JP7224114B2 - Composition for suppressing SRCAP expression containing lactic acid bacteria of the genus Lactobacillus as an active ingredient - Google Patents

Description

IPOD FERM BP-10953 IPOD FERM BP-5445

TECHNICAL FIELD The present invention relates to a composition for suppressing SRCAP expression containing, as an active ingredient, a lactic acid bacterium belonging to the genus Lactobacillus and/or an aqueous extract of a lactic acid bacterium belonging to the genus Lactobacillus.

SRCAP is a protein identified as Snf2-Related CBP (cAMP response-element binding protein (CREB)-binding protein) Activator Protein, which belongs to the SNF2/SWI2 protein family, and functions as an activator of many transcription factors (non-patent Reference 1). SRCAP has DNA helicase activity, is involved in dissolution of DNA double helix structure, reconstruction of chromatin structure, and regulation of transcription (Non-Patent Document 2). Also, a mutation in exon 34 of SRCAP is known to be a gene responsible for Floating-Harbor syndrome (Non-Patent Document 3). On the other hand, SRCAP is known to interact with P300/CBP (Creb-binding protein), and also functions as a transcription factor for Notch-1 involved in intercellular recognition (Non-Patent Documents 4 and 5). Hepatitis C virus nonstructural protein 3 (NS3) interacts with SRCAP to attenuate the interaction between P300/CBP and SRCAP (Non-Patent Document 5).
Since SRCAP interacts with virus-derived NS in this way, suppression of SRCAP expression is expected to inhibit the intracellular growth of NS-bearing viruses after infection. In addition, since SRCAP is a helicase and is thought to affect the regulation of cell division and transcription, suppression of its expression is effective in suppressing the proliferation of cancer cells, cells infected with viruses such as hepatitis C, and inflammatory cells. is expected to have an inhibitory effect on the growth of cells for which
On the other hand, except for genetic techniques represented by siRNA and shRNA, there is no technique for suppressing the expression of SRCAP using an inhibitor or the like, and none of the documents disclose or suggest the solution provided by the present application.

Johnston H, Kneer J, Chackalaparampil I, Yaciuk P, Chrivia J. J. Biol. Chem 1999; 274: 16370-16376 Wong, M.M., Cox, L.K., and Chrivia, J.C. 2007; J. Biol. Chem. 282: 26132-26139. Nikkel SM, Dauber A, de Munnik S, Connolly M, Hood RL, Caluseriu O, Hurst J, Kini U, Nowaczyk MJ, Afenjar A, Albrecht B, Allanson JE, Balestri P, Ben-Omran T, Brancati F, Cordeiro I , da Cunha BS, Delaney LA, Destree A, Fitzpatrick D, Forzano F, Ghali N, Gillies G, Harwood K, Hendriks YM, Heron D, Hoischen A, Honey EM, Hoefsloot LH, Ibrahim J, Jacob CM, Kant SG, Kim CA, Kirk EP, Knoers NV, Lacombe D, Lee C, Lo IF, Lucas LS, Mari F, Mericq V, Moilanen JS, Moller ST, Moortgat S, Pilz DT, Pope K, Price S, Renieri A, Sa J , Schoots J, Silveira EL, Simon ME, Slavotinek A, Temple IK, van der Burgt I, de Vries BB, Weisfeld-Adams JD, Whiteford ML, Wierczorek D, Wit JM, Yee CF, Beaulieu CL; FORGE Canada Consortium, White SM, Bulman DE, Bongers E, Brunner H, Feingold M, Boycott KM. Orphanet J. Rare Dis. 2013;8:63-71. Eissenberg JC, Wong M, Chrivia JC. Mol Cell Biol. 2005 25:6559-69. Iwai, A., Takegami, T., Shiozaki, T., Miyazaki, T. PLoS One 6, e20718

An object of the present invention is to provide a novel composition that suppresses SRCAP expression.

