JP7274164B2 - Methods for detecting Streptococcus mutans - Google Patents

Description

According to the present invention, the presence or absence of Streptococcus mutans, particularly cnm-positive Streptococcus mutans and PA (Protein antigen)-positive Streptococcus mutans, can be determined by analyzing oral samples such as saliva and dental plaque. It relates to a method of detecting.

Streptococcus mutans is known not only to be a representative causative bacterium of dental caries but also to be associated with systemic diseases.

For example, Non-Patent Document 1 describes whether or not Streptococcus mutans (cnm-positive Streptococcus mutans) having a surface cnm protein that binds to type I collagen is present in saliva of 279 subjects. As a result of investigating whether or not they have and cognitive function, the group of subjects with cerebral microhemorrhages had a higher frequency of carrying cnm-positive Streptococcus mutans than the group of subjects without cerebral microhemorrhages. That, in the cnm-positive Streptococcus mutans detection group, the risk of cerebral microhemorrhage was significantly higher than in the non-detection group (odds ratio = 14.3), and that the cnm-positive Streptococcus mutans group had cognitive function disclosed that it was low.
Non-Patent Document 2 also examined the presence or absence of cnm-positive Streptococcus mutans in saliva and the presence or absence of cerebral microhemorrhage in 51 subjects. It is disclosed that there were many occurrences of

Non-Patent Document 3 discloses that infiltration of cnm-positive Streptococcus mutans into the blood exacerbates inflammatory enteritis.

In addition, Non-Patent Documents 3 and 4, among Streptococcus mutans, strains having cnm protein and PA protein in the surface layer were intravenously administered to mice administered a high-fat diet, and non-alcoholic steatohepatitis (NASH: Non-alcoholic steatohepatitis) symptoms were disclosed.
In recent years, even non-alcoholic people have been found to have liver damage due to excessive intake of nutrients, etc., and it is called non-alcoholic fatty liver disease (NAFLD). Among NAFLD, non-alcoholic steatohepatitis (NASH), in which inflammatory changes and fibrosis progresses along with hepatic steatosis, is regarded as a problem because it progresses to liver cirrhosis and even liver cancer, and early detection is necessary. is.

Thus, Streptococcus mutans, especially Streptococcus mutans having cnm protein and PA protein on the cell surface layer, is associated with cerebral microhemorrhage and serious systemic diseases such as stroke, dementia, inflammatory enteritis, and NASH. ing. Therefore, by examining the presence or absence of these bacteria, the onset of these diseases can be predicted and prevented at an early stage.

Various methods for detecting Streptococcus mutans in the oral cavity are known.
The method adopted by Non-Patent Document 2 is commonly used. In this method, saliva or dental plaque is applied to an MSB (Mitis-Salivarius-Bacitracin) agar medium, cultured for 2 days, colonies are collected, inoculated into a liquid medium, cultured for 1 day, and proliferated cells are recovered. Then, DNA is extracted by lysozyme lysis, RNase treatment, and ethanol precipitation, and PCR is performed using primers specific to the Streptococcus mutans gene to determine the presence or absence of Streptococcus mutans. This method takes 3-4 days.

In addition, Patent Document 1 discloses that bacteria contained in dental plaque are lysed by surfactant (Triton X-100) treatment and boiling treatment, and the lysed solution is LAMP ( It discloses a method for determining the presence or absence of Streptococcus mutans by subjecting it to loop-mediated isothermal amplification and visually confirming cloudiness due to magnesium pyrophosphate, which is a by-product of DNA amplification. Although this method does not require culturing for several days, it is complicated because it requires surfactant treatment and boiling treatment.
In addition, the method of Patent Document 1 is not suitable for mass examinations targeting a large number of people because dental plaque cannot be easily collected by the subject himself/herself.

In Patent Document 2, saliva is applied to an MSB agar medium, cultured for 2 days, colonies are collected, inoculated into a liquid medium and cultured for 18 hours, and the cultured fungus solution is reacted with a reagent to change the liquid color. A method for detecting Streptococcus mutans is disclosed. This method takes about 3 days.

Thus, conventional methods for detecting Streptococcus mutans from oral samples require 3-4 days or involve laborious steps.
When examining the presence or absence of Streptococcus mutans in a group medical examination, etc., a large number of test samples are examined, so it is required that the results can be obtained in a short time with a simple operation. In parallel with the Streptococcus mutans detection test, brain imaging tests and blood tests may be performed. should be avoided. In addition, not including complicated steps is also required to improve inspection accuracy.

Patent No. 4359699 Patent No. 5747370

SCIENTIFIC REPORTS 6:38561 (2016) Oral Diseases (2015) 21, 886-893 Journal of Osaka University Dentistry, 62(1) P.15-17 SCIENTIFIC REPORTS 6:36886 (2016)

An object of the present invention is to provide a method capable of detecting the presence or absence of Streptococcus mutans in an intraoral sample by a simple operation in a short period of time.

