RU2811010C2 - High-amylosic wheat-iii - Google Patents

Abstract

FIELD: biochemistry.

SUBSTANCE: invention relates to wheat grain of the Triticum aestivum species with a high content of amylose, fructan, β-glucan, arabinoxylan and cellulose. Also the following is disclosed: a food ingredient and a food product derived from the said grain; a composition for production of the said food product or food ingredient. The following is disclosed: the use of the specified grain to obtain flour; a method of obtaining wheat; wheat grain screening method; a method of production of a food product from the specified grain; a method of obtaining starch from the specified grain.

EFFECT: invention makes it possible to effectively obtain wheat grain of the Triticum aestivum species with a high content of amylose, fructan, β-glucan, arabinoxylan and cellulose compared to wild-type wheat grain.

25 cl, 26 dwg, 9 tbl, 12 ex

Description

RELATED APPLICATION

[0001] The application claims benefit from Australian Provisional Patent Application No. 2016902643, filed July 5, 2016, the entire contents of which are incorporated herein by reference.

TECHNICAL FIELD

[0002] This invention describes methods for producing hexaploid wheat plants containing high amylose starch, and the use of such plants and, in particular, grains or starch derived from them, in a wide range of food and non-food products.

BACKGROUND OF THE ART

[0003] References to any prior art made in this specification are not, and should not be construed, as an admission or any form of suggestion that such prior art forms part of the common knowledge in any country. This application contains references to various publications, including those cited in parentheses. A complete list of publications cited, referenced in parentheses, can be found in alphabetical order at the end of the specification immediately before the claims. The description of all publications cited in their entirety is incorporated into this application by reference to more fully describe the prior art to which this invention relates.

[0004] Food products produced from wheat grains supply at least 20% of the dietary kilojoules for the global population and provide a significant portion of the protein and non-starch polysaccharides as well as the energy contribution to the human diet. Starch is the main component of wheat grains and is used in a wide range of food and non-food products. Starch characteristics vary and play a key role in determining the suitability of wheat starch for a particular end use. Despite the enormous global consumption and despite the growing understanding of the importance of functional starch characteristics on the quality of the final product, research on genetic variations in wheat and their precise influence on starch characteristics lags behind research on other industrially important cereal plants.

[0005] Carbohydrates constitute about 65-75% of mature wheat grains (Stone and Morell, 2009). The main carbohydrate in wheat grains is starch, which is composed of two polymers of glucose, amylose and amylopectin. Amylose is a predominantly linear polymer of α-1,4-linked glucose units with several branches, whereas amylopectin is relatively highly branched with α-1,6-glucosidic linkages linking the α-1,4-linked glucose units. The ratio between amylose and amylopectin is a major determinant for (i) the health benefits of wheat grains and wheat starch and (ii) the final quality of products containing wheat starch.

[0006] A second important health determinant in wheat grains is the amount of non-starch polysaccharides in the grains, which form part of the dietary fiber. Wild wheat grains contain about 1% by weight oligosaccharides such as raffinose, about 1% fructans, and about 10% cell wall polysaccharides, mainly cellulose, arabinoxylan, and β-glucan (Stone and Morell, 2009). They constitute the main components of dietary fiber, which are not digested or absorbed in the small intestine, but pass into the large intestine, where they are subject to bacterial degradation. Dietary fiber is important for regulating blood glucose and insulin levels, as well as for gut health.

[0007] Cereal grains containing starch with an increased relative amount of amylose are of particular interest due to their health benefits. Foods containing increased amounts of amylose have been found to have higher levels of resistant starch (RS), which is a form of dietary fiber. PA is starch or partially broken down starch products that are not digested or absorbed in the small intestine. It is becoming increasingly clear that resistant starch plays an important role in promoting gut health and protecting against diseases such as colorectal cancer, type II diabetes, obesity, heart disease and osteoporosis. Some grains with high amylose starch, such as corn and barley, have been developed for use in foods and as a means of promoting gut health. The beneficial effects of resistant starch are due to the delivery of nutrients to the large intestine, where the intestinal microflora receives an energy source that is fermented to form short-chain fatty acids. These short-chain fatty acids provide nutrients to colonocytes, increase the absorption of certain nutrients by the colon, and stimulate the physiological activity of the colon. In general, unless the colon receives resistant starches or other dietary fiber, it becomes relatively metabolically inactive. Thus, high-amylose foods have the potential to provide increased fiber intake. Additional potential health benefits of consuming high-amylose wheat grains or their products such as starch include improved regulation of blood sugar, insulin and lipid levels. In addition, such foods may provide a feeling of satiety, improve intestinal motility, stimulate the growth of probiotic bacteria, and increase fecal excretion of bile acids.

[0008] Most processed starch-based foods contain very little DO. Bread made from wild-type wheat flour through traditional kneading and baking processes contains <1% DO. In comparison, bread baked using the same process and storage conditions, but containing high-amylose wheat flour due to reduced starch-branching enzyme activity in the grain, has DO levels 10 times higher (WO2006/069422). Legumes, one of several rich sources of DO in the human diet, have DO levels typically <5%. Therefore, consuming high-amylose wheat bread in amounts typically consumed by an adult (eg, 200 g/day) could easily provide at least 5-12 g of DO. Thus, the inclusion of high-amylose wheat grains in food products has the potential to make a significant contribution to human dietary OC consumption.

[0009] Starch is initially synthesized by plants in the chloroplasts of photosynthetic tissues, such as leaves, as a transition form of starch. It is mobilized during subsequent dark periods to supply carbon for export to sink organs and energy metabolism or for storage in organs such as seeds or roots. The synthesis and long-term storage of starch occurs in the amyloplasts of storage organs, such as the endosperm in cereals, where starch is deposited in the form of semi-crystalline granules with a diameter of up to 100 μm. The granules contain both amylose and amylopectin, the former typically as an amorphous material in native starch granules, while the latter is semicrystalline due to the packing of linear glucosidic chains. The granules also contain some proteins involved in starch biosynthesis.

[0010] At least four types of enzymes are involved in the synthesis of starch in the endosperm (Figure 1). First, ADP-glucose pyrophosphorylase (ADPG) catalyzes the synthesis of ADP-glucose from glucose-1-phosphate and ATP. Second, a number of diverse starch synthases (SS, from starch synthase; EC 2.4.1.21) catalyze the transfer of glucose residues from ADP-glucose to the non-reducing end via α-1,4 linkages to extend the α-glucan chain. Third, starch branching enzymes (SBBEs) form new α-1,6 linkages in α-polyglucans. Finally, starch debranching enzymes (SDBEs) remove some of the branching bonds through a mechanism that is not yet fully understood.

[0011] Although it is clear that at least these four activities are required for normal synthesis of starch granules in higher plants, multiple isoforms of each enzyme are found in the endosperm of higher plants. Specific roles for some of the enzymes have been suggested based on mutational analysis or through modification of gene expression levels using transgenic approaches (Abel et al., 1996; Jobling et al., 1999; Schwall et al., 2000). However, the contribution of each isoenzyme is significantly characterized among different species, and the exact contribution of each isoform to starch biosynthesis is still unknown. This is especially true for the hexaploid common wheat ( Triticum aestivum ), which has three sets of homologous chromosomes defining the genomes A, B and D. Hexaploidity has been considered a significant handicap in the study and development of useful wheat varieties. Indeed, information is limited regarding how homologous wheat genes interact, how their expression is regulated, and how different proteins that are products of homologous genes work alone or in combination.