The inventors of the present application have extensively investigated whether there is a technique for suppressing the expression of SRCAP other than genetic techniques represented by siRNA and shRNA, and found that lactic acid bacteria of the genus Lactobacillus or components derived from lactic acid bacteria have an SRCAP expression-suppressing effect. The present inventors have found a certain thing and have completed the present invention.
That is, the present invention has the following configurations.
[1] A composition for suppressing the expression of SRCAP containing, as an active ingredient, a lactic acid bacterium belonging to the genus Lactobacillus and/or a water-soluble fraction of a lactic acid bacterium belonging to the genus Lactobacillus.
[2] The composition for suppressing SRCAP expression according to [1], wherein the lactic acid bacterium belonging to the genus Lactobacillus is one or more selected from the group consisting of Lactobacillus helveticus and Lactobacillus gasseri.

The present invention provides an unprecedented composition that suppresses the expression of SRCAP.

Fig. 2 shows a correlation diagram of protein expression in HEp-2 cells with and without addition of Lactobacillus gasseri SBT2055 water-eluted fraction (Example product 4). The expression level of the SRCAP gene is shown when the water-eluted fraction of Lactobacillus gasseri SBT2055 (Example product 4) was added to HEp-2 cells at concentrations of 100, 200 and 400 µg/mL. The gene expression level was expressed as a relative value with the gene expression level of the control group (cells to which lactic acid bacteria was not added) being 1 (hereinafter the same in FIGS. 3, 5, 6 and 7). In addition, the gene expression suppression rate (%) of each test group is shown above the bar graph when the gene expression rate of the control group is assumed to be 100%. The expression level of the RS virus-derived F-protein gene when the water-eluted fraction of Lactobacillus gasseri SBT2055 (Example product 4) was added to RS virus-infected HEp-2 cells at concentrations of 100, 200, and 400 µg/mL was measured. show. In addition, the gene expression inhibition rate (proliferation inhibition rate) (%) of each test group is shown above the bar graph when the gene expression rate of the control group is assumed to be 100%. Fig. 2 shows the correlation between the SRCAP gene expression inhibition rate (%) and the RS virus proliferation inhibition rate (%) for the water-eluted fraction of Lactobacillus gasseri SBT2055 (Example product 4). The expression level of the SRCAP gene in HEp-2 cells added to HEp-2 cells at concentrations of 100, 200, and 400 µg/mL is shown. Fig. 3 shows the expression level of RS virus-derived F-protein gene in HEp-2 cells when methanol-eluted fractions of Lactobacillus gasseri SBT2055 by diaion HP-20 were added to HEp-2 cells at concentrations of 100, 200, and 400 µg/mL. . SRCAP expression level of SW480 cells when Lactobacillus helveticus SBT2171 was added to SW480 cells at 100 μg/mL. The cell proliferation activity (cell number) of SW480 cells when Lactobacillus helveticus SBT2171 was added to SW480 cells at 50, 100, and 200 μg/mL is shown.

The active ingredient of the composition for regulating the expression of a protein involved in inhibiting the growth of human cells of the present invention is a lactic acid bacterium belonging to the genus Lactobacillus and/or a water-soluble fraction of a lactic acid bacterium belonging to the genus Lactobacillus. .

(Lactic acid bacteria belonging to the genus Lactobacillus)
The lactic acid bacterium belonging to the genus Lactobacillus of the present invention is a lactic acid bacterium classified into the genus Lactobacillus, and may be any species or strain as long as it has the SRCAP gene-suppressing effect of the present invention. Specific examples thereof include, but are not limited to, Lactobacillus helveticus, Lactobacillus gasseri, Lactobacillus acidophilus, and the like.
In addition, as strains of lactic acid bacteria belonging to the genus Lactobacillus of the present invention, Lactobacillus helveticus SBT2171 strain (deposited as FERM BP-5445), SBT2161 strain (deposited as NITE BP-01707), SBT2195 strain (FERM P-11538), SBT2196 strain (deposited as FERM P-11676), SBT0064 strain (deposited as FERM P-21079), SBT0402 strain (deposited as FERM P-21559), Lactobacillus gasseri SBT2055 ( FERM BP-10953) is preferred.