The present inventor has made extensive research to solve the above problems, and has obtained the following findings.
That is, oral samples such as saliva and dental plaque are coated on a solid medium capable of selectively growing Streptococcus mutans and cultured, and the cells grown on this solid medium are used to obtain Streptococcus mutans chromosome In the method for detecting the presence or absence of Streptococcus mutans by performing nucleic acid amplification targeting a partial sequence of, the culture on this solid medium is set to a short time of 40 hours or less, and the bacteria grown on the solid medium are used for harvesting The presence or absence of Streptococcus mutans can be detected in a short period of time without complicated operations by recovering with a liquid and subjecting the recovered liquid to nucleic acid amplification.

The present invention has been completed based on the above findings, and provides the following [1] to [9].
[1] a culture step of coating at least one oral cavity sample selected from the group consisting of saliva and dental plaque on a solid medium capable of selectively growing Streptococcus mutans and culturing for 6 to 40 hours; , a recovery step of recovering the bacteria grown on the solid medium into a fungus collection solution, a nucleic acid amplification step of performing nucleic acid amplification for amplifying the target sequence portion of the Streptococcus mutans chromosome using the recovery solution, and the target sequence portion A method for detecting Streptococcus mutans, comprising a determination step of determining the presence or absence of amplification of Streptococcus mutans.
[2] The method of [1], wherein the culture on the solid medium is performed until colonies can be visually observed.
[3] The method of [1] or [2], wherein after the recovery step, a nucleic acid amplification step is performed without performing an operation for extracting nucleic acids from the bacteria in the recovery solution.
[4] The method according to any one of [1] to [3], wherein the nucleic acid is amplified by the LAMP method.
[5] The method of any one of [1] to [4], wherein the target sequence portion is a sequence portion containing the entire length or part of a gene encoding a cnm protein or a gene encoding a PA protein.
[6] The method according to any one of [1] to [5], wherein the intraoral sample is saliva.
[7] a portion of the Streptococcus mutans cnm protein gene, which consists of the nucleotide sequence shown in SEQ ID NO:4;
[8] a primer consisting of the nucleotide sequence of SEQ ID NO: 13, a primer consisting of the nucleotide sequence of SEQ ID NO: 14, a primer consisting of the nucleotide sequence of SEQ ID NO: 15, a primer consisting of the nucleotide sequence of SEQ ID NO: 16, a primer consisting of the nucleotide sequence of SEQ ID NO: 17 and a set of primers consisting of the base sequence of SEQ ID NO: 18.
[9] A solid medium used in the method for detecting Streptococcus mutans according to [1], wherein a solid medium capable of selectively growing Streptococcus mutans is formed in one or more recesses of the container. , a solid medium having a surface area of 0.2 to 8 cm ² formed in the concave portion of 1.

Conventional methods for detecting Streptococcus mutans in oral samples require 3 to 4 days for culturing, and results cannot be obtained in a short time, or nucleic acids are extracted from bacterial cells after culturing. In any case, it was not possible to carry out easily.
In this regard, the method of the present invention can reduce the culture time in a solid medium to 40 hours or less (maximum of 1.5 days), for example, a short period of time such that colonies are not formed, and the culture in a liquid medium can be reduced. As a whole, the presence or absence of Streptococcus mutans can be determined in a very short time. The method of the present invention can also provide results on the day the test sample is taken or the day the test is started.
In addition, the method of the present invention can specifically amplify the target sequence portion of the chromosome if Streptococcus mutans is present, without performing an operation for extracting nucleic acid from the grown cells. It is very convenient.

In addition, the method of the present invention uses a solid medium with a small cultivable area, such as a tube with a diameter of about 1 cm, even though the time for coating and culturing an intraoral sample on a solid medium is very short. However, if Streptococcus mutans is present, subsequent nucleic acid amplification can detect Streptococcus mutans. Since the method of the present invention can be cultured on a small scale in this way, it is suitable for testing a large number of test samples in group medical examinations and the like.
In addition, in the method of the present invention, Streptococcus mutans can be detected even when saliva, which has a low bacterial density unlike dental plaque, is used as a test sample, even though the time for coating and culturing an oral cavity sample on a solid medium is very short. If present, Streptococcus mutans can be detected by subsequent nucleic acid amplification. Unlike dental plaque, saliva can be easily collected by the subject himself/herself, so the method of the present invention is suitable for mass examination of a large number of people.

As described above, the method of the present invention can easily process a large number of test samples in a short period of time, so that it can be easily incorporated into hospital examinations, mass examinations, and the like. As a result, it will be possible to predict cerebral microhemorrhage and the associated stroke, dementia, inflammatory bowel disease, NASH and the associated liver cirrhosis and liver cancer in a large number of subjects, enabling early prevention and reduction of medical costs. leads to

In addition, if Streptococcus mutans is detected, it can be bacteriostatic by washing the oral cavity with a drug, taking Lactobacillus reuteri L8020 strain that inhibits the growth of Streptococcus mutans, or the like. As a result, it is possible to suppress dental caries, cerebral microhemorrhage and the resulting stroke, dementia, inflammatory enteritis, NASH and the development of liver cirrhosis and liver cancer due to the same.

