JP7116589B2 - Composition for promoting Discoidin Domain Receptor2 (DDR2) production - Google Patents

Description

The present invention relates to a composition for promoting DDR2 production in living organisms.

About 30% of the total protein in the body is said to be collagen, and collagen is considered to be an important constituent of the extracellular matrix. Collagen serves as a physical scaffold for cell adhesion, and also acts as a signal transducing substance that conveys information to cells, and is involved in various events such as cell proliferation and differentiation.
A receptor membrane protein that recognizes collagen exists on the cell membrane. Representative receptors include Integrin, Discoidin Domain Receptor (hereinafter referred to as “DDR”), glycoprotein IV, and leukocyte-associated immunoglobulin-like receptor-1 (Non-Patent Document 1).

Among these receptors, DDR has attracted attention in recent years. DDR is a collagen receptor protein belonging to the receptor tyrosine kinase family (Non-Patent Document 2). DDR has two isoforms, DDR1 and DDR2, which are expressed specifically in epithelial cells and mesenchymal cells, respectively. Non-Patent Document 3 describes that DDR2 is involved in the expression of collagen and MMP (matrix metalloproteinase) and plays an important role in skin wound healing. US Pat. No. 6,200,003 proposes compounds for use in treating proliferative disorders mediated by the kinase activity of DDR2.

DDR2 is also known to be stimulated by a collagen molecule having a triple helix structure to transmit a phosphorylation signal. Since DDR2 recognizes and binds to damaged cartilage tissue and is more activated, it has been suggested that DDR2 functions as a mechanosensor that transmits mechanical stress into cells (Non-Patent Document 4). .
As such, DDR2 is considered to play an important role in repairing tissue damage. DDR2 in dermal fibroblasts is considered to play an important role in recognizing damaged dermal collagen and repairing/regenerating damaged parts. However, no substance or composition is known that maintains or increases the expression level of DDR2 in dermal fibroblasts.

Japanese Patent Publication No. 2013-508393

Leitinger, B. (2011) Transmembrane collagen receptors. Annual Rev. Cell Develop. Biol., 27, 2.1-2.26. Leitinger, B. (2014) Discoidin domain receptor functions in physiological and pathological conditions. Int. Rev. Cell Mol. Biol., 310, 39-87. Olaso, E. at al. (2011) Impaired dermal wound healing in discoidin domain receptor 2-deficient mice associated with defective extracellular matrix remodeling. Fibrosis Tissue Repair, 4, 5-14. Majkowska, I. et al. (2017) Discoidin domain receptor 2 mediates Collagen-induced activation of membrane-type 1 matrix metalloproteinase in human fibroblasts. J. Biol. Chem., 292, 16, 6633-6643.

The present inventors have searched for a large number of natural substances, found a substance that promotes the production of DDR2, and completed the present invention.
An object of the present invention is to provide a composition that promotes DDR2 production in living organisms.

(1) A composition for promoting DDR2 production containing an evening primrose seed extract or a Kudamono passionflower fruit extract as an active ingredient.
(2) The composition according to (1), which contains 0.00005% by mass to 0.05% by mass of evening primrose seed extract.
(3) The composition according to (1), which contains 0.001% by mass to 0.05% by mass of Passionflower fruit extract.
(4) The composition according to any one of (1) to (3), which is in the form of external application applied to the skin.

The present invention provides compositions that promote DDR2 production.

FIG. 10 is a graph showing test results confirming an increase in DDR2 mRNA by collagen irradiated with ultraviolet rays. FIG. In the figure, "Coll-" means no collagen treatment, and "UVA Coll+" means UV-irradiated collagen. 4 is a graph showing the results of a test confirming the effect of an evening primrose seed extract (Luna White B) on human fibroblasts to promote DDR2 production. Fig. 10 is a graph showing the results of a test confirming the effect of promoting DDR2 production on human fibroblasts by Kudamono Passiflora fruit extract (Cure Passion).

TECHNICAL FIELD The present invention relates to a composition for promoting DDR2 production containing evening primrose seed extract or kudamonopassiflora fruit extract as an active ingredient.
The evening primrose seed extract and Kudamono Passiflora fruit extract, which are the active ingredients of the present invention, will be described.

