JP7208614B2 - Transformed plant and method for producing the same - Google Patents

Description

TECHNICAL FIELD The present invention relates to a transgenic plant in which whitening of green plants is controlled, and a method for producing the same. More specifically, the present invention relates to a technique for preventing spread of transformed plants by inducing spontaneous death using a DNA methylation control mechanism.

The technique of introducing new traits into crops by genetic recombination (GM; Genetically Modified) makes it possible to use genes of different species that could not be used in conventional crossbreeding. Several GM crops produced using this technique are now being grown commercially and are expanding their area. GM crops are used, for example, as plants having characteristics not found in nature, or as plants for the synthesis of pharmaceuticals such as antibodies.

On the other hand, ``the unintended spread of GM crops and their impact on the ecosystem'' has long been pointed out as a problem of GM crop cultivation.

As a method to prevent GM crops from becoming wild and the spread of foreign genes introduced into GM crops into the natural world, suppression of pollen and seed formation in GM crops, non-transformants (existing cultivars) and It is known to prevent cross-breeding with closely related wild plants. Specifically, it is a method that utilizes sterile seed traits, male/female fertility suppression traits, chloroplast transformation, marginal chimera traits, and the like to prevent the outflow of plants and genes.

Sterile seed trait is a technology that prevents seed dispersal by directly inhibiting seed formation in GM crops, also called terminator technology. Male/female fertility suppression traits are technologies that prevent the spread of genes by inhibiting pollen formation and suppressing the reproductive functions of pollen and pistils. For example, a method has been reported in which a promoter that expresses specific male reproductive organs is used to cause tissue-specific production of harmful proteins, thereby inhibiting pollen formation (Patent Documents 1 and 2). In addition, methods such as suppressing the expression of important genes that function during meiosis and pollen formation using RNA interference (RNAi) and genome editing technology have also been reported (Patent Document 3).

Chloroplast transformation is a method of preventing gene diffusion by pollen by utilizing the maternal inheritance property of chloroplasts and introducing foreign genes into the chloroplast genome that is not contained in pollen cells (Patent document 4 and 5). Peripheral chimerism is a technique for producing GM crops in which foreign genes are contained only in the superficial L1 cell layer, utilizing the fact that pollen cells and ovule cell layers are derived from the L2 cell layer (Patent Document 6). These methods ensure that the foreign genes of the GM crop are not included in the pollen or seeds.

JP 2006-109766 JP 2007-289042 JP 2010-187597 JP 2006-075078 JP 2009-225721 JP 2010-200754

However, the conventionally known anti-diffusion techniques have problems and problems.

For example, sterile seed traits and male/female fertility suppression can be applied to ornamental crops that require only flower organs, but crops that produce post-pollination fruits and seeds commercially (maize, rapeseed, cotton, etc.) difficult to apply to The use of parthenocarpic cultivars that do not require pollination is also conceivable, but applicable crop species and cultivars are limited to only a few.

In chloroplast transformation, foreign genes are introduced into the chloroplast genome mainly by the particle gun method, but there are problems with reproducibility and production efficiency. be. In addition, the production efficiency of periclinal chimerism is very low, because a method for introducing foreign genes only into the L1 cell layer has not been established. Moreover, in order to select and produce chimeric individuals, it is necessary to rely on mutations that are naturally induced in the process of redifferentiating cells into which foreign genes have been introduced into plants, and active production is difficult.

Furthermore, if the target GM crop is a vegetatively propagated crop, or if it is intentionally or accidentally propagated vegetatively (clonal propagation by cuttings, etc.), it is difficult to prevent the spread of the GM crop into the natural world using these conventional techniques alone.

Therefore, at present, there are almost no GM crop diffusion prevention technologies that do not interfere with pollen, fruit, seed formation, etc., are highly efficient in producing the desired plant body, and are applicable to seed- and vegetative-propagating crop species. I would say no.

In the future, unexpected new risks may arise if plant species that have not been cultivated as GM crops are commercialized. In order to minimize these risks, it is thought that a novel technology is required to reliably prevent the spread of GM crops themselves or pollen and seeds of GM crops.

Therefore, the present inventors have attempted to develop a new technology to prevent the spread of GM crops by introducing a system in which GM crops spontaneously wither and die after a certain period of commercial cultivation. This system is an unprecedented technology that simultaneously introduces a program that kills a new cultivar at the same time. The present invention is characterized by combining a mechanism that suppresses the expression of a specific gene to induce spontaneous death and a mechanism that regulates death induction by DNA methylation/demethylation and introduces them into a plant body. do.

