JP7008767B2 - Cold acidic protease PsAPA and its preparation method and application - Google Patents

Description

The present invention relates to the field of biotechnology, and more specifically to the low temperature acidic protease PsAPA and its preparation method and application.

The bones of livestock and poultry are rich in collagen, which is an important raw material for the preparation of functional foods. Common methods for extracting bone collagen include steps such as acid, alkali, and enzymatic methods. Of these, bone collagen is most efficiently extracted by the enzymatic method. Since bone collagen has a relatively high solubility in an acidic solution, extraction of bone collagen is usually performed under low pH conditions. An acidic protease can be added during the extraction process to promote enzymatic degradation of collagen telopeptides, reduce the degree of protein cross-linking, and increase the efficiency of bone collagen extraction. Besides, in order to prevent the collagen spiral from unraveling due to heat, the extraction of bone collagen is usually performed under low temperature conditions; the pepsin normally used in the enzymatic extraction process is a room temperature protease and bone. In the low temperature extraction process of collagen, there are problems such as low extraction rate.

One object of the present invention is to at least solve the above problems and provide at least the advantages described below.

A further object of the present invention is to provide an acidic protease PsAPA capable of increasing the extraction rate of bone collagen.

Another object of the present invention is to provide a method for preparing the acidic protease PsAPA.

Another object of the present invention is to provide an application of the acidic protease PsAPA in the extraction of bone collagen.

In order to realize these purposes and other advantages of the present invention, the amino acid sequence of the acidic protease PsAPA is as shown in SEQ ID NO: 1.

Preferably, the DNA sequence of the acidic protease PsAPA is as shown in SEQ ID NO: 2, and the cDNA sequence of the acidic protease PsAPA is as shown in SEQ ID NO: 4.

Preferably, the method for preparing the acidic protease PsAPA comprises the following steps.
S1, first Penicillium sp. The entire RNA sequence of XT7 was extracted, and reverse transcription was performed to detect Penicillium sp. Obtain the cDNA sequence of XT7. Penicillium sp. The cDNA sequence of the acidic protease PsAPA is amplified using the cDNA sequence of XT7 as a template, and then the cDNA sequence of the acidic protease PsAPA is connected to the Pikia yeast expression vector pPIC9 to obtain a recombinant expression vector pPIC9-PsAPA.
S2, recombinant expression vector pPIC9-PsAPA is transformed into host cell Pichia yeast to obtain a recombinant strain.
S3, the recombinant strain is cultured for 2 to 3 d under the condition of 30 ° C., and the recombinant strain is expressed under the induction of methanol to produce a crude enzyme solution.
Purified recombinant protease PsAPA is obtained by concentrating and purifying S4, a crude enzyme solution.

4. In step S1, Penicillium sp. Amplifying the cDNA sequence of the acidic protease PsAPA using the cDNA of XT7 as a template is specifically described in the following steps:
S1a, the specific primer PsAPA_f nucleotide sequence of the acidic protease PsAPA was designed to CGGAATTCATGGCCGCTGCCCCAA, the PsAPA_r nucleotide sequence was designed to TTGCGGCCGCCTAAGCCTCTGCTTGGCGAAGCCAAG, and the designed PsAPA_f and PsAPA
S1b, Penicillium sp. Obtained by reverse transcription. The method for preparing an acidic protease PsAPA according to claim 3, wherein the cDNA of XT7 is used as a template and PsAPA_f and PsAPA_r are used as primers for PCR amplification to obtain a cDNA sequence of the acidic protease PsAPA.

Preferably, in step S1, Penicillium sp. The conditions for amplifying the cDNA sequence of the acidic protease PsAPA using the cDNA sequence of XT7 as a template are 95 ° C. 5 min; 94 ° C. 30s, 60 ° C. 30s, 72 ° C. 2 min, 35 cycles; 72 ° C. 10 min.

Preferably, it is an application of the acidic protease PsAPA, and is an application of using the acidic protease PsAPA for extraction of bone collagen.

The present invention includes at least the following beneficial effects:
In the process of extracting bone collagen by an enzymatic method, the acidic protease PsAPA provided in the present invention can be used to increase the extraction rate of bone collagen.

Other advantages, goals and features of the present invention will be illustrated in part in the following description and will be understood by those skilled in the art through research and practice of the present invention.

