JP2020048428A - Transgenic plant and method for making the same - Google Patents

Abstract

To provide a novel technique that reliably prevents the diffusion of genetically modified (GM) crops, or the pollen and seeds of GM crops.SOLUTION: A plant transformation method includes introducing, to a plant, a first vector containing a first polynucleotide and a plant-derived promoter for the expression of the polynucleotide, and a second vector containing a second polynucleotide for induction of the methylation of the promoter.SELECTED DRAWING: None

Description

  The present invention relates to a transformed plant in which whitening of a green plant is controlled, and a method for producing the same. More specifically, the present invention relates to a technique for preventing the spread of a transformed plant by inducing spontaneous death using a DNA methylation control mechanism.

  Techniques for introducing new traits into crops by genetically modified (GM) can utilize genes of different species that could not be used in conventional crossbreeding. Currently, several GM crops produced using this technique are being cultivated commercially and are expanding their area. GM crops are used, for example, as plants having characteristics not found in nature or as plants for synthesizing pharmaceuticals such as antibodies.

  On the other hand, as a problem of GM crop cultivation, "unintended diffusion of GM crops and its impact on ecosystems" has been pointed out before.

  Methods to prevent GM crops from wildening themselves and the spread of foreign genes introduced into GM crops into the natural world include suppression of GM crop pollen and seed formation, non-transformants (existing cultivars) and It is known to prevent hybridization with closely related wild plants. Specifically, it is a method of using a sterile seed trait, a male / female fertility-suppressing trait, chloroplast transformation, a peripheral chimeric trait, and the like to prevent the outflow of plants and genes.

  The sterile seed trait is a technique for preventing the spread of seeds by directly inhibiting seed formation in GM crops, and is also called a terminator technique. The male / female fertility-suppressing trait is a technique for preventing the spread of genes by inhibiting pollen formation and suppressing the reproductive function of pollen and pistils. For example, there has been reported a method of inhibiting pollen formation by producing a harmful protein in a tissue-specific manner using a promoter that is specifically expressed in a male reproductive organ (Patent Documents 1 and 2). In addition, a method has been reported in which the expression of important genes that function during the meiosis or pollen formation stages is suppressed by using RNA interference (RNAi) or genome editing technology (Patent Document 3).

  Chloroplast transformation is a method of preventing gene spread by pollen by introducing a foreign gene into a chloroplast genome not contained in pollen cells, utilizing the property of chloroplasts being maternally inherited (Patent Document 4 and 5). The marginal chimera trait is a technique for producing a GM crop in which a foreign gene is contained only in the surface L1 cell layer, utilizing the fact that the pollen cells and the ovule cell layer are derived from the L2 cell layer (Patent Document 6). In these methods, the foreign gene of the GM crop is not contained in pollen or seed.

JP 2006-109766 JP 2007-289042 JP 2010-187597 JP 2006-075078 JP 2009-225721 JP 2010-200754

  However, the above-mentioned known diffusion prevention techniques also have problems and problems.

  For example, sterile seed traits and male / female fertility suppression can be applied to ornamental crops and the like that require only flower organs, but crops that produce fruits and seeds after pollination (corn, rapeseed, cotton, etc.) Is difficult to apply. Parthenomorph varieties that do not require pollination may be used, but applicable crop species and varieties are limited to only a few.

  In chloroplast transformation, a foreign gene is mainly introduced into the chloroplast genome by the particle gun method.However, there are problems with reproducibility and production efficiency, and only tobacco has a stable transformation method established. is there. In addition, a method for introducing a foreign gene into only the L1 cell layer has not been established for the peripheral chimeric trait, and the production efficiency is extremely low. In addition, in order to select and produce chimeric individuals, it is necessary to rely on naturally induced mutations and the like in the process of redifferentiating cells into which a foreign gene has been introduced into a plant, and it is difficult to actively produce them.

  Furthermore, when the target GM crop is a vegetatively propagated crop, or when vegetatively propagated intentionally or accidentally (clonal propagation by cuttings or the like), it is difficult to prevent the spread to the natural world using only these conventional techniques.

  Therefore, at present, there is almost no GM crop diffusion prevention technology that does not inhibit pollen, fruit, seed formation, etc., has high production efficiency of the target plant, and is applicable to seed- and vegetative-propagation crop species. I can't say that.

  In the future, if a plant species that has not been grown as a GM crop is grown commercially, unexpected new risks may arise. In order to minimize these risks, it is likely that unprecedented techniques are needed to ensure that the GM crop itself or the pollen and seeds of the GM crop are not spread.

  Therefore, the present inventors have tried to develop a new technique for preventing the spread by introducing a system that dies spontaneously to a GM crop after a certain commercial cultivation period has elapsed. This system is an unprecedented technology that simultaneously introduces a program that dies in advance when creating a new variety. The present invention is characterized in that a mechanism for suppressing spontaneous death by suppressing the expression of a specific gene and a mechanism for controlling the induction of death by DNA methylation / demethylation are introduced into plants. I do.