More specifically, the present invention provides the following.
1. Introducing a first vector containing a first polynucleotide and a plant-derived promoter for expression of the polynucleotide and a second vector containing a second polynucleotide that induces methylation of the promoter into a plant A method for transforming a plant, characterized by:
2. 2. The method of claim 1, wherein the first vector and the second vector are introduced simultaneously or separately.
3. 3. The method according to 1 or 2 above, wherein the first polynucleotide is a polynucleotide that suppresses the expression of carotenoid biosynthetic genes.
4. 4. The method according to any one of 1 to 3 above, wherein the second polynucleotide contains a sequence complementary to the base sequence of the promoter and induces methylation of the promoter.
5. Including introducing into a plant a first vector that expresses a polynucleotide that suppresses the expression of carotenoid biosynthetic genes, and a second vector that induces methylation of a plant-derived promoter that controls the expression of the polynucleotide. , a method for producing transgenic plants with controlled whitening.
6. A method for controlling whitening in a transformed plant, comprising inducing whitening of the plant by suppressing the expression of carotenoid biosynthetic genes,
Suppression of carotenoid biosynthesis gene expression is suppression by a first siRNA that is expressed under the control of a plant-derived promoter and has a sequence complementary to a part of the nucleotide sequence of the carotenoid biosynthesis gene;
the promoter is methylated in the presence of a second siRNA having a sequence complementary to a portion of the nucleotide sequence of the promoter and demethylated in the absence of the second siRNA;
above method.
7. A first vector comprising a first polynucleotide that suppresses the expression of a carotenoid biosynthetic gene and a plant-derived promoter that controls the expression of the first polynucleotide, and a second vector that induces methylation of the promoter introducing a second vector containing a polynucleotide into a plant to produce a transformed plant with controlled whitening;
cultivating the transformed plant to select a progeny plant in which the expression of the first polynucleotide is regulated and which does not contain the second polynucleotide, wherein the progeny plant after selfing or crossing , or a method for preventing the spread of transformed plants, characterized in that by cultivation by vegetative propagation, whitening occurs due to demethylation of the promoter.
8. A transformed plant in which whitening of green tissue is controlled, wherein a polynucleotide that suppresses the expression of a carotenoid biosynthetic gene has been introduced together with a plant-derived promoter that controls the expression of the polynucleotide.
9. 9. The plant according to 8 above, wherein the plant-derived promoter is a promoter that induces expression in a green tissue-specific manner.
10. 10. The plant according to 8 or 9 above, wherein the plant-derived promoter is methylated.
11. 11. The plant according to any one of 8 to 10 above, further into which a polynucleotide encoding RNA having a sequence complementary to the sequence of the plant-derived promoter has been introduced.
12. 12. The plant according to any one of 8 to 11 above, further into which a gene encoding a protein of interest has been introduced.
13. 13. The plant according to any one of 8 to 12 above, which is seed-propagating or vegetatively propagating.
14. A polynucleotide that suppresses the expression of carotenoid biosynthetic genes for use in the method according to any one of 1 to 7 above or for producing the plant according to any one of 8 to 13 above, and the polynucleotide A vector comprising a plant-derived promoter that controls the expression of nucleotides.
15. A vector comprising a polynucleotide that induces methylation of the promoter for use in the method according to any one of 1 to 7 above or for producing the plant according to any one of 11 to 13 above.

INDUSTRIAL APPLICABILITY The method of the present invention makes it possible to prevent the spread of undesirable traits in transformed plants, and has the following advantageous features compared with conventionally proposed methods.

1) Does not interfere with pollen, fruit, seed formation, etc.
2) Conventional gene recombination techniques such as the Agrobacterium method can be used without the need for special gene introduction techniques.
3) It is applicable to both seed-propagating and vegetative-propagating crop species.

Furthermore, since the technique of the present invention uses automatic regulation of the expression of a specific gene, unlike drug-inducible promoters, it does not require induction by chemical treatment of plants. Since the whitening and dying system inhibits the carotenoid biosynthetic pathway of all photosynthetic plants, it can be applied to most plants including useful crops. In addition, since the endogenous carotenoid biosynthesis is inhibited, the use of substances toxic to other organisms and the production of harmful substances inside the plant body do not occur. Even if demethylation is not induced in the entire leaf and the plant does not die, a part of the leaf turns white and stands out, making it easy to find diffused GM individuals and hybrids.

An outline of diffusion prevention technology for GM crops using DNA methylation control mechanism is shown. Schematic representation of the mechanism by which RNAi-mediated suppression of endogenous PDS gene expression induces plant death due to whitening. Schematic representation of the mechanism by which methylation is induced in promoters for RNAi expression that suppresses endogenous PDS gene expression. Suppression of RNAi allows plants to grow normally. Schematic representation of continued promoter methylation after the methylation-inducing machinery is removed by gene isolation. Plants grow normally with continued suppression of RNAi. Schematic diagram showing that demethylation of a promoter results in RNAi-induced suppression of endogenous PDS gene expression, and spontaneous plant death is induced. 4 shows a photograph of a plant with controlled whitening. A: White plants introduced with lethal trait; B: Green adventitious buds formed from leaf discs of white plants by two-step introduction and enlarged view thereof; C: Green leaves grown with methylation maintained. Individual (continuous suppression of lethal trait expression); D: Individual whitened by demethylation in progeny (expression of lethal trait); E: Individual mixed with white tissue due to partial demethylation. The results of confirming the presence or absence of methylation in the target sequence by treatment with a methylation-sensitive restriction enzyme MaeII are shown. In individuals into which the first and second vectors were introduced (TS-1 and TS-2 strains), the target sequence was not cleaved and the target sequence was methylated, regardless of the presence or absence of treatment with the methylation-sensitive restriction enzyme MaeII. On the other hand, it was shown that the target sequence was cleaved by MaeII enzymatic treatment in the individual (T-1 strain) into which only the first vector was introduced and was not methylated.

The present invention is characterized by combining the induction of withering in plants and the control of withering induction. The outline of the present invention will be described below with reference to FIG.

As a technique for inducing plant death, the present invention utilizes suppression of endogenous gene expression using exogenous RNAi (PTGS; post-transcriptional suppression gene silencing). Suppression of endogenous gene expression by RNAi in plants is known in the art, and a person skilled in the art can implement it based on the description of this specification.

The endogenous genes selected in the present invention are genes belonging to carotenoid biosynthetic genes. Carotenoids have the role of removing reactive oxygen species and heat generated during photosynthesis, and it is known that when carotenoid biosynthesis is not possible, chlorophyll biosynthesis is inhibited by stress caused by reactive oxygen, causing plants to turn white. Therefore, when the expression of carotenoid biosynthetic genes is suppressed in the green tissue of the plant, the green tissue of leaves and the like turns white, and the plant eventually dies.

By regulating their expression only in the green tissue, which is a photosynthetic organ, the influence on harvested fruits and seeds can be minimized.

In the present invention, a control mechanism by DNA methylation/demethylation is used as a method for controlling plant death induction. Specifically, the promoter region that induces the above-mentioned whitening (lethal trait) is targeted for methylation (TGS using exogenous RNAi structure; transcriptional repressive gene silencing), thereby suppressing the lethal trait. Expression can be suppressed (Fig. 1 center). This suppression of expression can be temporary, and then the demethylation phenomenon of the methylated region is used to "release" the "suppression of the lethal trait" and induce spontaneous death. (Fig. 1 right and left).

The method of the present invention can control the spread of GM crops by controlling the time of expression of the lethal trait. The lethal trait can be induced immediately after fruit or seed harvest (after the cultivation period is over), several generations after seed propagation, and one to several years after vegetative propagation (Fig. 1, right). ). In addition, pollen from GM crops into which this lethal trait has been introduced follows normal genetic rules as a dominant trait. It turns white and spontaneously dies (Fig. 1, left). Therefore, the DNA molecules of GM crops are inherited only for several generations at the longest, and the spread of the DNA molecules not only to the present generation of GM crops but also to the hybrid progeny can be reliably prevented.

