JP7004816B2 - New powdered endosperm genes, molecular markers and their uses - Google Patents

Description

The present invention relates to a gene having a novel sequence that determines the trait of rice powdery endosperm, a molecular marker for detecting the gene, its use, and a detection method.

Rice is the main source of income for farmers, who account for 70% of Korea's agricultural income, but its consumption is steadily declining due to the westernization of eating habits and the increase in consumption of functional cereals. According to the announcement by the Statistics Agency in 2017, the annual rice consumption per capita decreased from 136.4 kg in 1970 to 61.9 kg in 2016, and the rice cultivation area was 12.18 million in 1975. The actual situation is that the production base has become fragile, decreasing from ha to 77,900 ha in 2016.

Wheat, which is a major edible crop along with rice, is provided as a raw material through the milling process, and is secondarily processed into food. In other words, the wheat industry has a clear division between the "raw material industry" such as breeding and flour milling process and the "food industry" that develops and provides various processed products, and has the potential to expand the market and create added value. Is evaluated as a very high crop. In the case of rice, there are about 300 types of processed foods even excluding rice cakes, but the amount of rice consumed for processing in Korea is about 220,000 tons, which is less than 5% of the production. The reality is that it is only (import 100,000, domestic production 120,000). Most manufacturers directly purchase polished rice and voluntarily manufacture and use rice flour, so not only is the quality of the rice flour not uniform, but its sales are close to 49 trillion won in the beverage and grocery manufacturing industries. The reality is that the price is only 2% (as of 2006, about 1 trillion won).

Since rice has a very high grain hardness (grain hardness), the most commonly used rice milling method in Japan at present is a wet milling method in which the rice is soaked in water and crushed. However, wet milling has a problem of inducing environmental pollution by generating about 500 liters of rice broth to produce 100 kg of rice flour. In addition, in order to distribute rice flour, a separate step of sterilizing and drying the rice flour must be added. For this reason, the processing cost of rice flour using the wet milling method (500-700 won / kg) is more than twice as high as the production cost of wheat flour using the dry milling method (200-300 won / kg). Is the reality. Recently, mass production equipment has been set up and semi-wet milling technology has been partially operated, but the factors that increase production costs have not been completely eliminated.

The size (particle size) of the crushed powder is important along with the milling method for the production of high-quality rice flour that is competitive. Since the physicochemical properties of dough and processed products are largely dominated by the particle size distribution, how to structure and maintain the particle size of rice flour to suit the application is a very important issue. In general, the finer the rice flour, the less the change in the hardness of the dumplings, and the better the water absorption rate when making the dough. Therefore, the finer the crushed rice flour, the higher the quality and the higher the distribution price. However, in order to obtain fine particles by dry milling, which reduces production costs, the high grain hardness of rice increases the mechanical force, and the proportion of damaged starch granules increases sharply. Damaged starch granules cause changes in the physicochemical properties of the dough, which ultimately leads to a deterioration in the quality of the rice flour. Recently, technologies such as jet mills and turbo mills that grind rice flour into smaller pieces have been developed and are being studied, but those who have a large burden such as initial capital investment costs and increased production unit prices. Is.

In conclusion, in order to smoothly build a large-scale raw material supply system centered on rice flour in Korea and promote the development and consumption of processed rice foods, 1) wastewater treatment and pre-distribution generated in rice flour production. It is necessary to be able to significantly reduce the cost required for drying and sterilization of rice, and 2) unless a concrete plan to reduce the damage of starch granules is presented even if the rice is crushed to the fine particle level. It doesn't become. Considering the production cost, 1) the process is simple, 2) the crushing time is short, and 3) the dry flour milling method with almost no generation of wastewater is advantageous. Furthermore, in South Korea, dry milling equipment for wheat milling is installed on a considerable scale, so the cost required to construct production equipment can be significantly reduced.

Under such a technical background, the development of rice varieties having the characteristics of powdered endosperm and research on genetic markers for them are being actively promoted (Korean registered patent 10-1226485 (Patent Document 1). )), The situation is still inadequate.

Korean Registered Patent No. 10-1226485

Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press (2001) Andrew Collins and Xizyi Ke. The Open Bioinformatics Journal, 2012, 55-58.

The present invention is for solving the above-mentioned problems, and an object of the present invention is a novel gene for determining the trait of powdered endosperm of rice, a protein encoded by the gene, and a powdery substance according to the gene. It is an object of the present invention to provide a composition and a kit for discriminating endosperm traits, and a method for discriminating the composition.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and another problem not mentioned above can be clearly understood by those skilled in the art from the following description. ..

In order to achieve the above-mentioned object of the present invention, the present invention provides a cyOsPPDK (cytosolic pyruvate orthophosphate dikinase) gene that determines the trait of the powdered endosperm of rice represented by SEQ ID NO: 2.

The present invention provides, as another aspect, a recombinant vector containing the gene.

The present invention provides, as another aspect, a transformant containing the gene or the recombinant vector.

The transformant may be rice.

The present invention provides, as another aspect, a plant containing the gene.

The present invention provides, as another aspect, rice containing the gene.

As another aspect, the present invention is a preparation capable of detecting a single nucleotide polymorphism (SNP) marker present at a position corresponding to 19,722,254 bp of chromosome 5 in the standard genome of rice (IRGSP 1.0). Provided is a composition for discriminating powdery endosperm traits based on the cyOsPPDK (cytosolic pyruvate orthophosphate dikinase) gene.

The SNP marker present at the position corresponding to 19,722,254 bp on chromosome 5 in the rice standard genome (IRGSP 1.0) may have a base of A or T.

The preparation capable of detecting the single nucleotide polymorphism is a sequence of 10 to 300 consecutive nucleic acids containing a base at a position corresponding to 19,722,254 bp of chromosome 5 in the standard genome of rice (IRGSP 1.0). A probe consisting of a polynucleotide consisting of the same or a probe that specifically hybridizes with a polynucleotide complementary thereto; or a primer that amplifies the polynucleotide may be used.

The pharmaceutical product capable of detecting the single nucleotide polymorphism is a primer set consisting of the positive primer shown by SEQ ID NO: 3 and the reverse primer shown by SEQ ID NO: 4; or the external positive primer shown by SEQ ID NO: 5. It may be a primer set consisting of the external reverse primer shown by SEQ ID NO: 6, the internal forward primer shown by SEQ ID NO: 7, and the internal reverse primer shown by SEQ ID NO: 8.

As another aspect of the present invention, there is provided a kit for determining powdered endosperm using the cytosolic pyruvate orthophosphate dikinase (cyOsPPDK) gene containing the composition for discriminating powdered endosperm.

In another aspect, the present invention comprises identifying a single nucleotide polymorphism (SNP) marker present at a position corresponding to 19,722,254 bp on chromosome 5 in the rice standard genome (IRGSP 1.0). (Cytosolic pyruvate orthophosphate dikinase) Provided is a method for discriminating powdery endosperm traits by a gene.

The single nucleotide polymorphism (SNP) present at the position corresponding to 19,722,254 bp on chromosome 5 in the rice standard genome (IRGSP 1.0) may be based on A or T.

The powdery germ milk trait discrimination method (a) uses the genomic DNA isolated from the sample as a template and contains a base at a position corresponding to 19,722,254 bp of chromosome 5 in the standard genome of rice (IRGSP 1.0). A probe that specifically hybridizes to a polynucleotide consisting of 5 to 300 consecutive nucleic acid sequences or a polynucleotide complementary thereto; or reacting with a primer capable of amplifying the polynucleotide; and (b) the reaction. It can further include checking things.

The primer is a primer set consisting of the forward primer shown by SEQ ID NO: 3 and the reverse primer shown by SEQ ID NO: 4, or the external forward primer shown by SEQ ID NO: 5 and the external reverse primer shown by SEQ ID NO: 6. , The internal forward primer set forth in SEQ ID NO: 7, and the internal reverse primer set forth in SEQ ID NO: 8 may be a primer set.

The powdered endosperm trait discrimination method can further include treating the reaction product of (b) with a restriction enzyme.