[0012] In corn, rice, and wheat, the enzymes starch synthase I (SSI), starch synthase IIa (SSIIa), and starch synthase IIIa (SSIIIa) are involved in the synthesis of amylopectin, possibly along with other SSs. In rice, for example, there are 10 different starch synthases, including two granule-bound forms (GBSS). Mutants defective in SSIIa have been isolated in wheat, barley and rice, but the three species exhibit different effects on the phenotype resulting from SSIIa deficiency, particularly with respect to the extent of this effect. A mutant wheat plant, ssIIa , which completely lacks the SGP-1 protein (SSIIa), was obtained by crossing lines that lacked genome A, B, and D specific forms of the SGP-1 protein (Yamamori et al., 2000). Triple ssIIa null grains showed deformed starch granules and the starch itself had an altered amylopectin structure. This starch had an amylose content of 30-37% w/w, an increase of approximately 8% relative to the wild type level, and a significantly reduced starch content (Yamamori et al ., 2000). Starch from ssIIa triple null mutants showed a decrease in gelatinization temperature compared to starch from the corresponding wild-type grain. The starch content of the ssIIa triple-null grains was reduced to less than 50% relative to at least 60% w/w. in wild type grain. Yamamori et al., (2000) does not suggest that wheat having more than 45% amylose starch content can be produced by combining ssIIa gene mutations, in fact, Yamamori et al. it says the opposite. This was confirmed by Konik-Rose et al., (2007), which obtained a maximum of 43.98% amylose in the starch of the ssIIa triple null mutant crossed with the Sunco wheat variety.

[0013] In the case of barley, a chemically induced null mutation in the SSIIa gene greatly reduced amylopectin synthesis and thereby increased the relative amylose content of grain starch to 65-70% w/w. (WO02/37955-A1; Morell et al., 2003). Japonica rice contains an SSIIa mutation that reduces the amount of SSIIa enzyme in the endosperm compared to Indica rice, but amylose levels in Japonica grain starch were not significantly higher compared to Indica grain starch. In rice, the combination of mutations in the SBEIIb and SSIIIa genes had a more significant effect on the relative amylose content (Asai et al., 2014).

[0014] The differential effects of ssIIa null mutations in wheat, barley and rice have been associated with varying degrees of pleiotropic effects due to the absence of SSIIa protein on the partitioning of starch synthase I (SSI) and starch branching enzyme IIb (SBEIIb) enzymes within and outside starch granules in developing endosperm of these ssIIa mutants (Luo et al., 2015). In addition, the different actions of SSI and SBEIIb proteins at the post-translational level could influence the structure of the remaining amylopectin. This was one example where observations for one cereal species cannot simply be extrapolated to other cereal species in the field of starch synthesis.

[0015] In the case of corn and rice, high-amylose phenotypes were created by mutations in the SBEIIb gene encoding starch branching enzyme IIb, better known as the amylose elongation (ae) gene (Boyer and Preiss, 1981, Mizuno et al., 1993; Nishi et al., 1993). al., 2001), and not as the SSIIa gene. In these sbeIIb mutants, amylose content was significantly increased in proportion to starch content, the branching frequency of residual amylopectin was reduced, and the proportion of short chains (< DP 17, especially DP 8-12) was reduced. In addition, the gelatinization temperature of starch was increased. To obtain a further increase in amylose levels in corn, varieties were produced that had reduced starch branching enzyme I (SBEI) activity along with almost complete inactivation of SBEII activity (Sidebottom et al., 1998).

[0016] Wheat having at least 50% amylose in proportion to starch content was produced by reducing the activity of SBEIIa alone (Regina et al., 2006), but not reducing the activity of SBEIIb or SSIIa. Unlike corn and rice, a decrease in SBEIIb in wheat alone does not lead to an increase in amylose content. International Publication No. WO2005/001098 and International Publication No. WO2006/069422 describe transgenic hexaploid wheat containing exogenous duplex RNA that reduces the expression of one or both of the SBEIIa and SBEIIb genes in the endosperm. Grain from transgenic lines expressed reduced levels of SBEIIa and/or SBEIIb proteins. A decrease in the amount of SBEIIa protein was associated with an increase in relative amylose levels by more than 50%, whereas the absence of the SBEIIb protein itself did not appear to significantly change the proportion of amylose in the grain starch. International Publications Nos. WO2012/058730 and WO2013/063653 report the generation of non-transgenic sbeIIa and/or sbeIIb triple null mutants that have virtually no expression of the SBEIIa and SBEIIb proteins and exhibit increased levels of amylose. Grain with the sbeIIa triple-null genotype was viable provided that at least one of the sbeIIa gene mutations was a point mutation and not a deletion extending outside the gene into contiguous regions. Therefore, if there was a need to produce high amylose wheat having at least 50% amylose, the SBEIIa gene would be the common wheat gene that would be targeted. Levels of non-starch polysaccharides such as fructans were not increased in wheat having reduced SBEII activity and increased amylose content (>50%) in starch (eg WO2010/006373).

[0017] There is a need in the art for improved high amylose wheat plants and methods for producing them.

SUMMARY OF THE INVENTION

[0018] The inventors have unexpectedly discovered that a hexaploid wheat grain with an amylose content of at least 45%, expressed as a mass percentage of the total starch content of the grain, can be obtained by combining mutations in three SSIIa genes in genomes A, B and D wheat through crossing and selection. According to the prior art, an amylose content of 45% was unattainable, and in fact, the amylose level in ssIIa mutant wheat was generally 30-38% (Yamamori et al., 2000). At least two of these three mutations were null mutations, and preferably all three. Because loss-of-function mutations in SSIIa are recessive, the phenotype was evident when the mutations were in a homozygous state. The inventors also found that the ssIIa mutant wheat grain had significantly increased levels of non-starch polysaccharides, particularly β-glucan, fructan, arabinoxylan and cellulose, each expressed as a percentage of grain weight. This resulted in a significant increase in total fiber content, as well as associated increases in protein content and other beneficial phenotypes.

[0019] Therefore, in a first aspect, the present invention provides a wheat grain of the Triticum aestivum species, including:

i) mutations in each of the SSIIa genes, wherein the grain is homozygous for a mutation in the SSIIa-A gene, homozygous for a mutation in the SSIIa-B gene and homozygous for a mutation in the SSIIa-D gene, and at least two of these mutations in said SSIIa genes are null mutations, preferably all three are null mutations,

ii) total starch content, including amylose content and amylopectin content,

iii) a fructan content that is increased compared to wild-type wheat grain in a mass ratio, preferably from 3% to 12% of the grain weight,

iv) β-glucan content,

v) arabinoxylan content and

vi) cellulose content,

in this case, the grain has a grain weight from 25 mg to 60 mg, and the amylose content ranges from 45% and 70% by weight of the total starch content of the grain when determined by iodine binding analysis, the amylopectin content is reduced by weight compared to wild-type wheat grain , each of β-glucan content, arabinoxylan content, and cellulose content is increased relative to wild-type wheat grain on a mass basis such that the total fructan content, β-glucan content, arabinoxylan content, and cellulose content constitutes 15% to 30% of the grain weight .

[0020] The present invention further provides wheat plants that are capable of producing grain or that are obtained from this grain, or products such as flour, bran, wheat starch granules or wheat starch obtained from this grain.

[0021] The present invention also provides food ingredients containing the grain of the present invention or a material derived from the grain. Also provided are food products comprising these food ingredients and compositions containing the grain of the present invention or material derived from this grain. The food ingredient may be a coarse, crushed, steamed, rolled, crushed, milled or milled grain, or any combination of these options. The preferred ingredient is flour, preferably whole wheat flour, or a mixture of whole wheat flour and all-purpose flour. These ingredients have an increased level of total fiber content compared to the corresponding wild-type wheat ingredient due to the inclusion of wheat grain material according to the invention.