The present invention provides methods and plants as described in more detail below.

As a first aspect, the present invention provides a first vector comprising a first polynucleotide and a promoter for expressing the polynucleotide, and methylation of the promoter. and a second vector containing a second polynucleotide that induces a plant transformation method.

The target plant for the method of the present invention may be any plant that has green tissue, in other words, a plant that has chlorophyll, but considering the object of the present invention, it is herbaceous. The plant may be either an annual plant or a perennial plant, and may be either a monocotyledonous plant or a dicotyledonous plant. Plants may be plants such as ornamental flowering plants, edible vegetables and fruits, and other agricultural crops, or plants such as tobacco, soybean, corn, rapeseed, potato, tomato, etc. that are used for material production by genetic recombination. can be

For example, plants targeted by the present invention include morning glory, sunflower, cosmos, sweet pea, marigold, pansy, viola, daisy, snapdragon, gerbera, bellflower, mint, rosemary, lavender, clematis, canna, cyclamen, chrysanthemum, and rose. , carnation, petunia, gypsophila, and the like. In addition, the target plants of the present invention can be rice, wheat, corn, green onion, lily, orchid, soybean, rapeseed, cabbage, lettuce, tobacco, tomato, strawberry, eggplant, carrot, potato, cotton, and the like.

Plants of interest in the present invention also include, but are not limited to, seed-propagating plants and vegetatively propagating plants. Seed-propagating plants refer to plants that can be propagated by seeds, and vegetatively propagating plants are parent plants such as rhizomes, tubers, tuberous roots, bulbs, and brambles, regardless of whether or not they can be propagated by seeds. Part of the vegetative body of the plant can become the next generation plant. It is known that plants, even seed-propagating plants, may undergo vegetative propagation. Examples of vegetative propagation plants include, but are not limited to, onions, garlic, lilies, potatoes, taro, yams, sweet potatoes, strawberries, lotus, roses, carnations, chrysanthemums, tulips, cyclamen, and the like.

First Vector The first vector to be introduced into the plant for the method of the present invention comprises a first polynucleotide and a promoter for expression of said polynucleotide. The first polynucleotide is not particularly limited, but may be, for example, a polynucleotide that can be used to control whitening of green tissue of plants. Examples of such polynucleotides include polynucleotides that suppress the expression of carotenoid biosynthetic genes endogenous to plants.

The green tissue of a plant is a tissue in which photosynthesis is performed in the plant, and leaves and stems mainly correspond to it. Green tissue contains chlorophyll, and if chlorophyll biosynthesis is inhibited, the plant will not produce green tissue (whitening) and will die because photosynthesis will not be possible.

Chlorophyll is known to be biosynthesized through a multistep biosynthetic pathway starting from L-glutamic acid (for example, Protein Nucleic Acid Enzyme Vol.41, No.2, 1996, pp.136-145). Therefore, it is envisioned that multiple genes would need to be targeted in order for inhibition of the chlorophyll biosynthetic genes involved in this pathway to lead to plant whitening and mortality.

On the other hand, in plants that perform photosynthesis, there are various carotenoids such as lutein and β-carotene, all of which are synthesized by condensation of isopentenyl diphosphate and dimethylallyl diphosphate, etc., which are produced in the non-mevalonic acid pathway. Phytoene is known to be biosynthesized in chloroplasts via the same biosynthetic pathway involving various enzymes.

As described above, when carotenoid biosynthesis is not possible, chlorophyll biosynthesis is inhibited by stress caused by active oxygen. Therefore, in the present invention, it is preferable to induce whitening and death of plants by suppressing carotenoid biosynthesis. .

Genes in the gene group involved in the carotenoid biosynthetic pathway are referred to herein as "carotenoid biosynthetic genes". Examples of carotenoid biosynthetic genes include phytoene synthase (PSY), phytoene desaturase (PDS), ζ-carotene isomerase (Z-ISO), and ζ-carotene desaturation, which act in the steps up to lycopene synthesis. Genes encoding enzymes such as enzymes (ZDS), carotene isomerase (CRTISO), and lycopene β-cyclase (LCYb) that acts in the step of synthesizing various carotenoids from lycopene can be mentioned.

There are two carotenoid biosynthetic pathways after lycopene, and 9,15,9'-tri-cis-ζ-carotene, which is produced from phytoene as a substrate by the action of phytoene desaturase, has an absorption spectrum. is in the visible light wavelength range, its presence causes coloration in the plant body. In order to effectively inhibit carotenoid biosynthesis, it is preferable to inhibit steps upstream of lycopene synthesis. Among such carotenoid biosynthetic genes, phytoene desaturase and the like can be preferably used. The sequence of the phytoene desaturase gene is available, for example, from NCBI as Gene ID: 107761716 (phytoene synthase 2).

Polynucleotides that suppress the expression of carotenoid biosynthetic genes are not particularly limited, and those that suppress transcription of these genes and those that suppress post-transcriptional translation can be suitably used. Examples thereof include siRNA (small interfering RNA) that contains a sequence complementary to the base sequence of mRNA transcribed from the target gene and induces degradation of mRNA. To avoid confusion with the second siRNA described below, the siRNA expressed from the first polynucleotide may be referred to as the first siRNA in this specification.

siRNA is a low-molecular-weight double-stranded RNA consisting of 21 to 23 base pairs, and for introduction of siRNA into cells, in addition to introduction of synthetic siRNA, a method using a vector that expresses siRNA is known. there is In this case, a DNA sequence encoding an RNAi structure that includes a sequence complementary to the target nucleotide sequence and a reverse sequence complementary to this sequence and that forms a hairpin after expression is incorporated into a vector. be able to. Since the vector introduced into the cell is integrated into the genome, long-term siRNA expression can be achieved. The RNAi structure to be incorporated into the first vector can be appropriately designed and constructed based on the target base sequence information to suppress its expression.