FIG. 2 shows the detection sensitivity of a transglucosidase gene amplification primer set and a cnm protein gene amplification primer set. FIG. 10 is a diagram showing the results of examining methods for culturing saliva. FIG. 2 is a diagram showing the detection sensitivity of Streptococcus mutans by the LAMP method. Fig. 2 shows that even when cnm-positive Streptococcus mutans and cnm-negative Streptococcus mutans coexist, cnm-positive Streptococcus mutans could be detected by amplifying DNA by the LAMP method targeting the cnm protein gene. is. Fig. 1 shows that even when cnm-positive Streptococcus mutans and cnm-negative Streptococcus mutans coexist, cnm-positive Streptococcus mutans could be detected by amplifying DNA by PCR targeting the cnm protein gene. is. It was found that cnm-positive Streptococcus mutans could be detected by amplifying DNA by the LAMP method even when saliva was cultured using an MSB agar medium prepared at an angle of 45 degrees in a microtube with an inner diameter of 9 mm. FIG. 4 is a diagram showing;

The present invention will be described in detail below.
In the method for detecting Streptococcus mutans of the present invention, at least one oral cavity sample selected from the group consisting of saliva and dental plaque is coated on a solid medium capable of selectively growing Streptococcus mutans. A culture step of culturing for ~40 hours, a recovery step of recovering the bacteria grown on the solid medium into a fungus collection solution, and using the recovery solution, carry out nucleic acid amplification to amplify the target sequence portion of the Streptococcus mutans chromosome. The method includes a nucleic acid amplification step and a determination step of determining the presence or absence of amplification of a portion of the target sequence.

As an intraoral sample test sample, one or more of saliva and dental plaque can be used.
Since dental plaque is a mass of bacteria, its bacterial density is very high if it contains Streptococcus mutans. Therefore, it is easy to increase the number of bacteria by culturing, and it is easy to detect the amplified nucleic acid. However, since dental plaque cannot usually be collected by the subject himself/herself, it is desirable to use saliva in order to easily perform the Streptococcus mutans test. However, since the density of bacteria in saliva is low, conventional methods for detecting Streptococcus mutans have required culturing for a relatively long time. In this respect, according to the method of the present invention, Streptococcus mutans can be detected by short-time culture and nucleic acid amplification even using saliva. Therefore, saliva is a suitable target sample for the method of the present invention.

Solid Medium As a solid medium capable of selectively growing Streptococcus mutans, a solid medium containing bacitracin, a drug to which Streptococcus mutans specifically exhibits high resistance, can be used. The concentration of bacitracin in the solid medium may be about 0.05 to 0.5 Units/mL, preferably 0.1 to 0.3 Units/mL, more preferably 0.2 Units/mL.
In addition, if the medium contains a relatively high concentration of sucrose, growth of contaminants becomes difficult, but Streptococcus mutans can grow. It preferably contains 25% by weight, especially 15-20% by weight of sucrose.
A solid medium is typically an agar medium.
In the present invention, the solid medium capable of selectively growing Streptococcus mutans is not limited to one that does not grow bacteria other than Streptococcus mutans, and bacteria other than Streptococcus mutans such as Streptococcus sobrinus. However, it may grow to the extent that it does not affect the results of the method of the present invention.
Examples of solid media capable of selectively growing Streptococcus mutans include MSB solid media and TYCSB (Trypticase-yeast-cysteine-sucrose-bacitracin) solid media.

A solid medium may be formed in one or more recesses of the container. Although the shape of the container is not particularly limited, it may be a dish-shaped container, a container having a single concave portion such as a tube-shaped container, a container provided with a plurality of dish-shaped or tubular bag-shaped concave portions, or a plurality of tubular bag-shaped containers. and the like. For example, general-purpose products such as Petri dishes, microtubes, and multiwell plates can be used.

The surface area (cultivable area) of the solid medium formed in the recess 1 of the container is 0.2 cm ² or more, 0.5 cm ² or more, 1 cm ^{2 or} more, 2 cm ^{2 or} more, 3 cm ² or more, 4 cm ^{2 or} more, 5 cm ^{2 or more} . It can be 10 cm ² or more, 20 cm ² or more, or 50 cm ² or more. 100 cm ² or less, 80 cm ^{2 or} less, 50 cm 2 or less, 30 ^{cm 2} or less, 20 cm ² or less, 15 cm ² or less, 10 cm ² or less, 8 cm ^{2 or less, 7 cm 2 or less} , 6 cm ² or less, 5 ^{cm 2 or} less, 4 cm ^{2 or} less, It can be 3 cm ² or less, 2 cm ² or less, 1 cm ² or less, and the like.
A medium with a surface area of this level can be obtained by preparing a solid medium in a concave portion of a Petri dish, microtube, multiwell plate, or the like.
Containers for containing solid culture media generally have one concave portion with a circular cross-section. , 6 cm or more, or 8 cm or more. In addition, it can be 10 cm or less, 8 cm or less, 6 cm or less, 5 cm, 4 cm or less, 3 cm or less, 2 cm or less, or 1 cm or less.
The present invention provides a solid medium capable of selectively growing Streptococcus mutans for use in the method for detecting Streptococcus mutans of the present invention, or for use in the method for detecting Streptococcus mutans of the present invention (particularly, A solid medium having a surface area of 0.2 to 8 cm ² formed in one recess) is provided.