(Preparation of lactic acid bacteria belonging to the genus Lactobacillus)
Lactic acid bacteria belonging to the genus Lactobacillus may be cultured according to a conventional method for culturing lactic acid bacteria to prepare a desired amount. One mode of preparation is shown below. Lactic acid bacteria belonging to the genus Lactobacillus are cultured in a reduced skim milk medium, and the resulting culture is collected by centrifugation to obtain bacterial cells. The obtained microbial cells may be used as they are, or microbial cells subjected to concentration, drying, and freeze-drying treatment may be used. Cells killed by heat drying or the like can also be used.

(Water-soluble fraction of lactic acid bacteria of the genus Lactobacillus)
One embodiment of the method for preparing a water-soluble fraction of lactic acid bacteria belonging to the genus Lactobacillus of the present invention is shown below. A freeze-dried powder of Lactobacillus cells is suspended in a buffer solution and heated at 80° C. for about 30 minutes to obtain heated cells. After removing the supernatant by centrifugation, pure water is added, and the cells are disrupted by ultrasonic waves on ice. The lysate is subjected to centrifugation and filtering to remove precipitates to obtain a water-soluble fraction of lactic acid bacteria belonging to the genus Lactobacillus. This is dried and weighed, and the extract is resuspended in as little pure water as possible, adsorbed on a hydrophobic adsorption column, and then hydrophilic molecules are eluted with pure water to obtain a water-eluted fraction. This water-eluted fraction can also be powdered by drying the solvent. The water-soluble fraction of the lactic acid bacteria of the genus Lactobacillus of the present invention is preferably the water-soluble fraction obtained in this way, and more preferably, the water-soluble fraction is adsorbed on a hydrophobic column and eluted with water. Hydrophilic fraction.

(How to Use)
As described above, the composition of the present invention can also contain fungal cells subjected to concentration, drying, freeze-drying, and dead cells obtained by heat drying, etc., as an effective component. It can be widely used as a raw material. At the time of formulation, excipients, stabilizers, corrigents, etc. permitted in pharmaceutical formulations can be appropriately mixed and used, and dried products, concentrates and pastes thereof are also included. In addition, excipients, binders, disintegrants, lubricants, flavoring agents, suspending agents, coating agents, and other arbitrary agents as long as they do not interfere with the SRCAP gene expression-suppressing action of lactic acid bacteria belonging to the genus Lactobacillus. can also be formulated by mixing. As dosage forms, tablets, capsules, granules, powders, powders, syrups, etc. are possible, and it is desirable to administer these orally.
The SRCAP gene expression-suppressing agent of the present invention may be incorporated into any food or drink, and may be added to raw materials during the manufacturing process of the food or drink. Examples of food and drink include cheese, fermented milk, dairy lactic acid drink, lactic acid drink, butter, margarine and other dairy products, milk drinks, fruit juice drinks, soft drinks and other beverages, jellies, candies, puddings, mayonnaise and other eggs. Processed products, sweets and breads such as butter cakes, various milk powders, infant foods, nutritional compositions, etc. may be mentioned, but are not particularly limited.
The intake of the composition of the present invention is individually determined in consideration of the symptoms such as cancer, hepatitis C, allergy, etc., age, etc. of the subject to be administered. About 000 mg should be ingested.
The food and drink containing the composition for suppressing SRCAP expression of the present invention is useful as a food and drink for suppressing SRCAP expression. Even if it is, it can be suppressed to a mild condition, and a quick recovery can be expected.
When it is included in animal feed, the same effect can be expected for animals ingesting it.
In addition, since SRCAP is a helicase and is thought to affect the regulation of cell division and transcription, pharmaceuticals containing the composition for suppressing SRCAP expression of the present invention can be used for the treatment or prevention of various viral infections, and for the treatment of various cancers. It can be used as a therapeutic or prophylactic drug.