Expression of the first polynucleotide by expression induction by the promoter degrades mRNA produced by transcription of the carotenoid biosynthesis genes, resulting in suppression of the expression of the carotenoid biosynthesis genes. As a result of suppression of the expression of carotenoid biosynthetic genes, the plants become white and die due to the inability of photosynthesis (Fig. 2A).

The promoter for expressing the first polynucleotide is not particularly limited, but is preferably a plant-derived promoter, and for example, a promoter capable of specifically inducing expression in green tissue can be used. Such promoters are known in the art, for example, morning glory-derived chlorophyll biosynthesis-related gene promoter (PnZIPp), Arabidopsis thaliana-derived chlorophyll a/b binding protein gene promoter (AtCAB3p), Arabidopsis thaliana-derived chlorophyll degrading enzyme gene promoter (AtCLH1p). , Arabidopsis thaliana-derived photosystem II oxygen-generating complex protein gene promoter (AtOEC33p), Arabidopsis thaliana-derived plastocyanin gene promoter (AtPC2p), and the like can be preferably used.

It is already widely known that in tobacco, an RNAi structure that suppresses the expression of phytoene desaturase can be systemically overexpressed by induction of the cauliflower mosaic virus (CaMV) 35S promoter or the like to cause whitening (for example, Tao Wang et al., New Phytologist (2005) 167: 751-760). However, there is no known example of using a green tissue-specific promoter or the like to whiten a plant and induce its death.

Second vector In the method of the present invention, a second vector containing a second polynucleotide that induces methylation of the promoter capable of inducing expression in a green tissue-specific manner is added to a plant together with the first vector. It is characterized by introducing The first vector and the second vector are assumed to integrate into different genomic regions (Fig. 2B).

Examples of the second polynucleotide include, but are not limited to, those that contain a sequence complementary to the nucleotide sequence of the above-mentioned promoter, thereby inducing methylation of the promoter. Regulation of gene expression by base methylation is also called epigenome editing, and it has been reported that gene expression can be regulated by base methylation in the promoter regions of foreign or endogenous genes in plants (D. Miki et al., Plant and Cell Physiology, Vol. 45, Issue 4, 15 April 2004, 490-495; and S. Bai et al., Journal of Experimental Botany, 1-10, 2011).

In the method of the present invention, for example, when the promoter for expression of the first polynucleotide is the morning glory-derived chlorophyll biosynthesis-related gene promoter (PnZIPp), the second polynucleotide is a sequence complementary to a partial sequence of PnZIPp can be a polynucleotide that expresses an siRNA comprising Therefore, the second polynucleotide includes, but is not limited to, a sequence complementary to a portion of the base sequence of PnZIPp and a reverse sequence complementary to this sequence, and forms a hairpin after expression. It can be a DNA sequence that encodes an RNAi structure that forms.

The siRNA expressed from the second polynucleotide (which may be referred to as the second siRNA herein) has a sequence complementary to part of the base sequence of the promoter for expressing the first polynucleotide and can induce promoter methylation. The present inventors found that the promoter capable of inducing the expression of the first polynucleotide in the first vector is methylated by RNAi against the promoter, and as a result, in plants into which the first and second vectors have been introduced , confirmed that the transcription of the first polynucleotide was repressed. In such plants, whitening, which is a lethal trait, is suppressed and can grow normally.

The present inventors further found that in progeny of plants into which the first and second vectors have been introduced, the first polynucleotide is transcribed in plants containing only the first vector due to genetic segregation by mating. It was also confirmed that lethal traits (whitening) occurred and the plants withered. In such plants, demethylation of the promoter that induces expression of the first polynucleotide had occurred.

That is, the promoter for expression of the first polynucleotide can be methylated in the presence of the second siRNA and demethylated in the absence of the second siRNA.

Methylation is a phenomenon in which C (cytosine) is methylated when CG or CNG (N is all bases) is present in the genome base sequence. Methylation of the promoter can be confirmed by, for example, methylation-sensitive restriction enzyme analysis or bisulfite sequence analysis.

Methylation-sensitive restriction enzymes do not cleave if the recognition site for cleavage is methylated, so the presence or absence of methylation can be easily determined from the presence or absence of cleavage. As such a methylation-sensitive restriction enzyme, those used in the art can be appropriately used, and MaeII, for example, can be preferably used, although not particularly limited.

In addition, by bisulfite treatment of genomic DNA, unmethylated cytosine (unmethylated cytosine) is converted to U (uracil), and methylated cytosine (methylated cytosine) is not converted. Therefore, since unmethylated DNA and methylated DNA after bisulfite treatment have different base sequences, the presence and position of methylated cytosines can be confirmed by performing PCR amplification and sequence analysis on the base sequences obtained from each sample. information can be obtained.

The second polynucleotide can be contained in a second vector together with a promoter capable of inducing its expression. The promoter used to induce the expression of the second polynucleotide is not particularly limited, but is preferably a systemic promoter such as polyubiquitin gene promoter, cauliflower mosaic virus (CaMV) 35S promoter, Arabidopsis thaliana. derived AtU6-26 promoter, Agrobacterium tumefaciens T-DNA derived nopaline synthase gene (NOS) promoter, and the like. For example, Lotus japonicus-derived polyubiquitin gene promoter (LjUbip) and the like can be preferably used. Expression of the second polynucleotide induces RNAi against the promoter that drives expression of the first polynucleotide.

Introduction of Vectors into Plants The first vector and the second vector can be introduced into plants simultaneously or separately.

For introduction of the vector into plants, any technique commonly used in the art may be used, and for example, the Agrobacterium method, particle gun method, electroporation method and the like can be preferably used. Plants used for vector introduction may be plant bodies, plant organs, or plant tissue pieces, or callus or protoplasts may be prepared and used.

Plants into which the vector has been introduced can be selected, for example, by using the presence or absence of expression of a selectable marker gene incorporated into the vector. The selectable marker gene is not particularly limited, but for example, an antibiotic resistance gene commonly used in the art can be preferably used. In this case, it is preferable to incorporate different antibiotic resistance genes into the first vector and the second vector so that introduction of each vector can be distinguished. Antibiotic resistance genes that can be preferably used include, but are not limited to, kanamycin resistance gene, neomycin resistance gene, ampicillin resistance gene, hygromycin resistance gene, and the like.