The restriction enzyme may be Hinf I.

In the method for discriminating powdery embryo milk traits, (a) a single nucleotide polymorphism at a position corresponding to 19,722,254 bp of chromosome 5 in the standard genome of rice (IRGSP 1.0) using the genomic DNA isolated from the sample as a template. A polynucleotide consisting of 10 to 300 consecutive nucleic acid sequences containing a polymorphic site of a marker or a polynucleotide complementary thereto is reacted with a primer to amplify it; and (b) the amplified reaction product. Further confirmation can be included.

In the powdery embryonic milk trait discrimination method, the genomic DNA isolated from the sample (a') is used as a template, and the base at the position corresponding to 19,722,254 bp of chromosome 5 in the standard genome of rice (IRGSP 1.0) is used. It can further include hybridization with a probe that specifically hybridizes to a polynucleotide consisting of 10 to 300 contiguous nucleic acid sequences, or a polynucleotide complementary thereto.

According to the present invention, the novel gene that determines the trait of the powdered endosperm of rice investigated in the present invention can be utilized as a main target gene for the development of a plant having the characteristics of the powdered endosperm. The monobasic polymorphism (SNP) allows easy and accurate determination of the presence or absence of phenotypic expression of powdered endosperm in various varieties of rice at the early stage of breeding. Specifically, it can be applied to the evaluation of powdered endosperm of plants at the stage of initial breeding line or selection of individual F ₂ plants, and can be extended to processed products made from rice as the main raw material. It can be used in the processing industry using rice.

It shows the replication of the map-based FLO4-4 mutation, and (A) shows the number of molecular markers and recombinants on a precise genetic map of the FLO4-4 locus. The 33 kb virtual contig (contig) composed of the superimposed parts of the two BAC clones is divided by the e-Landings of two important markers on the reference rice genome (Os-Nipponbare-Reference-IRGSP-1.0). Is displayed. (B) Comparison of FLO4-4 gene structure and cDNA sequence shows a G → A base mutation in exon 8, where wild-type Gly-404 is induced to Asp-404 in FLO4-4. White boxes indicate untranslated areas, black boxes indicate coding areas, and solid lines indicate introns. This is the result of confirming the single nucleotide polymorphism site by comparing the base sequences of the PPDK1 (OS05G0405000-02) gene of Namil (SA) -FLO2 with Namil rice. It is a figure which showed the sequence of the dCAPs primer set candidate group for the amplification of the single nucleotide polymorphism site of Namil rice, or Namil (SA) -FLO2 searched by dCAPS Finder 2.0. It is a figure which showed the base sequence of the fragment amplified by the dCAPs primer set which concerns on this invention, and the processing site of a restriction enzyme (Hinf I). It is a method using a dCAPs primer set and a restriction enzyme according to the present invention, and shows the results of electrophoresis of Miryang No. 23, Namil rice, and Namil (SA) -FLO2 (S542). It is a figure which schematized the position of the base sequence of the fragment amplified by the Tetra-primer ARMS primer set which concerns on this invention. The nucleotide sequence of the fragment amplified by the Terra-primer ARMS primer set according to the invention, and (b) the results of electrophoresis of Miryang No. 23, Namil rice and Namil (SA) -FLO2 (S542) are shown. It is a thing. It is a method using a dCAPs primer set and a restriction enzyme according to the present invention, and shows the results of electrophoresis of Miryang No. 23 and Namil (SA) -FLO2 mating progeny. It is a method using a primer set and a restriction enzyme according to the present invention, and shows the results of electrophoresis of Japonica varieties having similar genetic backgrounds (1. Ammi, 2. Alanchanchar, 3. White pearls). 1, 4. Shiratama Char, 5. Boram Char, 6. Boram Chan, 7. Borami, 8. Jewel, 9. Jewel Char, 10. Jewel Black Char, 11. Jeongnam, 12. Chindle, 13. Akiharu, 14. Tabo, 15. Tanmi, 16. Tampyung, 17. Trechan, 18. Todam rice, 19. Tonjin, 20. Tonjin 1, 21. Tonjinchar, 22. Healthy red rice, 23. Konyang 2, 24. Koami, 25. Koami 2 , 26. Koami 4, 27. Hepum, 28. Haiami, 29. Hanam, 30. Hanmaum, 31. Black Jinmi, 32. Fukuhan, 33. Black Pearl, 34. Fukunam, 35. Fukusol, 36. Red Pearl, 37. Hopum, 38. Golden Nuri, 39. Hwason, 40. Fawan, 41. Hwayoung, 42. Hyangnam, 43. Hyun Pum, 44. Ilumi, 45. Ilpum, 46. Red Pearl, 47. Red Pearl Char, 48. Black Hyanchar). It is a method using the Terra-primer ARMS primer set according to the present invention, and shows the results of electrophoresis of Miryang No. 23 and Namil (SA) -FLO2 mating progeny. It is a method using the Terra-primer ARMS primer set according to the present invention, and shows the results of electrophoresis of Japonica varieties having similar genetic backgrounds (1. Ammi, 2. Aranchanchar, 3. White). Pearls 1, 4. Shiratama Char, 5. Boram Char, 6. Boram Chan, 7. Borami, 8. Jewel, 9. Jewel Char, 10. Jewel Black Char, 11. Jeongnam, 12. Chindle, 13. Akiharu, 14. Tabo , 15. Tanmi, 16. Tampyung, 17. Trechan, 18. Todam Rice, 19. Tonjin, 20. Tonjin 1, 21. Tonjinchar, 22. Healthy Red Rice, 23. Konyang 2, 24. Koami, 25. Koami 2, 26. Koami 4, 27. Hepum, 28. Primer, 29. Hanam, 30. Hanmaum, 31. Black Jinmi, 32. Fuku Hyang, 33. Black Pearl, 34. Fuku Nam, 35. Fukusol, 36. Red Pearl, 37. Hopum, 38. Golden Nuri, 39. Hwason, 40. Fawan, 41. Hwayoung, 42. Hyangnam, 43. Hyun Pum, 44. Illumina, 45. Ilpum, 46. Red Pearl, 47. Red Pearl Char, 48. Black primer). The results of the phenotypic analysis of Namil (SA) -FLO2 (S542) and Namil (Namil) according to the present invention are shown. The brown rice and cross section of Namil (SA) -FLO2 and Namil are shown. Also, electron microscopic visualization of mature endosperm. As indicated by the red arrow, Namil (SA) -FLO2 is loosely filled with starch granules. The yellow box (boxed in a 500 μm ratio photo) indicates the enlarged area. 10 It is the result of analyzing the expression of FLO4-4 between Namil and Namil (SA) -FLO2 in DAF, and the displayed value is mean ± SD (n = 3).

Hereinafter, the present invention will be described in detail.

The present invention provides a novel sequence of genes that determine the traits of rice powdery endosperm. The gene of the novel sequence of the present invention may be a cyOsPPDK (cytosolic pyruvate orthophosphate dikinase) gene that determines the trait of the powdered endosperm of rice shown in SEQ ID NO: 2.

The term "floury endosperm" used in the present invention refers to a mutation having a whitish and opaque appearance similar to that of glutinous rice, but having a coarse arrangement of starch granules. Dry and wet milling are used to produce rice flour. Dry milling has a simple process, but has the problem of increasing damaged starch, while wet milling improves workability but is soaked in water. And the time and cost required for drying act as a limiting factor. In order to contribute to the revitalization of the rice processing industry, it is necessary to diversify processing varieties with characteristics suitable for each application and to develop varieties with excellent milling properties, and such characteristics of powdered endosperm. Is one of the important properties that overcomes the problems of conventional dry milling.