[0022] In another aspect, there is provided a process for producing a wheat plant capable of producing grain according to the invention, comprising the step of (i) crossing two parent wheat plants, each of which contains a null mutation in each of one, two or three SSIIa genes selected from the group, consisting of SSIIa-A , SSIIa-B and SSIIa-D , or subjecting the parent plant to mutagenesis, preferably containing one or two of these null mutations; and step (ii) screening plants or grains obtained by crossing or mutagenesis, or daughter plants or grains derived from them, by analyzing DNA, RNA, protein, starch granules or starch taken from the plants or grains, and step (iii) selecting a fertile wheat plant having reduced SSIIa activity compared to at least one of the parent plants from step (i).

[0023] In another aspect, the present invention provides a process for improving one or more parameters of metabolic health, gut health, or cardiovascular health in a subject in need thereof, or preventing or reducing the severity or incidence of metabolic diseases such as diabetes, bowel disease or cardiovascular disease, comprising providing the subject with a grain or food product according to the present invention.

[0024] In a further aspect, the present invention provides a process for producing wheat grain bins, comprising:

a) cutting wheat stalks containing wheat grain according to the present invention;

b) threshing and/or winnowing the stalks to separate the grain from the chaff; And

c) sifting and/or sorting the grain separated in step b), and loading the sifted and/or sorted grain into bins, thereby obtaining bins with wheat grain.

[0025] In embodiments of each of the above aspects, the wheat grain is further characterized by one or all of the following characteristics. The amylose content is increased compared to wild type wheat grain, eg 48% to 70%, preferably 50% to 65% of the total starch content of the grain as determined by iodine binding assay. In embodiments, the amylose content is from 50% to 70%, or about 48%, about 50%, about 53%, about 55%, about 60%, or about 65%. The starch content of the grain is reduced compared to wild-type wheat grain, for example at least 25%. In embodiments, the starch content of the grain according to the invention is from 30% to 70% of the grain weight, from 25% to 65%, from 25% to 60%, from 25% to 55%, from 25% to 50%, from 30% up to 70%, from 30% to 65%, from 30% to 60%, from 30% to 55% or from 30% to 50%. In additional embodiments, the starch content is about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, or about 65% as a percentage of grain weight (w/w). In one embodiment, at least 50%, preferably at least 60%, or at least 70%, more preferably at least 80% of the starch granules obtained from the grains of the invention have a curved shape and/or surface morphology. The grain starch contains at least 2% resistant starch, preferably at least 3% resistant starch, more preferably from 3% to 15% RA or from 3% to 10% RA. Starch has a reduced gelatinization temperature, which can be easily measured by differential scanning calorimetry (DSC), for example the first peak in a DSC scan appears at a temperature 2-8°C lower than in the case of wild-type starch. In embodiments, the BG content of the grain is β-glucan content and is increased by 1% or 2% in absolute value compared to wild-type grain and/or increased by 2-7 times compared to wild-type wheat grain on a mass basis. In embodiments, the level of BG is at least 1% or at least 2%, preferably 1% to 4% or 1% to 5% by weight of grain, preferably about 2%, about 3%, about 4%, or more preferably 2% to 5%. In embodiments, the arabinoxylan content is increased by 1% to 5% absolute value and/or the cellulose content is increased by 1% to 5% absolute value. In a preferred embodiment, the grain (before any treatment that prevents it from sprouting) has a germination rate of about 70% to about 100% compared to wild-type wheat grain, wherein the grain, when sown, produces wheat plants with male and female fertility. Each of these phenotypes is associated with decreased SSIIa activity during grain development in the wheat plant as a result of mutations in SSIIa genes.

[0026] The foregoing summary of the invention should in no way be taken as an exhaustive listing of all embodiments of the present invention.

BRIEF DESCRIPTION OF THE FIGURES

[0027] Figure 1. Schematic representation of enzymes involved in starch synthesis in cereal grains for amylose and amylopectin.

[0028] Figure 2 . Schematic gene map of the wheat SSIIa-A gene mutation in the A genome of the C57 wheat line. Above is a map of exons of the SSIIa-A gene. Below are the nucleotide sequences of the SSIIa-A gene region from Chinese Spring wild type and the C57 mutant, showing a deletion of 289 nucleotides in exon 1, including the ATG translation start codon, and an insertion of 8 nucleotides, for a total deletion size of 281 nucleotides. The positions of primers JKSS2AP1F and JKSS2AP2R are shown.

[0029] Figure 3 . Schematic gene map of the wheat SSIIa-B gene mutation in the genome of the B wheat line K79. Above is a map of exons of the SSIIa-B gene. Below are the nucleotide sequences of the SSIIa-B gene region from Chinese Spring (CS) wild type and K79 mutant species, showing a 179 nucleotide insertion into exon 8 of SSIIa-B . The positions of primers JKSS2BP7F and JLTSS2BPR1 are shown.

[0030] Figure 4 . Schematic gene map of the wheat SSIIa-D gene mutation in the genome of the D wheat line Turkey 116. Above is a map of exons of the SSIIa-D gene. Below are the nucleotide sequences of the SSIIa-D gene region from Chinese Spring (CS) wild type and the T116 mutant, showing a deletion of 63 nucleotides located at the junction of exon 5 and intron 5 (intron 5 splice site) of SSIIa-B. The positions of primers JTSS2D3F and JTSS2D4R are shown.

[0100] Figure 5 . Schematic of the cross and backcross program to produce triple null ssIIa mutants in the Sunco genetic environment.

[0101] Figure 6 . Schematic of the cross and backcross program to produce triple null ssIIa mutants in the EGA Hume genetic environment.

[0102] Figure 7 . Schematic of the cross-and-backcross program to produce triple null ssIIa mutants in the Westonia genetic environment.

[0103] Figure 8 . The top panel shows the average grain weight (mg per grain) and the bottom panel shows the total lipid content (% grain weight) of ssIIa triple null (abd) grain and SSIIa wild type (WT) grain for individual wheat lines in the EGA genetic environment Hume, Sunco and Westonia.

[0104] Figure 9 . Average values according to Fig. 8 for triple null mutation (abd) and WT genotypes in the EGA genetic environment Hume, Sunco and Westonia with standard deviation indicated. Bars labeled with the same letters (a, b, c) are not statistically different, while bars with different letters are statistically different.

[0105] Figure 10 . The topmost panel shows amylopectin content (% starch by weight), the middle panel shows amylose content (% starch by weight by iodine binding method), and the bottom panel shows total starch content (% grain weight) in ternary ssIIa null grain (abd) and SSIIa wild type (WT) grain for individual wheat lines in the genetic environment of EGA Hume, Sunco and Westonia.

[0106] Figure 11 . Average values according to Fig. 10 for triple null mutation (abd) and WT genotypes in the EGA genetic environment Hume, Sunco and Westonia with standard deviation indicated. Bars labeled with the same letters (a, b, c) are not statistically different, while bars with different letters are statistically different.

[0107] Figure 12 . The top panel shows total fiber content (% grain w/w) and the bottom panel shows total BG content (% grain w/w) in ssIIa triple null (abd) grain and SSIIa wild type (WT) grain for individual wheat lines in the genetic environment of EGA Hume, Sunco and Westonia.

[0108] Figure 13 . Average values according to Fig. 12 for triple null mutation (abd) and WT genotypes in the EGA genetic environment Hume, Sunco and Westonia with standard deviation indicated. Bars labeled with the same letters (a, b, c) are not statistically different, while bars with different letters are statistically different.

[0109] Figure 14 . The topmost panel shows the fructan content (% grain w/w), the middle panel shows the arabinoxylan content (% grain w/w), and the bottom panel shows the cellulose content (% grain w/w) of ssIIa triple zero grain (abd ) and wild-type (WT) SSIIa grains for individual wheat lines in the genetic environment of EGA Hume, Sunco and Westonia.