Introduction of the vector into plants can also be confirmed by PCR, Southern hybridization, Northern hybridization, Western blotting, and the like.

In the first and second vectors, enhancers, insulators, terminators, poly-A sequences and the like can be appropriately incorporated in addition to the above polynucleotides, promoters and selectable marker genes.

The configurations and features of the invention described above are equally relevant in the further aspects of the invention described below, and thus the configurations described in the first aspect, unless stated otherwise in the further aspects. and characteristics.

As a second aspect of the method for producing a transformed plant with controlled whitening, the present invention provides a first vector expressing a polynucleotide that suppresses the expression of carotenoid biosynthetic genes, and controlling the expression of the polynucleotide. The present invention relates to a method for producing a transformed plant in which whitening is controlled, which comprises introducing into the plant a second vector that induces promoter methylation.

As described above, the purpose of the present invention is to prevent the unintended spread of the trait incorporated in the transformed plant, and the introduction of the first vector induces death due to whitening of the plant. At the same time, by introducing a second vector, it is possible to control the induction of withering.

In addition to the first vector and the second vector, a gene encoding the protein of interest can be introduced into the transformed plant. The gene encoding the protein of interest is not particularly limited, but for example, traits not originally possessed by plants, such as specific colors and shapes of plant parts such as flowers and leaves, and environmental changes such as high temperature, humidity, and dryness. It may be a gene for conferring resistance, etc., to the plant, or a gene for synthesizing pharmaceuticals such as antibody drugs. The method for introducing the gene encoding the protein of interest may be any of the techniques commonly practiced in the art. For example, the Agrobacterium method, particle gun method, electroporation method, etc. are preferably used. can be done.

The first vector and the second vector can be introduced into the plant simultaneously or separately. Also, the gene encoding the protein of interest may be introduced before the first vector and the second vector, or may be introduced after the first vector and the second vector.

Method for controlling whitening in transgenic plants As a third aspect, the present invention provides a method for controlling whitening in transgenic plants, which comprises inducing whitening in plants by suppressing the expression of carotenoid biosynthetic genes. and
Suppression of carotenoid biosynthesis gene expression is suppression by a first siRNA that is expressed under the control of a promoter and has a sequence complementary to a portion of the base sequence of the carotenoid biosynthesis gene;
the promoter is methylated in the presence of a second siRNA having a sequence complementary to a portion of the nucleotide sequence of the promoter and demethylated in the absence of the second siRNA;
The above method is provided.

As a fourth aspect of the method for preventing diffusion of a transformed plant , the present invention provides a first polynucleotide comprising a first polynucleotide that suppresses the expression of a carotenoid biosynthetic gene, and a promoter that controls the expression of the first polynucleotide. and a second vector containing a second polynucleotide that induces methylation of the promoter into a plant to produce a transformed plant in which whitening is controlled,
cultivating the transformed plant to select a progeny plant in which the expression of the first polynucleotide is regulated and which does not contain the second polynucleotide, wherein the progeny plant after selfing or crossing , or cultivation by vegetative propagation, demethylation of the promoter to cause whitening, and a method for preventing the spread of the transformed plant.

In this embodiment, the step of producing a transformed plant is as described above.

A transformed plant in which whitening is controlled has a green tissue and grows normally, so that it can be cultivated using a normal plant cultivation method. A transgenic plant may be one into which a gene encoding the protein of interest has been introduced in addition to the first vector and the second vector, so that cultivation thereof produces the protein of interest. For example, a transformed plant may have traits that the plant does not naturally have. Alternatively, cultivation of transformed plants may enable the synthesis of drugs such as antibody drugs.

After the desired cultivation of the transformed plant is completed, it is necessary to prevent the spread of the trait. Therefore, in this aspect, in order to prevent the transgenic plant from multiplying more than necessary, progeny plants in which the expression of the first polynucleotide is regulated and which do not contain the second polynucleotide are selected and cultivated. can be used for As described above, the first vector containing the first polynucleotide and the second vector containing the second polynucleotide are introduced into plants as separate vectors, and are integrated into different genomic regions. is assumed. Therefore, progeny plants may include plants in which both vectors have been integrated, plants in which only one of the vectors has been integrated, and plants in which neither vector has been integrated.

In order to select, from such a population of progeny plants, progeny plants in which the expression of the first polynucleotide is regulated and which do not contain the second polynucleotide, the plants are not whitened; The indicator can be that the promoter that induces the expression of the polynucleotide is methylated and/or that the second polynucleotide is not contained in the plant.

The presence or absence of whitening of plants can be easily determined by visual inspection of the plant body, and promoter methylation can be confirmed by methylation-sensitive restriction enzyme analysis or bisulfite sequence analysis as described above. The presence or absence of the second polynucleotide can be confirmed by, for example, PCR, Southern hybridization, Northern hybridization, Western blotting, and the like.

Methylation of the promoter is followed by demethylation to release the silencing of the first polynucleotide. As a result, post-transcriptional expression of carotenoid biosynthetic genes endogenous to the plant is suppressed, and the plant turns white and dies.

Plant The present invention also provides a transformed plant in which whitening of green tissue is controlled, wherein a polynucleotide that suppresses the expression of carotenoid biosynthetic genes is introduced together with a plant-derived promoter that controls the expression of the polynucleotide. , providing the above plants.

The plant of the present invention can be produced by the method of the present invention described above. That is, a polynucleotide that suppresses the expression of a carotenoid biosynthetic gene and a plant-derived promoter that controls the expression of the polynucleotide can be introduced into a plant using the first vector described above.

The plant-derived promoter is preferably a promoter that induces expression in a green tissue-specific manner, and more preferably a PnZIP promoter can be used.

In plants into which the first vector has been introduced, gene expression of endogenous carotenoid biosynthetic genes is suppressed through mRNA degradation by the first polynucleotide. Therefore, in a plant into which only the first vector was introduced, chlorophyll biosynthesis was not possible, and the plant turned white and died as a result (Fig. 2A).