FIG. 1 is a curve diagram of the relative enzyme activity of the acidic protease PsAPA described in one of the present inventions under various pH conditions. FIG. 2 is a curve diagram of the pH stability of the acidic protease PsAPA described in one of the technical proposals of the present invention. FIG. 3 is a curve diagram of the relative enzyme activity of the acidic protease PsAPA described in one of the technical proposals of the present invention under various temperatures. FIG. 4 is a curve diagram of the temperature stability of the acidic protease PsAPA described in one of the technical proposals of the present invention. FIG. 5 is a comparative diagram of the bone collagen extraction rate described in one of the technical proposals of the present invention. FIG. 6 is an SDS-PAGE analysis diagram of bone collagen extracted by an enzymatic method in one of the technical proposals of the present invention.

Note: PSC represents pepsin-extracted bovine bone collagen and ESC represents bovine bone collagen treated with the acidic protease PsAPA.

Hereinafter, the present invention will be described in more detail by combining examples. Those skilled in the art can carry out this by referring to the text of the specification.

Test materials and reagents 1. Strains and vectors: The artificial strain used for heterologous expression of protein was Pichia pastoris GS115, which was purchased from Biotechnical Bioprocess (Shanghai) Crotch Fun Co., Ltd. The Pichia yeast expression vector pPIC9 and the strain GS115 were purchased from Invitrogen.
2. Enzymes and other biochemical reagents: Endonucleases are purchased from TaKaRa, ligases are purchased from Invitrogen, and all others are domestic reagents (both can be purchased from Biochemical Agents).
3. Enzyme-producing medium: 30 g / L wheat bran, 30 g / L corn cob powder, 30 g / L soybean cake, 5 g / L barley glucan, 5 g / L (NH ₄ ) SO ₄ in 1 L of deionized water. Add ₁ g / L KH ₂ PO ₄ , 0.5 g / L silyl 4.7H ₂ O, 0.01 g / L FeSO _{4.7H 2} O, 0.2 g / L CaCl ₂ and temperature 121. Perform 20 min steam sterilization treatment at ° C and high pressure.
4. E. coli medium: 1% yeast extract, 2% peptone, 1.34% YNB, 0.000049 <Biotin, 1% glycerin (v / v).
5. BMGY medium: 1% yeast extract, 2% peptone, 1.34% YNB, 0.000049 <Biotin, 1% glycerin (v / v).
6. BMMY medium: All other components are the same as BMGY except that 0.5% methanol replaces glycerin, and the pH is 4.0.
Note: All of the methods of molecular biology experiments not specifically described in the following examples are "Molecular Cloning (A Laboratory Manual)" (3rd edition). It is performed by referring to the specific method described in Sambrook, or based on the instruction manual of the kit and the product.

Example 1. Obtaining the DNA sequence of the acidic protease PsAPA. The DNA sequence of XT7 is extracted and stored at a temperature of −20 ° C.

Cloning primers PsAPA_f and PsAPA_r were designed, and the sequences of the primers PsAPA_f and PsAPA_r are SEQ ID NO: 5 and SEQ ID NO: 6, respectively. Penicillium sp. PCR amplification was performed using the DNA sequence of XT7 as a template, and the amplification conditions were 95 ° C. 5 min; 94 ° C. 30s, 60 ° C. 30s, 72 ° C. 2 min, 35 cycles; 72 ° C. 10 min. A DNA sequence of about 1100 bp is obtained, and after collecting the DNA sequence, it is sent to Eibo Biotechnology Co., Ltd. for sequencing. The gene sequence is shown in SEQ ID NO: 2, which is the DNA sequence of the acidic protease PsAPA, and the corresponding amino acid sequence is SEQ ID NO: 1.

2. Obtain the cDNA sequence of the acidic protease PsAPA. The RNA sequence of XT7 was extracted, and further by reverse transcription, Penicillium sp. Obtain the cDNA sequence of XT7. Cloning primers PsAPA_f and PsAPA_r were designed, and the sequences of the primers PsAPA_f and PsAPA_r are SEQ ID NO: 5 and SEQ ID NO: 6, respectively. Penicillium sp. PCR amplification is performed using the cDNA sequence of XT7 as a template, the cDNA sequence is amplified, and the amplified cDNA sequence is sent to Eibo Biotechnology Co., Ltd. for sequencing. Its gene sequence is set forth in SEQ ID NO: 4, which is the cDNA sequence of the acidic protease PsAPA, and the corresponding amino acid sequence is SEQ ID NO: 1.