On the other hand, the Namil (SA) -FLO2 rice plant of the present invention is mutated by immersing the seeds of Namil rice in a diluted solution of sodium azide (NaN ₃ ), which is the cause of chemical mutation. Was induced, and the plant (M1) was developed through the germination and seedling raising stages, M2 seeds were harvested from the M1 plant, and then the generation was advanced to M7 by the phylogenetic breeding method and genetically fixed. It is a strain that has established a strain of mutation. The Namil (SA) -FLO2 has a similar composition of amylose-amylopectin content to the existing Namil rice, but the grain hardness is lower than that of general rice, the particles are fine even in dry milling, and the starch granules are damaged. It has the characteristic of being able to obtain a small amount of high-quality rice flour. However, no technique has been known for easily and accurately discriminating such varieties in the early stages of breeding, specifically, related genetic markers.

Therefore, the present inventors investigated the gene that determines the trait of powdered endosperm through the base sequence analysis of Namil (SA) -FLO2 rice cultivar (Experimental Example 1), and closely related to the trait of powdered endosperm. The site of the single nucleotide polymorphism showing the above was investigated (Experimental Example 2). In addition, a primer set targeting the site of the single nucleotide polymorphism was first developed, and the technique using the primer set according to the present invention is useful for determining the characteristics of the powdered endosperm of Japonica rice varieties. It was experimentally proved that it was.

The properties of the powdered endosperm of the present invention are determined by the novel sequence PPDK gene. The PPDK (Pyruvate orthophosphate dikinase) is to reversibly convert pyruvate, ATP and orthophosphate to perform various functions in cells of various plants, cytosol and Chloroplast-targeted PPDK proteins (cyOsPPDK and chOsPPDK, respectively) are encoded. chOsPPDK mRNA is constitutively expressed in photosynthetic institutions, and cyOsPPDK is expressed only in developing rice seeds after pollination. Normally, in rice, cyOsPPDK is expressed at a high level during the milk ripening period during seed development, and when the cyOsPPDK protein reaches the highest level about 10 days after pollination, both the cyOsPPDK protein level and the activity are threonine. -Rapidly down-regulated by a combination of threonyl-phosphorylation and the post-translational mechanism of proteolysis. In Nihonbare rice, the entire genome of cyOsPPDK is 7656 bp, the cDNA contains 19 exons, is 2649 bp, and encodes a protein of 882 amino acids.

However, the cyOsPPDK of the present invention contains a mutation against the wild-type cyOsPPDK gene, through which the traits of the powdered endosperm of rice are determined. The cyOsPPDK gene of the present invention is an allele and is a recessive gene. The mutant gene cyOsPPDK of the present invention has a property that expression is maintained at a higher level than that of the wild type during the ripening stage (after 10 days after pollination) and the ripening stage (grain filling stage).

In particular, a single nucleotide polymorphism (SNP) was present in G → A at the site of exson 8 of the cyOsPPDK gene of the present invention (mutation from C to T in the allele), thereby being encoded by the cyOsPPDK gene of the present invention. There is a mutation from glycine (G, Gly) to aspartic acid (D, Asp) in the amino acid sequence of the protein (position of amino acid 404 corresponding to the single nucleotide polymorphism). This allows the expression and activity of the protein to be maintained during the ripening period of the rice, while being involved in the development of seeds in the rice to exhibit the trait of powdered endosperm. In this aspect, the cyOsPPDK of the present invention may mean a mutant cyOsPPDK gene, a mutated cyOsPPDK protein or a mutated cyOsPPDK mRNA. In the present invention, the mutant gene that determines the trait of powdered endosperm is named cyOsPPDK, Namil (SA) -FLO2, FLO7 or FLO4-4, and the names may be referred to interchangeably.

The cyOsPPDK gene of the present invention is represented by SEQ ID NO: 2, deposited with GenBank, and displayed as registration number MG267058.

The position of the cyOsPPDK gene of the present invention is based on RAP-DB (Rice Annotation Project Database, http://rapdb.dna.affrc.go.jp/viewer/gbrowse/irgsp1/?name=chr02%3A1..105000). The position can be shown in. The cyOsPPDK locus of the present invention exists between the BAC clone OSJNBb0006J12 and OJ1174_H11, and the characteristics of the powdered endosperm are determined by the single nucleotide polymorphism (G → A) in exon 8 of the mutant cyOsPPDK gene.

The single nucleotide polymorphism is present at the position corresponding to 19,722,254 bp of chromosome 5 in the rice standard genome ( IRGSP 1.0 ) in comparison with the rice standard genome (IRGSP 1.0). It is a position corresponding to the 4055th base in the gene sequence of SEQ ID NO: 1.

In the present invention, the term "gene" means a unit of genetic information as a factor that determines a trait, and may also be referred to as a nucleic acid molecule or a polynucleotide that encodes a protein. The gene of the present invention can contain a base sequence having substantial homology with the above-mentioned base sequence of SEQ ID NO: 2. The substantial homology described above aligns the base sequence of the present invention described above with any other sequence to the maximum extent and is commonly used in the art (eg, DNASIS and CrystalX). ), While containing the single nucleotide polymorphism present in the gene of the invention, at least 80% homology, more preferably at least 90% homology, most preferably. It means a base sequence showing at least 95% homology.

According to another aspect of the invention, the invention provides a recombinant vector comprising said gene. The vector system of the present invention can be constructed through various methods known in the art, and specific methods thereof are described in Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press. (2001) (Non-Patent Document 1), which is incorporated herein by reference.

The vectors of the invention can typically be constructed as vectors for cloning or vectors for expression. Further, the vector of the present invention may be constructed using prokaryotic cells or eukaryotic cells as a host.

In the present invention, the vector is a transformation binary vector that can be permanently expressed in a plant into which a foreign gene has been introduced, and a gene encoding a target protein is operably linked downstream of a promoter. It may be a vector produced by the above-mentioned.

The vector according to the present invention uses a conventional vector used for protein expression as a basic skeleton, inserts the promoter of the present invention, and encodes a target protein on the downstream side of the promoter (gene). Can be manufactured by inserting. The recombinant vector can include a specific promoter for expression of the gene of interest.

According to another aspect of the invention, the invention provides a transformant comprising said gene or vector.

The term "transformant" in the present invention means a progeny containing the trait of powdered germ milk determined by the gene of the present invention in addition to the gene of the present invention being inserted into the host as a foreign gene by a genetic engineering method. In order to breed an individual, it is meant to include at least one individual containing the gene of the present invention and an individual of a progeny line that has been crossed with another individual to have the gene of the present invention.

In order to produce the transformant of the present invention, it can be carried out by a method generally known in the art.

According to a preferred embodiment of the present invention, the transformant may be a plant, more preferably rice.

Therefore, in this aspect, the present invention can provide a rice plant having the mutant cyOsPPDK gene; or the sequence of SEQ ID NO: 2.

In one specific example of the present invention, the gene that determines the trait of the powdered endosperm of rice is the mutant cyOsPPDK, and the characteristic of the powdered endosperm is a single nucleotide polymorphism (G → A or C →) in exon 8 of the mutant cyOsPPDK gene. It was confirmed that it was determined by T).

In this aspect, the invention provides, in other embodiments, single nucleotide polymorphisms for genes of novel sequences that determine the traits of the powdered endosperm of the invention.

Specifically, based on the information on the transcript of the candidate gene PPDK1 (Pyruvate, phosphate dikinase1) located on chromosome 5 based on the information on the standard genome of rice (IRGSP 1.0), OS05G0405000-02 (19,718, 19,718,785-19,726,340 (7,556bp) in PPDK1 of Namil rice and FLO4-4 (Namil (SA) -FLO2) of the present invention based on the nucleotide sequence of 538-19,737,605bp). As a result of analyzing the base sequence of Nucleotide sequence and comparing it with the standard genome Nipponbare (IRGSP 1.0), one SNP was searched between Namil rice and Namil (SA) -FLO2, and the SNP was the standard of rice. It is located in the genome (IRGSP 1.0) at the position corresponding to 19,722,254 bp of chromosome 5, which is SEQ ID NO: 1 (polynucleotide sequence derived from Namil rice, ch5: 19,726,340-19,718,785. ) Or the 4055th base in the sequence of SEQ ID NO: 2, and the 4093th base of SEQ ID NO: 9.