More specifically, the present invention provides the following.
1. A first vector containing a first polynucleotide and a plant-derived promoter for expression of the polynucleotide, and a second vector containing a second polynucleotide that induces methylation of the promoter are introduced into a plant. A method for transforming a plant, comprising:
2. 2. The method according to the above 1, wherein the first vector and the second vector are introduced simultaneously or separately.
3. 3. The method according to 1 or 2, wherein the first polynucleotide is a polynucleotide that suppresses the expression of a carotenoid biosynthesis gene.
4. 4. The method according to any one of the above items 1 to 3, wherein the second polynucleotide comprises a sequence complementary to the base sequence of the promoter, and induces methylation of the promoter.
5. The method comprises introducing into a plant a first vector that expresses a polynucleotide that suppresses the expression of a carotenoid biosynthesis gene and a second vector that induces methylation of a plant-derived promoter that controls the expression of the polynucleotide. And a method for producing a transformed plant in which whitening is controlled.
6. A method for controlling whitening in a transformed plant, comprising inducing plant whitening by suppressing the expression of a carotenoid biosynthetic gene,
The suppression of the expression of the carotenoid biosynthesis gene is suppressed by a first siRNA expressed under the control of a plant-derived promoter and having a sequence complementary to a part of the base sequence of the carotenoid biosynthesis gene,
The promoter is methylated in the presence of a second siRNA having a sequence complementary to a part of the base sequence of the promoter, and demethylated in the absence of the second siRNA;
The above method.
7. A first vector comprising a first polynucleotide that suppresses the expression of a carotenoid biosynthesis gene, a plant-derived promoter that controls the expression of the first polynucleotide, and a second vector that induces methylation of the promoter. Introducing a second vector containing a polynucleotide into a plant to produce a transformed plant in which whitening is controlled,
Culturing the transformed plant to select a progeny plant in which the expression of the first polynucleotide is controlled and does not contain the second polynucleotide, wherein the progeny plant is inbred after selfing or mating. Or a method for preventing the spread of a transformed plant, which comprises whitening by demethylation of the promoter by cultivation by vegetative propagation.
8. A transformed plant in which whitening of green tissue is controlled, wherein the polynucleotide that suppresses the expression of a carotenoid biosynthesis gene is introduced together with a plant-derived promoter that controls expression of the polynucleotide.
9. 9. The plant according to the above item 8, wherein the plant-derived promoter is a promoter that induces expression in a green tissue-specific manner.
10. 10. The plant according to the above 8 or 9, wherein the plant-derived promoter is methylated.
11. 11. The plant according to any of 8 to 10 above, wherein a polynucleotide encoding an RNA having a sequence complementary to the sequence of the plant-derived promoter has been introduced.
12. 12. The plant according to any one of the above items 8 to 11, further comprising a gene encoding a protein of interest.
13. The plant according to any one of the above items 8 to 12, which is seed-propagating or vegetative-propagating.
14． A polynucleotide for suppressing the expression of a carotenoid biosynthesis gene for use in the method according to any one of the above 1 to 7 or for producing the plant according to any one of the above 8 to 13; A vector comprising a plant-derived promoter that controls nucleotide expression.
15. A vector comprising a polynucleotide for inducing methylation of the promoter, for use in the method according to any one of the above 1 to 7, or for producing the plant according to any one of the above 11 to 13.

  By the method of the present invention, it is possible to prevent the spread of undesired traits of the transformed plant, and it has the following advantageous characteristics as compared with the conventionally proposed methods.

1) Does not inhibit pollen, fruit, seed formation, etc.
2) No special gene transfer technique is required, and conventional gene recombination techniques such as Agrobacterium method can be used.
3) It is applicable to both seed-propagating and vegetative-propagating crop species.

  Furthermore, the technology of the present invention uses automatic regulation of the expression of a specific gene, so that unlike a drug-inducible promoter, it is not necessary to induce plants by drug treatment. The whitening and dying system inhibits the carotenoid biosynthesis pathway of all photosynthetic plants and can be applied to most plants including useful crops. In addition, since endogenous carotenoid biosynthesis is inhibited, the use of substances that are toxic to other organisms and the generation of harmful substances inside plants are not caused. Even if demethylation is not induced in the whole leaf and does not die, it is easy to find diffused GM individuals and hybrids because part of the leaf is white and conspicuous.

The outline of the technology for preventing the spread of GM crops using the DNA methylation control mechanism is shown. Fig. 2 schematically shows a mechanism by which RNAi suppresses the expression of an endogenous PDS gene to induce plant death by whitening. Fig. 2 schematically shows a mechanism for inducing methylation in a promoter for expression of RNAi that suppresses expression of an endogenous PDS gene. Plants grow normally due to suppression of RNAi. FIG. 4 schematically shows that promoter methylation continues after the methylation induction mechanism has been removed by gene separation. Plants grow normally with continued suppression of RNAi. FIG. 7 schematically shows that demethylation of a promoter causes suppression of endogenous PDS gene expression by RNAi, and induces spontaneous plant death. The photograph of the plant body in which whitening was controlled is shown. A: a white individual in which a lethal trait has been introduced; B: a green adventitious bud formed from leaf pieces of a white individual by two-step introduction and an enlarged view thereof; C: a green leaf that has grown while maintaining methylation Individual (continuation of suppression of expression of lethal trait); D: individual whitened by demethylation in progeny (expression of lethal trait); E: individual mixed with white tissue due to partial demethylation. The result of confirming the presence or absence of methylation of the target sequence by treatment with the methylation-sensitive restriction enzyme MaeII is shown. In the individuals (TS-1 and TS-2 strains) into which the first and second vectors have been introduced, the target sequence is not cleaved regardless of the presence or absence of the treatment with the methylation-sensitive restriction enzyme MaeII, and the target sequence is methylated. On the other hand, in the individual (T-1 strain) into which only the first vector was introduced, the target sequence was cleaved by MaeII enzyme treatment, indicating that it was not methylated.

  The present invention is characterized by combining induction of death in a plant with control of induction of death. Hereinafter, an outline of the present invention will be described with reference to FIG.

  As a technique for inducing plant death, the present invention utilizes the suppression of endogenous gene expression using exogenous RNAi (PTGS; post-transcriptional suppression gene silencing). Suppression of endogenous gene expression by RNAi in plants is known in the art, and can be performed by those skilled in the art based on the description in the present specification.

  The endogenous gene selected in the present invention is a gene belonging to a carotenoid biosynthesis gene. It is known that carotenoids have a role of removing active oxygen species and heat generated during photosynthesis, and when carotenoids cannot be biosynthesized, chlorophyll biosynthesis is inhibited by stress caused by active oxygen and plants are whitened. Therefore, the suppression of the expression of the carotenoid biosynthesis gene in the green tissue of the plant causes the green tissue such as leaves to whiten and eventually die.

  By controlling these expressions only in green tissues, which are photosynthetic organs, the effects on harvested fruits and seeds can be minimized.

  As a technique for controlling the induction of plant death, the present invention utilizes a control mechanism by methylation and demethylation of DNA. Specifically, the promoter region that induces the whitening (lethal trait) is targeted for methylation (TGS using an exogenous RNAi structure; transcriptional repression gene silencing), Expression can be suppressed (FIG. 1, center). This suppression of expression can be temporary, and then, using the demethylation phenomenon of the methylated region, "release" the "suppression of the expression of lethal traits" to induce spontaneous death (Figure 1 right and left).