Since the method of the present invention can detect Streptococcus mutans even with such a small surface area solid medium, it is suitable for handling a large number of test samples.
In particular, if the solid medium is formed as a slant medium, the surface area can be expanded, so that a small-sized container can be used to grow more bacteria.

Application and culture of intraoral sample The plaque scraped off with a scaler or the like may be applied to the solid medium as is or after being suspended in a small amount of water or the like. Greater amounts of plaque may be used.
Alternatively, the saliva may be directly applied to the solid medium. The amount of saliva applied can be 10 μL or more, 20 μL or more, 50 μL or more, or 100 μL or more. Also, the upper limit of the amount of saliva is not particularly limited, but 200 μL is sufficient. Also, it can be 150 μL, 100 μL or less, or 50 μL or less.

Next, the solid medium coated with the intraoral sample is placed under a temperature suitable for the growth of Streptococcus mutans for culturing.
The culture time is 6 hours or longer, preferably 8 hours or longer, and more preferably 10 hours or longer. The culture time is 40 hours or less, preferably 24 hours or less, more preferably 12 hours or less. In the method of the present invention, culturing can be continued until colonies can be visually or macroscopically (ie, without using a microscope or the like) visible on the solid medium. Although it is easier to detect Streptococcus mutans by increasing the culture time to increase the number of bacteria, the method of the present invention can detect Streptococcus mutans even with such short-time culture. Since the method of the present invention allows for such a short incubation time, results can also be obtained on the same day that the intraoral sample is taken.
The culture temperature may be 30 to 45°C, especially 35 to 40°C, especially about 37°C.

After culturing , the surface (culture surface) of the solid medium is washed with a liquid for collecting bacteria, and the liquid for collecting bacteria is recovered to collect the bacteria. At this time, the bacteria on the solid medium may be scraped into the fungus-collecting solution with a sterilized Conlarge rod, platinum loop, or the like.

The liquid used for collecting bacteria may be any liquid as long as it does not contain a component that inhibits nucleic acid amplification. In addition, such a component may be contained in an amount that does not inhibit nucleic acid amplification. Components that inhibit nucleic acid amplification include chelating agents such as EDTA, surfactants such as SDS, proteolytic enzymes, strong acids, and strong alkalis.
Since divalent cations are required for the activity of DNA polymerase, it is desirable not to contain a chelating agent in order not to inhibit the activity of DNA polymerase. Therefore, it is desirable to contain a chelating agent in order to suppress the activity of the DNase. Therefore, the nucleic acid amplification reaction solution should contain an appropriate concentration of divalent cations. When the bacterium collection solution contains a chelating agent, the concentration of the chelating agent brought into the nucleic acid amplification reaction solution is required to be low enough not to inhibit the activity of the DNA polymerase.
In addition, when the fungus collection solution contains a surfactant, the concentration of the surfactant brought into the nucleic acid amplification reaction solution is required to be low enough not to denature the DNA polymerase.
In addition, when the bacterium collection solution contains a strong acid or strong alkali, the concentration of the strong acid or strong alkali brought into the nucleic acid amplification reaction solution is such a low concentration that the pH of the reaction solution does not become a pH at which the DNA polymerase is difficult to function. is required.
Although water may be used as the liquid for collecting bacteria, a buffer (for example, a buffer containing EDTA such as TE buffer), a liquid medium, or the like may also be used.

Depending on the area of the solid medium, the amount of the liquid for collection can be 30 μL or more, 50 μL or more, 100 μL or more, 200 μL or more, 500 μL or more, or 1 mL or more. Within this range, the bacteria on the solid medium can be sufficiently collected. Also, the amount of the fungus collection solution used can be 2 mL or less, 1 mL or less, 500 μL or less, 300 μL or less, 200 μL or less, or 100 μL or less. If the amount of the collection solution is too large, the density of bacteria in the collected solution will be too low, making it difficult to detect Streptococcus mutans by nucleic acid amplification.

Nucleic Acid Extraction In the method of the present invention, nucleic acids (DNA or RNA) may be extracted from the recovered bacteria, but Streptococcus mutans can be detected by directly subjecting the bacterial recovery solution to the nucleic acid amplification method without extraction. .
The term "nucleic acid extraction" as used in the present invention refers to a treatment for increasing the permeability of cells to release at least part of the nucleic acids from the cells. Such treatments are well known to those skilled in the art, and examples include heat treatment (heating at about 65 to 100° C.), surfactants (nonionic surfactants such as Triton X-100, SDS and guanidine salts, etc.). ionic surfactant, etc.) treatment, calcium chloride treatment, enzyme (cell wall-dissolving enzyme such as lysozyme, etc.) treatment, pulse voltage application, application of osmotic shock, electron beam irradiation, and the like.