Evening primrose seed extract is an extract extracted from the seeds of the evening primrose (Oenothera biennis), otherwise known as evening primrose. The evening primrose seed extract is obtained by extracting evening primrose seeds with a suitable solvent. Extraction can be carried out by immersing the seeds in a solvent at low temperature or high temperature for a predetermined period of time. Specifically, it can be extracted by adopting the method disclosed in Japanese Patent Application Laid-Open No. 2004-137233.
The extraction solvent is not particularly limited, but for example, water; lower monohydric alcohols such as methyl alcohol and ethyl alcohol; liquid polyhydric alcohols such as glycerin, propylene glycol and 1,3-butylene glycol; ketones such as acetone; One or more of ethers such as ether and esters such as ethyl acetate can be used.

The evening primrose seed extract can be used as it is or after being left for a certain period of time to mature. If necessary, purification treatment such as deodorization and decolorization may be performed by filtration or ion-exchange resin to the extent that the effect of the present invention is not affected. Furthermore, a fraction with high activity can be extracted and used by separation means such as liquid chromatography.

As an example of a preferred method for extracting the seed extract of evening primrose, water-containing ethyl alcohol, 1,3-butylene glycol or acetone at a concentration of 0 to 100 vol% is used, and extraction is performed at room temperature or with heating for 1 to 5 days. After that, it is filtered, and the obtained filtrate is allowed to stand for about one week to mature, and then filtered again. However, the extraction method is not limited to this.

The composition of the present invention is not particularly limited in form as long as it is an external preparation containing the evening primrose seed extract as an active ingredient. It can be used in any form such as liquid, paste or gel. Alternatively, a liquid extract can be dried to a solid state, or dried by spray drying or the like to be used as a powder.
A commercially available evening primrose seed extract may be used. As a commercially available product suitable for the present invention, "Luna White B" manufactured by Ichimaru Farcos Co., Ltd. containing 1.0% by mass of evening primrose seed extract can be exemplified. Luna White B consists of 1.0% by weight of evening primrose seed extract, 49.5% by weight of 1,3-butylene glycol and 49.5% by weight of water.

The Kudamono passionflower fruit extract used in the present invention is a plant of Passifloraceae (Passifloraceae), Passiflora genus (Passiflora): pericarp, fruit of passion fruit (Passiflora edulis Sims.), It is an extract extracted from fruits (including seeds). The Kudamono Passiflora fruit extract is obtained by extracting the Kudamono Passiflora fruit with a suitable solvent. Extraction can be carried out by immersing the seeds in a solvent at low temperature or high temperature for a predetermined period of time. Specifically, it can be extracted by adopting the method disclosed in Japanese Patent Application Laid-Open No. 2013-60404.

Extraction solvents for obtaining the Passiflora fruit extract used in the present invention include water, lower alcohols such as methanol, ethanol, propyl alcohol, isopropyl alcohol, butanol and isobutanol, or water-containing lower alcohols, propylene glycol, and 1,3-butylene. Glycol, 1,2-butylene glycol, 1,4-butylene glycol, 1,5-pentanediol, 1,2-pentanediol, 1,3-pentanediol, 1,4-pentanediol, 1,3,5- Polyhydric alcohols or hydrous polyhydric alcohols such as pentanetriol, glycerin, polyethylene glycol (molecular weight 100 to 100,000), acetone, ethyl acetate, diethyl ether, dimethyl ether, ethyl methyl ether, dioxane, acetonitrile, xylene, benzene, chloroform, Various organic solvents such as carbon chloride, phenol, toluene, acids (hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, etc.) and alkalis (sodium hydroxide, potassium hydroxide, calcium hydroxide, ammonia, etc.), and preferably one or more selected from water, ethanol and 1,3-butylene glycol.

As for the extraction method, the temperature of the solvent, the weight ratio of the solvent to the raw material, and the extraction time can be arbitrarily set for various raw materials and solvents to be used. The temperature of the solvent can be arbitrarily set in the range of -4°C to 100°C, but is preferably around 10 to 40°C from the viewpoint of the stability of the components contained in the raw materials. Also, the weight ratio of the solvent to the raw material can be arbitrarily set, for example, within the range of 4:1 to 1:100 (raw material:solvent), with a weight ratio of 1:1 to 1:20 being particularly preferred.