  According to the method of the present invention, the spread of GM crops can be controlled by controlling the timing of the expression of the lethal trait. The induction period of the lethal trait can be immediately after harvest of fruits and seeds (after the end of the cultivation period), several generations from the next generation of seed propagation, and one to several years after vegetative propagation (Fig. 1, right). ). In addition, the pollen of GM crops in which this lethal trait has been introduced follows the normal genetic rules as a dominant trait, so even if hybrid pollen is formed with surrounding non-GM crops due to the scattering of pollen, the seeds are not regenerated after germination. It turns white and dies spontaneously (Fig. 1, left). Therefore, the DNA molecule of the GM crop is inherited only for a few generations at the longest, and it is possible to reliably prevent the spread not only of the GM crop but also of the hybrid progeny.

  The present invention provides methods and plants described in more detail below.

Method for transforming plant / method for producing transformed plant As a first aspect, the present invention provides a first vector comprising a first polynucleotide and a promoter for expression of the polynucleotide, and methylation of the promoter. And introducing a second vector containing a second polynucleotide that induces the above-mentioned expression into a plant.

  The plant to be subjected to the method of the present invention may be any plant having a green tissue, in other words, any plant having chlorophyll. However, herbs are considered in view of the object of the present invention. The plant may be either an annual or a perennial, and may be a monocotyledon or a dicotyledon. The plant may be an ornamental flower plant, a plant such as agricultural crops such as edible vegetables or fruits, or a plant such as tobacco, soybean, corn, rapeseed, potato, tomato used for the production of a substance by genetic modification. It may be.

  For example, plants targeted for the present invention include morning glory, sunflower, cosmos, sweet pea, marigold, pansy, viola, daisy, snapdragon, gerbera, kikyo, mint, rosemary, lavender, clematis, canna, cyclamen, chrysanthemum, rose , Carnations, petunias, gypsophila and the like. Further, the plant to be used in the present invention may be, for example, rice, wheat, corn, leek, lily, orchid, soybean, rape, cabbage, lettuce, tobacco, tomato, strawberry, eggplant, carrot, potato, cotton, and the like.

  Plants that are the subject of the present invention also include, but are not limited to, seed-propagating plants and vegetative-propagating plants. Seed-propagating plants are plants that can be propagated by seeds, and vegetatively-propagating plants are parent plants such as rhizomes, tubers, tubers, bulbs, bulbs, etc., regardless of whether they can be propagated by seeds. A part of the vegetative body can be a next-generation plant. It is known that plants may vegetatively propagate even if they are seed-propagating plants. Examples of vegetatively propagating plants include, but are not limited to, onion, garlic, lily, potato, taro, yam, sweet potato, strawberry, lotus, rose, carnation, chrysanthemum, tulip, cyclamen and the like.

First Vector A first vector to be introduced into a plant for the method of the present invention comprises a first polynucleotide and a promoter for expression of the polynucleotide. The first polynucleotide is not particularly limited, and may be, for example, a polynucleotide that can be used for controlling whitening of green tissue of a plant. Such polynucleotides include polynucleotides that suppress the expression of carotenoid biosynthesis genes endogenous to plants.

  The green tissue of a plant is a tissue where photosynthesis is performed in the plant, and mainly corresponds to leaves and stems. Chlorophyll is present in the green tissue, and when the biosynthesis of chlorophyll is inhibited, the green tissue of the plant is not produced (whitened) and dies because it cannot photosynthesize.

  Chlorophyll is known to be biosynthesized by a multi-step biosynthetic pathway starting from L-glutamic acid (eg, Protein Nucleic Acid Enzyme Vol. 41, No. 2, 1996, pp. 136-145). Therefore, it is assumed that multiple genes need to be targeted in order to cause plant whitening and death by inhibiting chlorophyll biosynthesis genes involved in this pathway.

  On the other hand, in plants that perform photosynthesis, various carotenoids such as lutein and β-carotene are present, all of which are synthesized by the condensation of isopentenyl diphosphate and dimethylallyl diphosphate generated in the non-mevalonic acid pathway. Phytoene is known to be biosynthesized in chloroplasts via the same biosynthetic pathway involving various enzymes.

  As described above, when carotenoids cannot be biosynthesized, chlorophyll biosynthesis is inhibited by stress caused by active oxygen. In the present invention, it is preferable to suppress carotenoid biosynthesis to induce plant whitening and death. .

  Genes of genes involved in the carotenoid biosynthesis pathway are referred to herein as "carotenoid biosynthesis genes". Examples of carotenoid biosynthesis genes include, for example, phytoene synthase (PSY), phytoene desaturase (PDS), テ ン -carotene isomerase (Z-ISO), ζ-carotene desaturation, which act until lycopene synthesis. Examples include a gene encoding an enzyme (ZDS), an enzyme such as carotene isomerase (CRTISO), and lycopene β-cyclase (LCYb) that acts at the stage where various carotenoids are synthesized from lycopene.

  The carotenoid biosynthesis pathway consists of two pathways after lycopene, and the absorption spectrum after 9,15,9'-tri-cis-ζ-carotene generated by the action of phytoene desaturase using phytoene as a substrate. Is in the visible light wavelength range, and its presence causes coloring of the plant. In order to effectively inhibit carotenoid biosynthesis, it is preferable to inhibit a step upstream of lycopene synthesis. Among such carotenoid biosynthesis genes, phytoene desaturase and the like can be suitably used. The sequence of the phytoene desaturase gene can be obtained, for example, from NCBI as Gene ID: 107761716 (phytoene synthase 2).

  Polynucleotides that suppress the expression of carotenoid biosynthetic genes include those that suppress transcription of these genes and those that suppress translation after transcription, and are not particularly limited. For example, siRNA (small interfering RNA) that includes a sequence complementary to the base sequence of mRNA transcribed from the target gene and induces mRNA degradation can be mentioned. In addition, in order to avoid confusion with the second siRNA described below, the siRNA expressed from the first polynucleotide may be referred to as the first siRNA in this specification.

  siRNA is a low-molecular double-stranded RNA consisting of 21 to 23 base pairs.Introduction of siRNA into cells is known to involve the use of a vector that expresses siRNA in addition to the introduction of synthesized siRNA. I have. In this case, a vector containing a sequence complementary to the target base sequence and a reverse sequence complementary to this sequence and encoding an RNAi structure that forms a hairpin after expression is incorporated into the vector. be able to. Since the vector introduced into the cell is integrated into the genome, long-term siRNA expression can be realized. The RNAi structure to be incorporated into the first vector can be appropriately designed and constructed so that its expression can be suppressed based on information on the target base sequence.

