CN101381415A

CN101381415A - Barley with reduced ssii activity and starch containing products with a reduced amylopectin content

Info

Publication number: CN101381415A
Application number: CNA2008101301320A
Authority: CN
Inventors: 莫维尔·马太·肯尼迪; 托普·大卫; 贝特·伊恩·莱伊斯
Original assignee: Commonwealth Scientific and Industrial Research Organization CSIRO
Current assignee: Commonwealth Scientific and Industrial Research Organization CSIRO
Priority date: 2000-11-09
Filing date: 2001-11-09
Publication date: 2009-03-11

Abstract

The invention relates to starch obtained from starch grains from a barley plant. Because the content of amylopectin is reduced, the content of amylase is correspondingly improved. In addition, the grain has relatively high content of beta-glucan. The structure of the starch can be changed by a plurality of modes, and the starch has the characteristics of lower gelatinization temperature and reduced expansibility. The viscosity of gelatinized starch in the starch is also reduced. The starch has chain length distribution of the amylopectin and lower starch crystallinity. The starch has another characteristic, namely, higher content of lipid relevant to the starch, and the starch shows higher V-type starch crystallization level. The content of edible fiber of the starch is high. The characteristics are useful for food and food processing.

Description

Starch, grain and grain production method that a kind of amylose content is higher

Technical field

The present invention relates to a kind of starch, more particularly, relate to the starch that obtains a kind of starch small grain of the grain from barley plants.The method that the invention still further relates to the grain that produces this starch and thus obtained food and produce described grain.

Background technology

A discovery in the nutrition science shows, Resistant starch is healthy significant to the health of intestines especially large intestine.This good result of Resistant starch comes from a kind of nutritive substance that offers large intestine.In large intestine, a kind of energy that microbial flora obtains in the intestines forms ultrashort chain fatty acids by fermentation.These short chain fatty acids provide nutrition for the mucous membrane of colon cell, improve the intake of the more inner nutritive substances of large intestine, strengthen the physiologically active of colon.Generally speaking, if not for colon provides Resistant starch or other food fibers, the metabolism of the colon relative torpescence that will become.

Since the last few years, provide Resistant starch to become a kind of trend from various sources for the health problem that solves intestines.Therefore, the someone finds that there is some grain such as corn the inside in the starch of high amylose content, and can be used as a kind of method of improving gut health and be used in the food.

The physical structure of starch has significant effects to the nutritive property and the handling property of the starch of making foodstuff products.Some features can be considered as a kind of expression to starch structure, and, degree of crystallinity chain length distribution comprising amylopectin and crystalline form are as the V complex form of starch crystals.The form of these characteristics also can be considered as the nutritive property that food had that comprises these starch or the indication of handling property.Therefore, very short amylopectin chain length may be a kind of indication of low-crystallinity and low gelification, and also being considered to has a kind of mutual relationship with amylopectin reduction degeneration.In addition, shorter amylopectin chain length is considered to and can makes a response to the organoleptic properties of the food that includes a large amount of starch.The reduction of a kind of degree of crystallinity of starch also may be a kind of indication that the gelling temp of this starch reduces, and also is counted as relevant with the organoleptic properties that has improved in addition.The crystallization of V complex form or other lipids relevant with starch can improve the level of Resistant starch, and therefore improve the level of food fiber.

In the past, the barley kind that amylose content is very high is just identified.These barleys just relatively have been increased to the level that accounts for total starch content 45% greatly with amylose content, as the high straight chain of barley variety glacier number (being called for short AC38).The higher starch of this amylose content is useful, if but can obtain the higher starch of amylose content just better, people are just cultivating the cereal of some kinds, in the hope of obtaining the starch of 90% so higher straight chain content.These starch have very strong resistant function to human consumption, will bring better health effect.

Occur a problem when the high starch of amylose content is provided, the high starch of promptly known amylose content also has a high gelling temperature.Gelling temperature can reflect the required size reduction energy of these foods of processing.So, under normal operation, grain or flour are processed, making grain or starch make food needs higher temperature.In addition, the product price that amylose content is higher is generally higher.Equally, from human consumer's angle, producing food prepared therefrom may need longer time and higher temperature, and perhaps the flour that contains the high starch of amylose content being made food may need longer time and higher temperature.Therefore, the supply of the starchy food that amylose content is high is in a great inferior position.

The another kind of nutrition of cereal, particularly barley is beta-glucan.Beta-glucan is by forming by β (1-4) and/or β (1-3) glycosidic link bonded glucose unit, can not be by the human consumption enzyme liberating, make it to become a kind of source of suitable food fiber.Beta-glucan can be partly by interior living colon bacteria digestion, and the short chain fatty acid (mainly being acetate, propionic salt and butyrates) that this fermenting process produces is to useful along the mucomembranous cell of intestinal tube and colon arrangement.(Sakata and Engelhard Comp.Biochem Physiol. 74a:459-462(1983))

The picked-up of beta-glucan can also obtain excretion that improves bile acide and the effect that therefore reduces serum cholesterol total amount and low-density lipoprotein (LDL) level and reduce coronary heart disease danger.Similarly, the skew of blood sugar concentration plays a role beta-glucan by weakening after meal.It is generally acknowledged that these two kinds of effects all are the bases that increases to the viscosity of material in the stomach and intestine.

The substantial connection of these bag formations of starchy foods and these starch and other nutrition or other composition has significant effects to the nutritive value of these foods or the making of food or the functional performance in the structure.

A kind of functional food that can not be provided by unmodified material can be provided providing as treated starch or the such material of beta-glucan, and this course of processing has following shortcoming: or change other valuable compositions, or the undesirable sensation that in modifying process, produces.Therefore, preferably provide some can be used for the composition source of food with unmodified form.

Barley type MK6827 belongs to barley germplasm series (USDA-ARS whole nation small grain germplasm research institution, Ida. Aberdeen city 831290).The grain of MK6827 is shunk back, and shell bright-colored is elongated shape.In inventor's hand, this grain is difficult to process, comprising wear-resisting broken in the extreme.These performances of MK6827 grain also were not identified in the past, and the essence of species sudden change is not determined yet, is considered to can not be used for carrying out foodstuff production yet.

Summary of the invention

The present invention relates to a kind of barley plants, the grain of this barley plants is found and contains a kind of starch, and this starch has less amylopection content, thereby has the higher amylose starch of relative content level, and has therefore improved the contents level of food fiber.

These grain also contain the beta-glucan that content has improved.Beta-glucan that content has improved and the combination that forms the Resistant starch of the high food fiber of content are regarded as of the present invention one big characteristic by inventors.

In addition, it is found that the starch that these grain contain has amylose starch and the low gelling temperature that level is high relatively.This starch in gelification and low expansion character after this in some edible food processed and applied, also have advantage.

In addition, these grain are found the starch that comprises and contain the high amylose starch of level relatively.The starch content of the horizontal exceeding 50% of the amylose starch of being found, this level never was found in coming from the unmodified starch of barley in the past.

This starch has a kind of structure that has changed by following one or more concrete physical property indication: the higher amylose starch of relative content level, not accessibility physically, the particle form that has changed and the lipid relevant with starch that high beta-glucan content causes, this Resistant starch also has a kind of structure that has changed by following one or more characteristic indication: chain length distribution with the considerable lipid relevant with starch of the amylopectin of low-crystallinity, reduction.

On the one hand, the present invention can be described as and be the starch that obtains from a kind of barley plants grain, and above-mentioned starch granules then has the very high amylose starch of content because reduced amylopection content.

From another aspect widely, the present invention can be described as a kind of grain that is the suitable foodstuff production that obtains from a kind of barley plants.Starch in the above-mentioned grain then has the very high amylose starch of content because reduced amylopection content.And described grain itself is fit to foodstuff production.

The invention still further relates to a kind of method that produces barley plants, said method comprising the steps of: a) adopt sodiumazide to bring out the no barley kind Himalaya of sudden change to obtain mutant strain, b) obtain the grain seed from described mutant strain, c) the screening endosperm dwindles phenotypic grain seed from the grain seed that step b) obtains, and perhaps screens the grain seed of high amylose content.

Description of drawings

For the ease of understanding, the present invention will provide some to be described with reference to example.

The starch molecule size distribution of HPLC (HPLC (high performance liquid chromatography)) separation determination of the starch of Fig. 1 in 90%DMSO (dimethyl sulfoxide (DMSO)) is analyzed.(a) Himalaya (b) AC38 (c) 342 (d) 292

Fig. 2 shows the picture of the particle form of emergency sport and maternal kind.(a) Himalaya (b) AC38 (c) 292 (d) Waxiro (e) 342 (f) adds seemingly firmly and draws (g) MK6827 (h) Sloop. particulate length (L), width (W), and the size of thickness (T) explains through diagrams in photo (a).

Fig. 3 adopts the chain length distribution analysis of the auxiliary carbohydrate electrophoresis (FACE) of fluorophore to various emergency sports and wild-type starch.(a) chain length distribution (b) of normalizing not chain length distribution contrast of same district.Sample has 342 (■), and 292 (●) add seemingly firmly and draw (s), AC38

MK6827 (◆) and Himalaya (+).

The RVA of Fig. 4 barley starch sample analyzes.Sample has Himalaya

Namoi (△), AC38 (zero), 342

292 (▲) and MK6827 (■).The temperature curve that uses in the skiagraph is represented by successive lines.

The X-ray diffraction data of Fig. 5 emergency sport and wild-type

The electron photomicrograph of the barley starch scanning that Fig. 6 emanates out.(a) Himalaya (b) Waxiro (c) AC38 (d) 292 (e) 342 (f) MK6827

The site plan of Fig. 7 barley chromosome 7H, show that the position of nud1 and sex6 is close ( Http:// wheat.pw.usda.gov/) barley form gene, 7H figure, author: Franckowiak JD.

Fig. 8 292 x add the seed sizes and the chain length distribution relation of starch of drawing double monoploid type seemingly firmly.The lines that (+) forms are represented Himalaya PCR, and the lines that (zero) forms are represented 292 PCR.Figure (A), the seed length that the percentage of DP (polymerization degree) starch chain between 6 and 11 is divided and the ratio of thickness; Figure (B), the seed weight that the percentage of DP (polymerization degree) starch chain between 6 and 11 is divided.

Fig. 9 comes from the cDNA sequence (SEQ ID NO 1) of a kind of barley SSII of cultivated variety plant Himalaya (Himalaya).

Figure 10 is from (1) T.tauschii (diploid wheat), the SSII gene structure of (2) barley cultivated variety plant Morex.Thick lines are represented exon, and hachure is represented intron.Straight line below each sample is represented the residing zone of gene order.Dotted line is represented the zone from the barley SSII gene of intron 7, and this gene is not process ordering also, but determines that according to pcr analysis length is approximately 3kb.

Figure 11 MK6827 (SEQ ID NO 2), the SSII cDNAs of Morex (SEQ ID NO 3) and 292 (SEQID NO 4) precognition, and the contrast of the cDNA sequence of Himalaya (SEQ ID NO 1).The sequence of precognition is tested and appraised the residing zone of the genome sequence that is present among the Himalaya SSII cDNA and produces.The method for expressing of ATG initiator codon and wild-type terminator codon and be present in MK6827 (#) respectively and 292 (﹠amp; ) in extra terminator codon the same.

Figure 12 is from barley type 292 (SEQ ID NO 7), Morex (SEQ ID NO 5), MK6827 (SEQ ID NO 8), the comparative analysis of the aminoacid sequence of deducing out for the gene of SSII coding in the Himalaya (SEQ ID NO 8).Be present in extra terminator codon among the 292 and MK6827 respectively by symbol (﹠amp; ) and (#) expression.

The position of the barley SSII transgenation among Figure 13 MK6827 (SEQ ID NO 2) and 292 (the SEQ ID NO 4).

Figure 14 is to the progress and the purposes of the PCR chemical examination of 292 sudden changes.(a) by the SSII zone diagram of the Himalaya of ZLSS2P4 and two introductions amplifications of ZLBSSIIP5.(b) 292 the SSII gene region diagram of being amplified by ZLSS2P4 and ZLBSSIIP5 shows the disappearance that NlaIV is ordered.(c) barley is through the sepharose body electrophoresis of postdigestive NlaIV product; Row M; The dna marker ladder, row 1 are MK6824, row 2 are Himalayas; Row 3 are to add seemingly firmly to draw; Row 4 are 292; Row 5 are 342.

The proteinic SDS-PAGE electrophoresis of Figure 15 starch small grain.Among the figure (A), 8% acrylamide (37.5:1 Acryl/Bis) SDS-PAGE gelinite carries out electricity suction and detection with a kind of SSII antibody relative with pure particle bonded SSII protein that produce from wheat.Among the figure (B), 12.5% acrylamide (30:0.135Acryl/Bis) is coated with silver.Determine that the migration (unit is kd) of the molecular wt standard of quality represents in each face of chart.

SSII after the diagram that Figure 16 DNA constitutes thing is used for that the standard barley is stable and changes expresses.(1) the SSII gene in the nucleosides 1 to 2972 (sequence is referring to chart 9) inserts between the promotor gene and terminator of visual direction.(2) the SSII gene inserts between promotor gene that opposite orientation feels and the terminator (sequence is referring to chart 9) in the nucleosides 2972 to 1.(3) two reconstitute in the thing, and the introne 3 of the barley SSII gene (between the nucleosides 1559 and 2851) of Morex SSII genome sequence inserts between the

exon

2 and 3 of Himalaya barley SSII cDNA (nucleosides 363 to 1157 in the chart 9).

Embodiment

Several definition

Glucemia index: a kind of food such as white bread or glucose contrast that is put to the test to the effect of the skew of blood sugar concentration.The glucemia index is to measure relevant food to a kind of standard of measurement of effect of serum glucose concentration after meal, also is to measure a kind of standard of measurement of keeping the required Regular Insulin of blood sugar running balance.

Resistant starch: do not absorbed but the summation that enters the starch and the starch digestion product of large intestine by healthy people's small intestine.Therefore, Resistant starch does not comprise that digestion is fallen and by the product of little intestinal absorption.

Resistant starch can be divided into four groups.

Resistant starch 1 physically is difficult to the starch that obtains: the starch of this form remains in protein or the similar matrix as being present in starch, or in the plant cell wall; Perhaps be present in not exclusively pulverizing in the particle of grain, or in the leguminous plants after freezing.

Resistant starch 2, the resistance particle: this is often referred to thick starch, as results from the thick starch of immature soil beans or green banana, and in the starch of some beans and high amylose content.