When the DNA sequence of the acidic protease PsAPA and the cDNA sequence information of PsAPA are analyzed, the total length of the DNA sequence of the acidic protease PsAPA is 1178 bp, and it contains one intron. The base sequence of the intron is as shown in SEQ ID NO: 3, and the total length of the cDNA sequence is 1122 bp. Since the amino acid sequence expressed by the DNA sequence is predicted by software to have no signal peptide sequence at the N-terminal, the amino acid sequence expressed by the DNA sequence of the acidic protease PsAPA and the amino acid sequence expressed by the cDNA sequence are the same. , Both are as shown in SEQ ID NO: 1. By Blast comparison, Penicillium sp. The gene encoding the protease obtained by isolation and cloning from XT7 has been proven to have relatively high novelty.

3. Preparation of recombinant strains (1) Preparation of recombinant strains Using the cDNA of the acidic protease PsAPA with accurate sequencing as a template, primers PsAPA_f and PsAPA_r having EcoRI and NotI restriction enzyme cleavage sites were designed and synthesized, respectively. The sequences of the primers PsAPA_f and PsAPA_r are SEQ ID NO: 5 and SEQ ID NO: 6, respectively, of which the underlined portion of the primer PsAPA_f sequence is the EcoRI restriction enzyme cleavage site and the underlined portion of the primer PsAPA_r sequence is the NotI restriction enzyme cleavage site. .. PCR amplification is performed using the cDNA of the acidic protease PsAPA as a template and PsAPA_f and PsAPA_r as primers, and then the PCR product is enzymatically cleaved using EcoRI and NotI to obtain the amplified cDNA sequence of the acidic protease PsAPA. The cDNA sequence of the amplified acidic protease PsAPA is connected to the Pichia yeast expression vector pPIC9 to obtain a recombinant expression vector pPIC9-PsAPA. That is, the cDNA sequence of the acidic protease PsAPA is inserted downstream of the signal peptide sequence of the above expression vector to form an accurate reading frame with the signal peptide to construct the Pikia yeast expression vector pPIC9-PsAPA, and then E. coli competence in E. coli medium. Transform into tent cell Trans1. DNA sequencing of positive transformants is performed and transformants with accurate sequencing are used to prepare large quantities of recombinant plasmids. The DNA sequence of the expression plasmid vector is linearized using the restriction endonuclease BglII, electrical transformation is performed on Pichia yeast GS115 competent cells, and the mixture is further cultured at a temperature of 30 ° C. for 2 to 3 days. Transformants grown on MD plates will be picked up for further expression experiments, but for specific operations, refer to the manual for Pichia yeast expression operations. Further, an expression vector of a cDNA sequence containing a PsAPA signal peptide sequence is constructed and transformed in the same manner.

(2) Screening for high protease active transformants Using sterilized toothpicks, a plurality of single colonies are picked up from the MD plate on which the transformants have grown, and inoculated into another MD plate according to the number. Incubate MD plates in an incubator at 30 ° C. for 1-2 days to grow to colonies. Transformants were sequentially picked up from the MD plate according to the number, inoculated correspondingly into a centrifuge tube containing 3 mL of BMGY medium, and cultured with shaking at a temperature of 30 ° C. and a rotation speed of 220 rpm for 48 hours. do. Centrifuge the bacterial solution cultured with shaking for 48 hours at 3000 × g for 15 minutes to remove the supernatant, add 1 mL of BMMY medium containing 0.5% methanol to a centrifuge tube, and add a temperature of 30 ° C. and a rotation speed of 220 rpm. Induction culture is performed under the conditions. After 48h induction culture, centrifuge at 3000 × g for 5 minutes, the supernatant is used for measuring enzyme activity, and transformants with high protease activity are screened from this, but the specific operation is Pichia yeast expression operation. See manual.

4. Preparation of recombinant protease PsAPA (1) Expression of recombinant strain pPIC9-PsAPA A transformant having a relatively high enzyme activity was screened, inoculated into 300 mL of BMGY liquid medium, and the temperature was 30 ° C. and the rotation speed was 220 rpm. Incubate with shaking for 48 hours under the conditions. After shaking culture, centrifuge at 5000 rpm for 5 min, remove the supernatant, add 100 mL of BMMY liquid medium containing 0.5% methanol to the cells, and add them to the cells under the conditions of a temperature of 30 ° C. and a rotation speed of 220 rpm for 72 hours. Perform induction culture. During the induction culture period, a methanol solution is added once every 24 hours to compensate for the loss of methanol and keep the methanol concentration around 0.5%. After the induction culture for 72 hours, the mixture is centrifuged at 12000 × g for 10 minutes, the fermentation broth of the supernatant is collected, the enzyme activity is measured, and further analyzed by SDS-PAGE protein electrophoresis.