The nucleic acid amplification bacterium recovery solution or the nucleic acid extract is subjected to nucleic acid amplification. According to the method of the present invention, Streptococcus mutans can be detected by directly subjecting the bacterial recovery solution to nucleic acid amplification without extracting nucleic acid from the recovered bacteria.
Methods for amplifying DNA include PCR (Polymerase chain reaction) (Science 239, 487-491 (1988)) and LCR (Ligase chain reaction) (Proc. Natl. Acad. Sci. USA, 88: 189-193 (1991)). LAMP (Loop-mediated isothermal amplification) (WO 00/28082), SDA (Strand displacement amplification) (U.S. Pat. No. 5,455,166), ICAN (Isothermal and chimeric primer-initiated amplification of nucleic acids) (International Publication 00/56877), SMAP (Smart amplification process) (Seibutsu butsuri kagaku, 52(4):183-187, 2008), 3SR (Self-stranded sequence replication) (Am. Biotechnol.Lab.8, 14-25 (1990)) include isothermal amplification methods that do not involve heat denaturation of double-stranded DNA.

Also, RNA can be amplified instead of DNA. In the case of amplifying RNA, isothermal amplification can be performed without heat denaturation because the RNA is single-stranded from the beginning. In addition, since RNA has a large intracellular copy number, the detection sensitivity is high, and the diversity among species is high, so the detection accuracy of Streptococcus mutans is high. Nucleic acid amplification methods for amplifying RNA include TMA (Transcription Mediated Amplification) (In Ferre, F. (ed), Gene quantification, Boston, Birhauser p189-201 (1998)), NASBA (Nucleic Acid Sequence-Based Amplification) ( In Ferre, F.(ed), Gene quantification, Boston, Birhauser p169-188(1998)), TRC (Transcription-reverse transcription concerted reaction) (J.Clin.Microbiol,.42(9):4284-4292,2004 ) and the like.

Among them, the isothermal amplification method is preferable because it is simple and inexpensive because it does not require changing the temperature. Among them, the LAMP method is particularly convenient because DNA can be amplified in one step using one type of synthetase. In addition, since the LAMP method has a high amplification efficiency, even a small amount of target DNA can be amplified detectably, and since it has extremely high specificity, erroneous detection of related strains can be suppressed.
In the isothermal amplification method, the temperature during amplification varies depending on the type of DNA polymerase, but may be, for example, about 50 to 70.degree.

The target sequence portion to be amplified by the nucleic acid amplification method may be the entire region or part of any gene of Streptococcus mutans. In addition, it is also possible to amplify a sequence portion that spans between genes. For example, the glycosyltransferase gene (GenBank accession number: M1736) has a relatively large difference in base sequence between species of the genus Streptococcus. Mutans can be detected with high accuracy. Also, by targeting a sequence portion containing all or part of the gene encoding the cnm protein (GenBank accession number: AB465300.1), it is possible to detect cnm-positive Streptococcus mutans, which encodes the PA protein. PA-positive Streptococcus mutans can be detected by targeting a portion of the sequence containing all or part of the gene (GenBank accession number: KM219946).

Among them, if the sequence portion of the transglucosidase gene of Streptococcus mutans, which consists of the base sequence shown in SEQ ID NO: 1, is targeted, nucleic acid amplification with higher specificity can be performed, that is, false detection of other bacterial strains Fewer false negatives for Streptococcus mutans detection.
In addition, by targeting the sequence portion of the cnm protein gene of Streptococcus mutans, which consists of the base sequence shown in SEQ ID NO: 4, nucleic acid amplification with higher specificity can be performed. False detections of Streptococcus mutans and false negatives of cnm-positive Streptococcus mutans detections are reduced.

In addition, using a set of six primers of SEQ ID NOS: 7 to 12 as LAMP primers for amplifying the base sequence portion shown in SEQ ID NO: 1 increases the amplification efficiency and specificity of the target sequence. Also, if a set of six primers of SEQ ID NOS: 13 to 18 is used as the LAMP primers for amplifying the base sequence portion shown in SEQ ID NO: 4, the amplification efficiency and specificity of the target sequence are increased.

Determining the presence or absence of Streptococcus mutans Amplification of the target sequence portion of Streptococcus mutans is carried out in the presence of an intercalator that binds to double-stranded nucleic acids such as ethidium bromide (EtBr) and SYBR GREEN, followed by an ultraviolet lamp. You can do this by checking the fluorescence below. In addition, chelating agents such as calcein bind to manganese ions before amplification and are quenched. Furthermore, since the fluorescence is enhanced by binding with magnesium ions in the reaction solution, the presence or absence of amplification can be confirmed by confirming the fluorescence under an ultraviolet lamp.
Furthermore, since pyrophosphate is produced as a by-product in the elongation reaction by DNA synthetase, it reacts with magnesium ions in the reaction solution to produce magnesium pyrophosphate. In a method such as the LAMP method, which produces a large amount of amplified product, magnesium pyrophosphate precipitates in the reaction solution and causes white turbidity. Therefore, the amplification of the target sequence can be confirmed by visually confirming the white turbidity. .