Resistant starch 3, degeneration starch: this starch result from the heat/wet treatment of starch or be present in as boil and starch foods such as refrigerative potato, bread and cornflakes in.

Resistant starch 4, the starch of process chemical modification: the generation of this starch is owing to chemical modification, as substituting or crosslinked reason.In the food of the starch of this form through being usually used in processing.

Food fiber: be defined as the summation that is not absorbed but enter the carbohydrate or the carbohydrate digestion product of large intestine here, comprise Resistant starch, beta-glucan and other solvable and insoluble carbohydrate polymer by healthy people's small intestine.Food fiber means that comprising the large intestine microbial flora fermentable is the fermentable carbohydrate of part at least.

Pectisation: refer to the collapse (disintegrating) of the molecular order of starch small grain inside, the irreversible in nature change of simultaneous, as grain expansion, the crystallite fusing, the double refraction forfeiture, viscosity increases and starch dissolution.

The present invention comes from the separation of emergency sport barley plants and sign.According to discovery, the contained starch amylopection content of the grain of this kind of plant reduces and the high amylose starch of consequent relative content level, and contains the food fiber of high level.

According to discovery, these emergency sport plants have the very gratifying characteristics of many ideal, and verified: other various genetic backgrounds that generate with its hybridization still are retained to the described desirable characteristics of small part.

The grain of some genetic backgrounds that the grain of this emergency sport and hybridization generate has extra high-caliber-glucan content, it had-the glucan content level improves and the combination of two characteristics of food fiber contents level raising, thought characteristic of the present invention by inventors.

In addition, it is found that in some genetic backgrounds that at least the contained starch of grain that comes from these emergency sports has amylose starch and the low gelation temperature that level is high relatively.This starch agglomerative expansion characteristics have the benefit of low bulk, and this makes to have advantage in some food and food processed and applied.

In addition, come from the starch that the grain of these emergency sports contains and contain the high amylose starch of level relatively, surpass 50% of starch content, this level was never found in coming from the unmodified starch of barley in the past.

According to test to backcrossing, the starch of emergency sport shows a kind of like this Resistant starch, this Resistant starch has a kind of structure that has changed by following one or more concrete physical property indication: the amylose starch that the relative content level is higher, the not accessibility physically that high beta-glucan content causes, the particle form that has changed, and the lipid relevant with starch, this Resistant starch also has a kind of structure that has changed by following one or more characteristic indication: low-crystallinity, chain length distribution with the considerable lipid relevant of the amylopectin of reduction with starch.

In addition, up to now, from the sudden change barley plants grain can easily be applied to the food processing process.

Come from starch that the grain of a kind of form of these emergency sports contains and have the beta-glucan that level high food fiber, especially amylose starch and content relatively improve.Beta-glucan and high food fiber that content improves combine, be used as a characteristic of the present invention by the inventor, provide the source of the uniqueness that beta-glucan and Resistant starch combine simultaneously, at least in the present invention widely in the form scope, do not need beta-glucan and soluble food fiber are mixed, do not need moiety is made modification yet.

Known to the inventor, barley plants of the present invention is to find first, in the Resistant starch of this barley grain, improved the contents level of amylose starch relatively, improved the contents level of food fiber relatively, also improved the contents level of beta-glucan, its beta-glucan content is in the high-order of general beta-glucan content or is higher than this level.The grain that beta-glucan content is higher belongs to the wax phenotype, so its amylose starch level is low.

The rangeability of the β in the known barley--glucan content is very big, calculate with barley weight, about 4% to 18% about between scope, but more generally between about 4% to 8% (people such as Izydorcyk, 2000 agronomy and food chemistry magazine 48,982-989; People such as Zheng, 2000 cereal chemistries 77, people such as 140-144 Elfverson, 1999 cereal chemistries 76,434-438; People such as Andersson, 1999 food agronomy science magazines 79,979-986; People such as Oscarsson; 1996 cereal science magazines 24,161-170; People such as Fastnaught; 1996 Crop Sciences 36,941-946).Barley variety after the improvement is developed, and as Prowashonupana, the weight of contained beta-glucan accounts for about about 15% to 18%, but it belongs to a kind of wax phenotype.These are improved the breed with Sustagrain ^TMTitle sell (ConAgra ^TMSpecial cereal product company, the Nebraska,USA Omaha).

The beta-glucan contents level of the present invention's expection may depend on genetic background, and the activity of amylopectin synthetic enzyme is lowered in this genetic background.Yet the reduction of amylopectin synthase activity is believed to promote the level relatively and the beta-glucan level of food fiber again, and food fiber partly shows as amylose starch.A kind of explanation of following rising for relative amylose starch level rising back beta-glucan level is, this rising may be the result that endosperm reduces the back concentration effect, also may be by being synthesized to beta-glucan synthetic carbon conversion by starch, the beta-glucan contents level further raises.

Like this, the relatively suitable content of the beta-glucan of barley grain is greater than 6% of hulled grain weight not, even 7%, preferably can surpass 8%, yet the beta-glucan level in the wax emergency sport is through measuring up to 15% to 18%, and barley expection beta-glucan contents level of the present invention is compared the same high level that can reach with the wax emergency sport, even higher.

In second kind of desirable form, except having high relatively amylose content, the gelation temperature of barley grain also lower (passing through determine with dsc method).Be the shown data of barley that is used for illustration, this gelation temperature has not just reduced when the starch that barley produced that raises a little with amylose content is compared, when comparing with the starch with normal amylose content, the gelation temperature has also reduced.Therefore the lower gelling temperature of the present invention's expection is for the high starch of amylose content, also is for the normal starch of amylose content,

In addition up to now, in genetic background, checked starch also has an obvious characteristic, and promptly the swelling property in the water of the surplus that heats is lower than the swelling property of other starch of testing.

In the third desirable form, the amylose starch level of starch is higher than 50% of starch content, and in stemming from the unmodified starch of barley, this level was had no precedent in the past.

The relative amylose content of barley starch of the present invention is very high, and the content that can expect than SSII gene or other starch synthase transgenation mutation is much higher.Wheat emergency sport among the SSII causes the amylose starch level to be about reaching 35% of starch.Amylose content in the vulgare grain starch is approximately 25%, and when content substantially exceeds 25% (as 30%), the amylose content in the starch can be thought and has been enhanced.The content that is considered to the known barley of high amylose starch is 35-45%.Yet, the invention provides amylose content greater than 50% barley, this is a unprecedented level at the unmodified starch that stems from barley.

Amylose content may be greater than 60% even 70% relatively.Can also look to it is higher level, so just may reach higher level in other plant by breeding single variation, and this type of is on close level 90%.Amylose starch level of the present invention like this can be greater than 80%, even greater than 90%.

In the 4th desirable form, starch has altered structure, and this structural modification has produced Resistant starch.This may cause because of high amylose content.Resistant starch also may produce owing to beta-glucan is in a higher level; and the provide protection of following the associating of starch small grain to produce probably owing to beta-glucan; associating closely provides provide protection for starch potentially; thereby provide resistibility; this resistibility may be by the characterization of RS1 form, and is nondigestible to a certain extent.As a same reason, the starch of being measured by V-composite junction degree follows the associating of lipid also may the level of resistivity starch to be acted on to some extent.Since it is so because the existence of lipid, starch become be difficult to approaching, thereby produce resistivity probably, thereby this may be counted as RS1 starch.The degeneration starch utmost point of having known the V complex construction is not easy to digestion, thereby estimates that the amylopectin that constitutes the complicated crystalline texture part of V also can be not easy to absorb by the utmost point.Because starch granule structure, the starch of illustrative barley grain may be difficult to absorb, thereby have RS2 starch.These characteristics may occur individually, also may two or morely occur simultaneously.

The foodstuff fibre that improves may partly show as the Resistant starch form at least, and this starch may contain the amylose starch of very high above-mentioned starch small grain.

The amylose starch relative content may be greater than 60% even 70%.Also being expected is higher level, so just may breed other plant to reach higher level by single mutation, and this type of is on close level 90%.Amylose starch level of the present invention like this may be greater than 80%, even greater than 90%.

Be expected barley and can also express the activity level change of one or more amylose synthetases or other enzyme, thereby further improve the level relatively of amylose starch.Barley may be carried another kind and can further be reduced or change the biosynthetic sudden change of amylopectin like this, and perhaps carrying to increase biosynthetic sudden change of amylose starch or genetic background.For example, barley may show a kind of amylose starch additive genotype, as carries the barley of amo 1 sudden change.The example of this type of plant has AC38 kind (being the glacier high amylose starch).

Be appreciated that in the level relatively of this amylose starch of mentioning relevantly with the starch whole content, thereby the starch residuum may mainly be the osculant of starch, or amylopectin, or both mixtures.In the barley of being analyzed, the amylose starch level of raising is to be produced by the amylopectin level that reduces, thus amylose starch relatively level be not to produce by the synthetic amylose starch that improves.

Known that beta-glucan has the effect of the digestion in the small intestine that slows down, as long as have it and another kind of food composition to exist.Similarly, known that the molecule with resistibility that closely adjoins with starch small grain helps to shelter starch, thereby and it has been difficult near strengthening its resistivity.Because with the combination of lipid the resistance level of amylose starch and other form starch is improved, the molecule by having resistibility and the contiguous physical of starch small grain will further improve.So just strengthened the effect of Resistant starch greatly, and other beneficial effect that is produced by high beta-glucan level is provided.

The beneficial effect of having known Resistant starch and beta-glucan in addition has a dose response, thereby thinks that the Resistant starch enhanced level in addition of improving the standard of beta-glucan will strengthen the benefit to health.

At least be the beta-glucan of the optional form of the present invention and the former undiscovered mistake of combination of Resistant starch high-content level, of course not come from a source that does not have modification or purify, this form of the present invention like this provides single practical source for these benefits.

The valuable aspect of another of this starch is exactly, although amylose starch relative content height, the gelation temperature of being measured by dsc is still very low.This and common discovery form contrast, and promptly high amylose starch trends towards having higher gelation temperature, this temperature limitation utilize the method for the starch of high amylose starch.In at the shown data of illustration barley, the gelation temperature is not only compared with the starch that amylose content improves a little and has been reduced, and compares with the starch with normal amylose starch level, and the gelation temperature has also reduced.Simultaneously, a desirable aspect of the present invention has expected to have lower gelation temperature with respect to high amylose starch starch, and it it is also contemplated that with respect to the starch with normal amylose starch level to have lower gelation temperature.For high amylose starch starch, the processing aspect needs higher temperature and more energy input, and this not only needs higher cost, and may damage the functional of other food composition.Similarly, from ultimate consumer's angle, the high amylose starch starchy food also may be more inconvenient, because need higher temperature and longer time when preparing.Like this, for example, in this optional form of the present invention, can provide a kind of product such as noodles now, need in container such as teacup, add boiling water or hot water, and not need reheat for some time, the composition of resistivity starch and other nutritious value can be offered large intestine.

The energy requirement that the low temperature of the present food of main acting body of the low gel temperature of these starch requires and food is pulverized is low.Its inevitable outcome is, food processing and mix and can at room temperature carry out is heated mixture then, and low gel temperature has also shortened the needed time of gel that reaches.In addition, when temperature is lower than the complete gel of normal starch when temperature required, the present invention will have more complete gel than conventional starch.

One of mensuration of gel ability is reflected on the thermal characteristics of being measured by DSC (dsc).The beginning on DSC first summit (gel summit) may be lower than 53 degrees centigrade, is lower than 50 degrees centigrade better, preferably is lower than 47 degrees centigrade.The beginning that begins can be regarded as gelation on first summit.Starch first summit that is produced by barley grain may be less than about 60 degrees centigrade greatly, is lower than 55 degrees centigrade better, preferably is lower than 52 degrees centigrade.The Δ H (enthalpy) on first summit may be lower than 3.5, is lower than 1.0 better, preferably is lower than 0.5.

Another discovery of gelation that comprises the flour of starch of the present invention is that they have showed lower swelling property.The typical measuring method of swelling property is that starch or flour are mixed with superfluous water, and the heating elevated temperature is usually greater than 90 degrees centigrade.Collect sample by centrifugal filtration process then, swell increment is represented divided by the value of sample dry weight with sedimentary quality.The swell increment of starch that comes from wax and common barley is approximately greater than 5.5.The swell increment of the flour of being made by the high grain of amylose content (AC38) is approximately 3.75.Yet the swell increment of the emergency sport of being test and the grain of crossbred is less than 3.2, less than 3.0 more, but usually greater than 2.

During contents of starch, the low bulk of gelation is particularly useful in improving the particularly moisture foodstuffs preparation of foodstuffs preparation.Under current situation, its be used for possibly raising content of foodstuff fibre of colloidal sol or the preparation of other liquid may be restricted in addition to the conveying of foodstuffs preparation.

Prepare food if desired fast as making things convenient for soup, instant noodles etc., this characteristic combines with the gelling temp of the shown reduction of starch, just can strengthen the nutritive validity of food greatly.

Supposing that the gelling temp effect is the result of grain embryo Ruzhong amylopectin structural changes, is exactly chain length distribution (extent of polymerization) by the starch molecule behind the isoamylase debranching to one of measure of this structure.The chain length analysis of the amylopectin in the illustration SSII emergency sport starch shows that behind debranching, the chain length distribution of them is 5 to 60, and be shorter than the length allocation of the starch that no emergency sport produced behind the debranching.Branch's frequency of the starch that chain length is shorter also will suitably increase.It is chain length distribution that starch also has shorter amylopectin like this.The polymerization degree is that the ratio of 6 to 11 starch chain may be greater than 25%, greater than 30% better, more preferably greater than 35%.The polymerization degree is that the ratio of the starch chain of 12-30 may be lower than 65%, is lower than 60% better, is preferably lower than about 55.The polymerization degree is that the ratio of the starch chain of 31-60 may be lower than 10%, is lower than 8% better, and is higher than 5%, preferably is higher than about 6%.Three kinds of chain length scope ratios are taken all factors into consideration and more are better than independent consideration, and can be used for judging whether a kind of starch meets the present invention.

Chain length distribution reduction causes lower gelation temperature possibly.Chain length reduces also to be considered to strengthen the organ sensation of starch, and especially mouthfeel so just can reach smoother product.In addition, the amylopectin chain length reduces also to be assumed to be and may reduce the degree that amylopectin is degenerated, and this degeneration impacts quality of food, and for example, it is considered to the bread extremely important effect of having worn out.