[0110] Figure 15 . The top panel shows the average grain weight (mg per grain) and the bottom panel shows the total lipid content (mg per grain) of ssIIa triple null (abd) grain and SSIIa wild type (WT) grain for individual wheat lines in the EGA genetic environment Hume, Sunco and Westonia.

[0111] Figure 16 . Average values according to Fig. 15 for the triple null mutation (abd) and WT genotypes in the EGA genetic environment Hume, Sunco and Westonia with standard deviation indicated. Bars labeled with the same letters (a, b, c) are not statistically different, while bars with different letters are statistically different.

[0112] Figure 17 . The topmost panel shows the amylopectin content (mg per grain), the middle panel shows the amylose content (mg per grain), and the bottom panel shows the total starch content (mg per grain) of ssIIa triple null grain (abd) and SSIIa wild grain type (DT) for individual wheat lines in the genetic environment of EGA Hume, Sunco and Westonia.

[0113] Figure 18 . Average values according to Fig. 17 for triple null mutation (abd) and WT genotypes in the EGA genetic environment Hume, Sunco and Westonia with standard deviation indicated. Bars labeled with the same letters (a, b, c) are not statistically different, while bars with different letters are statistically different.

[0114] Figure 19 . The top panel shows total fiber content (mg per grain) and the bottom panel shows total BG content (mg per grain) in ssIIa triple null (abd) grain and SSIIa wild type (WT) grain for individual wheat lines in the EGA genetic environment Hume, Sunco and Westonia.

[0115] Figure 20 . Average values according to Fig. 19 for triple null mutation (abd) and WT genotypes in the EGA genetic environment Hume, Sunco and Westonia with standard deviation indicated. Bars labeled with the same letters (a, b, c) are not statistically different, while bars with different letters are statistically different.

[0116] Figure 21 . The topmost panel shows fructan content (mg per grain), the middle panel shows arabinoxylan content (mg per grain), and the bottom panel shows cellulose content (mg per grain) in ssIIa triple null grain (abd) and SSIIa wild type grain (DT) for individual wheat lines in the genetic environment of EGA Hume, Sunco and Westonia.

[0117] Figure 22 . Average values according to Fig. 21 for triple null mutation (abd) and WT genotypes in the EGA genetic environment Hume, Sunco and Westonia with standard deviation indicated. Bars labeled with the same letters (a, b, c) are not statistically different, while bars with different letters are statistically different.

[0001] Figure 23. Resistant starch content as percent starch in three selected ssIIa triple null mutants (Sunco-abd) and wild type (WT) grain in the Sunco genetic environment. The three mutants were not statistically different from each other, but were statistically different from WT.

[0002]Figure 24. Profiles of the average mol.% difference in chain length distribution (CLD) for debranched starch from 5 ternaryssIIa-mutant lines compared with the corresponding wild-type starch. The frequency of short chains (SP 6-10) has been increased, while the frequency of medium chains (SP 11-24) has been reduced forssIIa-mutant starch compared to the corresponding wild type.

[0118] Figure 25 . Size exclusion chromatography (SEC) profiles of starch from ssIIa triple null mutation grains and starch from corresponding wild-type wheat after debranching of the starches by isoamylase. The curves illustrate the distribution of normalized refractometric index (RI) signals of eluted fractions according to their degree of polymerization (X-axis). The first elution peak (I) is amylose, the second (II) is long-chain amylopectin, and peak III is amylopectin (debranched). The black curve is for ssIIa mutant starch, the gray curve is for wild type starch.

[0119] Figure 26 . Immunological characterization of starch granule-associated proteins from mature wheat grains of ssIIa mutant wheat (B22) and wild-type SSIIa wheat (B70). The top band of the Western blot results was identified as SSIIa, the second band from the top was identified as a mixture of SBEIIa and SBEIIb, and the 70 and 60 kDa bands represented SSI and GBSSI based on their binding to specific antisera. The identification of each band is labeled and indicated by arrows. Identification of antibodies used for different blots is given on the left or below each panel. M: protein molecular mass marker (kDa).

LIST OF SEQUENCES

[0120] SEQ ID NO:1 Amino acid sequence of the SSIIa-A polypeptide encoded by the wheat A genome; Accession number: AAD53263, 799 ac.

[0121] SEQ ID NO:2 Amino acid sequence of the SSIIa-B polypeptide encoded by the wheat B genome; Accession number: CAB96627, 798 ac.

[0122] SEQ ID NO:3 Amino acid sequence of the SSIIa-D polypeptide encoded by the wheat D genome; Accession number: BAE48800, 799 ac; Shimbata et al., (2005).

[0123] SEQ ID NO:4 Nucleotide sequence of the full-length cDNA of the wheat SSIIa-A gene; 2821 nucleotides; Accession number: AF155217; Li et al., (1999); nucleotides 89-91 translation start codon, stop codon 2486-2488.

[0124] SEQ ID NO:5 Nucleotide sequence of the full-length cDNA of the wheat SSIIa-B gene; 2793 nucleotides; Accession number: AJ269504; Gao and Chibbar, (2000); nucleotides 135-137 start codon of translation, stop codon 2529-2531.

[0125] SEQ ID NO:6 Nucleotide sequence of the full-length cDNA of the wheat SSIIa-D gene; 2846 nucleotides; Accession number: AJ269502; Gao and Chibbar, (2000); nucleotides 210-212 start codon of translation, stop codon 2607-2609. Transit peptide encoded by nucleotides 201-384, mature peptide 385-2606.

[0126] SEQ ID NO:7 Nucleotide sequence of the wheat SSIIa-A gene; Accession number: AB201445; 6898 nt (IWGSC: chromosome 7AS, Traes_7AS_53CAFB43A, bp 52346437 to bp 52346905, bp 52351676 to bp 52351931 reverse strand).

[0127] SEQ ID NO:8 Nucleotide sequence of the wheat SSIIa-B gene; Accession number: AB201446) (IWGSC: chromosome 7DS, Traes_7DS_E6C8AF743, 3877787: 1 to 396 bp, 5137 to 5419 bp straight strand), 6811 nt.

[0128] SEQ ID NO:9 Nucleotide sequence of the wheat SSIIa-D gene; Accession number: AB201447) (IWGSC: chromosome 7DS, Traes_7DS_E6C8AF743, 3877787: 1 to 396 bp, 5137 to 5419 bp straight strand), 6950 nt.

[0129] SEQ ID NO:10 The amino acid sequence of wheat SSIIb-A encoded by the A genome, 676 aa, is derived from the nucleotide sequence Accession Number AK332724.

[0130] SEQ ID NO:11 Amino acid sequence of wheat SSIIb-D encoded by the D genome, 674 aa, Accession Number ABY56824 (which has 100% identity with EU333947).

[0131] SEQ ID NO:12 Nucleotide sequence of the full-length cDNA of the SSIIb-A gene in the wheat A genome; Accession number: AK332724. 2727 nt (IWGSC: chromosome 6AL, Traes_6AL_AE01DC0EA, bp 187500495 to bp 187505249 straight strand).

[0132] SEQ ID NO:13 Nucleotide sequence of the partial SSIIb-B cDNA in the wheat B genome; 1282 nt, IWGSC: chromosome 6DL, gene: Traes_6BL_61D83E262, from bp 162113784 up to 162116959 p.o. return circuit).

[0133] SEQ ID NO:14 Nucleotide sequence of full-length SSIIb-D cDNA in the wheat D genome; 2025 nt (Accession number: EU333947) (IWGSC: chromosome 6DL, gene: Traes_6DL_19F1042C7, from 147°049°693 bp to 147°051°708 bp reverse strand).