(2) Purification of recombinant protease PsAPA The protease supernatant of the expressed recombinant strain is collected in a shaking flask, concentrated with a 10 kDa membrane, and this medium is further replaced with a low salt buffer, and then Further concentrate in a 10 kDa ultrafiltration tube. The concentrate can be diluted with a constant multiple of recombinant protease PsAPA and further purified by ion exchange chromatography to give recombinant protease PsAPA. Specifically, 2.0 mL of the recombinant protease PsAPA concentrate was applied to a HiTrapQ Sepharose XL anion column previously equilibrated with 20 mM Tris-HCl (pH 7.5), and then linear gradient elution was performed with 0.1 mol / L NaCl. conduct. The enzyme activity of the eluate collected stepwise is measured, and the protein concentration is further measured.

5. Analyzing some properties of the acidic protease PsAPA The activity of the recombinant protease PsAPA prepared in the present invention, that is, the acidic protease PsAPA, is analyzed by using the coloring method using a forinphenol reagent. The specific method is as follows. After reacting the acidic protease PsAPA in a 1 mL reaction system for 10 minutes, 1 mL of trichloroacetic acid (0.4 mol / L) is added to terminate the reaction. Of these, 1 mL of the reaction system has a pH of 3.0 and a temperature of 30 ° C., and further contains 500 μL of an appropriately diluted enzyme solution and 500 μL of the substrate. After completion of the reaction, the reaction system is centrifuged at 12000 rpm for 3 min, 500 μL of the supernatant is sucked up, and 2.5 mL of sodium carbonate (0.4 mol / L) is added. Further, 500 μL of the forinphenol reagent is added, the color is developed for 20 minutes at a temperature of 40 ° C., and after cooling, the OD value is measured under the condition of an ultraviolet wavelength of 680 nm. Protease activity unit defines the amount of enzyme required to decompose the substrate casein per minute to produce 1 μmol of tyrosine under certain conditions as 1 activity unit (U).

(1) Measurement of Optimal pH and pH Stability of Acidic Protease PsAPA The recombinant protease PsAPA purified and obtained in the present invention, that is, acidic protease PsAPA, is subjected to an enzymatic reaction under various pH conditions, and the optimum pH value thereof. To measure. The buffers used are glycine-hydrochloric acid buffer with a pH of 1.0 to 3.0, citrate-disodium hydrogen phosphate buffer with a pH of 3.0 to 8.0, and a pH of 8.0 to 10. It is a Tris-HCl buffer of 0.0. The results of the optimum pH of the purified acidic protease PsAPA measured under the condition of a temperature of 30 ° C. in various pH buffer systems are as shown in FIG. That is, under the condition of a temperature of 30 ° C., the optimum pH of the acidic protease PsAPA is 3.0, and the enzyme can maintain the enzyme activity of 70% or more in the pH range of 2.5 to 3.5. can.

The enzyme solution is treated in buffers of various pH values at 10 ° C. for 60 minutes, and then the enzyme activity is measured to study the pH stability of the enzyme. The results are as shown in FIG. 2, and the results show that the acidic protease PsAPA can maintain an enzyme activity of 90% or more between pH 3.0 and 6.0, and the enzyme is under acidic conditions. Explains that it has good pH stability.

(2) Measurement of optimum reaction temperature and thermal stability of acidic protease PsAPA The enzyme activity of the purified acidic protease PsAPA is measured at various temperatures (5 to 40 ° C.) under the condition of pH 3.0. .. As shown in FIG. 3, that is, the optimum reaction temperature of the enzyme is 30 ° C., and even at 10 ° C., the enzyme activity is still 40% or more. The purified acidic protease PsAPA is treated under the conditions of 30 ° C., 35 ° C. and 40 ° C. for various times, and then the enzyme activity is measured at 30 ° C. The results are as shown in FIG. 4, and PsAPA can completely inactivate the protein when treated for 30 minutes under the condition of 40 ° C. In summary, it can be seen that the protease has a highly efficient protein hydrolyzing activity under low temperature conditions and a relatively low heat inactivation temperature. This means that the newly invented protease has important applied value in fields such as food and medicine.