In addition, the starch structure in the illustration starch demonstrates crystallinity change again, has reduced because compare degree of crystallinity with the common starch of separating from barley.When with chain length distribution the combining of amylopectin of having reduced, the particle degree of crystallinity that has reduced may show that gelling temp will be lower.Starch has reduced degree of crystallinity and also has been considered to relevant with strengthening the organ sensibility, and shorter amylopectin chain length can make smooth mouthfeel better.Like this, because the activity level of one or more amylopectin synthetic enzyme has reduced, starch may also can show lower degree of crystallinity.It is about 20% that the ratio of the degree of crystallinity that starch shows may be lower than, and preferably is lower than 15%.

Also have a kind of method of measuring the performance of starch to measure its viscosity exactly.By using quick viscosity analyzer (RVA) to find, the viscosity of starch of the present invention and be obtained from the common starch of barley, waxy starch, and the viscosity of high amylose starch is made a world of difference.These measurements are made of semolina, and this specific character of starch will be dominant in these are measured.The high viscosity of common and waxy starch is about 900 to 500RVA unit, and the high viscosity of known high amylose starch is greater than 200, and the high viscosity of barley is lower than 100 according to the present invention, and majority is lower than 50, also has only 10RVA unit in some plant.The people who is good at this technology can both understand, and experimental considerations unit parameter of quoting and the result who quotes are used for by RVA (fast viscosity analyzer) or similarly instrument such as amylograph show the relative performance of these starch.

Except above-mentioned degree of crystallinity, starch also may show obvious characteristic owing to starch exists with the V comprehensive form.The inventor thinks that this is that starch is presented in the starch small grain of cereal with this form and appreciable quantity for the first time.This form of starch is associated with the starch of degenerating usually, is especially having under the situation of contact with lipid.In the present invention, suppose that starch structure allows the formation of intimacy between vegetable lipid and the starch, this has just caused the V compages.This form of starch also is considered to have health-care effect, because it has reduced digestibility, thereby may form Resistant starch.

Other structure formation also can interact be produced by lipid starch, and comprises noncrystalline lipid starch association.The present invention also can be described as and is like this, and in the barley plants, because the activity level of one or more amylopectin synthetic enzyme reduced, but this barley plants has been showed the starch lipid association of perception quantity in grain endosperm starch content.The starch that comprises starch lipid association comprises that those show the starch of V compages, also have resistivity to digestion usually, thereby can improve the level of foodstuff fibre.The ratio of the crystal starch of the crystallized form of performance starch lipid association is preferably greater than 50%, and is better greater than 80%.

But the A comprehensive form that the starch with V comprehensive form also may not showed the starch of perception quantity.If there is not the A comprehensive form, may show the existence of starch of the present invention.

Find that also the starch made by grain of the present invention and the tack temperature of product have raise greatly.The tack temperature of known starch is lower than 70 degrees centigrade, and this is suitable for the starch of common amylose content and high amylose content.Yet the tack temperature that starch of the present invention shows is higher than 75 degrees centigrade, is higher than 80 degrees centigrade better.Notice that these all are that empirical formula is measured, with respect to the method for masurement of other starch.

The starch of finding the illustration barley has a large amount of foodstuff fibres and Resistant starch, this growth may be because the high result of relative content level of amylose starch at least in part, yet also has the effect of foodstuff fibre, because the existence of starch lipid association, comprise the V-type compages, or because the tight associating of amylose starch or amylopectin and beta-glucan.Similarly, the beta-glucan level of rising also may play significant role to the rising of foodstuff fibre.

Amylose starch in the endosperm of the barley of lifting the rising of level relatively causes because of amylopectin generation variation most likely, and the generation of amylopectin changes the result of the activity reduction that is the SSII enzyme.

Have sudden change in the gene of above-mentioned codase and may demonstrate the amylose content of rising and/or the amylopectin level that reduces.Amylopectin is synthetic have been reduced if having only, and starch can show the amylose starch level of relative rising.

The activity of amylopectin synthetic enzyme reduces and can reach by the adjusting sequence of sudden change suitable in the corresponding gene or gene.The repressed degree of gene will be determined the characteristic of the starch made to a certain extent.Suddenly change as the SSII in the barley, illustration sudden change of the present invention is the truncate mutation body, and known that these character to starch have great effect, yet leaky mutant also may change the structure of amylopectin, and this leaky mutation physical efficiency effectively reduces the amylopectin synthase activity with starch that barley is provided or the beneficial characteristics in the particle.Other chromosome rearrangement also may effectively comprise disappearance, and inversion repeats, or point mutation.

This type of sudden change can be incorporated in the genetic background of wanting, and by the useful kind of mutagenesis, more reliable is by emergency sport and plant hybridization with genetic background of wanting, and carries out backcrossing of proper amt, to remove the parent background that wouldn't like to want.Can realize that sudden change separates by the mutagenesis plant is screened.

The molecular biosciences method can be used as the substitute process for selective of traditional method.The SSII sequence is presented in this specification.Carrying the carrier of the sudden change of wanting and selectable mark may be directed in tissue culture plant or the suitable botanical system, as protoplastis.Be incorporated into karyomit(e) to substitute the plant of existing wild-type allele for sudden change, can have used the suitable nuclei acid probe device that is exclusively used in sudden change and phenotype observation to screen.The method for transformation of monocotyledons (as barley) and come from protoplastis or the immature embryo's of plant plant regeneration method very famous in this technology, see " Canadian patent application 2092588 " that Nehra proposes, " No. 61781/94 application of Australian Patent " that Canadian National Research Council proposes, " Australian Patent 667939 " that Japan Tobacco Inc (JTI) proposes, and " the international monopoly PCT/US97/10621 number application " of the proposition of Monsanto (Meng Shandou) company, other method is described in " WO99/14314 patent description ".

Except using sudden change, also can adopt other method of knowing to change the activity of amylopectin synthetic enzyme.Like this, for example,, can driedly scratch single or multiple gene transcription and processing that the amylopectin synthetic enzyme is encoded by the expression of suitable antisense molecule.These may be based at this being the illustrated dna sequence dna of barley SSII gene.The sequence that these antisense sequences can be used for structure gene or genetic expression and bonding activity are controlled.These sequences are mentioned hereinbefore.The method of design antisense sequences is very famous in this technology, have " U.S.'s 5190131 patents " of example can be provided, " European 0467349AI patent description ", " European 0223399AI patent description ", and " European 0240208 patent description ", provide the situation of the method for carrying out antisense technology they integrators at this according to them.Import in plant and safeguard that the method for this type of sequence publishes, thereby be known.

The variation of antisense technology is exactly to utilize ribozyme.Ribozyme is the RNA molecule that has the enzyme function, can cut other RNA molecule in the antisense sequences appointed positions.The RNA cutting hinders the expression of target gene.Reference paper comprises " European 0321201 patent description " and " WO97/45545 explanation ".

Another the molecular biosciences method that may use is exactly common the inhibition.The common mechanism that suppresses is not fine understanding, but it relates to extra gene replication is put in the plant of normal tendency.In some cases, target plant genetic expression is interfered in extra gene replication meeting.For carrying out the common method that suppresses, reference paper comprises " WO97/20936 patent description " and " European 0465572 patent description ".

The method of the another kind of use dna sequence dna that may use is a double-stranded RNA intermediary gene inhibition.In the method, DNA is used to guide the synthetic of double-stranded RNA product.The existence of duplex molecule has caused the reaction of plant defense system, has destroyed double-stranded RNA and has come from the RAN of target plant gene, reduces or eliminated the activity of target gene effectively.About carrying out the method for this technology, reference paper comprises " Australia 99.The 292514-A patent description " and " WO99/53050 patent description ".

Can think that the present invention may result from the result who uses the molecular biosciences method to reduce the activity level of two or more genes of mentioning.

A kind of staple product that especially just is considered as high amylose starch and high beta-glucan content results is to have reduced glucemia exponential lower calories prod.Lower calories prod may be based on the inclusion of the flour of being made by crushed particle.Yet perhaps people wish at first grain to be carried out granulating processing, remove 10% or 20% of grain gross weight, therefore remove aleurone layer, eliminate embryo with bigger degree simultaneously.The effect of granulating processing is to reduce lipid content, thereby reduces the caloric value of food.This group food can be allayed one's hunger, and strengthen stomach health, reduce serum level of glucose and lipid concentration after the meal, and food low in calories is provided.Use granulated product that the nutritive ingredient that provides by aleurone layer and embryo will be provided.The flour of being made by granulated product has better outward appearance probably, and is whiter because the product of making so always seems.

Some aspect of the present invention also derives from the combination and the high-caliber foodstuff fibre of aleurone layer and embryo.Particularly derive from be present in give higher relatively aleurone layer and embryo in the example grain.At first, barley has the aleurone layer more much higher than other commercial cereal, and this is because it has three cell aleurone layers.Secondly, the example barley particles can shrink, and this just means that endosperm quantity reduces, and this just causes the relative populations of aleurone layer and embryo to increase.Like this in the mixing in the Resistant starch delivery system, barley just has high-caliber relatively specific beneficial element or VITAMIN, comprise divalent cation (as the available Ca++ of biology), VITAMIN (as folic acid), and antioxidant (as vitamin-E and tocotrienols).Like this, when providing material, just determined calcium, thereby reduced the danger that gets osteoporosis old age for the growth of bone and other calcified tissue and deposition.When folic acid just consumed in the mode near the notion formula, it can provide provide protection at neural tube defect, reduced the danger of cardiovascular diseases, thereby improved resistivity starch and beta-glucan bonded effect.Folic acid also is believed to reduce the risk of particular cancers.Vitamin-E and fertility triolefin powder carry the benefit of antioxidant, thus be believed to reduce cancer and cardiopathic risk, and have the effect that reduces undesired oxygenizement in the food composition, for example can cause the smelly lipid acid that loses.When constituting a kind of convenient packing when barley particles or by these compositions of this optional form of its product of making and a kind of particle, a kind of special shape of the product of milling may be exactly that aleurone layer is included among the product of milling.May take special method for grinding with the milled quantity of the aleurone layer in the product of raising.These class methods are mentioned in Fenech and other people ((1999) J Nutr 129:1114-1119).Like this, any product that comes from cereal that milled or other form processing all will comprise aleurone layer and embryo, thereby have extra nutritive ingredient, and not need to add these elements to product again from other source.

Know that barley plants of the present invention is to have to be more suitable for being particularly suitable for the cereal of commodity foodstuff production in producing food.This production can comprise that flour or other are used for the batching product of commodity foodstuff production.The purposes of low one-level is its content about 12% or surpasses 15% starch.Perhaps, this production comprises similarly and can wear into powder to cereal; Therefore, though the cereal of most of shapes all can be worn into pearl barley product, the structure of some cereal then is not suitable for wearing into powder especially.Another characteristics that influence the commercial processing variety of cereal are that the product of producing can variable color.Therefore, the epidermis or the other parts of cereal develop the color significantly, and such as purple, and these and product mix, and limit its suitable commercial applications, such as, its colored semolina is as the batching of bread.In general, the barley of no skin uses also more convenient, because processing causes bigger difficulty to the epidermis on the barley grains to cereal.Another aspect that improves the value of barley plants is, extract starch from cereal, and extraction yield is high more, and is useful more.The shape of cereal is another feature that influences the commercial use of cereal, and the shape of cereal can influence difficulty of processing, or makes it be difficult to wear into powder.For example the grain shape anomaly ground of MK6827 is long, to such an extent as to be difficult to wear into powder or processing.The easy standard of measurement of this extended shape and operability thereof is two morphological specificity length of cereal and the ratio of its thickness (L/T ratio).This ratio is often determined by the characteristic of starch.The contriver finds that the L/T ratio that MK6827 had is greater than 6.Therefore, perhaps the L/T ratio of the barley plants with emergency sport SSII gene that is screened although estimate its range extension to bigger ratio, arrives less than after 5.8 or 5.5 within about scope of 4 to 5 at least, still can use.

The ideal genetic background will comprise considers business earnings and other characteristic.This specific character can comprise whether want winter or spring barley variety, agro-farming performance, resistance against diseases and to the resistivity of inanimate pressure.In Australia, people possibly Si Lupu (Sloop), this storehouse Neil (Schooner), Quebec (Chebec), Franklin (Franklin), my Pai Ersi (Arapiles), add and draw your moral Neil (Gairdner) of (Tantangara), Gary grace (Galleon), lid or skin koala (Picola) barley of etc.ing to hybridize cultivated variety seemingly firmly.Above-mentioned kind is suitable for Australian producing region, and other kind is fit to other producing region.

Want to obtain bigger income, just need fuller grain, and some benefit of this invention can obtain thus also, for example, produces the starch of high starch of amylose content or change chain length distribution.And the others of this invention then can better be realized by not full grain.Because in the not full grain, the ratio between aleurone layer or embryo and the starch may be higher, so, the higher barley flour or the other products of effective moiety content of aleurone layer can be provided.The product that this aleurone layer content is high may have higher vitamin contentss such as folic acid, perhaps higher content of mineral substances such as calcium, and these VITAMIN and mineral substance combine with higher resistant starch content and/or higher beta-glucan content, the effect of cooperation just can be provided, for example in large intestine, promote the absorption of mineral substance etc.

In order to make amylose starch reach maximum quantity, also can make barley plants have other additional phenotype feature, so that reduce the activity of one or more amylopectin synthetic enzyme, make its genetic background have higher amylose starch phenotype, for example amol mutation among the AC38 (the unknown of cause and effect gene) and wax mutation (for example mutation in the Wa Kexiluo kind).In addition, in other not quite clear contraction endosperm barley emergency sport of cause and effect gene, can carry out dual sudden change.

And then the present invention also is the grain of described barley.

This invention also comprises the grain through processing, comprising wear into powder, grind, the grain of corase grind, granulating or backing, and other products that in the course of processing, is obtained and above-mentioned complete grain.These products can be used for various food, and for example bread, cake, biscuit etc. contain the product of flour, or concentrate additive such as Ji, or make Fructus Hordei Germinatus or other barley beverage, noodles and make things convenient for soup.

This invention also can comprise isolated starch from the grain of above-mentioned barley plants.Starch can be separated by known technology.

An advantage of this invention provides the one or more products with special nutrition, and does not need starch or other composition of barley grains are carried out modification.

But, also have necessary change grain starch ,-dextran or other composition, comprise these modification contents in this invention.