  When the first polynucleotide is expressed by induction of expression by the promoter, mRNA generated by transcription of the carotenoid biosynthesis gene is degraded, and as a result, expression of the carotenoid biosynthesis gene is suppressed. As a result of suppression of the expression of the carotenoid biosynthesis gene, the plant is whitened and dies because it cannot perform photosynthesis (FIG. 2A).

  The promoter for the expression of the first polynucleotide is not particularly limited, but is preferably a plant-derived promoter. For example, a promoter capable of inducing green tissue-specific expression can be used. Such promoters are known in the art, for example, Asagao-derived chlorophyll biosynthesis-related gene promoter (PnZIPp), Arabidopsis chlorophyll a / b binding protein gene promoter (AtCAB3p), Arabidopsis chlorophyll-degrading enzyme gene promoter (AtCLH1p) An Arabidopsis thaliana photosystem II oxygen evolution complex protein gene promoter (AtOEC33p), an Arabidopsis thaliana plastocyanin gene promoter (AtPC2p), and the like can be preferably used.

  It is widely known that in tobacco, the RNAi structure that suppresses the expression of phytoene desaturase can be systemically overexpressed and whitened by induction of a cauliflower mosaic virus (CaMV) 35S promoter or the like (for example, Tao Wang et al., New Phytologist (2005) 167: 751-760). However, there is no known example in which a plant is whitened using a green tissue-specific promoter or the like to induce death.

Second vector The method of the present invention comprises, together with the first vector, a second vector containing a second polynucleotide that induces methylation of the promoter capable of inducing green tissue-specific expression in a plant. It is characterized by being introduced. It is assumed that the first vector and the second vector are integrated into different genomic regions (FIG. 2B).

  Examples of the second polynucleotide include, but are not limited to, those containing a sequence complementary to the base sequence of the above-mentioned promoter and thereby inducing the methylation of the promoter. Control of gene expression by base methylation is also called epigenome editing, and it has been reported that gene expression can be controlled in plants by methylating bases in the promoter region of a foreign or endogenous gene (D. Miki et al., Plant and Cell Physiology, Vol. 45, Issue 4, 15 April 2004, 490-495; and S. Bai et al., Journal of Experimental Botany, 1-10, 2011).

  In the method of the present invention, for example, when the promoter for expression of the first polynucleotide is a morning glory-derived chlorophyll biosynthesis-related gene promoter (PnZIPp), the second polynucleotide is a sequence complementary to a partial sequence of PnZIPp. And a polynucleotide that expresses siRNA containing Therefore, the second polynucleotide includes, but is not limited to, a sequence complementary to a part of the base sequence of PnZIPp, and a reverse sequence complementary to this sequence, and a hairpin after expression. It may be a DNA sequence that encodes an RNAi structure to form.

  The siRNA expressed from the second polynucleotide (sometimes referred to as the second siRNA herein) has a sequence complementary to a part of the base sequence of the promoter for expression of the first polynucleotide. And can induce promoter methylation. The present inventors have found that a promoter capable of inducing the expression of a first polynucleotide in a first vector is methylated by RNAi to the promoter, and as a result, in a plant into which the first and second vectors have been introduced, It was confirmed that the transcription of the first polynucleotide was suppressed. In such a plant, whitening, which is a lethal trait, is suppressed, and the plant can grow normally.

  The present inventors have further found that in a progeny of a plant into which the first and second vectors have been introduced, the first polynucleotide is transcribed in a plant containing only the first vector due to genetic separation by mating. It was also confirmed that a lethal trait (whitening) occurred and died. In such plants, promoter demethylation that induces expression of the first polynucleotide has occurred.

  That is, the promoter for expression of the first polynucleotide can be methylated in the presence of the second siRNA and demethylated in the absence of the second siRNA.

  Methylation is a phenomenon in which C (cytosine) is methylated when CG or CNG (N is all bases) is present in the genome base sequence. The methylation of the above promoter can be confirmed, for example, by methylation-sensitive restriction enzyme analysis or bisulfite sequence analysis.

  Methylation-sensitive restriction enzymes do not cleave if the recognition site for the cleavage is methylated, so that the presence or absence of methylation can be easily known from the presence or absence of the cleavage. As such a methylation-sensitive restriction enzyme, those used in the art can be appropriately used, and are not particularly limited. For example, MaeII can be suitably used.

  By performing bisulfite treatment of genomic DNA, unmethylated cytosine (unmethylated cytosine) is converted to U (uracil), and methylated cytosine (methylated cytosine) is not converted. Therefore, since unmethylated DNA and methylated DNA after bisulfite treatment have different nucleotide sequences, the presence and location of methylated cytosine are determined by performing PCR amplification and sequence analysis on the nucleotide sequences obtained from each sample. Information can be obtained.

  The second polynucleotide can be included in a second vector together with a promoter capable of inducing its expression. The promoter used to induce the expression of the second polynucleotide is not particularly limited, but is preferably a systemically expressed promoter, for example, a polyubiquitin gene promoter, a cauliflower mosaic virus (CaMV) 35S promoter, an Arabidopsis thaliana Derived AtU6-26 promoter, Agrobacterium tumefaciens T-DNA derived nopaline synthase gene (NOS) promoter, and the like. For example, a polyubiquitin gene promoter (LjUbip) derived from Lotus japonicus can be suitably used. Expression of the second polynucleotide induces RNAi for a promoter that drives expression of the first polynucleotide.

Introduction of Vector into Plant The first vector and the second vector can be introduced into a plant simultaneously or separately.

  The introduction of the vector into the plant may be performed by any of the techniques commonly used in the art, and for example, an Agrobacterium method, a particle gun method, an electroporation method and the like can be suitably used. As a plant used for introducing the vector, a plant body, a plant organ, a plant tissue piece may be used, or callus or protoplast may be prepared and used.