More specifically, the SNP marker present at the position corresponding to 19,722,254 bp of chromosome 5 in the standard genome of rice (IRGSP 1.0) may have a base of A. More specifically, G located at position 4055 in the polynucleotide sequence of SEQ ID NO: 1; position 4093 in the polynucleotide sequence of SEQ ID NO: 9 is replaced with A, whereby the said. Although encoded by the gene, the amino acids Glycine (Gly, G) are mutated to Aspartic acid (Asp, D) in the protein sequence to exhibit the traits of powdered embryo.

Therefore, in the single nucleotide polymorphism, G at position 4055 of the polynucleotide sequence represented by SEQ ID NO: 1 is A or G at position 4093 of the polynucleotide sequence represented by SEQ ID NO: 9 is A. May be good.

The term "Single Nucleotide polymorphism (SNP)" used in the present invention refers to the case where two or more alleles are present at one locus. It is called a single nucleotide polymorphism that only a single base is different in the polymorphism site. Further, the term "allele" refers to various forms of one gene existing at the same locus on a homologous chromosome, and SNP has two types of alleles.

In the aspect that the single nucleotide polymorphism of the present invention can be used to determine the characteristics of powdered embryo, the present invention is, according to another aspect, of chromosome 5 in the standard genome of rice (IRGSP 1.0). Provided is a composition for discriminating powdery embryonic milk by the gene according to claim 1, which comprises a preparation capable of detecting a single nucleotide polymorphism (SNP) marker present at a position corresponding to 19,722,254 bp.

The composition for determining the characteristics of powdered endosperm according to the present invention can be used to determine the characteristics of powdered endosperm of all rice varieties including the Japonica line, and as an embodiment, Namil The powdered endosperm of the mutant progeny Namil (SA) -FLO2 can be discriminated, but is not limited to these. Further, the composition can be applied not only to progeny lines by crossing between two or more rice varieties, but also to extended processed products manufactured using the above-mentioned rice varieties as a main raw material. can do.

The preparation capable of detecting the single nucleotide polymorphism is a sequence of 10 to 300 consecutive nucleic acids containing a base at a position corresponding to 19,722,254 bp of chromosome 5 in the standard genome of rice (IRGSP 1.0). It may be a polynucleotide consisting of a polynucleotide or a probe that specifically hybridizes with a polynucleotide complementary thereto; or a primer capable of amplifying the same.

The term "primer" as used in the present invention forms a base pair with a complementary template with a base sequence having a short free 3'hydroxyl group. It can mean a short sequence that can serve as a starting point for copying the template strand. The appropriate length of the primer may vary depending on the intended use, but is generally composed of 15-30 bases. The primer sequence does not have to be completely complementary to the template, but it must be sufficiently complementary to hybridize with the template. The primer can hybridize to a DNA sequence containing a polymorphic site and amplify a DNA fragment containing the polymorphic site.

For the purposes of the present invention, the primers amplify single nucleotide polymorphism sites that are closely related to the properties of powdered endosperm, for example, the forward primer shown in SEQ ID NO: 3 and the reverse direction shown in SEQ ID NO: 4. A primer set consisting of primers; or an external forward primer set forth in SEQ ID NO: 5, an external reverse primer set forth in SEQ ID NO: 6, an internal forward primer set forth in SEQ ID NO: 7, and an internal reverse primer set forth in SEQ ID NO: 8. It may be a primer set consisting of primers, but is not limited thereto.

Alternatively, the preparation capable of detecting the one-base polymorphism is the position 4055 of the polynucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2, or the position 4093 of the polynucleotide sequence represented by SEQ ID NO: 9. A probe that specifically hybridizes with a polynucleotide consisting of 10 to 300 consecutive nucleic acid sequences containing a single base polymorphic site or a polynucleotide complementary thereto; or a primer that amplifies the polynucleotide. You may.

According to one embodiment of the present invention, the pharmaceutical product is a primer set consisting of a forward primer set forth in SEQ ID NO: 3 and a reverse primer set forth in SEQ ID NO: 4; or an external positive primer set forth in SEQ ID NO: 5, SEQ ID NO: It may be a primer set consisting of the external reverse primer shown by 6, the internal forward primer shown by SEQ ID NO: 7, and the internal reverse primer shown by SEQ ID NO: 8.

Alternatively, the primer set is preferably preferably 80% or more of sequence homology, more preferably 90% or more of sequence homology, and further preferably 95% or more of each base sequence represented by SEQ ID NO: 3 and SEQ ID NO: 4. It may consist of any one base sequence having sequence homology of, most preferably 99% or more, but it may be included without limitation as long as the above-mentioned site of the one-base polymorphism can be amplified. can.

The primer set is preferably 80% or more of sequence homology, more preferably 90% or more of sequence homology, and further preferably 95% or more of each base sequence represented by SEQ ID NOs: 5 to 8. It may consist of any one base sequence having sequence homology of, most preferably 99% or more, but it may be included without limitation as long as the above-mentioned site of the one-base polymorphism can be amplified. can.

The primers or probes of the present invention can be chemically synthesized using the phosphoramidite solid support method or other widely known methods. Such nucleic acid sequences can also be modified using many means known in the art. Non-limiting examples of such modifications include methylation, capping, substitution with one or more homologues of native nucleotides, and internucleotide variants, such as uncharged conjugates (eg, methylphosphonates, phosphotriesters). , Phosphoramidite, carbamate, etc.) or transformations to charged conjugates (eg, phosphorothioate, phosphorodithioate, etc.).

Further, the present invention provides a kit for discriminating powdered endosperm using the cyOsPPDK (cytosolic pyruvate orthophosphate dikinase) gene for determining the trait of powdered endosperm of rice containing the composition for discriminating powdered endosperm according to another aspect. do.

In addition to the above composition, the kit according to the present invention can further contain a DNA polymerase, dNTP, and a PCR buffer solution that facilitate the PCR reaction, and not only this, but also confirming the presence or absence of amplification of the PCR product. The kit of the present invention may further include an identification criteria table for the constituents necessary for carrying out the electrophoresis capable of performing the polymerization, or the known varieties. In addition, the kit can further include known configurations for effectively carrying out the reaction with the probe.

The present invention also comprises identifying a single nucleotide polymorphism (SNP) marker present at a position corresponding to 19,722,254 bp of chromosome 5 in the rice standard genome (IRGSP 1.0) by another aspect. A method for discriminating powdery endosperm traits based on the gene of claim 1 is provided.

The single nucleotide polymorphism may be present at position 4055 of the polynucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2; or at position 4093 of the polynucleotide sequence represented by SEQ ID NO: 9. ..

Since the method for determining the characteristics of powdered endosperm of the present invention utilizes the constituents described in the above-mentioned composition for determining the characteristics of powdered endosperm, the content common to both of them is the excessive complexity of the present specification. To avoid this, the description is omitted.

The base of the polymorphism site hybridizes with a probe capable of amplifying the polymorphism site of the single nucleotide polymorphism marker or detecting the single nucleotide polymorphism marker from the nucleic acid sample separated from the sample, and the polymorphism. The base of the site can be confirmed.

For example, polymerase chain reaction (PCR), ligase chain reaction (LCR), transcription amplification (transcription amplification), self-retaining sequence replication and nucleic acid-based sequence amplification (NASBA) can be utilized to amplify polymorphic sites. ..

Confirmation of bases at polymorphic sites includes sequence analysis, microarray hybridization, allele specific PCR, dynamic allele-specific hybridization (DASH), and PCR extension analysis. , SCSP, PCR-RFLP analysis, TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (eg Sequenom's MassARRAY system), mini-sequencing method, Bio-Plex system (BioRad), CEQ and Includes, but is not limited to, SNPstream systems (Beckman), Polymerase Hybrid Array technologies (eg, Affymetrix GeneChip), and BedChips (Illumina HumanOmni2.5-8). For example, the base of the polymorphic site can be confirmed by using the SNP chip. The SNP chip means one of the DNA microarrays capable of confirming each base of hundreds of thousands of SNPs at one time.