The Kudamono Passiflora fruit extract used in the present invention may be subjected to further purification as appropriate after solvent extraction. Refining operations include decomposition by adding acid (hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, organic acid, etc.) or alkali (sodium hydroxide, calcium hydroxide, ammonia, etc.), fermentation or metabolic conversion by microorganisms, ion exchange resin and activated carbon. , adsorption of components by diatomaceous earth, etc., fractionation using chromatography with various separation modes (ion exchange, hydrophilic adsorption, hydrophobic adsorption, size exclusion, ligand exchange, affinity, etc.), filter paper and membrane filters , filtration using an ultrafiltration membrane, etc., pressurization or pressure reduction, heating or cooling, drying, pH adjustment, deodorization, decolorization, long-term static storage, etc., can be exemplified, and these can be arbitrarily selected and combined. It is possible.
A commercially available Kudamono passiflora fruit extract may be used. As a commercially available product suitable for the present invention, “Cure Passion” containing 1.0% by mass of Kudamono passionflower fruit extract can be exemplified. Cure Passion consists of 1.0% by mass of Kudamono Passiflora fruit extract, 30.0% by mass of 1,3-butylene glycol and 69.0% by mass of water.

The composition of the present invention contains 0.00005% by mass or more of the evening primrose seed extract. It preferably contains 0.00005 to 0.05% by mass. More preferably 0.00008 to 0.03% by mass, and particularly preferably 0.00008 to 0.01% by mass.
In addition, the composition of the present invention contains 0.001% by mass or more of Kudamono passionflower fruit extract. It preferably contains 0.001 to 0.05% by mass. More preferably 0.003 to 0.03% by mass, particularly preferably 0.003 to 0.02% by mass.

The composition for promoting DDR2 production of the present invention can be used as foods, pharmaceuticals/quasi-drugs, and cosmetics.
In formulating a formulation, excipients and other active ingredients can be used as long as they do not interfere with the purpose of the composition of the present invention. Specifically, dietary fibers and thickeners such as cyclodextrin, hemicellulose, lignin, guar gum, konjac mannan, isagol, alginic acid, agar, carrageenan, chitin, carboxymethylcellulose, polydextrose, edible oil, calcium, iron, Minerals such as sodium, zinc, copper, potassium, phosphorus, magnesium, iodine, manganese, selenium; fat-soluble or water-soluble vitamins such as vitamin A, vitamin C, vitamin D, vitamin E, vitamin K, niacin, folic acid, pantothenic acid Emulsifiers and dispersants such as vitamins, glycerin fatty acid esters, sucrose fatty acid esters, sorbitan fatty acid esters, propylene glycol fatty acid esters, phospholipids, gum arabic, xanthan gum, tragacanth gum, locust bean gum, bulking agents, excipients, preservatives・Antioxidants, flavor modifiers and fragrances, flavoring agents such as sodium chloride, sodium glutamate, glycine, succinic acid, sodium lactate, acidity such as citric acid, sodium citrate, acetic acid, adipic acid, fumaric acid, and malic acid low-calorie sweeteners such as maltitol and aspartame; and coloring agents.
As shown in Test Examples, the composition of the present invention directly acts on fibroblasts and exerts a DDR2 production-enhancing effect on fibroblasts. Therefore, it is preferable to use it as an external agent such as cosmetics in view of its mechanism of action. When it is used as a cosmetic, it is preferably blended with a cosmetic for skin massage and used in combination with massage.
When it is used as food, it can be exemplified in the form of chewing gum, candy, chewable tablets, and the like.
There are no particular restrictions on the ingredients of the cosmetic, as long as it has a composition capable of exhibiting the DDR2 production-promoting action as described above. Moreover, there is no problem even if it is in various forms such as liquid, cream, and jelly. Moreover, it may be either an oil-in-water type or a water-in-oil type emulsified composition.

The present invention will be further described with reference to test examples and examples below.
<Test example: DDR2 production promotion test>
Two kinds of extracts, the evening primrose seed extract and the Kudamono Passiflora fruit extract, which were selected by the preliminary test, were confirmed to promote collagen-induced DDR2 production upon UV damage.
1. Test method (1) Test sample 1) Evening primrose seed extract: Ichimaru Farcos Co., Ltd. "Luna White B" evening primrose seed extract containing 1.0% by mass.
2) Kudamono passionflower fruit extract: A product containing 1.0% by mass of Kudamono passionflower fruit extract "Cure Passion" manufactured by Ichimaru Farcos Co., Ltd.

(2) Cells for testing Neonatal-derived normal human fibroblasts (hereinafter referred to as "NHDF", LONZA) were used.