  Plants into which the vector has been introduced can be selected, for example, by using the presence or absence of the expression of the selectable marker gene incorporated into the vector. The selection marker gene is not particularly limited, but for example, an antibiotic resistance gene commonly used in the art can be suitably used. In this case, it is preferable that different antibiotic resistance genes are incorporated into the first vector and the second vector so that the introduction of each vector can be distinguished. Examples of the antibiotic resistance gene that can be suitably used include, but are not limited to, a kanamycin resistance gene, a neomycin resistance gene, an ampicillin resistance gene, a hygromycin resistance gene, and the like.

  Introduction of a vector into a plant can also be confirmed by PCR, Southern hybridization, Northern hybridization, Western blotting, or the like.

  In the first and second vectors, an enhancer, an insulator, a terminator, a polyA sequence, and the like can be appropriately incorporated in addition to the above-described polynucleotide, promoter, and selection marker gene.

  The above-described configurations and features of the present invention are similarly related to further aspects of the present invention described below, and therefore, unless otherwise described in the further aspects, the configurations described in the first aspect And features.

As a second aspect of the method for producing a transformed plant in which whitening is controlled , the present invention provides a first vector that expresses a polynucleotide that suppresses the expression of a carotenoid biosynthesis gene, and controls the expression of the polynucleotide. The present invention relates to a method for producing a transformed plant with controlled whitening, which comprises introducing a second vector that induces promoter methylation into a plant.

  As described above, an object of the present invention is to prevent unintended spread of a trait integrated in a transformed plant, and to induce death of a plant by whitening by introducing a first vector. In addition to the introduction of the second vector, the induction of death can be controlled.

  In addition to the first vector and the second vector, a gene encoding a target protein can be introduced into the transformed plant. The gene encoding the target protein is not particularly limited, but for example, a trait not originally possessed by a plant, for example, a specific color or shape of a plant part such as a flower or a leaf, or an environmental change such as high temperature, humidity, and drying. It may be a gene for imparting resistance to the plant to the plant or a gene for synthesizing a drug such as an antibody drug. The method for introducing the gene encoding the protein of interest may be any of those commonly used in the art, for example, preferably using Agrobacterium method, particle gun method, electroporation method and the like. Can be.

  The first vector and the second vector can be introduced into a plant simultaneously or separately. Further, the gene encoding the target protein may be introduced before the first and second vectors, or may be introduced after the first and second vectors.

As a third aspect, the present invention provides a method for controlling whitening in a transformed plant, which comprises inducing plant whitening by suppressing the expression of a carotenoid biosynthesis gene. And
Suppression of carotenoid biosynthesis gene expression is suppression by a first siRNA expressed under the control of a promoter and having a sequence complementary to a part of the base sequence of the carotenoid biosynthesis gene,
The promoter is methylated in the presence of a second siRNA having a sequence complementary to a part of the base sequence of the promoter, and demethylated in the absence of the second siRNA;
The above method is provided.

As a fourth aspect of the method for preventing the spread of a transformed plant , the present invention provides a first polynucleotide comprising a first polynucleotide that suppresses the expression of a carotenoid biosynthesis gene, and a promoter that controls the expression of the first polynucleotide. A vector and a second vector containing a second polynucleotide that induces methylation of the promoter are introduced into a plant to produce a transformed plant in which whitening is controlled,
Culturing the transformed plant to select a progeny plant in which the expression of the first polynucleotide is controlled and does not contain the second polynucleotide, wherein the progeny plant is inbred after selfing or mating. Or a method for preventing the spread of a transformed plant, characterized by whitening by demethylation of the promoter by cultivation by vegetative propagation.

  In this embodiment, the step of producing a transformed plant is as described above.

  Since the transformed plant in which whitening is controlled has a green tissue and grows normally, the cultivation may be performed using a normal plant cultivation method. Since the transformed plant may be one into which a gene encoding a target protein has been introduced in addition to the first vector and the second vector, the target protein is produced by cultivation. For example, a transformed plant may have traits that the plant does not naturally have. Alternatively, the cultivation of the transformed plant may allow the synthesis of pharmaceuticals such as antibody pharmaceuticals.

  After the desired cultivation of the transformed plant is completed, it is necessary to prevent the spread of the trait. Therefore, in this embodiment, in order to prevent the transformed plant from proliferating more than necessary, the progeny plant in which the expression of the first polynucleotide is controlled and which does not contain the second polynucleotide is selected and cultivated. Can be used for As described above, the first vector containing the first polynucleotide and the second vector containing the second polynucleotide are introduced into a plant as separate vectors, and when incorporated into different genomic regions, is assumed. Therefore, in progeny plants, plants in which both vectors are integrated, plants in which only one of the vectors is integrated, and plants in which neither vector is included may be mixed.

  From the population of such progeny plants, in order to select a progeny plant in which the expression of the first polynucleotide is controlled and does not contain the second polynucleotide, it is necessary that the plant is not whitened; It can be used as an indicator that the promoter for inducing the expression of the polynucleotide is methylated and / or that the second polynucleotide is not contained in the plant.

  The presence or absence of whitening of a plant can be easily determined by visual inspection of the plant, and methylation of the promoter can be confirmed by methylation-sensitive restriction enzyme analysis or bisulfite sequence analysis as described above. The presence or absence of the second polynucleotide can be confirmed by, for example, a PCR method, a Southern hybridization method, a Northern hybridization method, a Western blotting method, or the like.

  The methylation of the promoter subsequently causes demethylation, and the suppression of expression of the first polynucleotide is released. As a result, the post-transcriptional expression of the carotenoid biosynthesis gene endogenous in the plant is suppressed, and the plant becomes white and dies.

Plant The present invention is also a transformed plant in which whitening of green tissue is controlled, wherein a polynucleotide that suppresses the expression of a carotenoid biosynthesis gene has been introduced together with a plant-derived promoter that controls the expression of the polynucleotide. And the above plant.

  The plant of the present invention can be produced by the method of the present invention described above. That is, a polynucleotide that suppresses the expression of a carotenoid biosynthesis gene and a plant-derived promoter that controls the expression of the polynucleotide can be introduced into a plant using the above-described first vector.

  The plant-derived promoter is preferably a promoter that induces expression in a green tissue-specific manner, and more preferably, a PnZIP promoter can be used.

  In the plant into which the first vector has been introduced, the gene expression of an endogenous carotenoid biosynthesis gene is suppressed via mRNA degradation by the first polynucleotide. Therefore, in plants into which only the first vector has been introduced, chlorophyll cannot be biosynthesized, so that the plant becomes white and as a result dies (FIG. 2A).