Sequencing analysis can be performed using conventional methods for sequencing and utilizing automated gene analysis equipment. Further, the allele-specific PCR means a PCR method for amplifying a DNA fragment in which the SNP is located with a primer set containing a primer devised with the base in which the SNP is located at the 3'end. The principle of the method is, for example, devised a primer containing the G as a 3'end base and a reverse primer capable of amplifying a DNA fragment of an appropriate size when a specific base is replaced from G to A. When the PCR reaction is carried out, if the base at the SNP position is G, the amplification reaction is normally performed and a band at the target position is observed, and if the base is replaced with A, the band is observed. , The primer can complementarily bind to the template DNA, but the point that the amplification reaction is not properly performed is used because the complementary binding is not performed at the 3'end. DASH can be carried out by a conventional method, preferably by a method such as Prince.

In PCR extension analysis, a DNA fragment containing a base containing a single nucleotide polymorphism is first amplified with a primer pair, and then all nucleotides added to the reaction are dephosphorylated to inactivate it. It is carried out by adding an SNP-specific extension primer, a dNTP mixture, a dideoxynucleotide, a reaction buffer and a DNA polymerase to carry out the primer extension reaction. At this time, the extension primer has a base immediately adjacent to the base in which the SNP is located in the 5'direction as the 3'end, and the dNTP mixture excludes a nucleic acid having the same base as the dideoxynucleotide, and the dideoxynucleotide is used. It is selected from one of the types of bases indicating SNP. For example, when there is a substitution from A to G, when a mixture of dGTP, dCTP, and TTP and ddATP are added to the reaction, the primer is extended by the DNA polymerase at the base where the substitution occurred, and some bases are added. After that, the primer extension reaction is terminated by ddATP at the position where the A base first appears. If the substitution does not occur, the extension reaction ends at that position, so that the type of base indicating SNP can be determined by comparing the lengths of the extended primers.

At this time, as a detection method, when an extension primer or a dideoxynucleotide is fluorescently labeled, fluorescence is performed using a gene analysis device (for example, Model 3700 manufactured by ABI) used for determining a general base sequence. The SNP can be detected by detecting, and when an unlabeled extended primer and a dideoxynucleotide are used, the molecular weight is determined using the MALDI-TOF (matrix assisted laser desorption ionization-time of flight) technique. By measuring, the SNP can be detected.

As an embodiment of the present invention, in the method for discriminating the powdery embryonic milk trait, (a) the genomic DNA isolated from the sample is used as a template, and the standard genome of rice (IRGSP 1.0) is set to 19,722,254 bp of chromosome 5. PCR is performed with a primer capable of amplifying a polynucleotide consisting of 10 to 300 consecutive nucleic acid sequences containing a base at a corresponding position or a polynucleotide complementary thereto; and (b) the PCR. Further, it is possible to determine the presence or absence of traits in the powdered embryonic milk of the sample individual, including confirmation of the reaction product amplified by the above. If the PCR reaction product shows the same result as the individual having the cyOsPPDK gene (Namil (SA) -FLO2), it can be said that the individual plant of the sample has powdery endosperm characteristics.

Alternatively, as another embodiment of the present invention, in the powdery embryo milk trait discrimination method, the genomic DNA isolated from the (a') sample is used as a template in the standard genome of rice (IRGSP 1.0), and the number 5 is 19. Further comprising reacting with a probe consisting of a polynucleotide consisting of 10 to 300 contiguous nucleic acid sequences containing a base at a position corresponding to 722,254 bp or a probe specifically hybridizing to a polynucleotide complementary thereto. can.

The powdered endosperm trait discrimination method can further include treating the amplified product of (b) with a restriction enzyme. More specifically, the restriction enzyme may be Hinf I. When the PCR-amplified reaction product is cleaved into two or more fragments by the restriction enzyme treatment, it can be separated as having the characteristics of powdered endosperm. However, this may change the type of restriction enzyme and the reaction aspect associated with it, depending on the design characteristics of the primer.

As an embodiment of the present invention, the pharmaceutical product capable of detecting a single nucleotide polymorphism in (a) above is a primer set consisting of the forward primer shown in SEQ ID NO: 3 and the reverse primer shown in SEQ ID NO: 4. Alternatively, with a primer set consisting of the external forward primer shown by SEQ ID NO: 5, the external reverse primer shown by SEQ ID NO: 6, the internal forward primer shown by SEQ ID NO: 7, and the internal reverse primer shown by SEQ ID NO: 8. There may be.

In the present invention, the sample can be obtained from all rice varieties (candidate varieties) including the Japonica line, or the Namil mutant progeny line Namil (SA) -FLO2, as well as the above-mentioned rice. It can also be obtained from processed products manufactured using varieties as the main raw material.

In the present invention, genomic DNA isolated from a sample can be obtained by using an SDS extraction method commonly used in the art, a CTAB separation method (Cetyl trimethyl Ammonium Bromide), or a commercially available DNA extraction kit. Can be done.

The PCR in the present invention can be carried out by any one selected from the group consisting of real-time PCR, qRT-PCR or multiplex PCR, and the above-mentioned single nucleotide polymorphism site in the candidate variety or sample. Can be included without limitation as long as it is a method capable of amplifying. Along with this, the PCR product can be additionally treated with a restriction enzyme, where the restriction enzyme may be, but is not limited to, Hinf I.

The step of confirming the product amplified by PCR in the present invention can be performed through, but is not limited to, DNA chip, gel electrophoresis, radiometric measurement, fluorescence measurement, or phosphorescence measurement. As one of the methods for detecting the amplified product, gel electrophoresis can be performed, and the gel electrophoresis can utilize agarose gel electrophoresis or acrylicimide gel electrophoresis depending on the size of the amplified product.

Hereinafter, preferred embodiments will be presented to aid in the understanding of the present invention. However, the following examples are provided only for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.

[Preparation example] Experiment preparation and method Preparation example 1. Experimental Plants and Materials The DNA of Namil (SA) -FLO2, which has the characteristics of Namil rice and powdered endosperm, is obtained by using the CTAB (Cetyltrimethyl ammonium bromide) method (Murray & Thomason, 1980) after collecting each young leaf. Extracted. The extracted DNA was confirmed by 0.8% agarose gel electrophoresis, quantified using NanoDrop spectrophotometer (Thermo Fisher Scientific, USA), diluted at 5 ng / μl and used for PCR.

The F2 population and parent line of Namil (SA) -FLO2 / Miryang 23 were cultivated in the experimental area of Busan University and produced the F _{3: 4} family group for a precise gene map of the powdered endosperm gene. Whole-genome DNA was extracted from fresh leaves of all genotypes using the Nucleo Spin® Plant II kit (MACHEREY-NAGEL GmbH & Co.KG, Germany) according to the manufacturer's instructions.

Preparation example 2. Resequencing and Development of Molecular Markers The entire genomes of Namil (SA) -flo2 and Miryang 23 were resequencing with an average of 75x coverage using the Illumina HiSeq 2500 Sequence System Platform (Illumina Inc. USA). .. Raw sequence reads were aligned with the rice standard genome (IRGSP 1.0) (Kawahara et al., 2013). SNP without missing value, minor allele frequency (MAF)> 0.05, genotype call for parental sequences to create a genetic map associated with powdered embryo. Was used. In order to reduce the target site, SNPs were selected using Oligo 7.0 software and eight truncated polymorphic sequence (CAPS) markers were developed.

Preparation example 3. Creation of an elaborate powdery endosperm-determining gene map In order to find candidate regions, the F2 generation, whose genomic region between RM18624 and RM18639 is heterogeneous, was grown to the F3 generation. Next, F3 plants were self-mating to obtain F _{3: 4} seeds. The parental strain and 96 randomly selected F _{3: 4} recombinants were peeled and the endosperm was visually inspected and genotyped with 8 CAPS markers. The open reading frame (ORF) of the region and the functionality in the region are disclosed in the MSU Rice Genome Annotation Project Database (http://rice.plattbiology.mus.edu/).