Method of modifying adopts known method, comprise with traditional method extract starch ,-dextran or other composition, and, make it have desired resistivity with starch conversion.

Therefore, starch or-dextran can come modification by the treatment process of selecting for use independent or multiplely, this processing comprises and is not limited to: heat and/or moisture processing, physical treatment (for example ball milling powder), enzyme are handled the cross coupled (for example Trisodium trimetaphosphate, phosphorus oxychloride) of (for example adopt or-dextran, pullalanase etc.), chemical hydrolysis (get wet or dry up with liquid or gaseous reagent), oxidation, dual functional reagent, or carboxyl methylates.

Foodstuff fibre content in the illustration barley grain does not improve for no other reason than that improved the endosperm amylose content relatively.Its first cause is that high-load-dextran is very big to the influence of foodstuff fibre content.

-dextran also has provide protection probably with combining of starch granules, and it has the potential provide protection in conjunction with density to starch, to such an extent as to have resistivity as the structural performance of RS1, it can't be digested.Secondly, the combination of starch-lipid of measuring by the V-compound crystal also have probably resistivity carbohydrate.In this case, resistivity be likely owing to existing of lipid caused not accessibility physically produce, and can conclude a RS1 starch thus.Therefore, the degeneration starch with V-composite structure has very high resistivity to digestion, and estimates thus, and the amylopectin that constitutes the part of the starch small grain with V-composite crystalline structure has improved the digestion resistivity.Once more, the starch of illustration barley plants may have resistivity to digestion owing to have RS2 starch in its starch granule structure.

Though all respects to this invention have been carried out various explanations,, this invention also is the combination of above-mentioned two or more aspects.

Example 1

Background

Starch in the senior albumen is synthetic to be finished by one group of enzyme, and its process is divided into 4 critical steps.The first step, ADP glucose is by the monomer precursor that activates starch that synthesizes from the ADP glucose of G-1-P and ATP.In second step, the glucose donor ADP glucose that is activated is by the synthetic non reducing end that changes into the 1-4 connection that is pre-existing in of starch.In the 3rd step, starch bifurcated enzyme produces branch point by the division in a zone of 1,4 glucose that connects, and then changes into the acceptor chain from the division chain, forms 1,6 a new connection.At last, genetics research shows that in senior plant, starch debranching enzyme is of paramount importance to the synthetic of normal quantity of starch, and still, the mechanism of action of debranching enzyme does not obtain answer (Myers etc., 2000) as yet.

The normal starch small grain of senior plant is synthetic obviously needs above-mentioned 4 kinds of activities, and has found each multiple isomer of these 4 kinds of active in the endosperm of senior plant, each isomer (Wang Shi etc., 1998 on mutation analysis; Bu Lien etc., 1998) (Abel etc., 1996 or in the variation of the gene symbol by transgenic method; Qiao Bulin etc., 1999; These Kyle Korvers etc., 2000) role is different.But each isomer in each activity is still unknowable to the effect accurately that biosynthesizing play of starch, does not know that also its difference that acts between the different plant species has much.In the endosperm of cereal, have two kinds of hot Starch phosphorylase isomer of ADP glucose, one in starchiness, another is (De Nier etc., 1996 in tenuigenin; Tao Erboqiao Ademilson etc., 1996).Each isomer all has two lateral configurations.The contraction emergency sport (sh2) of corn and frangible emergency sport (bt2) are represented big or small ramose variation (Ji Luozi and Hana, 1994) separately.The starch of having found 4 classes in the endosperm of cereal is synthetic, and one is positioned at the isomer of starch granules the inside, starch synthetic (GBSS), two kinds of forms (SSI, Li Shi etc., 1999a between particle and soluble fractions of granulometric range specially; SSII, Li Shi etc. are 1999b) with the 4th kind of form that is positioned at soluble fractions fully, SSIII (Cao Shi etc., 2000; Li Shi etc., 1999b; Li Shi etc., 2000).According to the show, GBSS is amylose starch synthetic fundamental (Suhl etc., 1983), and the sudden change among SSII and the SSIII can change amylopectin structure (Gao Shi etc., 1998; Cray dagger-axe etc., 1998).The mutation effect that the SSI activity is risen does not still have description.

Show the q enzyme of three kinds of forms in the endosperm of cereal, q enzyme I (BEI), q enzyme Iia (BEIIa) and q enzyme IIb (BEIIb) (G and Bao Ye, 1982; Bao Ye and Prey this, 1978; Mi Zhunuo etc., 1992; Sun Shi etc., 1997).In corn and paddy rice, the high amylose starch phenotype demonstrated variation result in the BEIIb gene (Bao Ye and Prey this, 1981; Mi Zhunuo etc., 1993).In these emergency sports, amylose content improves significantly, and branch's frequency of residue amylopectin has reduced.In addition, the material that is defined as " intermediate " between amylose starch and the amylopectin has been piled up (Bao Ye etc., 1980 significantly; Plutarch reaches etc., and 1993).The sudden change that offers some clarification on BEIIa and BEI does not still have description, although in potato, only the reduction of BEI can cause the atomic influence (Phelps etc., 1996) of starch structure.But in potato, the binding ratio of the reduction of BEII and the BEI only reduction of BEII produces higher amylose content (this Kyle Korver etc., 2000).In senior plant, there is two types debranching enzyme, its definition is based on (Mai Er etc., 2000) that its substrate material characteristic, isoamylase type debranching enzyme and pullulanase type debranching enzyme are made.Sugary-1 sudden change in corn and the paddy rice and lack two kinds of debranching enzymes relevant (James etc., 1995; Ku Bai etc., 1999), still, the position of its cause and effect sudden change figure is identical with isoamylase type debranching enzyme gene.At chlamydomonas sta-7 sudden change (scheme Yi Le etc. 1996), in the similar body of corn Sugary-1 sudden change, have only the activity of isoamylase to reduce.

It is limited that known mutation in the barley starch structure is compared with the mutation of corn.Most characteristic sudden change is to be called the sudden change of the wax high amylose starch of AC38.Also cultivate and analyzed two emergency sports (this willing Dare Mel etc., 1992; Fuji field etc., 1999).To starch structure and feature (short proud gas card etc., 1992 examined; This willing Dare Mel etc., 1992; Wa Shantan and Ba Di, 1995; Mo Lisen etc., 1984; Green and De Hasi, 1974; BAKE this etc., 1971; Pearson and Oscar Cristi Ademilson, 1997; Wa Shantan and Ba Di, 1998; Short proud gas card etc., 1998 examined; Song Shi and letter, 2000; An Deli husband etc., 1999; Yoshimoto etc., 2000) and cereal feature (Si Wansen, 1992; The Acker card this, 1979; Oscar Ademilson etc., 1997; Oscar Ademilson etc., 1998; Anderson etc., 1999; Ai Erfufosen etc., 1999; Ba Di, 1999; Zheng Shi etc., 2000; Yi Ji Dorr base gram etc., 2000; Anderson etc., 2000) all carried out the report of mutation characteristic widely, and emergency sport is tested (Xue Shi etc., 1996 in animal-feed; Niu Man etc., 1978; The Ka Erfo top grade, 1976; Dimension Ademilson etc., 1975; Mountain moral Burger etc., 1998; Burger etc., 1999), human food prods (Si Wansen etc., 1995; The Fa Sitenuo top grade, 1996; Pearson etc., 1996; Slope Mo Lanci etc., 1972) and human nutrition (sloping Mo Lanci, 1992; Granfield etc., 1994; Oscar Ademilson etc., 1996; Acker Burger etc., 1998) application in is studied.

In this example, we have isolated magical other high amylose starch emergency sport of level from barley.The amylose content that this emergency sport kind had (65%-70%) surpasses (45%-48%) (Wal gram etc. of those known high amylose starch emergency sport glaciers (AC38), 1968), and starch with amylopectin structure of starch branch frequency raising, the minimizing of branch's frequency that this is relevant with the amylose starch of corn expansion emergency sport forms and contrasts (Plutarch reach etc., 1993).

Grain and starch property to the emergency sport of this invention have carried out concrete research and have drawn cause and effect sudden change figure.It is allelic that isolated mutation and known barley shrink emergency sport sex6, and shows that the cause and effect sudden change is positioned in the synthetic II gene of starch.This results of mutation provides new prompting for the biosynthetic process of starch, and what different influence the sudden change in the concrete gene of demonstration different plant species has to starch structure.

Material and method

The bringing out and screen of sudden change

No barley kind " Himalaya " is the method for reining in (1995) according to Zi Waer and Shan De, brings out sudden change with sodiumazide.The kind that changes the cereal shape is to select according to the method for (1997) such as Green.According to the method for (1997) such as Green identification and kept and amount to 75 and have the kinds of shrinking the endosperm phenotype.

The separation of starch

The method of (1991) such as starch employing Schoolmans is separated from barley grains.

Definite method of amylose starch

Determining of amylose starch/amylopectin ratios is the method for describing according to Ba Tie and Ke Erting (1996), adopts the HPLC method to carry out the separation of debranching starch, and adopted the iodine control method.The analysis of amylose starch/amylopectin ratios is the method according to (1998) such as Keyes, and non-debranching starch method carries out by analyzing.

The mensuration of starch content

Total starch analysis tool bag that starch adopts big enzyme (Megazyme) (mine-laying, Ke Weike building, Ireland) to be provided is determined.

Protein content

Nitrogen adopts Kjeldahl method to determine, the coefficient of protein content employing 5.7 calculates.

Beta-glucan content

The tool kit that beta-glucan adopts big enzyme (Megazyme) (mine-laying, Ke Weike building, Ireland) to be provided is determined.

The starch chain length distribution

Starch adopts the auxiliary carbohydrate electrophoresis (FACE) of fluorophore according to the method for (1998) such as Mo Laier, carries out debranching and the analysis of chain length distribution with capillary electrophoresis.

DSC

Gel adopts a Pyris1 difference scanning heat instrument (sloping Er Jinaierma, the U.S. move Si Woke CT) to measure.Starch is in 2 parts of water: the ratio of 1 part of starch is blunged, and mixture (40-50mg accurately weighs) is placed in the Stainless Steel Kettle, seals the steel pot then.Sample scans for 10 ℃ by per minute from 20 ℃ to 140 ℃, and compares with the Stainless Steel Kettle of sky.Adopt Pyris software to determine gelatinization temperature and enthalpy.

RVA analyzes

Viscosity adopts quick viscosity analyzer (the sharp martial virtue is irrigated in Sydney for RVA, New Port science Pty company limited), measures with the semolina condition of report such as Ba Tie (1997).In order to suppress-amylase, all added concentration in all chemical examinations is the Silver Nitrate of 12mM.Measured parameter is peak viscosity (hot side group high viscosity), keep viscosity, final viscosity and dough temperature.In addition, decline viscosity (peak viscosity deducts and keeps viscosity) and bounce-back viscosity (final viscosity deducts and keeps viscosity) have been calculated.

The expansion of flour

The swell increment of flour is to determine according to the method for (2001) such as Ke Nike-Luo Si.

The X-ray data

The x-ray diffraction data are to adopt standard technology (Bu Lien etc., 1998) to collect.

Electron microscope scanning

Carried out electron microscope scanning with Joe1 JSM 35C instrument.Starch to purifying has carried out gold-plated spraying, and at room temperature scans with 15kV.

The production of double haploid

From 292 and add seemingly firmly and draw between (P doctor's Davis of Australian A Delaideweite institute Hordeum culgare cv Tantanjara) and 342 and add seemingly firmly the F1 plant that hybridization produced between drawing and produced double haploid.

Relationship analysis

The genetic affinity data have been calculated with Map Manager.

The foundation in barley cDNA storehouse

Collected 5 milligrams polyA+mRNA the barley endosperm tissue after blooming 10,12,15 days respectively, the cDNA that is used for carrying out according to the rules (" life technology ") is synthetic.The cDNA that NotI-(dT) 18 introductions (Pharmacia Biotech) are used for the first step synthesizes.Engaging and produce size difference (SizeSep 400 spun Column of Pharmacia Biotech) with NotI at cDNA afterwards, engages Ji (Stratagene) with double-stranded cDNA and rolls on the SalI-NotI arm that connects and be cloned into ZipLox (" life technology ") with SalI-XhoI.The cDNA of butting wraps up with Gigapack III gold packaging extract (Stratagene).Library titre with Y1090 (ZL) strain testing of E.coli is 2 * 10 ⁶Pfu.

Concrete cDNA zone with PCR clone barley starch synthase II

In order to screen the cDNA library of barley, adopted cDNA clone wSSIIp1.CDNA clones wSSIIp1, be by PCR, adopt introduction ssIIa (TGTTGAGGTTCCATGGCACGTTC SEQ.ID.NO 9) and ssIIb (AGTCGTTCTGCCGTATGATGTCG SEQ.ID.NO 10), amplify wSSIIA (gene pool, Number for access: nucleosides position 1 AF155217), cause in the zone between 435 and 1,835.

Amplify and to have adopted a FTS-1 Heat sequencer (Ke Beite, Australia), 1 circulation is 2 minutes in 95 ℃, and 35 circulations are 30 seconds in 95 ℃, and in 60 ℃ 1 minute, in 72 ℃ 2 minutes, 1 circulation was 1 minute in 25 ℃.Fragment wSSIIp1 is cloned into a pGEM-T vector (Promega) lining.

The screening in barley cDNA storehouse

To the cDNA library of from the RNA of the Himalayan endosperm of the barley variation coefficient (cv), setting up, adopt and to describe the 347-bp cDNA fragment wSSIIp of (drawing is graceful etc., 1998), under hybridization conditions, screen.By 50% methane amide, 6 * SSPE, 0.5% SDS, 5 * Denhardt ' s and 1.7 μ g/mL salmon sperm dnas carry out hybridization in 16 hours at 42 ℃, carry out 3 then and wash * 2 * SSC (containing 0.1%SDS) under 65 ℃, wash 1 hour at every turn.

The screening of barley genomic library

Substantially the method for describing according to (2000) such as Gu Bule adopts barley SSII cDNA to set up and screened barley (the barley variation coefficient (cv) Morex) genomic library as sample.

The sequencing of genomic clone

Morex SSII gene subclone is in the plastid vector and carried out sequencing.292 and the MK6827 gene adopt introduction according to the design of Morex order, the PCR by the gene overlap zone amplifies and carries out sequencing.PCR fragment or direct sequencing, or carry out after the subclone, from the plastid sequencing.