EXAMPLES The present invention will be described in more detail below with reference to Examples, but the present invention is not limited to these.
(1) Cloning of target sequence
After culturing Streptococcus mutans and cnm-positive Streptococcus mutans isolated from the human oral cavity, chromosomal DNA was prepared using a DNA genome extraction kit (GenCheck DNA Extraction Reagent, FASMAC). bottom.

A partial sequence of the transglucosidase gene shown in SEQ ID NO: 1 was amplified using a PCR kit (Expand long range, Roche) using the chromosomal DNA of Streptococcus mutans as a template and the following primer set.
Forward primer: TGAGCTGCTGTTTGTCTT (SEQ ID NO: 2)
Reverse primer: GTTTCAGCAGAAACAGAACA (SEQ ID NO: 3)

Using the chromosomal DNA of cnm-positive Streptococcus mutans as a template, a partial sequence of the cnm protein gene shown in SEQ ID NO: 4 was amplified using a PCR kit (Expand long range, Roche) using the following primer set. .
Forward primer: CAGACTGAATGTCATCTTCAA (SEQ ID NO: 5)
Reverse primer: GCAGTAACATTTCATCGCTG (SEQ ID NO: 6)

PCR products were TA cloned using pGEM-T Easy Vector System I (Promega). Specifically, the PCR product was mixed with the vector and ligase-containing buffer contained in this kit, ligated, and transformed into Escherichia coli DH5α competent cells (Takara Bio Inc.).
A plasmid containing a partial sequence of the transglucosidase gene shown in SEQ ID NO: 1 is called an SM plasmid, and a plasmid containing a partial sequence of the cnm protein gene shown in SEQ ID NO: 4 is called a cnm plasmid.

(2) Examination of primer sensitivity SM plasmid containing DNA having the base sequence of SEQ ID NO: 1 (transglucosidase gene portion) and cnm plasmid containing DNA having the base sequence of SEQ ID NO: 4 (cnm protein gene portion) DNA was amplified using a LAMP method reagent (Loopamp DNA amplification reagent, Eiken Chemical Co., Ltd.) as a template.

The amount of each component contained in 25 μL of the LAMP reaction solution was as follows.
Primers: 1600nM FIP, 1600nM BIP, 800nM LF, 800nM LB, 400nM F3, 400nM R3
Target DNA solution: 1 μL
Loopamp fluorescence/visual detection reagent (Eiken Chemical Co., Ltd.) 1 μL
0.8M betaine

After the LAMP reaction solution was prepared, it was transferred to a reaction tube, mixed by inversion, and reacted at 64° C. for 2 hours.

The primer sets used are as follows.
Primer set for transglucosidase gene amplification (referred to as "SM primer")
F3: GAAGTTTGTGCTTCTTCTGA (SEQ ID NO: 7)
B3: GATAAGGCGGCATCTGAA (SEQ ID NO: 8)
FIP: GCATAACTAAGGAAACTCCTTCACACGTATTTGTTACTGTTTTGTCAT (SEQ ID NO: 9)
BIP: CTTGTATCAGCAACGTTTGCCTGCCAAACAGATGCACCTAA (SEQ ID NO: 10)
LF: TATTACAACACAAGCCAACT (SEQ ID NO: 11)
LB: TGGGCCTGCG TTTGTTCTGT (SEQ ID NO: 12)

cnm protein gene amplification primer set (referred to as "cnm primer")
F3: CCAGTAATACTGTCATTGAAAGT (SEQ ID NO: 13)
B3: CGCTTTGAGTTTGATGAGC (SEQ ID NO: 14)
FIP: AACCATTAAGCTGGAGGTTCAGGAACTGCTTTGTCTTGCGT (SEQ ID NO: 15)
BIP: CGTATAACCTGTTCCTCTGACTGTAATATTAAAGCAGGCGACAC (SEQ ID NO: 16)
LF: GCAAGTATGTTGGTGATTTG (SEQ ID NO: 17)
LB: CCTGAATTCTGCCAGTTAAC (SEQ ID NO: 18)

The amount of target DNA added to the LAMP reaction solution was changed to 1×10 ² , 1×10 ³ , 1×10 ⁴ , 1×10 ⁶ or 1×10 ⁸ .

The result of observing each reaction tube under an ultraviolet lamp is shown in FIG. When SM primers for transglucosidase gene amplification are used, SM plasmids can be detected if they are 1×10 ⁶ molecules or more, and when cnm primers for cnm protein gene amplification are used, cnm plasmids are detected if they are 1×10 ³ molecules or more. could be detected.

(3) Investigation of saliva culture method Transfer 20 μL of saliva collected from a subject known to have cnm-positive Streptococcus mutans to 2 mL of BHI (Brain heart infusion) liquid medium, culture for 1 day, and then culture. Fluid was collected (salivary BHI liquid culture medium).
Separately, 20 μL of the same saliva was placed on an MSB agar medium (Becton, Dickinson and Company, 229810) prepared in a petri dish with an inner diameter of 6 cm (trade name: BioLite 60 mm Tissue Culture Dish, model number: 130181, Thermo Fisher Scientific). Then, it was statically cultured at 37° C. for 24 hours. No colonies were observed by visual observation after this culture. Next, 50 μL of BHI liquid medium was poured onto this MSB agar medium, and after washing the medium surface, the bacteria were collected (collection liquid of bacteria on MSB agar medium).