PCR was performed on a 10 ng DNA template, 10 pmol primers, 1xPCR buffer [50 mM KCl, 10 mM Tris-HCl (pH 9.0), 0.1% Triton X-100, and 1.5 mM MgCl ₂ ], 0.2 mM. It was performed in a 20-μl (volume) solution containing 1 unit of dNTP, 1 unit of Taq DNA polymerase (Nurotics, Korea). PCR was performed on the MJ Research PTC-100 thermal cycler (Waltham, MA, USA) under the following conditions: initial denaturation at 94 ° C. for 5 minutes, denaturation at 94 ° C. for 36 cycles, 30 seconds at 58 ° C. Annealing and stretching at 72 ° C for 1 minute and final elongation at 72 ° C for 10 minutes. The PCR product was cleaved with restriction enzymes (New England Biolabs). Cleavage of PCR products containing CAPS mats was detected using the WatCut program (http://watercut.waterloo.ca/template.php? Act=snp_new). Cleavage products are separated at 80 V on a 3% polyacrylamide gel using 6M urea and 1X TAE and using Molecular Imager® Gel Doc® XR System (Bio-Rad Laboratories, Inc. USA). Visualized.

Preparation example 4. Gene Cloning and Mutation Location Identification The coding sequences of cyOsPPDK in Namil (SA) -FLO2 and Namil were compared using CLC Sequence Viewer 7. To confirm the mutation position, use dCAPS Finder 2.0 (http://helix.wustl.edu/dcaps/) to position the restriction enzyme in HinfI with the powdered endosperm mutant Namil (SA) -flo2. I put it in.

A 161 bp fragment containing the mutation site was PCR amplified from Namil (SA) -flo2 and Namil using primers F (CCCAGGTGATGCAGGGTGAG; SEQ ID NO: 32) and R (GCACAGGTCTTGGACATTGC; SEQ ID NO: 33). The PCR product is cleaved with HinfI (New England Biolabs) on a 15 μl (volume) solution containing 5 μl of the PCR product, 1.5 μl of 10X NEBuffer, 0.5 μl HinfI and 8 μl of ultrapure water and cultured at 37 ° C. for 2 hours. Was done. The cleavage products were separated on a 4% agarose gel. The dCAPS marker was also used in the simultaneous-separation analysis of the F _{3: 4} family and 48 Korean rice varieties with their respective endosperm phenotypes. The complete genomic DNA of the CyOsPPDK gene was cloned at three superposed moieties using primers designed based on the Nihonbare cyOsPPDK gene sequence.

Preparation example 5. Total RNA isolation and qRT-PCR analysis Total RNA was isolated from Namil and Namil (SA) -flo2 rice grains 10 days after flowering (DAF) using the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany). Genomic DNA was removed with DNase I (QIAGEN, Hilden, Germany) and reverse transcription was performed using the RNA to cDNA EcoDry Premix kit (Clontech, Mountain View, CA, USA).

The qRT-PCR was performed using the Quanti Nova SYBR Green RT-PCR kit (QIAGEN, Hilden, Germany) with Rotor-Gene Q equipment (QIAGEN, Hilden, Germany) under the following PCR conditions. After 10 minutes at 95 ° C, 10 seconds (40 cycles) at 95 ° C, 20 seconds at 60 ° C. The fold change was calculated relative to Namil. The fold changes showed the mean ± standard deviation of the three iterations, and Actin 1 (OsACT1; Os03g0718150) of rice was used as the internal control group. The qRT-PCR primer (qOsPPDKB) was designed based on the coding sequence of FLO4-4 and the primers in Table 1 were used.

Experimental example 1. Investigation of genes that determine powdery endosperm trait Experimental example 1-1. Map of loci associated with powdered endosperm The entire genome of Namil (SA) -flo2 rearranged in the prepared example was aligned with reference to Miryang 23 of the indica cultivated species. A total of 2,604 SNPs were identified in all target areas. Using the genomic sequence between RM18624 and RM18639 as a template, 8 CAPS markers were designed (Table 2), with 60 powdered endosperm individuals and 36 normal individuals from the F _{3: 4} recombinant family. Was used for genotyping. Various comparisons were made between the genotypes of the recombinants and the phenotypes of their offspring.

Since it was confirmed that the candidate gene related to the powdered milk of the present invention is regulated by the recessive gene, if the CAPS marker genotype of the powdered milk individual matches the positivity 23 or atypical zygotes genotype, It was determined that the region adjacent to the CAPS marker was not the position of the target gene. In addition, if the CAPS marker genotype is the same as Namil (SA) -FLO2 in the individual having wild-type endosperm, it was determined that the position of the gene is not the position of the target gene.

Individuals with heterozygous genotype and powdered endosperm for CAPS 5-8; and individuals with Namil (SA) -flo2 genotype and normal endosperm for CAPS 1-4, as shown in FIGS. 1a and 1b. Was identified. The target area was displayed on the map with the BAC clone OJ1174_H11 and OSJNBb0006J12 in the area of 33 kb displaying the CAPS 8 marker and RM18639 at both ends.

Experimental Example 1-2. Analysis of candidate genes for powdered endosperm RAP-DB (Rice Annotation Project Database, http: //rapdb.dna.affrc.go.jp/viewer/gbrouse/irgssp1 /?name=chr02%3A1.105) , 4 genes were predicted as candidates for target genes in the 33 kb region (FIG. 2a). Of these, Os05g0404500 encodes a hypothetical protein (hypothetical), Os05g0404700 is a functional gene similar to the methyl-binding protein gene MBD1, Os05g0404901 encodes a conserved hypothetical protein, and Os05g0405000 is a PPDK gene. rice field.

G / A SNPs were confirmed from exon 8 of PPDK in the sequence of four candidate genes and wild-type Namil in Namil (SA) -flo2 ((B) in FIG. 1b). In order to analyze the transcript type of PPDK from seeds during the ripening stage of rice, Namil (SA) -flo2 and Namil PPDK are combined with PF2 / PR3 (cyOsPPDK) and PF3 / PR3 (chOsPPDK) primers (Kang et al). In 2005), the sequence was further confirmed using the three primer pairs in Table 1.

As a result of comparing the base sequence of Namil (SA) -flo2 and CyOsPPDK of Namil with the base sequence of Nipponbare, 9 SNPs in the intron region except for the SNP of the coding region between Namil (SA) and flo2; Six Indels (insertions and deletions) were searched from the two SNPs in the intron region and the coding region with homologous mutations. The gene associated with the recessive powdery endosperm of the novel sequence according to the present invention was named FLOury4-4 (FLO4-4). The full-length coding sequences of Namil (SA) -flo2 and Namil FLO4-4 were deposited with GenBank and given registration numbers MG267058 and MG267056, respectively.

Experimental Example 1-3. Analysis of expression characteristics of genes related to powdered endosperm Powdered rice (grain) in 94 F2 samples by crossing Namil (SA) -flo2 with Namil (Mo et al, 2013) using the dCAPS marker. The effect of the FLO4-4 gene on the change in the ratio of

The type of FLO4-4 transcript was investigated from ripening rice using qRT-PCR. The relative expression level of FLO4-4 in Namil (SA) -flo2 was much higher than that of Namil (Fig. 11), which is related to the expression of FLO4-4 with ripening, and the difference in the powder texture of rice grains. It means that it is derived from the FLO4-4 allele. Taken together, all of these results suggest that FLO4-4 is the locus responsible for the powdered endosperm from rice.