(3) Cell culture conditions 10% (v/v) fetal bovine serum (FBS) SA (SIGMA LifeScience) and 1% (v/v) Penicillin-Streptomycin (Sigma Aldrich) containing DMEM (Dulbecco's Modified Eagle's Medium) ) medium (GIBCO) and cultured in an incubator at 37°C in the presence of 5% CO ₂ .

(4) Injury Load on Collagen by UV Rays NHDF cells were previously seeded in a 6-well plate at a density of 160,000 cells/well and cultured for 24 hours.
Then, the collagen solution (5 mg/ml collagen acidic solution I-AC, IAC-50, Koken) was diluted to 100 μg/ml using ice-cold DMEM medium containing 1% (v/v) penicillin-streptomycin. This diluted solution was placed on ice and irradiated with UVA at a dose of 7.5 J/cm ² .

(5) DDR2 production promotion test by collagen irradiated with UVA The collagen solution irradiated with UVA was diluted with ice-cold DMEM to 20 µg/ml, added to the cells, and placed in an incubator at 37°C in the presence of 5% CO ₂ . Incubated for 24 hours.
When inhibiting the phosphorylation of DDR2, the inhibitor DDR1-IN-1 (Namiki Shoji Co., Ltd.) was added to a final concentration of 5 μM.
After culturing for 24 hours, the medium was removed and washed with PBS (Phosphate Buffered Saline, Fujifilm Wako Pure Chemical Industries), and total RNA was prepared and quantified using RNeasy Mini Kit (Qiagen).
cDNA was synthesized using PrimeScript RT reagent Kit (Perfect Real Time: Takara Bio Inc.), and quantitative PCR was performed using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific).
The DDR2 primer sequences used for the measurement are as follows.
Forward primer: CCCAGCTGTCAGATGAACAGGTTA
(sequence list sequence number 1)
Reverse primer: TCAGGACAAATGGCTGGTTGAG
(sequence list sequence number 2)

(6) DDR2 production promotion test by evening primrose seed extract or Kudamono passionflower fruit extract "Luna White B" (Ichimaru Pharcos Co., Ltd.) was used as the evening primrose seed extract, and "Cure Passion" (Ichimaru Pharcos Co., Ltd.) was used as the Kudamono passionflower fruit extract. .
NHDF cells were seeded on a 6-well plate at 160,000 cells/well and cultured for 24 hours. After culturing, the medium was removed and Luna White B (Ichimaru Farcos) or Cure Passion (Ichimaru Farcos) was added.
First, Lunawhite B was diluted 200-fold with DMEM medium (without serum). This diluted solution contains 0.25 mass % butylene glycol (hereinafter "BG", Fuji Film Wako Pure Chemical Industries). 0.008, 0.016, 0.032 and 0.064% by mass Lunawhite B-containing media were prepared by serially diluting 200-fold diluted Lunawhite B with 0.25% by mass BG-containing DMEM medium.
Cure Passion was diluted 6-fold with DMEM medium (without serum). This diluted solution contains 0.5 mass % BG (Fuji Film Wako Pure Chemical). Six-fold diluted Cure Passion was serially diluted with 0.5% by mass BG-containing DMEM medium to prepare 0.417 and 1.66% by mass for use.
1, 1.5 and 2 mM Pirfenidone (hereinafter "PF", Tokyo Chemical Industry Co., Ltd.) were used as positive controls having the effect of promoting the production of DDR2 protein.

After culturing for 48 hours after sample addition treatment, the medium was removed and the cells were washed with 2 ml of PBS. Cells were dissolved in 200 μl Laemmli buffer (0.09 M Tris-HCl (pH 6.8), 3% SDS, 10.3% glycerol), collected in an Eppendorf tube, and sonicated (10 seconds treatment, 5 seconds on ice). Settling (3 times) was applied to lyse the cells.
Then, it was centrifuged at 4°C and 15,000 xg for 10 minutes. The supernatant was mixed with 4×SDS-loading buffer, heat-treated at 95° C. for 3 minutes, and subjected to SDS-PAGE to separate proteins. Proteins in the gel were electrically transferred to a PVDF membrane.
After transfer, the membrane was soaked in StartingBlock Blocking Buffer (Thermo Fisher Scientific) and blocked for about 15 minutes.
Next, the PVDF membrane was immersed in a primary antibody (Anti-DDR2, AF2538, R&D systems or Anti-βActin, Santa Cruz Biotechnology) diluted 1,000-fold with StartingBlock and allowed to react overnight at 4°C. Then, after washing four times with PBST (PBS, 0.05% Tween 20), 10,000-fold diluted secondary antibody (Rabbit anti-Goat IgG (H + L) Secondary Antibody, HRP, Polyclonal, Invitrogen Thermo Fisher Scientific or Goat anti-Mouse IgG (H+L) Cross-Adsorbed, HRP, Polyclonal, Secondary Antibody, Invitrogen, Fisher Scientific) and allowed to react at room temperature for 1 hour.
After washing with PBST four times, signals were detected with a chemiluminescence detector (LAS-4000 mini, Fuji Film) using an ECL detection kit (GE healthcare).
The signal intensity of the detected band was analyzed (Multi Gauge, Fuji Film Co., Ltd.), the relative value to the BG control was calculated, and the increase in DDR2 was evaluated.
In addition, the amount of DDR2 mRNA was measured in the same manner as described above.