[0134] SEQ ID NO:15-49 Oligonucleotide primers.

[0135] SEQ ID NO:50-51 Amino acid sequences of peptides.

DETAILED DESCRIPTION OF THE INVENTION

[0136] Throughout this specification, unless the context otherwise requires, the word “comprise” or variations thereof such as “comprises” or “comprising” should be understood to imply the inclusion of a specified element or integer, or group of elements or integers, but not to the exclusion of any other element or integer, or group of elements or integers. The expression “consisting of” is intended to include and be limited to those elements that follow the expression “consisting of.” Thus, the expression "consisting of" indicates that the listed elements are necessary or required and no other elements may be present. By “consisting predominantly of” is meant to include any of the elements listed after that expression and to limit other elements to those that do not interfere with or facilitate the activity or action specified in the description for the listed elements. Thus, the expression "consisting essentially of" indicates that the listed elements are necessary or mandatory, but any other elements are optional and may or may not be present depending on whether they affect the activity or effect of the listed elements.

[0137] As used herein, singular forms include plural aspects and vice versa, unless the context clearly indicates otherwise. Thus, for example, a reference to “mutation” includes one mutation as well as two or more mutations; a reference to “plant” includes one plant as well as two or more plants; and so on.

[0138] As used herein, the term “about” with respect to a numerical value or range is intended to cover numbers falling within ±10% of the specified numerical value or range.

[0139] Each embodiment in this specification should apply mutatis mutandis (mutatis mutandis) to every other embodiment unless expressly stated otherwise.

[0140] Genes and other genetic material (e.g., mRNA, constructs, etc.) are shown in italics, and the protein products of their expression are presented without italics. Thus, for example, SSIIa is the product of SSIIa expression.

[0141] Nucleotide and amino acid sequences are referenced by sequence identification number (SEQ ID NO:). SEQ ID NO: numerically correspond to sequence identifiers <400>1 (SEQ ID NO:1), <400>2 (SEQ ID NO:2), etc. A list of sequences is given after the claims. A listing describing the SEQ ID NO in the sequence listing is provided following the figure legends.

[0142] Unless otherwise specified, all technical and scientific terms used herein have the meaning commonly understood by those skilled in the art to which this invention relates. Although any methods and materials similar or equivalent to those described herein may be used in the practice or testing of the present invention, preferred methods and materials are described below.

[0143] The present invention is based in part on the unexpected discovery made in the experiments described herein that it is possible to obtain a hexaploid wheat grain containing null mutations in each of the three SSIIa genes, which has an amylose content of at least 45% (wt. /mass). This was unexpected given the results obtained by other researchers that the amylose level in triple null ssIIa hexaploid wheat grain was less than 45% (Yamamori et al., 2000; Konik-Rose et al., 2007). In this case, the amylose content is determined as a percentage of the total starch content of the grain based on the weight/weight ratio. In addition, wheat grain has other desirable properties, including increased total fiber content due to increased fructan, β-glucan, arabinoxylan, and cellulose content, which provide health benefits when the grain or grain-derived products are consumed as food or feed.

[0144] Accordingly, in a first aspect, the present invention provides a wheat grain of the species Triticum aestivum containing:

i) mutations in each of the SSIIa genes, wherein the grain is homozygous for a mutation in the SSIIa-A gene, homozygous for a mutation in the SSIIa-B gene and homozygous for a mutation in the SSIIa-D gene, and at least two of these mutations in the indicated SSIIa genes are null mutations,

ii) total starch content, including amylose content and amylopectin content,

iii) a fructan content that is increased compared to wild-type wheat grain in a mass ratio, preferably from 3% to 12% of the grain weight,

iv) β-glucan content,

v) arabinoxylan content and

vi) cellulose content,

in this case, the grain has a grain weight from 25 mg to 60 mg, and the amylose content ranges from 45% and 70% by weight of the total starch content of the grain when determined by iodine binding analysis, the amylopectin content is reduced by weight compared to wild-type wheat grain , each of β-glucan content, arabinoxylan content, and cellulose content is increased relative to wild-type wheat grain on a mass basis such that the total fructan content, β-glucan content, arabinoxylan content, and cellulose content constitutes 15% to 30% of the grain weight .

[0145] The present invention further provides wheat plants that are derived from the grain, and flour and/or wheat starch granules that are derived from the grain.

[0146] The present invention also provides food ingredients containing the grain of the present invention or a material derived from the grain. Also provided are food products comprising these food ingredients and compositions containing the grain of the present invention or material derived from this grain. The food ingredient may be a coarse, crushed, steamed, rolled, crushed, milled or milled grain, or any combination of these options.

[0147] In another aspect, the present invention provides a process for producing a wheat plant that produces grain according to the present invention, comprising the step of (i) crossing two parent wheat plants, each of which contains a null mutation in each of one, two or three SSIIa genes. selected from the group consisting of SSIIa-A , SSIIa-B and SSIIa-D , or the effect of mutagenesis on a parent plant containing said null mutations; and step (ii) screening plants or grains obtained by crossing or mutagenesis, or daughter plants or grains derived from them, by analyzing DNA, RNA, protein, starch granules or starch taken from the plants or grains, and step (iii) selecting a fertile wheat plant having reduced SSIIa activity compared to at least one of the parent wheat plants from step (i).

[0148] In another aspect, the present invention provides a process for improving one or more parameters of metabolic health, gut health, or cardiovascular health in a subject in need thereof, or preventing or reducing the severity or incidence of metabolic diseases, such as diabetes, bowel disease, or cardiovascular diseases, comprising providing the subject with a grain or food product according to the present invention.

[0149] As used herein, “improvement in one or more parameters of metabolic health” is a relative term and means an improvement compared to consuming an equivalent amount of food or beverage derived from wild-type wheat.

[0150] In a further aspect, the present invention provides a process for producing wheat grain bins, comprising:

a) cutting wheat stalks containing wheat grain according to the present invention;

b) threshing and/or winnowing the stalks to separate the grain from the chaff; And

c) sifting and/or sorting the grain separated in step b), and loading the sifted and/or sorted grain into bins, thereby obtaining bins with wheat grain.

[0151] In certain embodiments, the wheat grain of the present invention is further characterized by one or more or all of the following characteristics:

i) starch content from 30% to 70% of the grain weight,

ii) the amylose content is between 45% and 65% of the total starch content of the grain as determined by iodine binding assay,

iii) starch content has a chain length distribution when determined by fluorescence-activated capillary electrophoresis (FACE) after debranching of starch samples, in which the proportion of chain lengths with DP 7-10 is increased and the proportion of chain lengths with DP 11-24 is reduced compared to starch wild type wheat,

iv) the fructan content includes fructan with SP 3-12 such that at least 50% of the fructan content is represented by SP 3-12,

v) the fructan content is increased by 2-10 times compared to wild-type wheat grain in mass terms,

vi) the β-glucan content is increased by 1% or 2% in absolute value and/or increased by 2-7 times compared to wild-type wheat grain in mass terms,

vii) the β-glucan content is from 1% to 4% of the grain weight,

viii) arabinoxylan content is increased by 1% - 5% in absolute value,

ix) cellulose content increased by 1% - 5% absolute value,

x) the grain has a germination rate of about 70% to about 100% compared to wild-type wheat grain, and

xi) The grain when sown produces wheat plants with male and female fertility.

[0152] The grain may also have a level and/or activity of SSIIa protein that is less than 5% of the level or activity of the SSIIa protein in wild-type wheat grain, or that lacks one or more or all of the SSIIa-A protein, the SSIIa protein -B and protein SSIIa-D. The grain can also be homozygous for a null mutation in the SSIIa-A gene, homozygous for a null mutation in the SSIIa-B gene and homozygous for a null mutation in the SSIIa-D gene. Each null mutation may be independently selected from the group consisting of a deletion mutation, an insertion mutation, a premature translation stop codon, a splice site mutation, and a nonconservative amino acid substitution mutation, preferably the grain containing deletion mutations in each of the two or three SSIIa genes, or complete deletions of these genes.