On the other hand, when the promoter in the first vector is methylated, the polynucleotide whose expression is induced by the promoter is not expressed, and the plant endogenous carotenoid biosynthesis gene is normally expressed. It is biosynthesized and the plant is in a state in which normal growth is possible. This promoter methylation can be achieved by introducing, as a second vector, a polynucleotide encoding RNA having a sequence complementary to the promoter sequence (silencer) into the plant, as described above. (Fig. 2B).

Even if both the first and second vectors are introduced, adventitious buds in the process of redifferentiation may turn white if suppression of the lethal trait is not induced by target methylation. On the other hand, it is highly likely that the lethality trait is suppressed in the green regenerated individuals into which both vectors have been introduced (Fig. 3B). These lines were selfed or crossed with non-transformants, and green-growing progeny (T1 generation: PnZIPp methylation continuation) can be selected (Figs. 2C and 3C).

It is expected that endogenous carotenoid biosynthesis (NtPDS gene in Examples) is functioning normally (repression of lethal trait) in individuals that possess only methylated targets and have green leaves. Therefore, such individuals are selected. If necessary, the expression of endogenous carotenoid biosynthetic genes can be confirmed by commonly used techniques such as PCR and Western blotting.

During the cultivation period as a GM crop, in order to enable normal growth, the expression of the first polynucleotide can be suppressed by methylation of the promoter to achieve normal growth, flowering and fruiting of the crop. (Center of Fig. 1). For the GM crops that are actually cultivated, the individual shown in FIG. 2C, which possesses only the methylated target gene (suppression of the lethal trait) in a homozygous state, is used. By cultivating genetically homozygous individuals, lethal traits will be inherited to progeny even when self-fertilized progeny of GM crops and hybrid seeds with non-GM cultivars and related wild species are formed. (Fig. 1), as a result, lethal trait (whitening) can be exercised in all progeny.

In selfed progeny of GM crops and diffused pollen and seeds, demethylation of methylated regions causes “release” of “suppression of lethal trait” and spontaneous withering (whitening) is induced. (Fig. 1 right, left, 2D and 3D).

When a virus-derived systemic high expression CaMV35S promoter, which plants do not naturally retain, is introduced as a foreign gene and the promoter region is targeted for DNA methylation, the demethylation phenomenon from the methylated state does not occur even after several generations. It has been reported in Arabidopsis thaliana and rice (D. Miki et al., Plant and Cell Physiology, Vol. 45, Issue 4, 15 April 2004, 490-495; and S. Bai et al., Journal of Experimental Botany, 1-10, 2011). Therefore, when a lethal trait is regulated by the CaMV35S promoter or the like and "suppression of the lethal trait" is performed by methylation, "release" of the "suppression of the lethal trait" is induced by subsequent demethylation. Hateful. As a result, for several generations, GM crops will spread rather than die.

On the other hand, the plant-derived promoter used in the present invention has the characteristic that demethylation is easily induced in the next-generation plant body after selfing or crossing. In addition, even in vegetative propagation (clonal propagation) in which generations are not advanced, demethylation gradually progresses and whitening of leaves is induced (Fig. 3E).

A gene encoding a protein of interest can be introduced into the plant of the present invention. The gene encoding the protein of interest is not particularly limited, but for example, traits not originally possessed by plants, such as specific colors and shapes of plant parts such as flowers and leaves, and environmental changes such as high temperature, humidity, and dryness. It may be a gene for conferring resistance, etc., to the plant, or a gene for synthesizing pharmaceuticals such as antibody drugs. The gene encoding the protein of interest may be any gene that is currently used or that may be used in the future, and can be appropriately selected as long as it does not impair the features of the present invention described above.

The vector of the present invention further provides a polynucleotide for suppressing the expression of a carotenoid biosynthetic gene for producing the plant of the present invention or for use in the method of the present invention, and the polynucleotide and a promoter that controls the expression of This vector corresponds to the "first vector" described herein.

The present invention further provides a vector comprising a polynucleotide that induces methylation of the promoter for producing the plant of the present invention as described above or for use in the method of the present invention as described above. This vector corresponds to the "second vector" described herein.

[Example 1: Induction of whitening and withering of tobacco by the first vector]
Targeting the carotenoid biosynthetic gene (phytoene desaturase; NtPDS, XM_016642616 (SEQ ID NO: 1)) of tobacco (Nicotiana tabacum, cv. SR-1), the inverted repeat sequence of its partial sequence (RNAi structure (SEQ ID NO: 2)) was incorporated into the vector pRI910 (TaKaRa) together with a morning glory-derived chlorophyll biosynthesis-related gene promoter (PnZIPp, SEQ ID NO: 3) that induces expression in a green tissue-specific manner, and a kanamycin resistance gene as a selection marker gene. A first vector was generated that expresses RNAi under control.

Here, the 1st to 217th base sequences and 874th to 1090th base sequences of SEQ ID NO: 2 are sequences corresponding to the 217 base sequences of 925th to 1141st bases of SEQ ID NO: 1, and the 218th to 873rd bases of SEQ ID NO: 2 is a linker sequence derived from the β-glucuronidase (GUS) gene.

About 5 mm square leaf discs were prepared from the plantlets obtained after aseptic sowing of tobacco, and the vectors prepared above were inoculated by the Agrobacterium method according to a conventional method to induce adventitious buds.

Tobacco into which the RNAi vector was introduced was selected using resistance to kanamycin as an indicator. As a result of culturing tobacco in which the introduction of the vector was confirmed, post-transcriptional gene silencing (PTGS) of phytoene desaturase, one of the genes for endogenous carotenoid biosynthesis, occurred and turned white. Adventitious buds were obtained. These adventitious buds were rooted by transplanting to a rooting medium, and grew to some extent under sterile conditions containing the medium (Fig. 3A). However, such white individuals died within 1-2 weeks after being transplanted into pots containing soil (FIGS. 2A and 3A).

[Example 2: Suppression of whitening and withering 1]
Targeting the PnZIPp region (SEQ ID NO: 3), which was demonstrated to control leaf whitening (lethal trait) in Example 1, an RNAi structure (SEQ ID NO: 4) of the partial sequence was prepared ( silencer).