Experimental example 2. Investigation of single nucleotide polymorphism sites related to the properties of powdered endosperm
Experimental Example 2-1. Investigation of single nucleotide polymorphism sites through fertilizer of the base sequence of Namil rice and PPDK1 (OS05G0405000-02) gene of Namil (SA) -FLO2
Based on the information of the rice standard genome (IRGSP 1.0), the information of the transcript of the candidate gene PPDK1 (Pyruvate, phosphate dikinase1) located on chromosome 5 was confirmed, and OS05G0405000-02 (19,718,538-19, 737, 605bp, http: //ensembl.gramene.org/Oryza_sativa/Transcript/Summary?db=core;g=OS05G0405000;mr=5:19725828-197258229; r=5:19718000-197314 ; A sequence primer (securing primer) was synthesized based on the base sequence of tl = FRpMRF4sd5cjSKwa-7218-3304471 ), and 19,718,785-19,726,340 (7) in PPDK1 of Namil rice and Namil (SA) -FLO2. , 556bp) was analyzed. Specifically, the DNA fragment was amplified by dividing it into three regions using the primer set shown in Table 1 below, and then the base sequence was analyzed using 17 sequence primers.

As a result of analyzing the base sequence of OS05G0405000-02 (reverse strand) for the corresponding region (7,556 bp) in PPDK1 of Namil rice and Namil (SA) -FLO2, as shown in Table 2 below, Nipponbare (standard genome) Compared to IRGSP 1.0), Namil rice was searched for 6 Indels and 11 SNPs, and Namil (SA) -FLO2 was searched for 6 Indels and 12 SNPs, and Namil rice and Namil (SA). ) -One SNP was searched between FLO2.

In addition, as shown in FIG. 1b, the SNPs related to the properties of the powdered endosperm searched for are located at 19,722,254 bp in the IRGSP standard genome, and are "G" in Namil rice and Namil (SA). -In FLO2, it was possible to confirm that it was "A". It was confirmed that this induces a mutation in which the amino acid sequence of OS05G0405000-02 (reverse strand) is changed from Glycine (Gly, G) to Aspartic acid (Asp, D).

Experimental Example 2-2. Manufacture of primer set for characterizing Namil (SA) -FLO2 powdered endosperm
stomach. Preparation of dCAPs Primer Set A dCAPs primer was prepared using dCAPS Finder 2.0 (http://helix.wustl.edu/dcaps/dcaps.html) for the SNP investigated in Example 1 above. Using the 60 bp base sequence information around the searched SNP, a 1 bp mismatch primer was searched, and as shown in FIG. 2, 14 primers that cleave the forward sequence of Namil rice by dCAPS Finder 2.0. Seven primers were identified to cleave the reverse sequence of Namil rice. In addition, four primers that cleave the forward sequence of Namil (SA) -FLO2 and five primers that cleave the reverse sequence of Namil (SA) -FLO2 were searched for. Finally, as shown in Table 3 below, a primer set was selected in which cleavage of Namil (SA) -FLO2 having the characteristics of powdered endosperm is promoted by a stable reaction with a restriction enzyme (Hinf I).

PCR included 10 ng of DNA and 5 pmol of forward and reverse primers, 0.2 mM dNTP mix, 1X PCR buffer [50 mM KCl, 10 mM Tris-HCl (pH 9.0), 0.1% Triton X-100, 1.5 mM MgCl. ₂ ] and 1 unit of Taq polymerase (Nurotics, Korea) were used in a total volume of 20 ul. After initial denaturation at 95 ° C for 5 minutes using PTC-100® thermocycler (Waltham, USA), repeat at 95 ° C for 20 seconds, 61 ° C for 30 seconds, 72 ° C for 60 seconds, a total of 35 times. The reaction was carried out at 72 ° C. for 10 minutes.

On the other hand, the restriction enzyme is 5'. .. .. GAGTC. .. .. Using Hinf I, which cleaves the 3'site, as shown in FIG. 3, Namil rice is not cleaved by a restriction enzyme, while Namil (SA) -FLO2 has a GAGTC sequence by SNP, so that it is cleaved by the restriction enzyme. Designed to be. Treatment with restriction enzymes was performed using 1X enzyme buffer [50 mM Potassium Acate, 20 mM Tris-actate, 10 mM Magnesium Actate, 100 μg / ml BSA], 10 ng of PCR product, 5 U Hinf I (NEB, UK). Carried out. The reaction was carried out at 37 ° C. for 120 minutes using a PTC-100 ^TM thermal cycler (Waltham, USA). The result was electrophoresed using FA (Flagment analyzer), and then the genotype was determined.

As a result, as shown in Table 5 and FIG. 4, 161 bp was amplified in Namil (SA) -FLO2, Namil rice, and the standard genome (IRGSP 1.0, Nipponbare), but Namil (SA) was amplified by the HinfI restriction enzyme. -It was confirmed that FLO2 was cleaved into the form of 17,154 bp, and that the Namil rice and the standard genome (IRGSP 1.0, Nipponbare) were not cleaved.

That is, it was found that the characteristics of the powdered endosperm of the Namil mutant progeny line can be effectively discriminated through such a difference.

B. Manufacture of Terra-primer ARMS primer set
Primer1 (Primer Design for Terra-Primer ARMS-PCR, http: //primer1.soton.ac.uk/primer1 ) to produce primers that can omit the restriction enzyme treatment step for the searched SNP. .Html ) service was used to develop the Terra-Primer ARMS-PCR primer. Utilizing the information on the base sequence of 940 bp including the SNP and the SNP (G / A) information investigated in Example 1, (Andrew Collins and Xizyi Ke. The Open Bioinformatics Journal, 2012, 55-58. 2)) As shown in Table 6 below, a primer set capable of discriminating the SNP of Namil (SA) -FLO2 having the characteristics of powdered germ without treatment with a limiting enzyme was selected.

Specifically, when PCR is performed using the FLO2 Ttra-Primer ARMS-PCR primer, as shown in Table 7 and FIG. 5, Namil rice having Gallele is 635 bp by FLO2-outer-F and FLO2 outer-R. FLO2-inner-F (G) and FLO2-outer-R that bind to the PCR fragment of the It was expected that the 635 bp fragment and the FLO2-inner-R (A) and FLO2-outer-F bound to the Allele would show a 368 bp fragment.

PCR consisted of 10 ng of DNA and 5 pmol of a total of 4 primers, 0.2 mM dNTP mix, 1X PCR buffer [50 mM KCl, 10 mM Tris-HCl (pH 9.0), 0.1% Triton X-100, 1. It was carried out in a total volume of 20 ul using 5 mM MgCl ₂ ] and 1 unit of Taq polymerase (Nurotics, Korea). Using PTC-100® thermocycler (Waltham, USA), after initial denaturation at 95 ° C for 5 minutes, repeat at 95 ° C for 20 seconds, 59 ° C for 30 seconds, 72 ° C for 60 seconds, a total of 35 times. , 72 ° C. for 10 minutes. The results were electrophoresed on a 4% agarose gel and then genotyped.

As a result, as shown in FIG. 6, a Namil (SA) -FLO2-specific fragment could be obtained by performing PCR using the prepared FLO2 Terra-Primer ARMS-PCR primer. That is, it was found that the characteristics of the powdered endosperm of the Namil mutant progeny line can be effectively discriminated from such a difference.

Experimental Example 2-3. Verification of the effect of the primer for determining the characteristics of powdered endosperm of Namil (SA) -FLO2
stomach. Verification of the effect of dCAPs primer set
Among the mated progeny F2 individuals of Namil (SA) -FLO2 Mitsuyo _No. 23, seeds harvested from individuals in which the site related to chromosome 5 reported in the previous study is an atypical mating form are developed in the field and progeny. Fostered isolated groups. After harvesting, the endosperm characteristics of the seeds were evaluated, and these were sown to extract DNA from the plant and used for genotype evaluation. In addition, in order to confirm the selection effect in a population with a similar genetic background, the DNA of 48 Japonica varieties cultivated in Korea was used after being sold from the National Institute of Food Science (1. Ammi, 2. Alan Hyangchar, 3. White Pearl 1, 4. Shiratama Char, 5. Boram Char, 6. Boram Chan, 7. Borami, 8. Jewel, 9. Jewel Char, 10. Jewel Black Char, 11. Jeongnam, 12. Chindle, 13. Akiharu, 14. Tabo, 15. Tanmi, 16. Tampyeong, 17. Trechan, 18. Todam Rice, 19. Tonjin, 20. Tonjin 1, 21. Tonjinchar, 22. Healthy Red Rice, 23. Konyang 2, 24. Koami, 25. Koami 2, 26. Koami 4, 27. Hepum, 28. Haiami, 29. Hanam, 30. Hanmaum, 31. Black Jinmi, 32. Fukuhan, 33. Black Pearl, 34. Fukunam, 35. Fuksol, 36. Red Pearl, 37. Hopum, 38. Golden Nuri, 39. Hwason, 40. Fawan, 41. Hwayoung, 42. Hyangnam, 43. Hyun Pum, 44. Ilumi, 45. Il Pum, 46. Red Pearl, 47 .Red pearl char, 48. Black chanchar).