[0153] In certain embodiments, the grain further comprises a loss-of-function mutation in an endogenous gene that encodes a starch synthesis polypeptide, or a chimeric polynucleotide that encodes RNA that reduces expression of an endogenous gene that encodes a starch synthesis polypeptide, wherein said starch synthesis polypeptide is selected from the group consisting of SSI, SSIIIa and SSIV, wherein said mutation is selected from the group consisting of a deletion mutation, an insertion mutation, a premature translation stop codon, a splice site mutation and a non-conservative amino acid substitution mutation. Preferably, at least one, more than one or all of the mutations are i) introduced mutations, ii) induced in the wheat parent plants or seeds by mutagenesis using a mutagenic agent such as a chemical agent, biological agent or irradiation, or iii ) were introduced to modify the plant genome.

[0154] It is preferred that the grain has an amylose content of about 60% by weight of the total starch content of the grain and/or that the grain is not transgenic or does not contain any exogenous nucleic acid encoding RNA that reduces the expression of the SSIIa gene and/or the SBEIIa gene .

[0155] The level and/or activity of SSIIa is determined by analyzing the level and/or activity of SSIIa in the developing endosperm or by analyzing the amount of SSIIa protein in the harvested grain by immunological or other means. The endosperm may come from the plant from which the grain was obtained or from a daughter plant.

[0156] The grain starch granules and/or grain starch of the present invention may also have one or more properties selected from the group consisting of:

i) content of at least 2% resistant starch;

ii) starch has a reduced glycemic index (GI);

iii) starch granules are deformed;

iv) starch granules have reduced birefringence when observed under polarized light;

v) starch is characterized by reduced volumetric swelling;

vi) modified chain length distribution and/or branch frequency in starch;

vii) starch has a reduced peak gelatinization temperature;

viii) starch has a reduced peak viscosity;

ix) the gelatinization temperature of starch is reduced;

x) reduced peak molecular weight of amylose when determined by size exclusion chromatography;

xi) reduced degree of starch crystallization; And

xii) the proportion of A-type and/or B-type starch is reduced, and/or the proportion of V-type crystalline starch is increased;

each property being determined in comparison to wild-type wheat starch granules or wild-type wheat starch.

[0157] In certain embodiments of the present invention, the grain is treated so that it cannot germinate. Examples of such processed grains include heat-treated grains and coarse, crushed, steamed, rolled, crushed, crushed or ground grains. Alternatively, the germination capacity of the grain is 70% to 100% of the wild type.

[0158] The present invention expressly extends to the grain contained in the wheat plant as described above. The present invention also extends to wheat plants that produce grain or are derived from grain according to the present invention. Such wheat plants may have a level and/or activity of SSIIa protein in their endosperm that is less than 5% of the level or activity of the SSIIa protein in wild-type wheat grain, or that lacks one or more or all of the SSIIa-A protein SSIIa-B and SSIIa-D protein. Preferably, the wheat plant has male and female fertility.

[0159] Also included is flour obtained from the grains of the present invention. In one embodiment, the flour is premium flour. The flour is preferably whole grain or a mixture of flour and whole grain, for example in a ratio of 1:2 to 2:1. The invention also provides wheat bran from the grains of the invention. Each of these products contains wheat cells that have a set of wheat grain genes (i.e. wheat grain DNA).

[0160] Wheat starch granules or wheat starch derived from grain are also part of the present invention. Wheat starch granules or wheat starch typically contain 45%, preferably about 50%, about 55% or about 60% amylose, or 45% to 70% amylose, each by weight as a fraction of the total starch content of the granules starch or starch, the starch granules preferably containing the wheat GBSSI polypeptide. Starch granules and/or starch may also be characterized by one or more of the following:

a) absence of detectable SSIIa polypeptide when determined by immunological methods;

b) content of at least 2% resistant starch by weight;

c) starch is characterized by a reduced glycemic index (GI);

d) starch granules are deformed;

e) starch granules have reduced birefringence when observed under polarized light;

f) starch is characterized by reduced volumetric swelling;

g) modified chain length distribution and/or branch frequency in starch;

h) starch has a reduced peak gelatinization temperature;

i) starch has a reduced peak viscosity;

j) the starch gelatinization temperature is reduced;

k) reduced peak molecular weight of amylose when determined by size exclusion chromatography;

l) the degree of crystallization of starch is reduced; And

m) the proportion of A-type and/or B-type starch is reduced and/or the proportion of crystalline V-type starch is increased;

each property being determined in comparison to starch granules or wild-type wheat starch.

[0161] The present invention also provides a food ingredient that contains grain, flour, preferably whole grain, or wheat bran, or wheat starch granules or wheat starch according to the present invention, preferably at a level of at least 10%, preferably from about 20 % to about 80% based on dry weight. The food ingredient may be a coarse, crushed, steamed, rolled, crushed, milled or milled grain, or any combination of these options. The food ingredient may also be included in the food product, preferably at a level of at least 10% on a dry weight basis.

[0162] The present invention also provides a composition containing wheat grain, flour, preferably whole grain, or wheat bran, or wheat starch granules or wheat starch according to the present invention at a level of at least 10% by weight, or wheat grain having amylose level less than 45% (w/w), or flour, whole wheat flour, starch granules or starch derived from it. The composition may contain a mixture of different types of flour.

[0163] The present invention also provides a process for preparing a food product, comprising the steps of (i) adding a food ingredient according to the present invention to another food ingredient and (ii) mixing the food ingredients to thereby obtain a food product. The process may also include the step of processing the grain to obtain a food ingredient before step (i), or the step of heating the mixed food ingredients from step (ii) at a temperature of at least 100°C for at least 10 minutes.

[0164] As used herein, the term “by weight” or “on a mass basis” refers to the weight of a substance as a percentage of the weight of the material or component containing said substance. This is abbreviated as “wt/wt” in this document. For example, amylose content is defined as the mass of amylose as a percentage of the total starch content.

[0165] Starch synthesis in the endosperm of higher plants, including wheat, occurs through a set of enzymes that catalyze four key steps, schematically shown in FIG. 1. First, ADP-glucose pyrophosphorylase (EC 2.7.7.27) activates the monomeric starch precursor by synthesizing ADP-glucose from G-1-P and ATP. Second, the activated glucosyl donor, ADP-glucose, is transferred to the non-reducing end of a pre-existing α-1,4-linkage by starch synthases (EC 2.4.1.24). Third, starch-branching enzymes introduce branch points by cleaving the α-1,4-linked glucan region, followed by transfer of the cleaved strand to the acceptor strand to form a new α-1,6-linkage. Starch branching enzymes are the only enzymes that can introduce α-1,6 linkages into α-polyglucans, and therefore play an important role in the formation of amylopectin. Fourth, starch debranching enzymes (EC 2.4.4.18) remove some branching bonds.

[0166] Two forms of ADP-glucose pyrophosphorylase (ADPP) are present in the endosperm of cereals, one form in the amyloplasts and one form in the cytoplasm. Each form consists of two types of subunits. Wrinkled ( sh2 ) and brittle ( bt2 ) mutants of maize present lesions in the large and small subunits, respectively.