Express the identification in zone

With reference to Himalayan cDNA order and Morex genome order, defined the zone of estimating to be present in 292 in cDNA and MK6827 genome order.

The pcr analysis of the sudden change of G to A in the SSII gene

Designed the PCR introduction that amplifies the transfer sudden change zone of containing G to A of identification in 292.The order of this introduction is: ZLSS2P4 (CCTGGAACACTTCAGACTGTACG SEQ.ID.NO 11) and ZLBSSII5 (CTTCAGGGAGAAGTTGGTGTAGC SEQ ID NO 12).Adopt a FTS-1 Heat sequencer (Ke Beite, Australia), 1 circulation is 2 minutes in 95 ℃, and 35 circulations are 30 seconds in 95 ℃, and in 60 ℃ 1 minute, in 72 ℃ 2 minutes, 1 circulation was 1 minute in 25 ℃.

The proteic SDS-PAGE of barley endosperm analyzes

From ripening process and sophisticated barley and wheat Ruzhong extracted starch, and, removed surface protein with Proteinase K according to describing (drawing is graceful etc., 1995).With containing 50mM Tris, pH6.8,0.5 milliliter of 10% SDS and 10% 2 mercapto ethanol is extracted the buffering Ji, extracted starch small grain albumen from 20 milligrams dry starch.After over-cooking 10 minutes gel, the supernatant liquid of placing 15 milliliters on each road carries out centrifugation, and has collected starch.

The production of double haploid

The contrary strategy of handing over

292 and Hordeum vulgare cv Sloop between hybridize and produce the F1 seed.The plant that the F1 seed is grown carries out the population that endogamy produces the F2 seed.Adopt the PCR chemical examination, the plant that test F2 seed grows, and homotype is combined into 292 plants that suddenly change and Sloop (BC1) carries out contrary the friendship.The F1 plant that produces from BC1 has selected homotype and has been combined into 292 plants that suddenly change, and backcrossed with Sloop (BC2) again with the PCR test.The F1 plant that grows from BC2 carries out pcr analysis again, and selected the plants that homotype is combined into 292 sudden changes.These plants or carry out endogamy so that produce the BC2F2 population, or hybridize once more with Sloop (BC3).The F1 plant that produces from BC3 carries out pcr analysis again, and selects the plant that homotype is combined into 292 sudden changes.These plants carry out endogamy so that produce the BC3F2 population.The plant that these seeds grow has carried out the PCR test, has selected homotype and has been combined into 292 plants that suddenly change, and enlarges as single kind of subsystem and seed.

The result

The selection of emergency sport

Zi Wo (Zwar) He Chande reins in (Chankler) and reports and (1995) with sodiumazide from no shell or there is not the barley kind " Himalaya " discriminating conduct of deriving various emergency sports.Inventors have recognized the cereal emergency sport of one group of 75 kinds of contraction, and in the seed that shrinks, the amylose content of starch is determined with HPLC (Fig. 1).Two kinds, 292 and 342, find to contain separately 71% and 62.5% amylose content (Fig. 1).292 and 342 amylose content apparently higher than before the good AC38 kind (amylose starch 47% is seen Fig. 1) of characteristic.This research offers some clarification on the gene basis of the 292 and 342 strange high amylose starch display forms that show, and the sudden change of the cause and effect on explanation grain and starch structure and function result.

The grain characteristic

Grain size and form:

Grain weight and modal sudden change result are significant (tables 2).Grain weight reduces to 292 32 milligrams and 342 35 milligrams from 51 milligrams of mother's kind " Himalaya ".Emergency sport has kept the length and the width of wild kind, but by contrast, become flat (becoming 292 1.58 millimeters and 342 1.75 millimeters) from 2.82 millimeters mean thicknesss of Himalaya, and middle body is not full substantially.Fig. 2 represents the photo of emergency sport and wild kind grain.Its size adopts ordinary method to measure, and shows grain length (L), the wideest grain width of selecting (W) and thickness (T) among Fig. 2.Ratio between grain length (L) and the thickness (T) helps to distinguish the species sudden change, value＞3.5 that the seed of

discovery

292 or 342 species sudden change generally has, but not the value of emergency sport barley＜3.5.

The grain composition:

The starch content of emergency sport reduces to 292 17.7% and 342 21.9% (seeing Table 1) from 49.0% of Himalaya.The minimizing of the starch weight in the grain gross weight shows that so that the non-starch total content of grain to be provided the loss of starch content is equivalent to the loss of grain weight, and Himalaya, 292 and 342 non-starch weight are respectively 26.0,26.3 and 27.3 milligrams.

292 and 342 protein content has improved (table 1) than female Himalaya of planting, and this result causes owing to grain loss starch, rather than owing to the raising of the protein synthesis of each caryopsis causes.

The beta-glucan level of 292 and 342 emergency sports has also improved, and wants high from the result of the minimizing (table 1) of starch content is desired.In both cases, it is about 20% that the beta-glucan content of every caryopsis has improved, and this may represent that sub-fraction carbon transferred to the synthetic of beta-glucan from starch is synthetic.

Starch component and function

Amylose starch and amylopection content

The content of amylose starch determines that with two kinds of technology first kind is the size exclusion method among 90% (v/v) DMSO (dimethyl sulfoxide (DMSO)), and second kind is iodine blue valve method.Very approaching with the amylose content that two kinds of methods are determined, HPLC (HPLC (high performance liquid chromatography)) data rows is in table 1.

From the grain weight and amylose content data of emergency sport and wild kind, can calculate every in the amylose starch quantity of deposit.This analysis revealed, every amylose starch reduces to 292 4.0 milligrams/caryopsis and 342 4.8 milligrams/caryopsis from 6.2 milligrams/caryopsis of Himalaya.By contrast, the amylopectin of every caryopsis is synthetic significantly to be reduced, and reduces to 292 1.6 milligrams and 342 2.9 milligrams from 18.7 milligrams of Himalaya.

Chain length distribution

Carry out through the auxiliary carbohydrate electrophoresis (face) of the chain length distribution employing fluorophore of the starch of isoamylase debranching.292, the chain length distribution of 342 emergency sports and Himalaya is listed among Fig. 3 a.Fig. 3 b represents a difference chart, and wherein the stdn chain length distribution of 292 and 342 emergency sports is to deduct from the stdn distribution of Himalaya.From DP6-11, the chain length percent of calculating among DP12-30 and the DP31-65 is listed in table 3.The chain length distribution of 292 and 342 emergency sports has obvious variation, so that than DP12-30 higher chain per-cent is arranged in the zone of DP6-11.

Determine with dsc method

Adopt the determine with dsc method method to study the gelation temperature of emergency sport, and with data rows at table 4.The gelation temperature of 292 and 342 starch that produce is all obviously low than Himalaya aspect beginning, climax and the outlet temperature at gelling climax.The enthalpy at the gelling climax of 292 and 342 emergency sports also is starkly lower than wild kind.The amylose starch of 292 and 342 emergency sports/lipid climax begins temperature and also reduced, and still, enthalpy has but improved, and is consistent with the raising of the amylose content of emergency sport.

Starch viscosity according to RVA

In order to observe pasty state viscosity, the RVA that has carried out barley semolina sample analyzes.Research in the past shows, the analysis of semolina sample and the analysis of isolating starch be closely related (BETTY BOOP etc., 1997).Analyze to show, exist bigger difference (see Table 5 and Fig. 4) between the barley genotype of being studied.Himalaya and two kinds of barley varieties of Na Moyi of containing wild kind starch have demonstrated typical R VA curve, and an outstanding viscosity peak is arranged, and secondly are that viscosity drops to strength of fixation, and last, along with decrease of temperature, viscosity is brought up to final viscosity.The same with generally observed barley starch, the final viscosity of wild kind starch is equivalent to, or is lower than peak viscosity (table 5).In AC38, obtained outstanding peak viscosity, still, because the high amylose content of this kind, so resulting final viscosity is bigger than peak viscosity.Yet, 292,342 and MK6827 in obtained curve very inequality.Do not obtain initially improving, therefore, can't calculate the segmentation value with the corresponding significantly viscosity of the peak viscosity of other barley starch.The viscosity that the peak viscosity number of 292,342 and MK6927 that table 5 is listed is write down when being Himalaya (Himalaya) peak viscosity.Compare with other semolina sample, 292,342 and the viscosity of MK6827 be in The whole analytical process, to improve always, up to final viscosity.If carry out stdn according to starch content, 292 and 342 starch has very high final viscosity (see figure 5).

Swelling property is to measure the method for flour and starch property, the performance when contacting hot and superfluous moisture in order to explore material.By under specified temperature, sample and water are stirred into the colloidal material front and back, it is weighed respectively measure the water regain of its increase.Analysis revealed, control sample Himalaya and adding seemingly firmly draw (Tantangara) to be expanded to 6 to 8 times of dry weight, by contrast, and 292 and 342 2-3 times (tables 9) that are expanded to dry weight.

Crystallinity

Take a picture by the crystallization of X-ray, further studied starch structure (seeing Table 6).Himalaya (Himalaya) has shown the pattern of the cereal starch of expection, has dominant " A " type crystallinity, and AC38 has shown very similar x-ray diffraction pattern with Wa Kexiluo (Waxiro), only the crystallinity level of AC38 is lower, and the crystallinity level of Wa Kexiluo (Waxiro) is higher.The x-ray diffraction pattern of 292 and 342 emergency sports then becomes the mixed type of V-type and Type B.Except the variation of diffraction pattern, the crystallization quantity of 292 and 342 emergency sports sharply descends, and is respectively 9% and 12%.This low amylopectin content with 292 and 342 starch is consistent.

Particle form

Observed the particle form (Fig. 6) of starch with scanning electron microscope.Himalaya (Himalaya) (Fig. 6, A hurdle), the granular size of cured matter barley (Waxiro, Fig. 6, b hurdle) and AC38 (Fig. 6, c hurdle) and shape are observed consistent with the starch granules of the normal barley variety of delivering in the past.Emergency sport 292 (Fig. 6, d hurdle), obvious variation has taken place in " A " type starch granules shape of 342 (Fig. 6, e hurdles) and MK6827 (Fig. 6, f hurdle), compares with the slick lenticular shape of normal barley, and it is complicated that its particle surface becomes.

Foodstuff fibre

According to the AOAC program, carried out the foodstuff fibre analysis, find that 292 and 342 have the foodstuff fibre of increase, the foodstuff fibre that increases is because the increase of undissolvable foodstuff fibre causes, rather than because (table 1) that increase caused of solubility foodstuff fibre, this is that resistivity starch and beta-glucan are consistent with foodstuff fibre.This measuring method that it should be noted that foodstuff fibre is that chemistry is determined method, from the angle of trophology, compares clearer with physiological method.

The gene basis of emergency sport

Segregation ratio

The sudden change hybridization of barley variety does not show 292 and 342 endosperm phenotypes of contraction, the proof sudden change is the sudden change of directly driving in the wrong direction, the shrinking percentage that shows the F2 seed of outcross population is 3:1 (normal: as to shrink), and is 1:1 (normal: as to shrink) (seeing Table 6) along the shrinking percentage of the double haploid population seed of single outcross development.Be defined as the L/T (length/thickness)＜3.5 of seed normally, contraction is defined as the L/T of seed〉3.5.

The allelotrope characteristic of emergency sport

The analysis of filial generation by 292 and 342,292 and 342 sudden change demonstrate has allelotrope.The grain weight of all F1 seeds that obtain by reverse hybridization and shape are all within the size and form range of maternal 292 and 342 kinds, but outside the size and form range of maternal Himalaya (Himalaya) seed.In addition, all F2 seeds that obtain by 292 x, 342 F1 plants have all shown the typical contraction seed phenotype of 292 and 342 emergency sports.

Barley germplasm collection (USDA-ARS, dell species matter research institution of country, Ida. 83210, the grain shape of the contraction grain emergency sport series that is found A Baidiyin) and the analysis revealed of starch property, kind MK6827 (BGS31 also claims GSH02476) with sex6 sudden change has shown one group and 292 and 342 suddenly change very similar starch and grain characteristic.292 and MK6827 between hybridize after, all F1 grain is in grain weight and shrink and all to demonstrate typical 292 phenotypes aspect the seed phenotype.The F2 seed of 292 x MK6827 F1 plant gained has all demonstrated the L/T ratio〉the endosperm phenotype of 4 contraction.By contrast, 292 and the distribution that produced dual mode of the F2 seed of commercial barley cultivation sudden change Si Lupu (Sloop) hybridization gained, shrink and full seed variation ratio is 3:1 (table 6).292 with other 5 kinds shrink the endosperm phenotypes (BGS 380, shrink endosperm 4,7HL (pricking dimension etc., 1975); BGS381 shrinks endosperm 5,7HS (pricking dimension etc., 1975); BGS 382, sex1,6HL (Ai Silike and Lai Si, 1976); BGS 396, shrink endosperm 6,3HL (drawing Ma Zhi and Ai Silike, 1975); BGS 397, shrink endosperm 7, draw (drawing Ma Zhi and Ai Silike, 1975)) between the F1 seed of hybridization gained all produced full grain shape.Based on this, can assert 292,342 and MK6827 sport allelicly, and based on the sex6 site plan of delivering in the past, 292 and 342 mutation forecastings are the galianconism of barley chromosome 7H, about 4cM from the kinetochore (Buddhist nun Ci Weitafu, 1990; Buddhist nun Ci Weitafu and Chris Ding Kefu, 1993; Than Ya Xiefu etc., 1986; Buddhist nun Ci Weitafu, 1992).

Linkage analysis

By 292 and the commercial barley variety that has 90 offspring's kinds add seemingly firmly and draw hybridization between (Tantangara), produced double haploid population (table 8).

These kinds are by shape of the seed (full or shrink), according to the chain length distribution (per-cent) of face with chain of DP6-11, seed outside (naked or shell), and PCR mark (as follows) has been done record.Its data rows is at table 8.In this population, the seed characteristics of contraction distributes with 292 face identical variation has taken place exactly, and this variation with grain size and shape is that the result's of starch accumulation variation expection is identical.The identical variation of characteristic is listed in Fig. 8.A represents on the hurdle that starch chain length (listing with the chain per-cent between the DP6-11) and length are than the relation between the ratio of thickness.The circle of opening represents to have the kind of 292 sudden change PCR marks, and cross expression has the kind of wild kind PCR mark.Between these two kinds, there is significantly difference.The relation between starch chain length and the seed weight is represented on the B hurdle of Fig. 8, and the seed weight of expression sudden change is than ratio more difficult distinguish of length to thickness.