(Method for evaluating SRCAP gene expression inhibitory action)
Generally, the term "expression" of a gene refers to the production of the translation product or protein of the gene, but may also refer to the production of the transcription product or mRNA of the gene. In the present invention, "expression" of a gene means both expression at the protein level and expression at the mRNA level (transcription of the gene), unless otherwise specified.
Therefore, the SCRAP gene expression suppressing action in the present invention is used synonymously with a decrease in the amount of protein, a decrease in the amount of mRNA, and a decrease in the amount of transcription of the gene, unless otherwise specified.
In this example, it was determined whether there was a difference in the expression level of the SRCAP gene between the case where the active ingredient of the present invention, lactic acid bacteria of the genus Lactobacillus or the water-soluble fraction thereof, was added to the cells to be tested and when it was not added. It was evaluated by a method to detect whether

(Method for evaluating virus growth ability/cell growth inhibition ability)
It can be evaluated by the method described in Examples. That is, in the case of the cell growth inhibitory ability, the cell growth action differs between when the active ingredient of the present invention, the lactobacillus lactic acid bacteria of the genus Lactobacillus or the water-soluble fraction thereof, is added to the test subject cells and when it is not added. can be evaluated by a method that detects whether there is
In addition, the ability to suppress virus growth can be evaluated by detecting whether there is a difference in the expression level of virus-derived genes in virus-infected cells depending on whether or not the active ingredient of the present invention is added.

Methods for preparing lactic acid bacteria and lactic acid bacteria water-soluble fractions used in tests to confirm the effects of the present invention and lactic acid bacteria methanol fractions used in comparative tests are described below.

(Example product 1) Lactobacillus gasseri cells After culturing Lactobacillus gasseri SBT2055 in MRS broth for 16 hours, the cells were separated by centrifugation. The cells were washed twice with PBS (10 mM phosphate-buffered saline) and once with ultrapure water, and then freeze-dried to obtain SBT2055 cells.

(Example Product 2) Heated Cells of Lactobacillus gasseri The freeze-dried bacterial powder of Example Product 1 was suspended in PBS(−) and heated at 80° C. for 30 minutes to obtain heated cells.

(Example product 3) Water-soluble fraction derived from Lactobacillus gasseri Pure water was added to Example product 2, and the cells were crushed by ultrasonic waves on ice. The homogenate was centrifuged at 5000 rpm for 10 minutes and the precipitate was removed using a 0.22 μm filter, and the resulting liquid was used as a water-soluble fraction derived from Lactobacillus gasseri SBT2055.

(Example product 4) Lactobacillus gasseri water elution fraction The weighed extract (Example product 3) was resuspended in the smallest possible amount of pure water and applied to a hydrophobic adsorption column diaion HP-20 (10 mL volume). Mitsubishi Chemical Corporation), the hydrophilic molecules are eluted with 3 column volumes (30 mL) of pure water to form a water-eluted fraction, the solvent is dried using a centrifugal concentrator, and the extract is weighed. , which is referred to as Example product 4.

(Comparative example product 1) Methanol-eluted fraction of Lactobacillus gasseri After obtaining the water-eluted fraction of example product 4, 30 mL of methanol was applied to the HP-20 column, and the hydrophobicity was higher than that of example product 4. A group of substances was collected, concentrated by centrifugation, and a methanol-extracted fraction was obtained.

(Example Product 5) Cells of Lactobacillus helveticus After culturing Lactobacillus helveticus SBT2171 in MRS broth for 16 hours, the cells were separated by centrifugation. The cells were washed twice with PBS (10 mM phosphate-buffered saline) and once with ultrapure water, and then freeze-dried.