Miryang 23 and Namil (SA) -FLO2 mating progeny F _{2: 4} plant 38 individuals, Miryang 23 and Namil (SA) -FLO2 used as mother and father, and the original varieties of mutation. Namil rice was used as a comparative variety and analyzed under the same conditions as in Example 2. As a result, as shown in FIG. 7, when the form not cleaved by the restriction enzyme Hinf I is defined as type A and the form cleaved by the restriction enzyme Hinf I into 17 bp and 154 bp is defined as type B, it suddenly becomes Mitsuyo No. 23. The original cultivar of the mutation, Namil rice, showed type A, and only the powdered endosperm, Namil (SA) -FLO2, showed type B. In addition, the genotype of the progeny F _{2: 4} plant was atypical mating (hetero) and type A results in 19 individuals showing normal endosperm, and the phenotype in the F _{2: 4} plant was found. It was found that what is normal is dominant to powdered endosperm. At the same time, it was confirmed that the genotypes of the 19 individuals whose endosperm showed powdery characteristics were all shown as type B.

In addition, for 48 varieties of japonica breeding varieties, Mitsuyo No. 23 and Namil (SA) -FLO2 used as mothers and fathers and Namil rice, which is the original cultivar of the mutation, were used as comparative varieties. The analysis was performed under the same conditions as in Example 2. As a result, as shown in FIG. 8, it was confirmed that only Namil (SA) -FLO2 showing the characteristics of powdered endosperm showed type B, and the remaining 47 species all showed type A. From these results, it was found that the SNP according to the present invention and the dCAPs primer for the SNP can be applied to the determination of effective powdery traits.

B. Verification of the effect of the Ttra-primer ARMS primer set
Among the progeny F2 individuals that were mated with Namil (SA) -FLO2 and Miryang No. 23, seeds harvested from individuals in which the site related to chromosome 5 reported in the previous study was an atypical mating form were developed in the field and progeny. Fostered isolated groups. The endosperm characteristics of the seeds after harvesting were evaluated, and these were sown to extract DNA from the plant and used for genotype evaluation. In addition, in order to confirm the selection effect in a population with a similar genetic background, the DNA of 48 Japonica varieties (same as Example 3-1) cultivated in Korea was sold from the National Institute of Food Science. used.

Mating of Namil (SA) -FLO2 and Miryang 23 For 38 progeny F _{2: 4} plants, Miryang 23 and Namil (SA) -FLO2 used as mothers and fathers and the original varieties of mutation A certain Namil rice was used as a comparative variety and analyzed under the same conditions as in Example 2. As a result, as shown in FIG. 9, in the individuals showing normal endosperm, the results of Miryang No. 23 type (307bp + 635bp) or atypical junction (307bp + 368bp + 635bp) were shown, and all the individuals having the characteristics of powdery endosperm were FLO2 type. A fragment of (368bp + 635bp) is shown.

Further, for 48 varieties of Japanica breeding varieties, Miryang No. 23 and Namil (SA) -FLO2 used as mothers and fathers and Namil rice, which is the original cultivar of the mutation, were used as comparative varieties, and the above-mentioned Example 2 was used. The analysis was performed under the same conditions as above. As a result, as shown in FIG. 10, only Namil (SA) -FLO2 showing the characteristics of powdered endosperm was observed as a fragment of 368 bp + 635 bp. From these results, it was found that the SNP according to the present invention and the Ttra-primer ARMS primer for the SNP can be applied to effective phenotyping of powdered endosperm.

The above description of the present invention is for illustration purposes only, and a person having ordinary knowledge in the technical field to which the present invention belongs does not change the technical idea or essential features of the present invention, and does not change other concrete matters. It should be possible to understand that it can be easily transformed in various forms. Therefore, it should be understood that the examples described above are exemplary in all respects and are not limiting.

Claims (14)

The cytosolic pyruvate orthophosphate dikinase (cyOsPPDK) gene that determines the traits of the powdered endosperm of rice represented by SEQ ID NO: 2. A recombinant vector containing the gene according to claim 1. A transformant comprising the gene according to claim 1 or the recombinant vector according to claim 2. The gene according to claim 1, comprising a preparation capable of detecting a single nucleotide polymorphism (SNP) marker present at a position corresponding to 19,722,254 bp of chromosome 5 in the standard genome of rice (IRGSP 1.0). Composition for discriminating powdery endosperm traits. The powdery endosperm trait discrimination according to claim 4 , wherein the SNP marker present at the position corresponding to 19,722,254 bp of chromosome 5 in the standard genome of rice (IRGSP 1.0) has a base of A or T. Composition. The preparation capable of detecting the single nucleotide polymorphism is a sequence of 10 to 300 consecutive nucleic acids containing a base at a position corresponding to 19,722,254 bp of chromosome 5 in the standard genome of rice (IRGSP 1.0). The composition for discriminating powdery breast milk traits according to claim 4 , which is a probe consisting of a polynucleotide or a polynucleotide that specifically hybridizes with a polynucleotide complementary thereto; or a primer capable of amplifying the polynucleotide. The preparation capable of detecting the single nucleotide polymorphism is a primer set consisting of a positive primer shown by SEQ ID NO: 3 and a reverse primer shown by SEQ ID NO: 4; or an external positive primer shown by SEQ ID NO: 5. The powdery endosperm trait according to claim 4 , which is a primer set consisting of the external reverse primer shown by SEQ ID NO: 6, the internal forward primer shown by SEQ ID NO: 7, and the internal reverse primer shown by SEQ ID NO: 8. Discrimination composition. The kit for discriminating powdery endosperm traits based on the gene according to claim 1, which comprises the composition according to any one of claims 4 to 7 . The powdered endosperm according to the gene according to claim 1, which comprises confirming a single nucleotide polymorphism (SNP) marker present at a position corresponding to 19,722,254 bp of chromosome 5 in the standard genome of rice (IRGSP 1.0). Chromosome discrimination method. The powder according to claim 9 , wherein the single nucleotide polymorphism (SNP) present at the position corresponding to 19,722,254 bp of chromosome 5 in the standard genome of rice (IRGSP 1.0) is based on A or T. Method for discriminating traits of endosperm. The method for discriminating powdery embryonic milk traits includes (a) a base at a position corresponding to 19,722,254 bp of chromosome 5 in the standard genome of rice (IRGSP 1.0) using genomic DNA isolated from a sample as a template. A probe that specifically hybridizes to a polynucleotide consisting of 5 to 300 consecutive nucleic acid sequences or a polynucleotide complementary thereto; or reacting with a primer capable of amplifying the polynucleotide; and (b) the reaction. The powdery embryonic milk trait discrimination method according to claim 9 , further comprising confirming the substance. The primer is a primer set consisting of the forward primer shown by SEQ ID NO: 3 and the reverse primer shown by SEQ ID NO: 4, or the external forward primer shown by SEQ ID NO: 5 and the external reverse primer shown by SEQ ID NO: 6. The powdery endosperm trait discrimination method according to claim 11 , which is a primer set comprising the internal forward primer shown in SEQ ID NO: 7 and the internal reverse primer shown in SEQ ID NO: 8. The powdery endosperm trait discrimination method according to claim 11 , further comprising treating the reaction product of (b) with a restriction enzyme. The powdery endosperm trait discrimination method according to claim 13 , wherein the restriction enzyme is Hinf I.

Images