Barley has the nud position that does not have skin to depend on to be positioned at karyomit(e) 7H, and owing to add seemingly firmly and draw (Tantangara) for barley is arranged, and 292 be no barley, and this characteristic can be recorded in the double haploid offspring.To the no skin/analysis revealed of getting in touch between skin characteristic and the face data is arranged, in this hybridization, 292 sudden changes are plotted in the 16.3cM at nud position.The data of the allelotrope sex6 sudden change of drawing before this position meets (Buddhist nun Ci Weitafu, 1990, Buddhist nun Ci Weitafu and Chris Ding Kefu, 1993, than Ya Xiefu etc., 1986, Buddhist nun Ci Weitafu, 1992).

The identification of cause and effect gene

According to the show, the nud gene is positioned at barley chromosome 7H (Fig. 8, Fei Dake etc., 1972).In wheat, 3 starch synthases (GBSS, SSI and SSII) and an isoamylase type debranching enzyme (S. La Heman, person-to-person communication) be positioned on the galianconism of karyomit(e) 7 (homologous chromosomes) (mountain is gloomy and grace is many, 1996; Li Shi etc., 1999a; Li Shi etc., 1999b; Li Shi etc., 2000).The cognation closely at Nud position has hinted that the most possible candidate gene is the SSII gene.The SSII gene of wheat is at cDNA rank (Li Shi etc., 1996b; Gene pool interpolation AF155217) and genome rank (Li Shi etc., person-to-person communication) go up vegetative propagation, and the cDNA of a barley is independent and vegetative (Fig. 9).The SSII genome series arrangement of barley and wheat shows that its gene has very similar coded sequence/intron structure, still, and the intron length different (Figure 10) between the order.The contrast (Fig. 9) of Mo Likesi (Morex) genome of Himalaya (Himalaya) order and cDNA order causes from Mo Likesi (Morex), 292 and the identification of the cDNA order that deduces of MK2827.

Figure 11 represents the transition sudden change of the G to A that finds from 292 SSII gene corresponding to 1829 arrangement positions.This sudden change is with a SSII open reading structure (Figure 12) that stops base sign indicating number importing 292.The sequence analysis of Jia La and Himalaya shows seemingly firmly, and the gene of two kinds of wild kinds is identical in this zone, and 292 and 342 transition that all comprised identical G to A suddenly change.What import stops base sign indicating number truncated gene composition, and the scope of the C-terminal contact reflection of whole starch synthase II gene can't be explained, therefore, the activity of all SSII is probably by this sudden change cancellation.

Figure 11 represents that the transition of G to A also is present in the arrangement position 242 of MK6827, and the cDNA of Himalaya is listed in Fig. 9 in proper order.This sudden change also stops base sign indicating number to one and imports 292 SSII open reading frame (Figure 12), and prevents to surpass the explanation of 90% SSII gene, and cancellation is by the SSII activity of this genes encoding.

The restriction site (NlaIV) in the barley SSII gene has been interrupted in the transition of G to A in 292.The location column of distinguishing the NlaIV position is at Figure 14, (a) hurdle and (b) hurdle.Figure 14 c represents the sepharose body electrophoresis of the NlaIV classification composition of barley, shows that the patterns of distinguishing of 292 sudden changes are 292 and 342, but not at MK6827, Himalaya (Himalaya) or add seemingly firmly and draw (Tantangara).

292 x are added seemingly firmly draw 90 kinds of (Tantangara) double haploid population to write down the PCR mark of the transition of G to A, and find and contraction seed and the identical exactly variation of face chain length distribution phenotype, show that 292 sudden changes link to each other with this starch phenotype fully, and this sudden change is likely the cause and effect sudden change of hiding below 292 phenotypes.Figure 14 d represents to be derived from the analysis that 292 x add the kind of drawing (Tantangara) double haploid population seemingly firmly.

The active biochemistry that reduces of SSII proves

With a series of gelinite electrophoretic technique, studied the composition of the starch biosynthesis enzymes of emergency sport and normal barley variety.The endosperm soluble fractions analytical proof of growing, all kinds all contain BEI, BEIIa, BEIIb, SSI and SSIII, and the content of the same modality of these BE and SS does not all have to change in itself.But the analysis revealed of starch granules lacks several bands.At first, SDS-PAGE analyzes (Figure 16, B hurdle) and shows, 292,342 or MK6827 all do not have the band of 90kD, Himalaya (Himalaya), add and draw (Tantangara) and AC38 then to have seemingly firmly.The immunity absorption process shows that this band has SSII (Figure 16, B hurdle), BEIIa and BEIIb.Find that BEIIa and BEIIb are present in soluble fractions, and be not present in the particle, this show 292,342 and the MK6827 emergency sport in the distribution of these enzymes change rather than the sudden change expressed of cancellation to some extent.By contrast, all do not have to find the evidence have SSII to express in solubility or particulate fraction (Figure 16, A hurdle and B hurdle), this is consistent with the gene evidence that can be directly the SSII sudden change be linked to each other with viewed phenotype among the MK6827 with 292,342.

Cultivation with kind of 292 sudden changes

For 292 sudden changes are transformed into optionally barley genotype, two kinds of strategies have been adopted.

In first example, from 292 with add seemingly firmly and produced the double haploid kind the hybridization of drawing (Tantangara).Listed in the table 8 and comprised seed weight, L:T ratio, chain length distribution and SSIIDNA flag state data.Table 9 has been made more comprehensive analysis to these kinds, comprises that RVA analyzes beta-glucan content and flour expanding volume.Data presentation, the kind with 292 sudden changes has visibly different RVA parameter (for example, peak/final viscosity ratio), and higher beta-glucan content and flour expanding volume change.

In second example, changed sudden change by carrying out backcrossing to two of the cultivated variety (cv Sloop) with normal starch property from 292.Collected the F2 seed that originates from three 2F1 plants of backcrossing, for analysis.The F2 seed is divided into the L:T ratio〉3.5 and L:T ratio＜3.5.The distribution of two class seeds meets the requirement of single recessive gene.The flour expanding volume that originates from the seed category of each plant is listed in Figure 10, shows that the expansion characteristics of starch has obtained tangible transformation by the variety culture process of Si Lupu (Sloop) background with average 75%.

Discuss

We describe the magical emergency sport 292 of barley of the endosperm phenotype with contraction and 342 variation.The analytical proof of grain composition, the phenotype of contraction are the significant minimizings owing to starch content, and the analysis revealed of starch component, this minimizing is to show because of the phenotype that synthesizes the high amylose starch that is caused that reduces amylopectin.

292 and 342 emergency sports have the unique grain and the combination of starch property, contain more beta-glucan and resistivity starch.The beta-glucan content of this kind has approximately improved 15%, and this is the expected result that minimizing caused of starch content, shows that the carbon that can not change into starch is converted into the synthetic of beta-glucan.The determining of foodstuff fibre content shows that the grain of emergency sport has more foodstuff fibre, and this increase is because the increase of undissolvable foodstuff fibre causes.

The combination of this specific character shows that this emergency sport may have the very interesting potentiality of the integral part that becomes human foods.At first, higher beta-glucan content means that these kinds have the content that is used for reducing cholesterol that helps by elaborately planned beta-glucan.Secondly, the existence of resistivity starch means that these kinds have the intestinal health of helping, and utilizes the function of its resistivity starch to improve intracolic fermentation (holder equality, 1997; Holder is flat, and 1999).Once more, the composition of grain shows that these kinds have lower energy density, and digestion rate may be slower, means that they may provide low-carbohydrate food.

The starch property of illustration kind is also very unique, higher amylose starch is arranged, and amylose starch has lower gelatinization temperature.This point general other mutation that raises of gelatinization temperature when improving amylose content by sudden change branching enzyme IIb forms contrast, such as, increase corn mutation (Ng etc., 1997 of amylose starch; Card thatch etc., 1993; Section's glug etc., 1987; Fu Wa etc., 1999).Though 292 amylose content is equivalent to other kind that increases amylose starch, the amylopectin structure of its starch obviously different (Wang Shi etc., 1993).In 292 and 342, the chain length distribution of amylopectin changes towards oligomerization degree direction, and in the kind that increases amylose starch, the chain length distribution is to change towards high extent of polymerization direction.This means, be not the content of amylose starch, but amylopectin is only definite gelatinization temperature important factor, and this effect is to obtain by the interaction force between the outside chain of amylopectin molecule.The similar effects that people such as letter noticed multiple starch in 1999.

The viscosity data that RVA analyzes shows that the starch of SSII emergency sport is different with normal barley and AC38.The SSII emergency sport is as kind, when bringing up to 95 ℃ along with temperature, the viscosity peak occurs at the beginning part of RVA temperature curve.On the contrary, the viscosity of these emergency sports rises gradually, until final viscosity.Low amylopectin crystallization content in these data and its particulate low amylopectin content, the particle, and be corresponding to viewed low gelatinization temperature of difference scanning calorimeter and enthalpy.Heating in water, stir, when amylose starch in its particle is released, can reach higher final viscosity.This RVA characteristic is unique in cereal starch, can be the food and the industrial application that need low pasty state viscosity and high final viscosity magical starch source is provided.

The observation of the gelatinization temperature of DSC is to reflect from the x-ray diffraction result of study.292 and 342 particulate crystallization content has reduced, and crystal shape becomes the mixed type of V-type and Type B from the typical A type of cereal starch.V-type is the typical shape of amylose starch, reflect in the starch composition with lipid acid synthetic amylose starch, and Type B estimates to reflect the residual amylopection content (Bu Lien etc., 1998) of starch derived from amylopectin.

To the analysis revealed of the gene basis of 292 and 342 emergency sports, sudden change is simple back mutation, in the outcross experiment, shows typical Mendelian ratio.Hybridization studies show that 292 and 342 is allelic.To 292 and other shrink the interactional further analysis revealed in hybrid experiment between endosperm mutation, the Sex6 of 292/342 mutation and MK6827 kind also is an allelotrope.This mutation drew out in the past, showed its position on karyomit(e) 7H galianconism, from kinetochore 3cM with interior position (Buddhist nun Ci Weitafu, 1990; Buddhist nun Ci Weitafu and Chris Ding Kefu, 1993; Than Ya Xiefu etc., 1986; Buddhist nun Ci Weitafu, 1992).

Set up the double haploid population having barley to add seemingly firmly to draw between 292 emergency sports of (Tantangara) and no skin, it shrinks the endosperm mutation and is plotted on the galianconism of karyomit(e) 7H, position within nud gene 16cM, this position is consistent with the drafting position of Sex6 mutation.

On karyomit(e) 7H galianconism, the assignment of genes gene mapping in close kinetochore shows that cause and effect sudden change (sex6) is in a different gene, towards the sudden change of the high amylose starch phenotype that causes the AC38 (amol) that is plotted in karyomit(e) 1H (this willing Dare Mel etc., 1992).Drawing position is hinting that a gene candidate of interrupting in the sex6/292 mutation is starch synthase II, the starch synthase II of wheat also be positioned at chromosomal this same position (the gloomy and grace in mountain is many, 1996; Li Shi etc., 1999b).The arrangement analysis of 292 and 342 mutation shows that the transition sudden change of G to A is arranged in gene, cause the cut-out of gene, and the C-petiolarea of the reactive site that contains enzyme can't be understood, and may cause complete sluggish albumen synthetic.In addition, the SSII sequence in the gene of MK6827 has shown the transition sudden change at 242 locational G to A, and this also can cause the cut-out of gene.The allelotrope characteristic of this results verification 292 and MK6827 mutation.

The identification of the sudden change in the SSII gene has caused in 292 the development that the PCR mark of sudden change is distinguished.The record of this PCR mark passes 292 x and adds 91 offsprings that draw population seemingly firmly, and has taken place with the contraction endosperm phenotype of starch and reduce the absolutely identical variation of chain length distribution phenotype.In the SSII gene of the barley of different background (292 with MK6827), find to cause the allelic mutation of similar phenotype, and find mutation and the substantial connection of shrinking the grain phenotype, convincingly demonstrate 292,342 and the SSII gene of MK6827 in the sudden change that exists be the cause and effect sudden change that causes shrinking the endosperm feature.

The phenotype of SSII sudden change in the barley of this observation, very similar to the SSII sudden change phenotype of other plant in some aspects, still, the SSII sudden change has not improved the content of amylose starch the sudden change of being found significantly in 292/342.Find that pea (rug5, Cray dagger-axe etc., 1998) and chlamydomonas (Fang Tai because of etc., 1993) also have SSII to suddenly change, and, as this observed, improved amylopection content, the chain length distribution of minimizing.Evidence suggests that the contraction of corn-2 sudden change is that the sudden change by the SSII gene produces, but this conclusion does not obtain proof (Hahn etc., 1998 as yet yet; Nat etc., 1998).The contraction of corn-2 sudden change produces has the starch (Campbell etc., 1994) that gelatinization temperature reduces.Gloomy having cultivated in wheat in mountain lacks Sgp-1 proteic three no kinds (mountain is gloomy, 1998), and people such as Li Shi (Li Shi etc. 1996b) have proved that this kind is the SSII gene prod.In wheat, it is about 35% that amylose content is brought up to, and observed undesired starch granules, and crystallization variation and gelatinization temperature change (mountain is gloomy, 1998).Feature difference between the SSII sudden change of barley and the SSII sudden change of other species is very surprising.

SSII sudden change explanation can change into another from a genetic background by cultivation, and produces original 292,342 and typical distinguishing particles shape and the composition of MK6827.292 x of table 9 add in the data of drawing (Tantangara) double haploid kind seemingly firmly, L/T ratio, beta-glucan content, chain length distribution, RVA and flour expanding volume parameter prove that the kind with 292 sudden changes shows typical 292 female phenotypes of planting.And then the variation of 292 seeds that produced with the endogamy offspring of the reverse hybridization second time of Si Lupu (Sloop) has shown normal phenotype (L/T ratio＜3.5 of 74 seeds) and has shunk the 3:1 aberration rate that phenotype (the L/T ratios of 21 seeds〉3.5) makes a variation.