[Test Example 1] Verification 1 of SRCAP expression inhibitory action by Lactobacillus gasseri
(1) Test method For HEp-2 cells seeded in a 10 cm dish, at 50% confluency, a water-soluble fraction derived from Lactobacillus gasseri SBT2055 (Example product 4) was added to a final concentration of 2.4 mg / mL. and cultured for 3 days. As a negative control (NC), the same amount of sterilized water was added.
After washing the cells five times with PBS, 1 mL of lysis buffer (12 mM sodium deoxycholate, 12 mM sarcosinate) was added according to the literature (Masuda T, Tomita M, Ishihama YJ Proteome Res. 2008; 7:731-740). Cells were lysed on ice with sodium, 100 mM Tris-HCl (pH 9.0).
The cell lysate was denatured by heating at 95°C for 5 minutes, and then disrupted with an ultrasonic generator. This was centrifuged at 15,000 rpm for 30 minutes to remove insoluble components, and the supernatant was collected as a solubilized protein group, and then subjected to protein quantification by BCA assay.
A DTT solution was added to a solution containing 100 μg of solubilized protein to a final concentration of 100 mM, and after standing at room temperature for 30 minutes, an IAA solution was added to a final concentration of 50 mM and left to stand for 30 minutes in the dark. was subjected to reductive alkylation. After adding 5 volumes of 50 mM sodium bicarbonate solution to the solution to make the solution weakly basic, 1/100 (1 μg) of the total protein amount was added with mass spectrometry grade trypsin whose autolysis was suppressed by modification. The protein was digested by adding and incubating at 37° C. for 16 hours.
Ethyl acetate was added in an amount equal to the digested protein solution, and trifluoroacetic acid was added to a final concentration of 0.5%. After vigorously stirring, the upper layer containing deoxycholic acid was removed by centrifugation at 15,000 rpm for 2 minutes, the aqueous layer (lower layer) containing the peptide group was collected, and the solvent was dried using a centrifugal concentrator.
The dried product was redissolved in water containing 0.1% trifluoroacetic acid, and desalted and desalted using pre-equilibrated styrenedivinylbenzene polymer (SDB) or silica gel packed with octadecylsilyl (ODS) groups. Purified with condensed chips. The resulting eluate was dried with a centrifugal concentrator and resuspended in 20 μL of an aqueous solution consisting of 0.1% formic acid and 5% acetonitrile, which was used as an LC-MS sample.
Proteomics analysis was performed using LTQ Orbitrap Discovery (ThermoFisher), which is a linear ion trap electric field type FT mass spectrometer. The flow rate was 300 nL/min, and ODS with a column length of 15 cm was used as the separation column.
Data analysis was by MaxQuant and Perseus software and quantification was by the unlabeled quantification method (LFQ) (Cox J, Mann M. Nat. Biotechnol. 2008 Dec;26(12):1367-72. and Cox J, Hein MY, Luber CA, Paron I, Nagaraj N, Mann M. Mol Cell Proteomics. 2014 Sep;13(9):2513-26.).

(2) Test results A total of 1250 proteins were identified. FIG. 1 shows the change in protein expression in the cells depending on whether Example product 4 was added to HEp-2 cells (vertical axis: SBT2055 lactic acid bacteria water elution fraction added, horizontal axis: at a concentration of 2.4 mg / mL SBT2055 lactic acid bacteria aqueous elution fraction was not added).
(*) The LFQvalue is 25.0723 on the horizontal axis (added) and 20.5851 on the vertical axis (no addition) from FIG.