[0167] As used herein, the term “starch synthase” refers to an enzyme that transfers a glucosyl moiety from an activated glucosyl donor, ADP-glucose, to the non-reducing end of a preexisting glucan chain via an α-1,4 linkage (EC 2.4.1.24). KC enzyme activity can be assayed as described in Guan and Keeling (1998). At least five classes of starch synthases are found in the endosperm of cereals, including the hexaploid wheat T. aestivum , namely an isoform localized exclusively to or associated with starch granules, granule-associated starch synthase (GBSS), two forms that are shared between the granule and the soluble fraction (SSI and SSII), a form that is entirely localized in the soluble fraction (SSIII), and a recently discovered fifth form, SSIV (Figure 1). Each of these is included under the term starch synthase. They are active during endosperm development during wheat plant growth, when synthesis and deposition of starch reserves occur, but may be present in an inactive state in mature (dormant) wheat grains. GBSS has been shown to be important for amylose synthesis. Each of the SSI-IVs is primarily involved in the synthesis of amylopectin according to biochemical and genetic data. For example, mutations in the SSII and SSIII genes have been shown to alter the structure of amylopectin (Schondelmaier et al., 1992; Yamamori et al., 2000). Starch synthases are classified according to their amino acid sequence as belonging to one of these five groups based on the degree of homology with known members of these classes.

[0168] In cereals, at least two SSII subclasses, SSIIa and SSIIb, have been identified, although a third subclass SSIIc has been identified in rice (Ohdan et al., 2005), and genes that likely encode the corresponding SSIIc enzyme in wheat have been identified , as described in example 2. Starch synthase IIa (SSIIa) primarily catalyzes the polymerization of medium-length glucan chains (SP 12-24) of amylopectin in cereal endosperm by transferring a glucosyl moiety from ADP-glucose to the non-reducing end of pre-existing α-1s, 4-linked glucan chains (Fontaine et al., 1993). SSIIa thus extends short chains (DP < 10) of amylopectin. In the ssIIa mutant of wheat, the frequency of glucan chains with DP 6-11 was increased and the frequency of chains with DP 11-25 was reduced (Yamamori et al, 2000). Different classes of SSII differ in their homology with the amino acid sequences of typical representatives of each class, i.e., according to phylogenetic analysis. Different SSII enzymes and, in some cases, different SSIIa isoenzymes from wheat may differ in the number of amino acids in the polypeptides, as described below.

[0169] The level of expression of genes encoding SSII or, in particular, SSIIa, can be assessed by analyzing transcript levels, for example, using Northern blot hybridization analysis or RT-PCR analysis. In a preferred method, the amount of SSIIa protein in the grain or developing endosperm is determined by separating the proteins in grain/endosperm extracts in a gel by electrophoresis, then transferring the proteins to a membrane using Western blotting, followed by quantitation of the protein on the membrane using specific antibodies (“Western blotting”). blot analysis"). Typical gel electrophoresis and immunoblotting methods are described in Example 1.

[0170] Starch synthase I (SSI) appears to exist in a single isoform in cereals. In rice, SSI accounts for about 70% of the activity of total soluble SS in the endosperm (Fujita et al, 2006). SSI preferentially synthesizes short glucan chains with a DP of 6–15, preferring the shortest amylopectin chains as a substrate. Although important, the complete absence of SSI enzyme in rice endosperm does not affect the size and shape of seeds or starch granules, suggesting that other SS enzymes are able to compensate for the lack of SSI function.

[0171] In contrast, SSIII produces relatively long amylopectin chains, particularly those with a DP > 30, and elongates medium-length glucan chains. ssIII mutants show an increase in medium-length chains in amylopectin. There are two forms, of which SSIIIa is the major form expressed in the endosperm and SSIIIb is a minor form. Little is known about the contribution of SSIV isoforms to glucan chain length in cereal grains, but its function is likely to be expressed predominantly in leaves (Leterrier et al., 2008). Two SSIV genes, SSIVa and SSIVb, are expressed in rice throughout the entire plant and at relatively constant levels during grain filling, so it is likely that their function is expressed throughout the entire plant. ssIV mutants in Arabidopsis had reduced leaf starch levels.

[0172] Each of the starch synthases is expressed as polypeptides with N-terminal signal peptides that are cleaved off during translocation into amyloplasts.

[0173] As used herein, “starch branching enzyme” (SBE) means an enzyme that introduces α-1,6 glycosidic bonds between chains of glucose residues (EC 2.4.1.18), introducing , thus the α-1,6 branch point in amylopectin. There are two main classes of SBE in plants, SBEI and SBEII. In cereals, SBEII can be further classified into two types, SBEIIa and SBEIIb (Hedman and Boyer, 1982; Boyer and Preiss, 1978; Mizuno et al ., 1992, Sun et al ., 1997). Additional forms of SBE have also been reported in some cereals, a putative 149 kDa SBEI from wheat and a 50/51 kDa SBE from barley. Sequence alignment revealed a high degree of similarity at both the nucleotide and amino acid levels and allowed grouping into classes SBEI, SBEIIa and SBEIIb. The amino acid sequences of SBEIIa and SBEIIb generally show about 80% identity with each other, concentrated mainly in the central regions of the polypeptides.

[0174] SBEI, SBEIIa and SBEIIb can also be distinguished by their expression profile, but this aspect is characterized for different species. In wheat endosperm, SBEI (Morell et al ., 1997) is found exclusively in the soluble fraction, whereas SBEIIa and SBEIIb are found in both the soluble and starch granule-bound fractions (Rahman et al ., 1995). In maize, SBEIIb is the predominant form in the endosperm, whereas SBEIIa is expressed relatively more strongly in leaves and is likely expressed throughout the plant (Gao et al. , 1997). In rice, SBEIIa and SBEIIb can be found in the endosperm in approximately equal amounts. However, there is also a difference in the timing of gene expression. SBEIIa is expressed at an earlier stage of seed development, detected 3 days after anthesis and expressed in leaves, whereas SBEIIb was not detected 3 days after anthesis and was not distributed in developing seeds 7-10 days after anthesis, and was not expressed in leaves . In wheat endosperm, SBEIIa is expressed approximately 3-4 times more strongly than SBEIIb. Different cereal species show significant differences in the expression of SBEIIa and SBEIIb, and conclusions drawn from one species may not be generalizable to other species. Specific antibodies can also be used to distinguish between enzymes.

[0175] Genomic DNA and cDNA sequence characterizations were obtained for each of the SBE genes except wheat. Sequence alignment revealed a high degree of sequence similarity at both the nucleotide and amino acid levels, but also sequence differences, and allowed grouping into classes SBEI, SBEIIa and SBEIIb. In wheat, observed gene duplication events increase the number of SBEI genes in each genome (Rahman et al. , 1999). Elimination of more than 97% of SBEI activity in wheat endosperm through a combination of mutations in the highest expressing forms of SBEI genes from genomes A, B and D had no detectable effect on starch structure or functionality (Regina et al. , 2004). In contrast, reducing SBEIIa expression using a gene silencing construct in hexaploid wheat resulted in high amylose levels (>70%), whereas a corresponding construct that reduced SBEIIb but not SBEIIa expression had minimal effect (Regina et al. 2006). In barley, a gene silencing construct that reduced the expression of SBEIIa and SBEIIb in the endosperm was used to create high-amylose barley grain (Regina et al., 2010). In maize, SBEIIb mutants, known as amylose extenders (ae) , caused high-amylose phenotypes.