The acquisition of SSII sequence in the gene and barley transformation system provides with the gene inhibition technology and has opened the required instrument of SSII gene, is used for producing the phenotype that can compare favourably with the SSII sudden change.The efficient strategy of exploitation is to produce a kind of hairpin structure and can suppress the active double-stranded RNA of endogenous SSII in order to produce one recently.Though opening fully of the emergency sport of similar sudden change described here can be interesting, but have the recovery of using and having the transgenosis that the hairpin structure of different levels expresses of the different dna structures that promote Ji, make that adopting volumetry to measure from normal level can obtain assessment to the expression of gene influence of opening level fully.

Sudden change expression can be transferred to other barley genetic background from 292, keeps the essential characteristics of original 292 sudden changes simultaneously.Listed in table 9 and the table 10 292 x add seemingly firmly draw (Tantangara) double haploid offspring and with the phenotype data of the reverse second filial generation seed of Si Lupu (Sloop), show that phenotype shifts in the course of cultivation.

Table 1

The barley grain composition

	Starch content amount (%) ^a	Amylose content amount (%) according to HPLC ^b	Amylose content (%) according to the iodine gummed	Protein content (%) ^a	Beta-glucan (%) ^a	The total foodstuff fiber ^a (％)	The insolubility foodstuff fibre ^a (％)	The solubility foodstuff fibre ^a (％)
	Starch content amount (%) ^a	Amylose content amount (%) according to HPLC ^b	Amylose content (%) according to the iodine gummed	Protein content (%) ^a	Beta-glucan (%) ^a	The total foodstuff fiber ^a (％)	The insolubility foodstuff fibre ^a (％)	The solubility foodstuff fibre ^a (％)	The glacier	n.d.	31.0	.n.d.	11.5	4.3	21.6	16.6	5
AC38	47	47.4	60.6	10.4	5.8	24.9	28.8	6.1	The glacier	n.d.	31.0	.n.d.	11.5	4.3	21.6	16.6	5
AC38	47	47.4	60.6	10.4	5.8	24.9	28.8	6.1	Himalaya	49	25	25.4	10.0	4.8	27.1	18.1	9
292	17.7	71	68.9	15.0	9.5	30.3	21.4	8.9	Himalaya	49	25	25.4	10.0	4.8	27.1	18.1	9
292	17.7	71	68.9	15.0	9.5	30.3	21.4	8.9	342	21.9	62.5	71.7	15.7	8.3	28.3	19.4	8.9
MK6827	10.2	n.d.	44.4	21.3	n.d.	n.d.	n.d.	n.d.	342	21.9	62.5	71.7	15.7	8.3	28.3	19.4	8.9

Wa Kexiluo	42.8	n.d.	5.0	14.6	n.d.	19.8	12.7	7.1.
Wa Kexiluo	42.8	n.d.	5.0	14.6	n.d.	19.8	12.7	7.1.	Add seemingly firmly and draw	51.6	n.d.	29.5	14.6	n.d.	17.2	12.7	4.5.

^a% grain weight, 14% moisture

^b% starch total content

N.d. do not determine

Table 2

The grain specification

	Grain weight (mg)	Grain length (mm)	Grain width (mm)	Grain thickness (mm)	The L/T ratio
	Grain weight (mg)	Grain length (mm)	Grain width (mm)	Grain thickness (mm)	The L/T ratio
Himalaya	51.01 6.63 ^a	7.01 0.51	3.58 0.34	2.82 0.36	2.48
Himalaya	51.01 6.63 ^a	7.01 0.51	3.58 0.34	2.82 0.36	2.48	Add seemingly firmly and draw	50.40 6.51 ^a	7.22 0.98	3.60 0.25	2.73 0.21	2.64
Wa Kexiluo	45.71 5.21	7.54 0.47	3.40 0.20	2.67 0.19	2.82	Add seemingly firmly and draw	50.40 6.51 ^a	7.22 0.98	3.60 0.25	2.73 0.21	2.64
Wa Kexiluo	45.71 5.21	7.54 0.47	3.40 0.20	2.67 0.19	2.82	AC38	50.79 8.22	7.62 0.65	3.35 0.27	2.64 0.25	2.89
292	32.13 4.67 ^a	7.05 0.49	3.63 0.55	1.58 0.20	4.46	AC38	50.79 8.22	7.62 0.65	3.35 0.27	2.64 0.25	2.89
292	32.13 4.67 ^a	7.05 0.49	3.63 0.55	1.58 0.20	4.46	342	35.45 6.01	7.28 0.55	3.76 0.38	1.75 0.18	4.16
MK6827	44.89 3.78	11.20 0.58	3.63 0.27	1.77 0.33	6.33	342	35.45 6.01	7.28 0.55	3.76 0.38	1.75 0.18	4.16

N=50 is unless indicate ^a, n=200

Table 3

Isoamylase debranching starch chain length distribution

Dp ^a	Himalaya % ^b	Add seemingly firmly and draw % ^b	AC38 ％ ^b	342 ％ ^b	292 ％ ^b	MK6827 ％ ^b
Dp ^a	Himalaya % ^b	Add seemingly firmly and draw % ^b	AC38 ％ ^b	342 ％ ^b	292 ％ ^b	MK6827 ％ ^b	DP 6-11	24.15	22.40	26.33	38.18	38.96	37.98
DP 12-30	69.12	67.59	67.62	54.14	53.42	55.60	DP 6-11	24.15	22.40	26.33	38.18	38.96	37.98
DP 12-30	69.12	67.59	67.62	54.14	53.42	55.60	DP 31-60	6.73	10.01	6.05	7.68	7.62	6.42

^aThe polymerization degree

^bThe oligose distribution proportion of representing with mole

Table 4

Barley starch temperature profile with dsc measurement

Table 5

The RVA parameter of barley starch

	Peak viscosity	Break	Continue intensity	Reverse	Final viscosity	Standardized final viscosity *	Pasty state temperature (C)
	Peak viscosity	Break	Continue intensity	Reverse	Final viscosity	Standardized final viscosity *	Pasty state temperature (C)	Himalaya	871.5	653.1	218.4	235.8	454.2	926	64.9
Na Moyi Namoi	621.7	367.5	254.2	375.3	629.5	1284	65.9	Himalaya	871.5	653.1	218.4	235.8	454.2	926	64.9
Na Moyi Namoi	621.7	367.5	254.2	375.3	629.5	1284	65.9	AC38	226.7	87.3	139.4	188.4	327.8	697	68.9
292	92.1**	***	133.9	230	363.9	2055	89.5	AC38	226.7	87.3	139.4	188.4	327.8	697	68.9

342	110.9**	***	144.9	264.5	409.4	1869	87.9
342	110.9**	***	144.9	264.5	409.4	1869	87.9	MK6827	18.2**	***	25.7	43.3	69	676	n.d.

* the final viscosity distinguished of the starch content of semolina

The Himalaya numerical value that * writes down when the viscosity of peak

* * numerical value is less than zero

N.d. do not determine

Table 6

The starch crystals data

Sample	％H2O (W.B)	Crystallization %*	A ％*	B ％*	V ％*
Sample	％H2O (W.B)	Crystallization %*	A ％*	B ％*	V ％*	292	29.6	9	-	13	87
342	35.8	12	-	18	81	292	29.6	9	-	13	87
342	35.8	12	-	18	81	AC38	26.1	19	93	7	(trace)
Himalaya	27.7	27	93	7	(trace)	AC38	26.1	19	93	7	(trace)
Himalaya	27.7	27	93	7	(trace)	Wa Kexiluo	29.7	41	94	6	-

(*_±5％)

Table 7

Offspring analysis

Hybridization	Shrink	Full	Calculate ²Value ^c
Hybridization	Shrink	Full	Calculate ²Value ^c	292 x Si Lupu ^a	45	155	²(3:1)＝1.0
292 x add seemingly firmly and draw ^b	45	46	²(1:1)＝0.01	292 x Si Lupu ^a	45	155	²(3:1)＝1.0

^aThe offspring that standard hybridization produces

^bThe double haploid offspring

^cUnder each situation, ²(0.05), df=1=3.8 ₄, therefore, 292 * Si Lupu population meets 3:1 variation, and 292 * seemingly firmly add and draw the double haploid population to meet the 1:1 variation.

Table 8

292 * seemingly firmly add and draw double haploid kind record

Kind number ^aEpidermis ^bSeed weight L/T ratio ^cDP6-11 amylose starch PCR ^f

(mg) (%) ^dContent ^e

1 N 26 3.8 35.87 50.2 292

2 N 24 4.21 36.87 56.2 292

3 H 43 3.32 25.45 18.3 Wt

5 N 40 4.58 39.47 55.5 292

7 N 34 4.28 19.63 43.0 292

8 H 48 3.02 21.6 46.7 Wt

9 N 31 2.76 22.89 25.9 Wt

10 N 26 3.02 27.56 21.1 Wt

11 N 34 3.55 37.90 44.7 292

12 H 50 2.94 26.37 32.8 Wt

13 N 27 4.29 38.68 48.4 292

14 H 56 3.07 22.98 20.8 Wt

15 H 46 2.74 24.88 22.9 Wt

16 H 43 2.78 25.40 18.3 Wt

17 N 31 3.8 37.37 54.2 292

18 N 31 4.51 37.46 57.5 292

19 H 26 3.1 29.57 22.7 Wt

20 H 53 3.04 25.42 23.8 Wt

21 N 31 4.5 38.51 59.1 292

22 N 27 4.63 37.25 27.2 292

23 H 47 2.73 24.11 21.2 Wt

24 N 27 4.58 36.89 42.0 292

26 H 35 3.57 19.50 15.1 Wt

27 H 22 4.3 36.81 48.6 292

28 N 31 4.34 38.88 37.0 292

30 N 30 4.04 38.05 48.4 292

31 N 23 4.25 37.07 51.7 292

32 H 48 2.62 20.67 13.0 Wt

33 N 25 4.92 35.68 33.3 292

34 N 31 4.01 38.34 46.1 292

35 H 43 3.16 20.07 23.6 Wt

36 N 26 4.33 36.93 29.7 292

38 H 38 3.01 21.11 9.1 Wt

39 H 33 2.92 20.49 23.5 Wt

40 H 36 2.99 19.57 2.2 Wt

41 N 30 4.05 37.82 40.9 292

42 H 47 2.95 20.80 11.9 Wt

43 N 40 3.24 21.97 18.1 Wt

45 H 52 2.78 19.97 14.5 Wt

46 N 29 4.44 35.87 32.1 292

47 N 35 3.69 36.34 92.9 292

48 H 31 2.54 20.27 13.4 Wt

49 H 54 2.94 22.29 19.3 Wt

50 H 50 2.94 21.92 20.6 Wt

51 H 43 3.73 20.59 18.1 Wt

53 N 31 4.12 36.52 55.3 292

54 N 34 4.02 35.17 57.1 292

55 H 32 4.19 41.35 60.4 292

56 N 29 3.17 21.48 18.1 Wt

57 H 30 4.85 36.66 46.3 292

58 N 32 2.97 23.83 13.8 Wt

59 N 46 2.91 24.15 9.2 Wt

60 H 44 2.74 22.39 13.5 Wt

61 N 31 4.47 35.67 61.3 292

63 N 32 4.3 36.94 39.4 292

64 H 39 2.93 21.95 20.5 Wt

65 N 26 3.87 37.51 20.7 292

66 N 30 4.03 36.89 48.7 292

67 H 36 3.17 20.24 14.4 Wt

68 N 43 2.65 22.53 8.4 Wt

69 N 32 3.93 36.34 54.7 292

70 H 43 2.77 22.28 17.6 Wt

71 N 29 3.73 38.73 31.5 292

72 H 47 2.65 22.00 20.8 Wt

73 N 36 4.09 39.58 49.0 292

74 N 24 4.18 36.15 47.8 292

75 H 34 2.99 24.42 14.2 Wt

76 N 31 4.35 35.95 49.9 292

77 H 49 3.19 21.22 17.0 Wt

78 H 33 2.78 21.27 15.6 Wt

79 H 31 2.85 23.04 21.2 Wt

80 H 38 3.18 19.88 18.9 Wt

81 H 37 2.84 24.22 16.2 Wt

82 H 33 4.64 39.99 45.3 292

84 N 28 3.62 36.98 28.9 292

85 N 26 6.44 44.43 41.3 292

86 H 32 2.87 30.73 16.1 Wt

88 N 26 4.62 46.12 39.3 292

89 H 38 2.88 31.25 16.3 Wt

90 H 32 3.19 31.11 13.8 Wt

91 N 31 4.17 42.86 37.3 292

92 N 27 3.99 45.30 44.6 292

93 H 37 2.99 30.77 12.5 Wt

94 H 43 3.67 29.46 21.9 Wt

96 N 33 5.69 47.34 52.2 292

97 N 23 3.41 31.36 17.1 Wt

98 N 32 5.95 45.27 52.4 292

99 N 19 3.68 38.36 1.7 292

100 H 36 3.1 31.92 15.4 Wt

101 N 58 3.29 24.71 2.9 Wt

^a292 * seemingly firmly add and draw the double haploid kind

^bThe epidermis phenotype.N represents not have skin; H represents that skin is arranged.

^cL/T ratio: length and thickness ratio.

^dIn the debranching starch of DP6 to DP11, the per-cent of chain, calculates by the elution between DP6 and the DP65 as the chain per-cent between DP6 and the DP65 with mole foundation.

^eDetermine amylose content by the iodine blue valve

^fThe PCR record.292, the PCR reaction produces and can generate the 169bp band in the NlaIV digestion, adds the band of 103bp; Wt, the PCR reaction produces and can generate 111bp, the band of 103bp and 57bp on NlaIV.

The design of carrier and structure

Barley SSII gene region (among Figure 15 determine) is cloned in the carrier transforms.According to the gene inhibition strategy, prepare three kinds of constituents for each gene object, (1) feels the associating inhibition, (2) anti-sensation, (3) dual regulation suppresses.

Figure 16 has listed the alignment arrangements of the dna structure composition that designs for the genetic expression of inhibition endogenous object.Promote Ji can select special-purpose promotor (for example, polymer weight glutenin promoter, wheat SSI promotor, wheat BEII promotor) of endosperm or the special-purpose promotor (for example, ubiquitin or 35S) of non-endosperm for use.Also can contain other composition that improves conversion in the constituent, for example the nos3 composition of OCS.Listed DNA zone sneaked into contain suitably, optionally marker gene is arranged and the carrier the inside of other composition, perhaps with contain the common carrier the inside that transforms of these arranged carrier.