[Test Example 2] Verification 2 of SRCAP expression inhibitory action by Lactobacillus gasseri
(1) Test method HEp-2 cells were seeded at a concentration of 3×10 ⁵ cells/ml in 500 μl portions on a 24-well cell culture plate and cultured overnight to test (1.5×10 ⁵ cells /well). A water-eluted fraction of SBT2055 (Example product 4) was added at final concentrations of 100, 200, and 400 μg/mL. PBS (-) containing no lactic acid bacteria component was added to the negative control. After the addition, the cells were cultured for 24 hours, the culture supernatant was removed, and the water-eluted fraction of SBT2055 (Example product 4) was added again at the same concentration and cultured for 48 hours.
The culture supernatant was removed, and 0.4 ml of Trizol reagent (Life technologies) was added to each well to lyse the cells. Chloroform was added to a volume of 20% of the solution and the tube was vigorously shaken for 30 seconds. After being kept at room temperature for 3 minutes, it was centrifuged at 13,000 g at 4° C. for 15 minutes, and the upper layer was collected in another tube. An equal amount of isopropanol was added to the recovered upper layer, and the tube was gently agitated by inversion. It was allowed to stand at room temperature for 5 minutes or more, and centrifuged at 20,000 g at 4° C. for 10 minutes. The supernatant was removed, 0.5 ml of 75% ethanol aqueous solution was added to the tube, and the tube was gently inverted and stirred. After centrifugation at 20,000 g and 4° C. for 5 minutes, the supernatant was removed and air-dried for 30 minutes or more. After that, 20 μl of DEPC-treated water was added and heated at 55° C. for 10 minutes. RNA concentrations were calculated by 260 nm absorbance measurements. Moreover, the above RNA extraction is not limited to the method using Trizol reagent, and an extraction kit such as RNAEasy (Qiagen) can also be used.
Using the obtained RNA as a template, cDNA was synthesized by a polymerase reaction using a reverse transcriptase such as ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo). Expression of the SRCAP gene was evaluated by real-time PCR using a DNA polymerase such as KAPA SYBR Fast qPCR kit (Nippon Genetics). The human GAPDH gene was used as an endogenous control. The nucleotide sequences of the primers used in the test are shown below.
SRCAP-forward: CTCCACTGCTACCTCGTTTGGT (Sequence Listing SEQ ID NO: 1)
SRCAP-reverse: GGAAAATCCGTTCCAGGCGTTC (sequence listing SEQ ID NO: 2)
GAPDH-forward: GTCTCCTCTGACTTCAACAGCG (Sequence Listing SEQ ID NO: 3)
GAPDH-reverse: ACCACCCTGTTGCTGTAGCCAA (sequence listing SEQ ID NO: 4)

(2) Test Results FIG. 2 shows changes in the expression level of the SRCAP gene when the water-eluted fraction of SBT2055 (Example product 4) was added to HEp-2 cells at concentrations of 100, 200, and 400 μg/mL.
As a result, when added at concentrations of 100, 200 and 400 μg/mL, inhibition of SRCAP gene expression was observed by 32, 39 and 52%, respectively.
From this, it was found that the water-soluble fraction of Lactobacillus gasseri inhibits the SRCAP gene expression in a concentration-dependent manner.

[Test Example 3] Test on virus growth inhibitory effect by Lactobacillus gasseri HEp-2 cells were infected with RS virus, and the virus growth inhibitory effect of Lactobacillus gasseri was detected by detecting the RSV-derived F-protein gene in the infected cells. verified.
(1) RS virus infection experiment to HEp-2 cells Fetal Bovine Serum (FBS, GIBCO) was added at 5-10% to D-MEM (High Glucose) with L-Glutamine and Phenol Red (Sigma-Aldrich). A culture medium to which 1% Penicillin-Streptomycin Solution (Wako, final 100 units/ml-100 μg/ml) was added was used. The medium was preheated to 37°C before use. Other reagents were also preheated to 37°C before use, and all cell cultures were performed in an incubator at 37°C and 5% _CO2 .
HEp-2 cells were seeded at a concentration of 3×10 ⁵ cells/ml in 500 μl portions on a 24-well cell culture plate, cultured overnight, and subjected to the test (1.5×10 ⁵ cells/well).
A culture medium from which FBS was removed was used as an infection medium. SBT2055 water-eluted fraction (Example product 4) was added to HEp-2 cells seeded in a 24-well plate at final concentrations of 100, 200, and 400 μg/mL. PBS (-) containing no lactic acid bacteria component was added to the negative control. After addition, culture was performed for 24 hours, the culture supernatant was removed, the wells were washed twice with 0.6 ml of PBS (-), and the infection medium in which RSV strain A (hereinafter RSV) was suspended was added to zero. .5 ml was added (final titer of RSV was 0.00067 TCID50/cell). Immediately after infection, the extract components were added at the same concentration. After infection, the cells were cultured for 48 hours.