(3) Catalytic Specificity of Acidic Protease PsAPA The catalytic properties of acidic protease PsAPA are basically consistent with other proteases in the aspartic protease family, mainly hydrophobic amino acid residues or aromatic amino acid residues in substrate molecules. It cleaves the peptide bonds between them, such as Leu-Tyr, Phe-Phe, Phe-Tyr and the like. Protease activity can be specifically inhibited by Pepstatin A, which can specifically bind to the catalytic pocket of the acidic protease PsAPA but is not cleaved, thereby inhibiting the activity of the catalytic residue. ing. Therefore, such inhibitors belong to substrate-like inhibitors.

6. Application of acidic protease PsAPA in the extraction of bovine bone collagen Extraction process of bovine bone collagen:
After crushing bovine bone, 0.1 MNaOH solution (v / w) is added and stirred for 8 hours to remove non-collagen components. After that, it is washed with distilled water, drained, further 10% n-hexane is added, and the mixture is stirred for 12 hours to remove fat. After removing the fat, the solution is repeatedly washed with distilled water until it becomes neutral and then drained to obtain drained bovine bone. Using an EDTA-Na ₂ solution having a pH of 7.4 and a concentration of 0.25 M, a treatment for removing calcium salt from drained bovine bone is performed to obtain bovine bone from which calcium salt has been removed. The calcium salt-depleted bovine bone was divided into two on average, and one of the calcium salt-depleted bovine bones was mixed with a 5-fold volume (v / w) 0.5 M acetic acid solution and bovine bone. Add 1.6% times (w / w) pepsin by weight, the other is a 5 times volume (v / w) 0.5M acetic acid solution and 1.6% times the mass of bovine bone (w / w). w / w) acidic protease PsAPA is added to give a mixture of the two. Each mixture is extracted by stirring for 24 hours and then filtered through two layers of gauze to obtain a filtrate of bovine bone crude collagen. NaCl was added to each filtrate to adjust the final concentration of NaCl to 0.9 M (including 0.05 MTris, pH 7.0), and the mixture was stirred to precipitate a cotton-like precipitate. Then, NaCl was added. Liquid is obtained. The filtrate to which each NaCl is added is centrifuged for 20 minutes under the conditions of a temperature of 4 ° C. and a rotation speed of 10000 g, and precipitation, that is, crude bovine bone collagen after salting out is collected. The crude bovine bone collagen after each salting out is dissolved in a 0.5 M acetic acid solution, and dialyzed with 0.1 mol / L acetic acid and ultrapure water for 24 hours each, and the solutions are exchanged three times during the period. The obtained dialysate is freeze-dried at a temperature of −20 ° C. to obtain bovine bone collagen (PSC) extracted with pepsin and bovine bone collagen (ESC) treated with the acidic protease PsAPA. After that, the extraction rates of PSC and ESC are calculated and further analyzed by SDS-PAGE protein electrophoresis. The results are shown in FIGS. 5 and 6, respectively.

As shown in FIG. 5, the yield of PSC is only 8.34 ± 0.27, and the yield of ESC reaches 11.93 ± 0.53. Compared with pepsin, treatment with the acidic protease PsAPA clearly increased the extraction rate of bone collagen. Bone collagen terrorpeptides easily undergo molecular cross-linking, which reduces their solubility under acidic conditions and is disadvantageous for the extraction of bone collagen. Acidic protease PsAPA treatment can catalyze the enzymatic degradation of collagen telopeptides, increasing the solubility of collagen under acidic conditions and increasing the yield of collagen. Analysis by SDS-PAGE protein electrophoresis is as shown in FIG. The band of collagen extracted with the acidic protease PsAPA is consistent with the collagen extracted with pepsin. This indicates that the acidic protease PsAPA can increase the collagen concentration in the extract but does not destroy its overall structure. In summary, the acidic protease PsAPA can significantly increase the extraction efficiency of bone collagen and increase the yield of bone collagen.

Although the proposed embodiment of the present invention has been disclosed as described above, the present invention is not limited to the uses listed in the specification and the embodiment, and can be fully applied to various fields suitable for the present invention. , Other modifications can be easily realized. Accordingly, the invention is not limited to the particular details and the legends presented and described herein, under the general concept of not departing from the limitations of the claims and equivalents.

Claims (3)

The acidic protease PsAPA, characterized in that the amino acid sequence is as shown in SEQ ID NO: 1. The acidic protease PsAPA according to claim 1, wherein the DNA sequence is as shown in SEQ ID NO: 2 and the cDNA sequence is as shown in SEQ ID NO: 4. The method for using the acidic protease PsAPA according to claim 1, which is used for extracting bone collagen.

Images