The conversion of cereal

To barley (court of a feudal ruler Ji etc., 1997; Wan Shi etc., 1994), oat (Sa Mosi etc., 1992,1994; Ge Lisi etc., 1998; Zhang Shi etc., 1999; Cao Shi etc., 1999) and rye (Ka Sidiluo etc., 1994; Pi Na etc., 1984) method for transformation is described, can be in order to transform the dna structure composition that produces transgenic plant.

Genetically modified analysis

The DNA of the dna structure composition by PCR or south hybridization distinguishes, has carried out distinguishing of transgenic plant.By carrying out standard technologies such as north hybridization and west absorption respectively,, measured the mark level of indivedual barley starch biosynthesis genes at mRNA and protein level.Starch and grain content and composition have been measured with the technology of illustrative standard in the example 1 etc.

Bibliography

Abel etc., (1996).The plant magazine, 10,981-991.

A Haokasi, (1979).Barley heredity communication, 9,7-9.

The rich lattice of Acker etc., (1998).The cereal science magazine, 28,71-80.

Anderson etc., (2000).Cereal chemistry, 77,463-467.

Anderson etc., (1999).Food and agricultural sciences communication, 79,979-986.

An Deli not waits, (1999).Starch, 51,422-429.

BAKE this etc., (1971).Starch, 23,12-15.

The Ba Tie and the Cole court of a feudal ruler, (1997).Starch, 48,338-344.

Ba Tie etc., (1997).Cereal chemistry, 74,497-501.

Burger etc., (1999).Animal-feed science and technology, 78,215-226.

Ripple is breathed out and is carried (1999).Cereal chemistry, 76,589-599.

Than inferior Schaefer etc., (1986).Soviet's genetics, 22,296-303.

Bao Ye and Prey this, (1978).Carbohydrate compound research, 61,321-334.

Bao Ye and Prey this, (1981).Plant physiology, 67,1141-1145.

Bao Ye etc., (1980).Starch, 32,217-222.

Bu Lien etc., (1998).The biopolymer international magazine, 23,85-112.

The Ka Erfo top grade, (1976).International nutrition report, 14,55-61.

Campbell etc., (1994).Cereal chemistry, 71,464-468.

Cao Shi etc., (2000).Biological chemistry and biophysics archives, 373,135-146.

Keyes etc., (1998).The cereal science magazine, 27,301-314.

Ka Sidiluo etc., (1994).Biology/technology, 12,1366-1371.

Cao Shi etc., (1999).Plant science (Limerick), 148,9-17.

Ke Laige etc., (1998).Vegetable cell, 10,413-426.

The short proud Wa Sika etc., (1998) of examining.Cereal chemistry, 75,747-754.

The short proud Wa Sika etc., (1992) of examining.Cereal chemistry, 69,413-418.

Deng Ye etc., (1996).Plant physiology, 112,779-785.

Ai Erfufosen etc., (1999).Cereal chemistry, 76,434-438.

Ai Silike and Rice, (1976).The communication of barley genetics, 6,21-22.

The Fa Sinuo top grade, (1996).The farm crop science, 36,941-946.

Fei Dake etc., (1972).Canada's genetics and cytologic magazine, 14,949-957.

Phelps etc., (1996).Plant, 198,340.

Fang Tai because of etc., (1993).Journal of biological chemistry, 268,16223-16230.

Fu Jita etc., (1999).The breeding science, 49,217-219.

Fu Wa etc., (1999).Starch, 51,147-151.

Gao Shi etc., (1998).Vegetable cell, 10,399-412.

The Killough restrains this and Hana, (1994).Molecule and general genetics, 243,400-408.

Ge Lisi etc., (1998).The plant physiology magazine, 152,151-157.

Ge Elin and De Hasi, (1974).Cereal chemistry, 51,573-578.

Glan Fil moral etc., (1994).U.S.'s clinical nutrition magazine, 59,1075-1082.

Green etc., (1997).Plant physiology, 114,203-212.

Paddy Greensboro etc., (2000).Plant physiology, 122,1457.

Xi Deman and Bao Ye, (1982).Biochemical genetics, 20,483-492.

Yi Ji Dorr base gram etc., (2000).Agricultural and food chemistry magazine, 48,982-989.

James etc., (1995).Vegetable cell, 7,417-429.

Letter etc., (1999).Cereal chemistry, 76,629-637.

Jar (unit of capacitance) peacekeeping Ai Silike, R.F. (1975).The farm crop science, 15,363-366.

Qiao Bulin etc., (1999).The plant magazine, 18,163-171.

Card thatch etc., (1993).Carbohydrate polymer, 21,133-136.

Nat etc., (1998).The plant magazine, 14,613-622.

Ke Nike-Luo Si etc., (2001).Starch, 53,14-20.

Krueger etc., (1987).Cereal chemistry, 64,187-190.

Ku Bo etc., (1999).Plant physiology, 121,399-409.

Li Shi etc., (1999).Plant physiology, 120,1147-1155.

Li Shi etc., (2000).Plant physiology, 123,613-624.

Li Shi etc., (1999).Theory and applied genetics, 98,1208-1216.

Mi Zhunuo etc., (1993).Journal of biological chemistry, 268,19084-19091.

Mi Zhunuo etc., (1992).Biochemical magazine, 112,643-651.

Mo Laier etc., (1997).Plant physiology, 113,201-208.

Mo Laier etc., (1998).Electrophoresis, 19,2603-2611.

Mo Lisen etc., (1984).The cereal science magazine, 2,257-271.

Rub to rein in etc. (1996).Vegetable cell, 8,1353-1366.

Mayer this etc., (2000).Plant physiology, 122,989-997.

Buddhist nun Ci Weitafu, (1990).Nauchno-tekh.Bull ' VSGI, Order Sa, No. 175,31-35

Buddhist nun Ci Weitafu, (1992).Cytology and genetics (Ji Pu), 26,26-30.

Buddhist nun Ci Weitafu and Chris Ding Kefu, (1993).The communication of barley genetics, 22,44-45.

Niu Man etc., (1978).The animal science magazine, 47,448-455.

Ng etc., (1997).Cereal chemistry, 74,288-288.

Oscar Ademilson etc., (1998).Food and agricultural sciences magazine, 78,359-366.

Oscar Ademilson etc., (1996).The cereal science magazine, 24,161-170.

Oscar Ademilson etc., (1997).The cereal science magazine, 26,259-264.

Pi Na etc., (1987).Nature, Britain, 325,274-276.

Pearson and Chryst Ademilson, (1997).Sveriges.Utsadesforenings.Tidskrift.107，141-153。

Pearson etc., (1996).Sveriges.Utsadesforenings.Tidskrift.106，79-86。

Big gun Mo Lanci, (1992).Europe clinical nutriology magazine, 46, S63-S68.

Big gun Mo Lanci etc., (1972).Cereal chemistry, 49,629-635.

La Heman etc., (1995).Australia's plant physiology magazine, 22,793-803.

La Mazi and Ai Silike, (1975).The communication of barley genetics, 5,114.

La Mazi and Ai Silike, (1975).The communication of barley genetics, 6,115.

This willing Dare Mel etc., (1992).Plant propagation, 109,274-280.

Schoolman and Ka Miou pagoda, (1991).Starch, 43,387-389.

This Kyle Korver etc., (2000).Nature Biotechnol, 18,551-884.

Suhl etc., (1983).Cell, 35,225-233.

Suo Musi etc., (1994).The avenaceous genetic engineering, 37-46.

Song Shi and letter, (2000).Carbohydrate polymer, 41,365-377.

Sun Shi etc., (1997).New plant is learned, and 137,215-215.

Mountain De Boge etc., (1998).Food and agricultural sciences magazine, 76,457-463.

Si Wansidun, (1992).The communication of barley genetics, 22,66-67.

Si Wansidun etc., (1995).The cereal science magazine, 22,265-273.

Plutarch reaches etc., (1993).Carbohydrate compound research, 246,273-281.

Tuo Buqiao Ademilson etc., (1996).The plant magazine, 10,243-250.

Court of a feudal ruler outstanding person etc., (1997).The plant magazine, 11,1369-1376.

Holder is flat, (1999).Asia-Pacific clinical nutriology magazine, 8, S22-S26.

Holder equality, (1997).The trophology magazine, 127,615-615.

Wa Shantan and Ba Di, (1995).Cereal chemistry, 72,379-384.

Wa Shantan and Ba Di, (1998).Starch, 50,286-291.

Fertile Cole and Merritt, (1968).Nature, 221,482-484.

Wan Shi and Li Mokesi, (1994).Plant physiology, 104,37-48.

Wang Shi etc., (1998).The experimental botany magazine, 49,481-502.

Wang Shi etc., (1993).Cereal chemistry, 70,521-525.

Dimension Ademilson and Mike receive the primary, (1975).Britain's poultry science, 16,497-504.

Xue Shi, (1996).Cereal chemistry, 73,588-592.

The mountain is gloomy, (1998).(anonymity), pp.300-302.University's expansion newspaper, Saskatchewan university, Saskatoon.

The mountain is gloomy and grace is many, (1996).Theory and applied genetics, 93,275-281.

Yoshimoto etc., (2000).Cereal chemistry, 77,279-285.

Zhang Shi etc., (1999).The vegetable cell report, 18,959-966.

Zheng Shi etc., (2000).Cereal chemistry, 77,140-144.

Zi Waer and mountain De Leer, (1995).Plant, 197,39-48.

Sequence table

＜110〉Commw Scient Ind Res Org

＜120〉the higher starch of a kind of amylose content, the method that produces the grain of this starch and produce described grain

<160>12

<210>1

<211>2920

<212>DNA

<213>Hordeum vulgare

<220>

<223>SSIIcDNA

<400>1

<210>2

<211>2950

<212>DNA

<213>Hordeum vulgare

<220>

<221>mutation

<222>235

<223>Barley Line MK6827 cDNA of SSII gene

<400>2

<210>3

<211>2951

<212>DNA

<213>Hordeum vulgare

<220>

<223>Barley Cultivar Morex cDNA of SSII gene

<400>3

<210>4

<211>2946

<212>DNA

<213>Hordeum vulgare

<220>

<221>mutation

<222>1855

<223>Barley Line 292 cDNA of SSII gene

<400>4

<210>5

<211>813

<212>PRT

<213>Hordeum vulgare

<220>

<223>Barley Cultivar Morex SSII deduced amino acid sequence

<400>5

<210>6

<211>802

<212>PRT

<213>Hordeum vulgare

<220>

<223>Barley Cultivar Himalaya SSII deduced amino acid sequence

<400>6

<210>7

<211>813

<212>PRT

<213>Hordeum vulgare

<220>

<221>SITE

<222>583

<223>Barley Line 292 SSII deduced amino acid sequence with premature termination

<400>7

<210>8

<211>813

<212>PRT

<213>Hordeum vulgare

<220>

<221>SITE

<222>43

<223>Barley Line MK6827 SSII deduced amino acid sequence with prematuretermination

<400>8

<210>9

<211>23

<212>DNA

<213>Artificial

<220>

<223>PCR primer ssIIa

<400>9

<210>10

<211>23

<212>DNA

<213>Artificial

<220>

<223>PCR primer ssIIb

<400>10

<210>11

<211>23

<212>DNA

<213>Artificial

<220>

<223>PCR primer ZLSS2P4

<400>11

<210>12

<211>23

<212>DNA

<213>Artificial

<220>

<223>PCR primer ZLBSSII5

<400>12

Claims

1, the starch that obtains a kind of starch small grain of the grain from barley plants is characterized in that described starch small grain comprises the amylose starch of 50% massfraction at least.

2, starch according to claim 1 is characterized in that, described starch have reduced pass through dsc detected gelatinization temperature.

3, starch according to claim 1 is characterized in that, described starch has the expanding volume less than 3.2.

4, starch according to claim 3 is characterized in that, described starch has the expanding volume more than or equal to 2.0.

5, starch according to claim 1 is characterized in that, during described starch gel, demonstrates the peak viscosity that has reduced.

6, starch according to claim 1 is characterized in that, its gelatinization point is higher than 75 ℃.

7, starch according to claim 1, it is characterized in that, described starch has the structure of change, and the structure of described change is by following one or more concrete physical property indication: the amylopectin of lipid, low-crystallinity and reduction that the not accessibility physically that high beta-glucan content causes, the particle form of change, considerable and starch have is chain length distribution.

8, starch according to claim 1 is characterized in that, contains the amylose starch of 60% massfraction in the described starch at least.

9, starch according to claim 1 is characterized in that, comprises the lipid starch of remarkable quantity in the described starch, and described lipid starch test shows as the V-compound crystal, shows that the starch of V-compound crystal accounts for 10% of crystal starch at least.

10, starch according to claim 10 is characterized in that, compared to vulgare starch, the degree of crystallinity of described starch reduces, and the ratio of crystal starch is less than 20%.

11, starch according to claim 10 is characterized in that, has changed the amylopectin chain length by debranching, and the amylopectin chain length of described change meets following one or more condition:

A) the chain length amylopectin chain ratio that drops on 6 to 11 scope residues is at least 25%,

B) the chain length amylopectin chain ratio that drops on 12 to 30 scope residues is less than 65%,

C) the chain length amylopectin chain ratio that drops on 31 to 60 scope residues is less than 10%.

12, starch according to claim 11 is characterized in that, chain length drops on the amylopectin chain ratio of 31-60 scope residues greater than 5%.

13, a kind of barley grain that is used for foodstuff production is characterized in that the starch small grain of described barley grain comprises the arbitrary described starch of claim 1 to 12.

14, grain according to claim 13 is characterized in that, its state can for wear into powder, pulverize, pearl or rolling shape, corase grind shape, perhaps rhagadiform any one.

15, grain according to claim 14 is characterized in that, the flour of making of described grain or the swell increment of semolina are less than 3.2.

16, grain according to claim 14 is characterized in that, is at least 2 with the flour of described grain making or the swell increment of semolina.

17, grain according to claim 14 is characterized in that, its beta-glucan content accounts for 6% of hulled grain gross weight not at least.

18, grain according to claim 14 is characterized in that, described grain has following one or more feature: starch content is higher than 12% of no shell grain, easily mills.

19, a kind of method that produces barley plants, described barley plants can produce as the described grain of claim 13 to 18, it is characterized in that, said method comprising the steps of:

A) adopt sodiumazide to bring out the no barley kind Himalaya of sudden change with the acquisition mutant strain,

B) obtain the grain seed from described mutant strain,

C) the screening endosperm dwindles phenotypic grain seed from the grain seed that step b) obtains, and perhaps screens the grain seed of high amylose content.