(2) Detection test method for RSV-derived F-protein gene The culture supernatant was removed, and 0.4 ml of Trizol reagent (Life technologies) was added to each well to lyse the cells. Chloroform was added to a volume of 20% of the solution and the tube was vigorously shaken for 30 seconds. After being kept at room temperature for 3 minutes, it was centrifuged at 13,000 g at 4° C. for 15 minutes, and the upper layer was collected in another tube. An equal amount of isopropanol was added to the recovered upper layer, and the tube was gently agitated by inversion. It was allowed to stand at room temperature for 5 minutes or more, and centrifuged at 20,000 g at 4° C. for 10 minutes. The supernatant was removed, 0.5 ml of 75% ethanol aqueous solution was added to the tube, and the tube was gently inverted and stirred. After centrifugation at 20,000 g and 4° C. for 5 minutes, the supernatant was removed and air-dried for 30 minutes or longer. After that, 20 μl of DEPC-treated water was added and heated at 55° C. for 10 minutes. RNA concentrations were calculated by 260 nm absorbance measurements. Moreover, the above RNA extraction is not limited to the method using Trizol reagent, and an extraction kit such as RNAEasy (Qiagen) can also be used.
Using the obtained RNA as a template, cDNA was synthesized by a polymerase reaction using a reverse transcriptase such as ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo). Expression of the RSV F protein gene (RSVF) was evaluated by real-time PCR using a DNA polymerase such as KAPA SYBR Fast qPCR kit (Nippon Genetics). The human GAPDH gene was used as an endogenous control. The nucleotide sequences of the RSVF primers used in the test are shown below.
DNA primers used
RSVF-forward: GGAACAAGTTGTTGAGGTTTATGAATATGC (sequence listing SEQ ID NO: 5)
RSVF-reverse: TTCTGCTGTCAAGTCTAGTACACTGTAGT (sequence listing SEQ ID NO: 6)

(3) Test results Fig. 3 shows the ratio of the RS virus-derived F-protein gene when the SBT2055 water-eluted fraction (Example product 4) was added at concentrations of 100, 200, and 400 µg/mL (cell equivalent). expression level. When SBT2055 water-eluted fraction (Example product 4) was added at concentrations of 100, 200, and 400 μg/mL to the negative control (NC) to which no lactic acid bacteria component was added, the concentrations were 82, 94, 99.0 μg/mL, respectively, depending on the concentration. A 96% RS virus growth inhibition was observed.
(4) Discussion As described above, the results in FIG. 2 show that the water-eluted fraction of SBT2055 (Example product 4) suppresses the expression of SRCAP in a concentration-dependent manner.
FIG. 4 shows the correlation between the SRCAP gene expression suppression rate and the RS virus growth suppression rate for the Lactobacillus gasseri water-eluted fraction. A clear positive correlation was observed between the SRCAP gene expression suppression rate and the RS virus proliferation suppression rate. From the slope of the approximate straight line, (RS virus growth inhibition rate)/(SRCAP gene expression inhibition rate) = 1.192, indicating that the virus growth inhibition rate and the SRCAP expression inhibition rate have a relationship of approximately 1:1. This suggests that suppression of the expression of the SRCAP gene, which can bind to viral proteins, is a factor in suppressing respiratory syncytial virus.