  On the other hand, when the promoter in the first vector is methylated, the polynucleotide induced by the promoter is not expressed, and the endogenous carotenoid biosynthesis gene of the plant is normally expressed. After biosynthesis, the plant is in a state capable of normal growth. As described above, the methylation of the promoter can be achieved by introducing a polynucleotide (silencer) encoding RNA having a sequence complementary to the sequence of the promoter into a plant as a second vector. (FIG. 2B).

  If the introduction of both the first and second vectors does not induce the suppression of the lethal trait due to the methylation of the target, the adventitious buds undergoing regeneration may become white. On the other hand, green regenerated individuals into which both vectors have been introduced are highly likely to have the lethal trait suppressed by target methylation (FIG. 3B). These lines are self-bred or crossed with a non-transformant, and using a genetic separation to remove the silencer and introduce only the target, a green-growing normally progeny (T1 generation: methylation of PnZIPp Can be selected) (FIGS. 2C and 3C).

  Individuals who have only methylated targets and have green leaves are expected to ensure that endogenous carotenoid biosynthesis (NtPDS gene in Examples) is functioning normally (suppression of lethal trait expression) Therefore, such individuals are selected. If necessary, the expression of the endogenous carotenoid biosynthesis gene can be confirmed by a commonly used technique such as, for example, PCR or Western blotting.

  During the cultivation period as a GM crop, in order to enable normal growth, it is necessary to suppress the expression of the first polynucleotide by methylation of the promoter to realize normal growth, flowering and fruiting of the crop. Yes (Figure 1, center). For the GM crops actually cultivated, use is made of the individual shown in FIG. 2C which has only the methylated target gene (suppression of the expression of the lethal trait) in a homozygous state. By cultivating a genetically homozygous individual, lethal traits are inherited to progeny even when self-propagated progeny of GM crops and hybrid seeds with non-GM varieties and closely related wild species are formed. (FIG. 1) As a result, in all progeny, lethal trait (whitening) can be activated.

  In the self-propagated progeny of GM crops and in pollen and seeds that have spread, the demethylation phenomenon of the methylated region causes the release of the “suppression of the expression of lethal traits”, which leads to spontaneous death (whitening). (FIG. 1, right-left, 2D and 3D).

  When a plant-derived high-expression CaMV35S promoter derived from a virus not originally retained by a plant is introduced as a foreign gene and its promoter region is targeted for DNA methylation, the demethylation phenomenon from the methylated state occurs even after several generations. It has been reported to be maintained in Arabidopsis and rice (D. Miki et al., Plant and Cell Physiology, Vol. 45, Issue 4, 15 April 2004, 490-495; and S. Bai et al., Journal of Experimental Botany, 1-10, 2011). Therefore, when lethal traits are controlled by the CaMV35S promoter or the like and `` expression suppression of lethal traits '' is performed by methylation, `` release '' of `` suppression of expression of lethal traits '' is subsequently induced by demethylation. Hateful. As a result, GM crops will spread without dying for several generations.

  On the other hand, the plant-derived promoter used in the present invention has a feature that demethylation is easily induced in a next-generation plant after selfing or crossing. Also, in vegetative propagation (clonal propagation) where the generation is not advanced, demethylation gradually progresses and whitening of leaves is induced (FIG. 3E).

  The plant of the present invention can further be introduced with a gene encoding a target protein. The gene encoding the target protein is not particularly limited, but for example, a trait not originally possessed by a plant, for example, a specific color or shape of a plant part such as a flower or a leaf, or an environmental change such as high temperature, humidity, and drying. It may be a gene for imparting resistance to the plant to the plant or a gene for synthesizing a drug such as an antibody drug. The gene encoding the target protein may be any gene that is currently used or may be used in the future, and can be appropriately selected as long as the above-described features of the present invention are not impaired.

The present invention further provides a polynucleotide for suppressing the expression of a carotenoid biosynthesis gene, for producing the plant of the present invention as described above, or for use in the method of the present invention, and the polynucleotide. And a promoter that controls the expression of E. coli. This vector corresponds to the "first vector" described herein.

  The present invention further provides a vector for producing the above-mentioned plant of the present invention or for use in the above-mentioned method of the present invention, which comprises a polynucleotide that induces methylation of the above-mentioned promoter. This vector corresponds to the "second vector" described herein.

[Example 1: Induction of whitening and death of tobacco by first vector]
A carotenoid biosynthesis gene (phytoene desaturase; NtPDS, XM_016642616 (SEQ ID NO: 1)) of tobacco (Nicotiana tabacum, cv. SR-1) is targeted as a target and an inverted repeat sequence of its partial sequence (RNAi structure (SEQ ID NO: 2)) was incorporated into a vector pRI910 (TaKaRa) together with a chlorophyll biosynthesis-related gene promoter (PnZIPp, SEQ ID NO: 3) derived from morning glory, which induces expression in a green tissue-specific manner, and a kanamycin resistance gene as a selectable marker gene. A first vector expressing RNAi under control was created.

  Here, the nucleotide sequence at positions 1 to 217 and 874 to 1090 of SEQ ID NO: 2 is a sequence corresponding to the nucleotide sequence of nucleotides 925 to 1141 at 217 in SEQ ID NO: 1, and the nucleotide sequence at positions 218 to 873 in SEQ ID NO: 2. Is a linker sequence derived from the β-glucuronidase (GUS) gene.

  Leaf pieces of about 5 mm square were prepared from the plantlets obtained after aseptic sowing of tobacco, and the vector prepared above was inoculated by an Agrobacterium method according to a conventional method to induce adventitious buds.

  Tobacco transfected with the RNAi vector was selected using kanamycin resistance as an index. As a result of culturing tobacco in which the vector was confirmed, expression of phytoene desaturase, one of the endogenous carotenoid biosynthesis genes, was suppressed after transcription (Post Transcriptional Gene Silencing, PTGS) and turned white. Adventitious shoots were obtained. These adventitious buds rooted upon transplantation into the rooting medium and grew to some extent under sterile conditions including the medium (FIG. 3A). However, such white individuals died in 1-2 weeks when transplanted into pots containing soil (FIGS. 2A and 3A).

