addition may be added in advance or may be added during the production, and may be appropriately selected in consideration of workability.

When the APEH production promoter containing glutamine and / or leucine of the present invention is used as an external preparation, it may be used as a solid or powder depending on these specific forms, or as a solution. You may use it. In addition, fats and oils, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjustments, which are components used in pharmaceutical compositions and external preparations, within a range that does not impair the effect. It can contain components such as agents, preservatives, fragrances, moisturizers, powders, ultraviolet absorbers, thickeners, pigments, antioxidants, whitening agents, and chelating agents.

Next, in order to explain the present invention in detail, a formulation example of the present invention is given as Example 1, and an experimental example is given as Example 2, but the present invention is not limited thereto.

Prescription Example 1 Tablet prescription Content (g)
1. 1. Glutamine 5.0
2. Corn starch 10.0
3. 3. Purified sucrose 20.0
4. Carboxymethyl Cellulose Calcium 10.0
5. Microcrystalline Cellulose 40.0
6. Polyvinylpyrrolidone 5.0
7. Talc 10.0
[Manufacturing method] Ingredients 1 to 5 are mixed, and then an aqueous solution of ingredient 6 is added as a binder to granulate by a conventional method. Ingredient 7 is added and contained as a lubricant, and then the tablet is tableted into a 100 mg tablet. By taking 10 tablets a day, glutamine can be taken at 50 mg / day.

Prescription example 2 Ointment prescription content (g)
1. 1. Glutamine 0.5
2. Leucine 0.5
3. 3. Polyoxyethylene cetyl ether (30EO) 2.0
4. Glycerin monostearate 10.0
5. Liquid paraffin 5.0
6. Cetanol 6.0
7. Methyl paraoxybenzoate 0.1
8. Propylene glycol 10.0
9. Purified water 65.9
[Manufacturing method] Ingredients 3 to 6 are heated and dissolved, mixed, and kept at 70 ° C. to prepare an oil phase. Ingredients 1, 2 and 7 to 9 are heated, dissolved and mixed, and kept at 75 ° C. to prepare an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the product is cooled to 30 ° C. with stirring to prepare a product.

Prescription example 3 Beverage prescription content (g)
1. 1. Leucine 0.1
2. Citric acid 0.7
3. 3. Fructose-glucose liquid sugar 60.0
4. Fragrance 0.1
5. Purified water 39.1
[Manufacturing method] Ingredients 1 to 4 are added to ingredient 5, dissolved by stirring, filtered, sterilized by heating, and then filled in a glass bottle. By ingesting the beverage once a day, 100 mg / day of leucine can be ingested.

Prescription example 4 Cream prescription content (g)
1. 1. Glutamine 0.1
2. Squalan 5.5
3. 3. Olive oil 3.0
4. Stearic acid 2.0
5. Beeswax 2.0
6. Octyldodecyl myristate 3.5
7. Polyoxyethylene cetyl ether (20EO) 3.0
8. Behenyl alcohol 1.5
9. Glycerin monostearate 2.5
10. Fragrance 0.1
11. Methyl paraoxybenzoate 0.25
12.1,3-butylene glycol 8.5
13. Purified water 68.05
[Manufacturing method] Ingredients 2 to 9 are heated, dissolved and mixed, and kept at 70 ° C. to prepare an oil phase. Ingredients 1 and 11 to 13 are heated, dissolved and mixed, and kept at 75 ° C. to prepare an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the product is cooled while stirring, the component 10 is added at 45 ° C, and the product is further cooled to 30 ° C to prepare a product.

Prescription example 5 Gel prescription content (g)
1. 1. Leucine 0.001
2. Ethanol 5.0
3. 3. Methyl paraoxybenzoate 0.1
4. Polyoxyethylene hydrogenated castor oil (60EO) 0.1
5. Fragrance 0.1
6.1,3-butylene glycol 5.0
7. Glycerin 5.0
8. Xanthan gum 0.1
9. Carboxyvinyl polymer 0.2
10. Potassium hydroxide 0.2
11. Purified water 84.199
[Manufacturing method] Ingredients 2 to 5 and components 1 and 6 to 11 are uniformly dissolved, and the two are mixed to prepare a product.

Hereinafter, in order to effectively explain the present invention, experimental examples will be given. The present invention is not limited thereto.

Experimental Example 1 Effect of glutamine or leucine on APEH production in human skin fibroblasts DMEM supplemented with L-glutamine, L-leucine, L-valine or L-glutamic acid (final concentrations 0.4, 4 and 40 mg / mL) Human skin fibroblasts (NB1RGB) that became confluent in (-) were cultured for 24 hours, and total RNA was extracted. L-valine and L-glutamic acid were used for comparison. RNAiso plus (Takara Bio Inc.) was used for extraction of total RNA. Based on the total RNA, the expression level of APEH mRNA was measured by the real-time RT-PCR method. For the real-time RT-PCR method, SYBR Select Master Mix (Life Technologies) was used. The β-actin mRNA expression level was also measured as an internal standard, and the APEH mRNA expression level was determined as a ratio to the β-actin mRNA expression level, which is an internal standard. The primers used in the experiment are as follows.

Primer set for APEH TGGCAGCCCTCCAGATAAGA (SEQ ID NO: 1)
GAACAGCATCCAGGCAGTGA (SEQ ID NO: 2)
Primer set for β-actin CACTTTCCAGCCTTCCTTCC (SEQ ID NO: 3)
GTGTTGGGCGTACAGGTCTTG (SEQ ID NO: 4)

The results obtained are shown in Table 1. Addition of L-glutamine or L-leucine to human skin fibroblasts increased APEH mRNA expression. Therefore, L-glutamine or L-leucine promoted the production of APEH.

Similar experiments were performed on D-glutamine or D-leucine, and the expression level of APEH mRNA increased.

Glutamine or leucine has an effect of promoting the production of APEH, which is an enzyme that decomposes oxidized proteins and amyloid β. The composition containing glutamine and / or leucine can suppress the accumulation of abnormal proteins by promoting the production of APEH, and can suppress the deterioration of biological function mediated by protein abnormalities associated with aging. In addition, by promoting the decomposition of amyloid β, Alzheimer's disease can be prevented, ameliorated or treated with few side effects.

Claims (3)

An APEH production promoter comprising glutamine and / or leucine. A preventive or ameliorating agent for the accumulation of abnormal proteins, which comprises the APEH production promoter according to claim 1. A prophylactic, ameliorating or therapeutic agent for Alzheimer's disease, which comprises the APEH production promoter according to claim 1.