2. Test Results (1) Results of DDR2 Production Promotion Test Using UVA-Exposed Collagen FIG. 1 shows the DDR2 measurement results in the DDR2 production promotion test using damaged collagen. In order to know whether the production of DDR2 is phosphorylation signal-dependent, measurement was also performed in the presence of the inhibitor DDR1-IN-1.
As shown in FIG. 1, UVA treatment increased collagen DDR2 mRNA levels by 1.3-fold compared to untreated controls. Furthermore, DDR1-IN-1 inhibitors increased DDR2 mRNA levels by 1.15-fold, respectively, compared to untreated controls. This indicates that the cells recognized damaged collagen and the DDR2 mRNA expression level increased. This effect was also suppressed by phosphorylation inhibitors.

(2) Results of DDR2 production promotion test by evening primrose seed extract or Kudamono passionflower fruit extract 1) Luna White B (evening primrose seed extract)
The results of treating NHDF cells with Lunawhite B are shown in FIG.
As shown in FIG. 2, treatment of NHDF cells with Lunawhite B increased the amount of DDR2 protein by about 1.3-1.4 times compared to the control at concentrations of 0.008-0.064% by mass. At this time, no correlation was found between the amount of DDR2 protein and the variation of mRNA. Therefore, the evening primrose seed extract was considered to act directly on the DDR2 protein production mechanism.

2) Cure Passion (Kudamono passionflower fruit extract)
FIG. 3 shows the results of treating NHDF cells with CurePassion.
As shown in FIG. 3, when NHDF cells were treated with CurePassion, DDR2 increased about 1.2-fold compared to the control at a concentration of 0.417% by mass, and about 1.11-fold at a concentration of 0.166% by mass. Increased protein content. At this time, no correlation was found between the amount of DDR2 protein and the variation in mRNA. Therefore, the Kudamono Passiflora fruit extract was considered to act directly on the DDR2 protein production mechanism.

From the above tests, it was confirmed that the evening primrose seed extract or the Kudamono Passiflora fruit extract is effective for DDR2 production.

<Manufacturing example>
A massage cosmetic was prepared according to the following formulation.
Gel cosmetics for massage (% by mass)
Glycerin 5
Ethanol 3
(Acrylates/alkyl acrylate (C10-30)) crosspolymer
0.3
PEG-80 hydrogenated castor oil 0.3
Potassium hydroxide 0.11
Evening primrose seed extract 0.0001
water residue

Water, glycerin, (acrylates/alkyl acrylate (C10-30)) crosspolymer, and PEG-80 hydrogenated castor oil are dissolved by heating. After cooling, the mixture was neutralized with potassium hydroxide, and the evening primrose seed extract and ethanol dispersed in advance were further added and mixed to obtain a gel-like massage cosmetic.

Claims (4)

A composition for promoting DDR2 production containing an evening primrose seed extract as an active ingredient (excluding uses for activating cells, improving wrinkles, and increasing the expression level of MFAP4) . DDR2 production-promoting composition containing Kudamono passionflower fruit extract as an active ingredient (however, type I collagen production promotion use, TGFβ1 activation use, wrinkle improving agent, lymphatic endothelial cell proliferation promoting agent, lymphatic vessel formation promoting agent ) . The composition according to claim 1, comprising 0.00005% to 0.05% by weight of the evening primrose seed extract. 3. The composition according to claim 2 , which contains 0.001% to 0.05% by mass of Kudamono Passiflora fruit extract.

Images