A liquid for LAMP reaction was prepared by using 1 μL each of the culture solution of saliva in BHI liquid medium and the recovery solution of bacteria on MSB agar medium. Separately, a LAMP reaction solution was prepared using 1 μL each of the SM plasmid and the cnm plasmid.
The composition of the LAMP reaction solution is as described in the item "(2) Examination of primer sensitivity" except that 1 µL of the culture solution, bacterial recovery solution, or each plasmid solution was used instead of 1 µL of the target DNA solution. .
As primers, the SM primer for transglucosidase gene amplification and the cnm primer for cnm protein gene amplification described in the item "(2) Examination of primer sensitivity" were used.

After reacting at 64° C. for 2 hours, each reaction tube was observed under an ultraviolet lamp. The results are shown in FIG.
Amplification of both the above genes of Streptococcus mutans could not be detected by subjecting a culture solution obtained by culturing saliva in a BHI liquid medium to a nucleic acid amplification method. When the collected liquid was subjected to a nucleic acid amplification method, amplification of the Streptococcus mutans transglucosidase gene and cnm protein gene could be detected.

(4) Examination of the limit of detection of the number of bacteria Picked up from the preserved bacterial solution (Streptococcus mutans and cnm-positive Streptococcus mutans obtained from the carrier) with a sterilized toothpick and prepared MSB agar separately in a petri dish. Media were inoculated to form 1, 5, 10, or 20 colonies per plate. The composition of the MSB agar medium is the same as that used in "(3) Investigation of method for culturing saliva". In addition, an MSB agar medium without inoculating colonies was prepared as a negative control. These media were statically cultured at 37° C. for 24 hours.
Next, 50 μL of BHI liquid medium was poured onto these MSB agar media, and the medium surface was washed and recovered. A LAMP reaction solution was prepared using 1 μL of the recovered solution. The LAMP reaction solution was as described in the item "(2) Examination of primer sensitivity" except that 1 µL of the recovery solution was used instead of 1 µL of the target DNA solution.
As primers, the SM primer for transglucosidase gene amplification and the cnm primer for cnm protein gene amplification described in the item "(2) Examination of primer sensitivity" were used.

After reacting at 64° C. for 2 hours, each reaction tube was observed under an ultraviolet lamp. The results are shown in FIG.
When both the Streptococcus mutans transglucosidase gene and the cnm protein gene were targeted, one colony on the MSB agar medium showed clearly stronger fluorescence than the negative control, confirming DNA amplification.

(5) Investigation of detection limit of cnm-positive Streptococcus mutans Since cnm-positive Streptococcus mutans and cnm-negative Streptococcus mutans coexist in the oral cavity, both Streptococcus mutans coexist on MSB agar medium. It was examined whether cnm-positive Streptococcus mutans can be specifically detected when

Cnm-positive Streptococcus mutans obtained from the carrier was inoculated onto one plate of MSB agar medium prepared in a Petri dish so that one colony was formed, and cnm-negative Streptococcus mutans obtained from the carrier was inoculated. Tans were inoculated to form 1 colony, 9 colonies, or 49 colonies. As a negative control, an MSB agar medium was also prepared by inoculating only cnm-negative Streptococcus mutans without inoculating cnm-positive Streptococcus mutans to form 49 colonies. The composition of the MSB agar medium is the same as that used in "(3) Investigation of method for culturing saliva". These media were statically cultured at 37° C. for 24 hours.
Next, 50 μL of BHI liquid medium was poured onto these MSB agar media, and the medium surface was washed and recovered. A LAMP reaction solution was prepared using 1 μL of the recovered solution. The LAMP reaction solution was as described in the item "(2) Examination of primer sensitivity" except that 1 µL of the recovery solution was used instead of 1 µL of the target DNA solution.
As primers, the SM primer for transglucosidase gene amplification and the cnm primer for cnm protein gene amplification described in the item "(2) Examination of primer sensitivity" were used.

After reacting at 64° C. for 2 hours, each reaction tube was observed under an ultraviolet lamp. The results are shown in FIG.
If the ratio of cnm-positive Streptococcus mutans colonies to the total number of colonies is 2% (cnm-positive Streptococcus mutans: cnm-negative Streptococcus mutans colony ratio of 1:49) or more, cnm-positive We were able to propagate the cnm-binding protein gene of Streptococcus mutans.
This means that cnm-positive Streptococcus mutans can be detected when the ratio of cnm-positive Streptococcus mutans among Streptococcus mutans present in the oral cavity is 2% or more. In general, about 30% of intraoral Streptococcus mutans are cnm-positive Streptococcus mutans, so if cnm-positive Streptococcus mutans are detected by the method of the present invention, false negatives due to the presence of cnm-negative Streptococcus mutans are extremely high. It turns out that there are few.