[Example 2: suppression of whitening and withering 1]
Using the PnZIPp region (SEQ ID NO: 3), which was proven to control leaf whitening (lethal trait) in Example 1, as a target (target), an RNAi structure (SEQ ID NO: 4) of the partial sequence was prepared ( silencer).

  Here, the 800-803th, 1236-1239th, and 1310-1313th base sequences (ACGT) of SEQ ID NO: 3 are the recognition sequences of the methylation-sensitive restriction enzyme MaeII described below. In addition, the 1 to 350th and 1005 to 1354th nucleotide sequences of SEQ ID NO: 4 are sequences corresponding to the 1209 to 1558th 350 nucleotide base sequence of SEQ ID NO: 3, and the 351 to 1004th nucleotide sequences of SEQ ID NO: 4 The base sequence is a linker sequence derived from the GUS gene.

  The obtained sequence of the RNAi structure was incorporated downstream of the polyubiquitin gene promoter derived from Lotus japonicus (LjUbip, AP009383, SEQ ID NO: 5) to prepare a second vector incorporating a hygromycin resistance gene as a selectable marker gene.

  The first vector prepared in Example 1 and the above second vector were simultaneously inoculated into tobacco by the Agrobacterium method. An individual showing resistance to both kanamycin and hygromycin was selected as a transformant into which both vectors had been introduced, and cultured. As a result, tobacco into which both vectors were introduced grew normally without whitening.

[Example 3: suppression of whitening and withering 2]
The first and second vectors prepared in Examples 1 and 2 were inoculated to tobacco in two steps by the Agrobacterium method.

  First, about 5 mm square leaf pieces were prepared from the plantlets obtained after aseptic sowing. Using the leaf pieces, inoculation of the first vector, induction and selection of adventitious buds were performed by the Agrobacterium method according to a conventional method, and a whitened individual having a lethal trait (including a target) was produced. This individual can be maintained as a sterile individual on a medium. Next, a second vector was further introduced into the whitened individual.

  FIG. 3B shows adventitious buds formed from leaf pieces of a whitened individual after the first and second vectors were introduced in two stages. Even when both vectors were introduced, adventitious buds in the course of regeneration were whitened and green. It was shown that the lethal trait expressed by the first vector was suppressed in green regenerated individuals.

[Example 4: Confirmation of DNA methylation of PnZIP promoter region 1]
In individuals into which the first and second vectors have been introduced, it is considered that the second vector induces methylation of the target sequence of PnZIPp, thereby suppressing the expression of a lethal trait.

  Therefore, the methylation status of the target region (the nucleotide sequence of the 350 nucleotides at positions 1209 to 1558 in SEQ ID NO: 3) in the individuals obtained in Examples 1 to 3 was confirmed by methylation-sensitive restriction enzyme and PCR analysis. .

  MaeII, a methylation sensitive restriction enzyme, is not cleaved when the recognition sequence is methylated. In individuals (TS-1 and TS-2 strains) into which the first and second vectors have been introduced and whitening has not occurred, the MaeII recognition sequence ACGT (800 to 803, 1236 to 1239, 1310 131313), the genomic DNA is not cleaved with or without MaeII enzyme treatment. On the other hand, in the individual (T-1 line) into which only the first vector was introduced and whitening was induced, the recognition sequence was not methylated, so that the genomic DNA was cut by the MaeII enzyme treatment.

  Therefore, a methylation target sequence (700 bp) containing the MaeII recognition sequence in SEQ ID NO: 3 was designed upstream of the target region of the PnZIP promoter and at the beginning of the linker sequence derived from the GUS gene (primer U: TCCAGATTCTACCCAAGTTAAAGA (SEQ ID NO: 6). ) And primer L: PCR amplified using ACGCAAGTCCGCATCTTCATG (SEQ ID NO: 7)), a band was detected at 700 bp in the TS-1 and TS-2 strains regardless of the presence or absence of MaeII enzyme treatment (PnZIP promoter) 450 bp + reverse sequence of NtPDS 250 bp). On the other hand, in the T-1 strain, no band was detected when the MaeII enzyme treatment was performed (FIG. 4). From this result, it was confirmed that the target sequence was methylated in all the lines in which the color of the leaves changed (whitened).

[Example 5: Confirmation 2 of DNA methylation of PnZIP promoter region]
The methylation status of the target region (the nucleotide sequence of 350 nucleotides at positions 1209 to 1558 in SEQ ID NO: 3) in the individual obtained in Example 3 was confirmed by bisulfite sequence analysis.

  The following shows a sequence (SEQ ID NO: 8) containing 350 bases targeted for methylation in the PnZIP promoter region. ACGT surrounded by □ indicates the recognition sequence of MaeII used in Example 4, and the underlined portion indicates a nucleotide sequence containing cytosine which is highly likely to be methylated.

3 'end of 35 bases (G CG G CAG G CG GAAA CTG GCACCCTTAAG CG TGAGA, SEQ ID NO: 9) in the above sequence will be described the results obtained by analyzing in the method below. In the following description, “mC” means methylated cytosine, and “C” means unmethylated cytosine.

  When the underlined cytosine in the sequence to be analyzed is methylated, the methylated cytosine is not changed by bisulfite treatment, and the unmethylated cytosine is converted to uracil (SEQ ID NO: 10). Therefore, when the sequence after bisulfite treatment is subjected to PCR amplification, the base at the position corresponding to uracil in the amplification product is thymine (sequence 11).

  On the other hand, when cytosine in the sequence to be analyzed is not methylated, all of the cytosine is converted to uracil by bisulfite treatment (SEQ ID NO: 12), and when this sequence is PCR-amplified, it becomes uracil in the amplification product. The base at the corresponding position is thymine (13 in sequence).

  According to the above procedure, the target sequence (PnZIPp) of the individual (TS-1 and TS-2 strains) into which the first and second vectors have been introduced and the individual (T-1 strain) into which only the first vector has been introduced are obtained. The nucleotide sequence of 350 nucleotides at positions 1209 to 1558 of SEQ ID NO: 3) was subjected to bisulfite sequence analysis.

  As a result of analyzing the PCR products of 25 clones for each strain, 93.3% of the 26 cytosines likely to be methylated were methylated in the TS-1 strain and 95.2% in the TS-2 strain. In contrast, only 2.4% of the T-1 strain was methylated (average value of each 25 clones). In addition, regions other than the target sequence of PnZIPp were hardly methylated.