Here, the nucleotide sequences 800 to 803, 1236 to 1239 and 1310 to 1313 of SEQ ID NO: 3 (ACGT) are recognition sequences for the methylation-sensitive restriction enzyme MaeII described below. In addition, the 1st to 350th base sequences and 1005th to 1354th base sequences of SEQ ID NO: 4 are sequences corresponding to the 350 base sequences of 1209th to 1558th bases of SEQ ID NO: 3, and the 351st to 1004th base sequences of SEQ ID NO: 4 The nucleotide sequence is a linker sequence derived from the GUS gene.

The sequence of the obtained RNAi structure was integrated downstream of Lotus japonicus-derived polyubiquitin gene promoter (LjUbip, AP009383, SEQ ID NO: 5), and a second vector was prepared in which a hygromycin resistance gene was integrated as a selectable marker gene.

The first vector prepared in Example 1 and the second vector were simultaneously inoculated into tobacco by the Agrobacterium method. Individuals exhibiting resistance to both kanamycin and hygromycin were selected as transformants into which both vectors were introduced and cultured. As a result, the tobacco into which both vectors were introduced grew normally without whitening.

[Example 3: Suppression of whitening and withering 2]
The first and second vectors prepared in Examples 1 and 2 were inoculated into tobacco in two stages by the Agrobacterium method.

First, about 5 mm square leaf discs were prepared from plantlets obtained after aseptic sowing. Using this leaf piece, inoculation with the first vector, induction and selection of adventitious buds were carried out by the Agrobacterium method according to a conventional method, and whitening plants having lethal traits (including target) were produced. This individual can be maintained as a sterile individual on a culture medium. A second vector was then further introduced into this whitening individual.

FIG. 3B shows adventitious buds formed from leaf discs of whitened individuals after introduction of the first and second vectors in two stages. Even when both vectors were introduced, adventitious buds in the process of regeneration were mixed with white and green ones. In green regenerated individuals, the lethal trait expressed by the first vector was shown to be suppressed.

[Example 4: Confirmation of DNA methylation in the PnZIP promoter region 1]
In individuals into which the first and second vectors have been introduced, the second vector induces methylation of the target sequence of PnZIPp, presumably resulting in suppression of lethal trait expression.

Therefore, the methylation state of the target region (350-base sequence of positions 1209-1558 of SEQ ID NO: 3) in the individuals obtained in Examples 1-3 was confirmed by analysis using methylation-sensitive restriction enzymes and PCR. .

MaeII, a methylation-sensitive restriction enzyme, does not cleave if its recognition sequence is methylated. In individuals (TS-1 and TS-2 strains) into which the first and second vectors were introduced and whitening did not occur, the MaeII recognition sequence ACGT (SEQ ID NO: 3, 800 to 803, 1236 to 1239, 1310 ∼1313) is methylated, the genomic DNA is not cleaved with or without MaeII enzyme treatment. On the other hand, in individuals (T-1 strain) into which only the first vector was introduced and whitening was induced, the recognition sequence was not methylated, so the genomic DNA was cleaved by MaeII enzyme treatment.

Therefore, a primer (primer U: TCCAGATTCTACCCAAGTTAAAGA (SEQ ID NO: 6 ) and primer L: ACGCAAGTCCGCATCTTCATG (SEQ ID NO: 7)), a band at 700 bp was detected in TS-1 and TS-2 lines with or without MaeII enzyme treatment (PnZIP promoter 450 bp of + 250 bp of reverse sequence of NtPDS). On the other hand, in the T-1 line, no band was detected after MaeII enzyme treatment (Fig. 4). From this result, it was confirmed that the target sequence was methylated in all the lines in which the leaf color changed (whitened).

[Example 5: Confirmation of DNA methylation in PnZIP promoter region 2]
The methylation state of the target region (350-base sequence from positions 1209 to 1558 of SEQ ID NO: 3) in the individual obtained in Example 3 was confirmed by bisulfite sequence analysis.

Shown below is a sequence (SEQ ID NO: 8) containing 350 bases targeted for methylation in the PnZIP promoter region. The ACGT surrounded by □ indicates the recognition sequence of MaeII used in Example 4, and the underlined portion indicates a nucleotide sequence containing cytosine which is highly likely to be methylated.

The results obtained by analyzing the 3'-terminal 35 bases (G CG G CAG G CG GAAA CTG GCACCCTTAAG CG TGAGA, SEQ ID NO: 9) of the above sequence by this method are described below. In the following description, "mC" means methylated cytosine and "C" means unmethylated cytosine.

When the underlined cytosines in the sequence to be analyzed are methylated, the bisulfite treatment does not change the methylated cytosines and converts the unmethylated cytosines to uracil (SEQ ID NO: 10). Therefore, when the bisulfite-treated sequence is amplified by PCR, the base corresponding to uracil in the amplified product becomes thymine (sequence case 11).

On the other hand, when cytosines in the sequence to be analyzed are not methylated, bisulfite treatment converts all cytosines to uracil (SEQ ID NO: 12). The base at the corresponding position becomes thymine (sequence case 13).

According to the above procedure, the target sequence of PnZIPp ( The 350-base sequence from positions 1209 to 1558 of SEQ ID NO: 3) was subjected to bisulfite sequence analysis.

As a result of sequence analysis of 25 clones of PCR products for each strain, 93.3% of the 26 cytosines that are likely to be methylated are methylated in the TS-1 strain and 95.2% in the TS-2 strain. In contrast, only 2.4% of T-1 strains were methylated (average of 25 clones each). Moreover, regions other than the target sequence of PnZIPp were hardly methylated.

From these results, it was confirmed that the target sequence was methylated in all the lines in which the leaf color changed (whitened).

[Example 6: Cultivation of individuals with suppressed expression of lethal trait]
It is expected that the endogenous NtPDS gene is functioning normally (suppressed expression of lethal trait) in the individual obtained in Example 3, in which the induction of whitening is suppressed and which has green leaves. Such individuals (T0 generation) were selected.

They are then selfed or mated with non-transformants, and genetic segregation is used to remove the silencer and target-only introduced green, normally growing progeny (T1 generation: methylation of PnZIPp continued) was selected (Figs. 2C, 3C).