(6) Examination of the detection limit of Streptococcus mutans in an amplification method other than the LAMP method In the same manner as in the item "(5) Examination of the detection limit of cnm-positive Streptococcus mutans", cnm-positive Streptococcus mutans: cnm - Prepared MSB agar plates grown to 0:49, 1:1, 1:9 or 1:49 negative Streptococcus mutans colonies.
Next, 50 μL of BHI liquid medium was poured onto these MSB agar media, and the medium surface was washed and recovered.
Using 1 μL of the recovered solution, DNA was amplified by PCR using KOD FX Neo (TOYOBO). The reaction was carried out by thermal denaturation at 94°C for 2 minutes using a PCR Thermal Cycler Dice, followed by 32 cycles of 98°C for 10 seconds, 55°C for 20 seconds, and 68°C for 20 seconds. As primers, the primer set of SEQ ID NOs: 2 and 3 was used to amplify the transglucosidase gene of Streptococcus mutans, and the primer set of SEQ ID NOs: 5 and 6 was used to amplify the cnm protein gene of cnm-positive Streptococcus mutans. Using.
After DNA amplification by PCR, electrophoresis was performed with 3% agarose, and the band was confirmed by GelRed staining (Biotium).

The results are shown in FIG. If the ratio of cnm-positive Streptococcus mutans colonies to the total number of colonies is 2% (cnm-positive Streptococcus mutans: cnm-negative Streptococcus mutans colony ratio of 1:49) or more, cnm-positive We were able to propagate the cnm-binding protein gene of Streptococcus mutans. Methods other than the LAMP method also gave the same results as the LAMP method (Fig. 3).

(7) Examination of shape of MSB agar medium The MSB agar medium used in "(3) Examination of method for culturing saliva" was prepared in a petri dish having an inner diameter of 6 cm. This time, it was examined whether cnm-positive Streptococcus mutans can be detected even if cultured in a smaller medium area.
That is, the same operation as in “(3) Examination of saliva culture method” is performed, except that the MSB agar medium is a petri dish with an inner diameter of 6 cm (trade name: BioLite 60 mm Tissue Culture Dish, model number: 130181, Thermo Fisher Scientific). and 2 mL microtube (trade name: 2.0 ml Graduated Microcentrifuge Tube with Flat Top Cap, model number: 508-GRD-Q, Thermo Fisher Scientific) (inner diameter 9 mm) tilted at an angle of 45 degrees We used the one prepared by
A positive control was prepared by using 1 μL of the cnm plasmid instead of the recovered bacterial solution, and a negative control was prepared by adding neither the recovered bacterial solution nor the plasmid. and

The results are shown in FIG. It was shown that Streptococcus mutans, including cnm-positive Streptococcus mutans, can be detected by subsequent nucleic acid amplification even if the vessel for preparing the MSB agar medium is made smaller and the surface area for applying the intraoral sample is reduced.

Since the method for detecting Streptococcus mutans of the present invention can be performed simply and in a short time, it can be easily performed in hospital examinations and group examinations in which a large number of intraoral samples are processed. Among Streptococcus mutans, the presence of cnm-positive Streptococcus mutans is associated with cerebral microhemorrhage and the resulting stroke, dementia, inflammatory enteritis, and NASH. can be predicted and prevented at an early stage, leading to a reduction in medical costs. About 90% of adults have Streptococcus mutans, and about 30% of them are said to have cnm-positive Streptococcus mutans. Therefore, tests using the method of the present invention have a high market value.

Claims (5)

A culture step in which saliva is applied to a solid medium capable of selectively growing Streptococcus mutans and cultured for 6 to 40 hours before colonies can be visually observed , and the fungus grown on the solid medium. A recovery step of recovering in a solution for collecting bacteria, a nucleic acid amplification step of performing nucleic acid amplification for amplifying the target sequence portion of the Streptococcus mutans chromosome using the recovery solution, and a determination step of determining the presence or absence of amplification of the target sequence portion A method for detecting Streptococcus mutans, wherein after the recovery step, a nucleic acid amplification step is performed without performing an operation for extracting nucleic acids from the bacteria in the recovery solution. 2. The method according to claim 1, wherein nucleic acid amplification is performed by the LAMP method. 3. The method of claim 1 or 2 , wherein the target sequence portion is a sequence portion comprising the entire length or part of a gene encoding a cnm protein or a gene encoding a PA protein. a primer consisting of the base sequence of SEQ ID NO: 13, a primer consisting of the base sequence of SEQ ID NO: 14, a primer consisting of the base sequence of SEQ ID NO: 15, a primer consisting of the base sequence of SEQ ID NO: 16, a primer consisting of the base sequence of SEQ ID NO: 17, 3. The method according to claim 2 , wherein the nucleic acid is amplified by the LAMP method using a set of primers consisting of the nucleotide sequences of SEQ ID NO: 18 and SEQ ID NO: 18. a primer consisting of the base sequence of SEQ ID NO: 13, a primer consisting of the base sequence of SEQ ID NO: 14, a primer consisting of the base sequence of SEQ ID NO: 15, a primer consisting of the base sequence of SEQ ID NO: 16, a primer consisting of the base sequence of SEQ ID NO: 17, and a set of primers consisting of the base sequence of SEQ ID NO:18.

Images