[Comparative Test Example 1] RS virus growth inhibitory action and SRCAP expression inhibitory action by the methanol-eluted fraction derived from Lactobacillus gasseri SBT2055 As a comparative test example, the methanol-eluted fraction derived from Lactobacillus gasseri was tested in the same manner as in Test Example 3. It was confirmed that the component had no virus growth inhibitory effect.
(1) Test method Test Example 3 using Example Product 4, except that the methanol-eluted fraction of Lactobacillus gasseri (Comparative Example Product 1) was added to HEp-2 cells at concentrations of 100, 200, and 400 ug/mL. A test was conducted in a similar manner.

(2) Test Results FIG. 5 shows the gene expression levels of SRCAP when Comparative Example Product 1 was added to HEp-2 cells at concentrations of 100, 200, and 400 μg/mL, and FIG. 6 shows the virus growth inhibition rate. When the methanol-eluted fraction was added at 200 and 400 μg/mL (cell equivalent), virus growth inhibition of 29% and 41% was observed, but no SRCAP inhibitory effect was observed.
From these results, the methanol-eluted fraction of Lactobacillus gasseri HP-20 column did not show any inhibitory effect on SRCAP gene expression, and the inhibition of RSV could not be said to be concentration-dependent. It is not allowed.

[Test Example 4] Suppression of SRCAP Gene Expression and Cell Growth Inhibitory Effect by Lactobacillus helveticus A test was conducted to verify the inhibitory effect of Lactobacillus helveticus on the growth of human colon cancer cells and the SRCAP expression inhibitory effect. rice field.
(1) Test method (i) Preparation of Lactobacillus helveticus SBT2171 cells After culturing Lactobacillus helveticus SBT2171 in MRS broth for 16 hours, the cells were separated by centrifugation. The cells were washed twice with PBS (10 mM phosphate-buffered saline) and once with ultrapure water, and then freeze-dried to obtain SBT2171 cells.
Human colon cancer cell SW480 was seeded in a 6 cm dish, and at 50% confluency, SBT2171 cells were added to final concentrations of 50, 100, and 200 μg/mL (SBT2171 group), and SBT2171 cells were added as controls. PBS alone was added (control group). Three dishes were placed in both groups, and the number of cells was counted and growth assay was performed every culture day. Also, total RNA was extracted using RNAeasy kit (Qiagen), and the expression level of the SRCAP gene in W480 cells was measured using real-time PCR. The human GAPDH gene was used as an endogenous control gene.

(2) Test Results FIG. 7 shows the SRCAP gene expression level of SW480 cells to which SBT2171 was added at 100 μg/mL. The gene expression level was expressed as a relative value with the gene expression level of the control group (SBT2171-unadded cell group) set to 1. It was found that the SBT2171-added group significantly suppressed the expression level of the SRCAP gene compared to the control group.
Further, FIG. 8 shows the results of cell growth assay when SBT2171 was added to SW480 cells at 50, 100 and 200 μg/mL. This revealed that SBT2171 inhibited the proliferation of human colon cancer SW480.
(3) Discussion From the above, it was suggested that Lactobacillus helveticus suppresses the expression of the SRCAP gene and suppresses the growth of cancer cells.

The composition for suppressing the expression of SRCAP, which contains the lactic acid bacterium of the genus Lactobacillus or the water-soluble fraction of the lactic acid bacterium of the present invention as an active ingredient, suppresses the expression of SRCAP and causes various cancer diseases caused by proliferation of cancer cells, respiratory syncytial virus and C virus. It can be widely used for the prevention and treatment of viral diseases caused by proliferation of cells infected with various hepatitis viruses such as hepatitis viruses, and various allergic symptoms such as hay fever caused by proliferation of inflammatory cells.

Claims (2)

A composition for suppressing SRCAP expression containing, as an active ingredient, a water-soluble fraction of the cells of Lactobacillus gasseri SBT2055 (FERM BP-10953) strain . A composition for suppressing SRCAP expression containing cells of Lactobacillus helveticus SBT2171 (FERM BP-5445) strain as an active ingredient.

Images