  From these results, it was confirmed that the target sequence was methylated in all the lines in which the leaf color changed (whitened).

[Example 6: Cultivation of individual in which expression of lethal trait is suppressed]
Since the whitening induction obtained in Example 3 is suppressed and the individual having green leaves is expected to have a normal function of the endogenous NtPDS gene (suppression of the expression of lethal trait), Such individuals (T0 generation) were selected.

  Then, selfing or crossing with a non-transformant is carried out, the silencer is removed by using genetic separation, and only the target is introduced, and a normally growing green progeny (T1 generation: methylation of PnZIPp) Was continued) (FIGS. 2C and 3C).

  Specifically, the seeds obtained after the crossing were aseptically sowed and germinated, and then DNA was extracted from a green individual expected to maintain target methylation. PCR analysis was performed on the DNA for a silencer or target-specific sequence. An individual in which only the target-specific band was detected was selected as an individual from which the silencer was removed and PnZIPp methylation was maintained.

  By using the individual of FIG. 2C which has only the methylated target gene (suppression of the expression of the lethal trait) in a homozygous state, the "suppression of the expression of the lethal trait" is continued by the methylation during the cultivation period. The crop was able to grow, flower and bear fruit normally (Fig. 1, center). By cultivating individuals that are genetically homozygous, lethal traits are inherited to progeny even when self-propagated progeny of GM crops and hybrid seeds with non-GM varieties and closely related wild species are formed (Fig. 1).

[Example 7: Demethylation of PnZIP promoter region]
In the progeny of self-propagated GM crops and in pollen and seeds that have spread, the demethylation of the methylated region causes the release of `` suppression of the expression of lethal traits '', causing spontaneous death (whitening of leaves). Induced (FIG. 1, right-left, FIGS. 2D, 3D). In addition, in vegetative propagation (clonal propagation) in which generations did not proceed, demethylation gradually progressed, and whitening of leaves was induced (FIG. 3E).

  INDUSTRIAL APPLICABILITY The present invention can be applied to the prevention of unauthorized growth of varieties as well as transgenic plants, and can be developed to protect varieties of crops. In addition, transgenic plants and weeds to be controlled can be transfected using this technology, and those GM plants can be cultivated in the target area or sprayed with pollen only to gradually develop the lethal trait without labor. It is thought that it can be spread, and as a result, only the target plant can be efficiently and reliably controlled. Furthermore, when a hybrid between an exotic species and an endemic species is formed, only the exotic species and the hybrid can be controlled (the exogenous gene is dominantly inherited).

  In recent years, development of genome editing technology has been actively promoted, and endogenous carotenoid biosynthesis genes of plants can be destroyed as target genes. However, since genome editing does not repair a target gene once destroyed, a series of systems such as introduction of lethal traits, suppression of expression of lethal traits, and re-expression of Construction is difficult with technology alone.

  The present invention can provide a series of systems combining PTGS (post-transcriptional gene silencing) and TGS (transcriptional repression gene silencing) using an RNAi structure, and methylation and demethylation.

Claims (15)

  A first vector containing a first polynucleotide and a plant-derived promoter for expression of the polynucleotide, and a second vector containing a second polynucleotide that induces methylation of the promoter are introduced into a plant. A method for transforming a plant, comprising:   The method according to claim 1, wherein the first vector and the second vector are introduced simultaneously or separately.   The method according to claim 1 or 2, wherein the first polynucleotide is a polynucleotide that suppresses expression of a carotenoid biosynthesis gene.   The method according to any one of claims 1 to 3, wherein the second polynucleotide comprises a sequence complementary to the base sequence of the promoter, and induces methylation of the promoter.   The method comprises introducing into a plant a first vector that expresses a polynucleotide that suppresses the expression of a carotenoid biosynthesis gene and a second vector that induces methylation of a plant-derived promoter that controls the expression of the polynucleotide. And a method for producing a transformed plant in which whitening is controlled. A method for controlling whitening in a transformed plant, comprising inducing plant whitening by suppressing the expression of a carotenoid biosynthetic gene,
The suppression of the expression of the carotenoid biosynthesis gene is suppressed by a first siRNA expressed under the control of a plant-derived promoter and having a sequence complementary to a part of the base sequence of the carotenoid biosynthesis gene,
The promoter is methylated in the presence of a second siRNA having a sequence complementary to a part of the base sequence of the promoter, and demethylated in the absence of the second siRNA;
The above method. A first vector comprising a first polynucleotide that suppresses the expression of a carotenoid biosynthesis gene, a plant-derived promoter that controls the expression of the first polynucleotide, and a second vector that induces methylation of the promoter. Introducing a second vector containing a polynucleotide into a plant to produce a transformed plant in which whitening is controlled,
Culturing the transformed plant to select a progeny plant in which the expression of the first polynucleotide is controlled and does not contain the second polynucleotide, wherein the progeny plant is inbred after selfing or mating. Or a method for preventing the spread of a transformed plant, which comprises whitening by demethylation of the promoter by cultivation by vegetative propagation.   A transformed plant in which whitening of green tissue is controlled, wherein the polynucleotide that suppresses the expression of a carotenoid biosynthesis gene is introduced together with a plant-derived promoter that controls expression of the polynucleotide.   The plant according to claim 8, wherein the plant-derived promoter is a promoter that induces expression in a green tissue-specific manner.   The plant according to claim 8 or 9, wherein the plant-derived promoter is methylated.   The plant according to any one of claims 8 to 10, further comprising a polynucleotide encoding an RNA having a sequence complementary to the sequence of the plant-derived promoter.   The plant according to any one of claims 8 to 11, further comprising a gene encoding a protein of interest.   The plant according to any one of claims 8 to 12, which is seed-propagating or vegetative-propagating.   Suppresses the expression of a carotenoid biosynthesis gene for use in the method according to any one of claims 1 to 7, or for producing the plant according to any one of claims 8 to 13. A vector comprising a polynucleotide and a plant-derived promoter that controls the expression of the polynucleotide.   A polymorphism that induces methylation of the promoter for use in the method according to any one of claims 1 to 7 or for producing a plant according to any one of claims 11 to 13. Vectors containing nucleotides.

Images