Specifically, the seeds obtained after crossing were sown aseptically and germinated, and then DNA was extracted from green individuals in which target methylation was expected to be maintained. Their DNA was subjected to PCR analysis for silencer or target specific sequences. Individuals in which only target-specific bands were detected were selected as individuals in which the silencer was removed and PnZIPp methylation was maintained.

By using the individual shown in Fig. 2C, which possesses only the methylated target gene (suppression of the lethal trait) in a homozygous state, methylation will continue to suppress the expression of the lethal trait during the cultivation period. , the crops were able to grow, bloom and bear fruit normally (Fig. 1 center). By cultivating genetically homozygous individuals, lethal traits are inherited to progeny even when self-fertilized progeny of GM crops and hybrid seeds with non-GM cultivars and related wild species are formed (Fig. 1).

[Example 7: Demethylation of PnZIP promoter region]
In selfed progeny of GM crops and diffused pollen and seeds, demethylation of methylated regions causes “release” of “suppression of lethal trait” and spontaneous withering (whitening of leaves). (Fig. 1 right and left, Fig. 2D, 3D). In addition, even in vegetative propagation (clonal propagation) in which generations are not advanced, demethylation gradually progressed and leaf whitening was induced (Fig. 3E).

The present invention can be applied not only to transformed plants but also to prevent unauthorized propagation of plant varieties, and can be developed to protect crop varieties. In addition, by using this technology to introduce genes into alien plants and weeds that you want to exterminate, and by cultivating those GM plants in the target area or spraying only pollen, you can gradually develop lethal traits without much effort. It is thought that it is possible to disperse it, and as a result, only the target plant can be exterminated efficiently and reliably. Furthermore, even when a hybrid between a foreign species and an endemic species is formed, only the hybrid with the foreign species can be eradicated (the foreign gene is dominantly inherited).

Genome editing technology has been actively developed in recent years, and endogenous carotenoid biosynthetic genes in plants can also be disrupted as target genes. However, genome editing does not repair the target gene once it is destroyed. Construction is difficult with technology alone.

The present invention can provide a series of systems combining PTGS (post-transcriptional repressive gene silencing) and TGS (transcriptional repressive gene silencing) using RNAi structures, and methylation and demethylation.

Claims (11)

Introducing a first vector containing a first polynucleotide and a plant-derived promoter for expression of the polynucleotide and a second vector containing a second polynucleotide that induces methylation of the promoter into a plant A method for transforming a plant, characterized in that the first polynucleotide is a polynucleotide that suppresses the expression of carotenoid biosynthetic genes to induce whitening and death of the plant, and the plant-derived promoter is The above method, wherein the promoter is a promoter capable of inducing expression in a green tissue-specific manner, and the second polynucleotide is a polynucleotide encoding RNA having a sequence complementary to the nucleotide sequence of the above promoter. 2. The method of claim 1, wherein the first vector and the second vector are introduced simultaneously or separately. A first vector that expresses a polynucleotide that suppresses the expression of carotenoid biosynthetic genes to induce whitening and death of plants, and a second vector that induces methylation of a plant-derived promoter that controls the expression of the polynucleotide. A method for producing a transformed plant with controlled whitening, comprising introducing a vector into a plant, wherein the plant-derived promoter is a promoter capable of inducing expression in a green tissue-specific manner, and the second vector contains a polynucleotide encoding RNA having a sequence complementary to the base sequence of the plant-derived promoter . A method for controlling whitening in a transformed plant, comprising inducing whitening of the plant by suppressing the expression of carotenoid biosynthetic genes,
Suppression of carotenoid biosynthesis gene expression is expressed under the control of a plant-derived promoter capable of inducing expression in a green tissue-specific manner. is siRNA-mediated suppression of
the promoter is methylated in the presence of a second siRNA having a sequence complementary to a portion of the nucleotide sequence of the promoter and demethylated in the absence of the second siRNA;
above method. a first vector comprising a first polynucleotide that suppresses the expression of a carotenoid biosynthetic gene to induce whitening and death of a plant; and a plant-derived promoter that controls the expression of the first polynucleotide; introducing a second vector containing a second polynucleotide that induces methylation of the promoter into the plant to produce a transformed plant in which whitening is controlled;
cultivating the transformed plant to select a progeny plant in which the expression of the first polynucleotide is regulated and which does not contain the second polynucleotide, wherein the progeny plant after selfing or crossing , or a method for preventing the spread of transformed plants, characterized by whitening due to demethylation of the promoter by cultivation by vegetative propagation, wherein the plant-derived promoter induces expression in a green tissue-specific manner. The above method, wherein the second vector contains a polynucleotide encoding RNA having a sequence complementary to the base sequence of the plant-derived promoter . A transformed plant in which whitening of green tissue is controlled, wherein a polynucleotide that suppresses the expression of a carotenoid biosynthetic gene to induce whitening and death of the plant is a plant-derived promoter that controls the expression of the polynucleotide The plant-derived promoter is a promoter capable of inducing expression in a green tissue-specific manner, and a polynucleotide encoding an RNA having a sequence complementary to the nucleotide sequence of the plant-derived promoter is introduced. , plants above. 7. The plant of claim 6, wherein said plant-derived promoter is methylated. 8. The plant according to claim 6 or 7 , further into which a gene encoding a protein of interest has been introduced. The plant according to any one of claims 6 to 8 , which is seed-propagating or vegetative. Suppressing the expression of carotenoid biosynthetic genes for use in the method according to any one of claims 1 to 5 or for producing the plant according to any one of claims 6 to 9 A vector comprising a polynucleotide that induces the whitening and death of a plant by using the vector, and a plant-derived promoter that controls the expression of the polynucleotide, wherein the plant-derived promoter is a promoter that can induce expression in a green tissue-specific manner. , vector above. For use in the method according to any one of claims 1 to 5, or for producing the plant according to any one of claims 6 to 9 , to induce expression in a green tissue-specific manner A vector containing a polynucleotide that induces methylation of the obtained plant-derived promoter, wherein the polynucleotide is a polynucleotide that expresses siRNA having a sequence complementary to the base sequence of the promoter.

Images