[0176] The enzyme activity assay for branching enzymes to detect the activity of all three isoforms, SBEI, SBEIIa and SBEIIb, is based on the method of Nishi et al., 2001 with the following minor modifications. After electrophoresis, the gel is washed twice in 50 mM GEPES, pH 7.0, containing 10% glycerol, and incubated at room temperature in a reaction mixture consisting of 50 mM GEPES, pH 7.4, 50 mM glucose-1-phosphate, 2. 5 mM AMP, 10% glycerol, 50 U. phosphorylase a, 1 mM DTT and 0.08% maltotriose for 16 hours. Bands were visualized using a solution of 0.2% (w/v) I ₂ and 2% KI. The activities specific to the SBEI, SBEIIa and SBEIIb isoforms are separated under these electrophoresis conditions. This was confirmed by immunoblotting using anti-SBEI, anti-SBEIIa and anti-SBEIIb antibodies. Densitometric analysis of immunoblots, in which the intensity of each band is measured, is performed to determine the level of enzymatic activity of each isoform.

[0177] Starch branching enzyme (SBE) activity can be determined using an enzymatic assay, such as the phosphorylase stimulation assay (Boyer and Preiss, 1978). This assay measures SBE stimulation of glucose-1-phosphate incorporation into a methanol-insoluble polymer (α-D-glucan) by phosphorylase A. SBE isoforms show different substrate specificities, for example SBEI shows higher activity in amylose branching, whereas SBEIIa and SBEIIb exhibit higher levels of branching with amylopectin substrate. SBEI preferentially generates longer chains with DP > 16 through branching of less branched polyglucans, whereas SBEII isoenzymes generate shorter chains with DP < 12. These isoforms can also be distinguished based on the length of the transported glucan chain.

[0178] In cereals, two classes of debranching enzymes (DBE) are known, namely isoamylase (ISA) and pullulanase (PUL). ISA mainly mediates debranching of phytoglycogen and amylopectin, whereas PUL acts on pullulan and amylopectin but not on phytoglycogen (Nakamura et al., 1996). ISA mutants have been termed sugar mutants and produce shorter chains of amylopectin, and therefore the action of ISA is likely to be to edit overbranched or irregular chains in amylopectin. In contrast, PUL is thought to function in starch breakdown in germinating grains as well as in starch synthesis.

[0179] The developing endosperm of hexaploid wheat expresses SSIIa from the SSIIa genes in each of genomes A, B, and D. As used herein, “SSIIa expressed from genome A” or “SSIIa-A” means a polypeptide whose amino acid sequence is set forth in SEQ ID NO:1 or which is at least 99% identical to or contains the amino acid sequence shown in SEQ ID NO:1. The amino acid sequence given as SEQ ID NO:1 (Li et al., 1999; Genbank accession no. AAD53263) is used herein as the reference sequence for the wild type SSIIa-A polypeptide. The length of the polypeptide with SEQ ID NO:1 is 799 amino acid residues, as in the case of mutants with amino acid substitutions in SEQ ID NO:1. Enzymatically active variants of this enzyme exist in wheat, such as the cultivar Fielder, see Accession No. CAB96626.1 (Gao and Chibbar, 2000), whose amino acid sequence is 99.5% (795/799) identical to SEQ ID NO.1, and in diploid related forms of Triticum aestivum, such as those from Triticum urartu , listed under accession no. CUS28065.1 and CDI68213.1. Such options are included in "SSIIa-A". SSIIa-A does not include the homologous polypeptides, SSIIa-B and SSIIa-D, since these polypeptides are about 96% identical to SEQ ID NO:1.

[0180] As used herein, “SSIIa expressed from Genome B” or “SSIIa-B” means a polypeptide whose amino acid sequence is shown in SEQ ID NO:2 or which is at least 99% identical to the amino acid sequence shown in SEQ ID NO:2, or contains such a sequence. The amino acid sequence shown as SEQ ID NO:2 (Genbank accession no. CAB99627.1) corresponds to starch synthase IIa expressed from the Fielder wheat variety B genome, which is used herein as the reference sequence for the wild-type SSIIa-B polypeptide. The length of the polypeptide of SEQ ID NO:2 is 798 amino acids, as in the case of mutants with amino acid substitutions in SEQ ID NO:2. Enzymatically active variants of this enzyme exist in wheat and such variants are included in "SSIIa-B". SSIIa-B does not include the homologous polypeptides, SSIIa-A and SSIIa-D, since these polypeptides are about 96% identical to SEQ ID NO:2 (Li et al., 1999).

[0181] As used herein, “SSIIa expressed from the D genome” or “SSIIa-D” means a polypeptide whose amino acid sequence is shown in SEQ ID NO:3 or which is at least 99% identical to the amino acid sequence shown in SEQ ID NO:3, or contains such a sequence. The amino acid sequence SEQ ID NO:3 (Genbank accession no. BAE48800; Shimbata et al., 2005) corresponds to SSIIa expressed from the Chinese Spring wheat D genome, which is used herein as the reference sequence for wild-type SSIIa-D. The length of the protein SEQ ID NO:3 is 799 amino acids. Enzymatically active variants of this enzyme exist in wheat, such as the cultivar Fielder, see Accession No. CAB86618 (Gao and Chibbar, 2000), whose amino acid sequence is 99.9% (798/799) identical to SEQ ID NO.3, and in diploid related forms of Triticum aestivum, such as those from Aegilops tauschii , the probable progenitors of the hexaploid wheat D genome, listed under accession number CAB86618. Such options are included in "SSIIa-D". SSIIa-D does not include the homologous polypeptides, SSIIa-A and SSIIa-B, since these polypeptides are about 96% identical to SEQ ID NO:3. The amino acid sequence shown as SEQ ID NO: 3 is 95.9% identical to each of SEQ ID NO:1 and SEQ ID NO:2. An alignment of these three amino acid sequences demonstrates amino acid differences that can be used to distinguish proteins or to classify variants as SSIIa-A, SSIIa-B or SSIIa-D.

[0182] When comparing amino acid sequences to determine percent identity in this context, for example using Blastp, full-length sequences should be compared and gaps in the sequences counted as amino acid differences.

[0183] As used herein, “SSIIa polypeptide” means an SSIIa-A polypeptide, an SSIIa-B polypeptide, or an SSIIa-D polypeptide.

[0184] As used herein, each of the SSIIa-A, SSIIa-B and SSIIa-D polypeptides includes polypeptide variants having reduced or no starch synthase enzyme activity, as well as polypeptides having wild-type or substantially wild-type enzymatic activity. Comparison of the amino acid sequence of the mutant form of the SSIIa polypeptide with SEQ ID NO: 1, 2 and 3 is used to determine which of the SSIIa-A, -B or -D polypeptides it is derived from and thus to classify the mutant form. For example, a mutant SSIIa polypeptide is considered a mutant SSIIa-A polypeptide if its amino acid sequence is more closely related, i.e., has a greater degree of sequence identity to SEQ ID NO:1 than to SEQ ID NO:2 and 3. Likewise, a mutant SSIIa polypeptide is an SSIIa-B mutant polypeptide if it is more closely related to SEQ ID NO:2 than to SEQ ID NO:1 or 3, and an SSIIa mutant polypeptide is an SSIIa-D mutant polypeptide if it is more closely related to SEQ ID NO: 3 than with SEQ ID NO:1 and 2. Thus, those skilled in the art can classify the mutant SSIIa polypeptide.

[0185] The mutant SSIIa polypeptide may have reduced starch synthase enzyme activity (partial mutant) or no starch synthase activity (null mutant polypeptide). The mutant SSIIa gene may be expressed to produce an SSIIa polypeptide in the wheat endosperm, such as a truncated polypeptide, or it may not be expressed and produce no polypeptide at all. It can also be expressed to produce a transcript but not a translation product.

[0186] It should also be understood that SSIIa proteins may be present in grain, particularly in mature grain that is typically harvested commercially, but in an inactive or dormant state due to physiological conditions in the grain. As used herein, such polypeptides are included as “SSIIa polypeptides”. SSIIa polypeptides may be enzymatically active during only part of grain development, particularly in the developing endosperm when starch reserves are deposited, but are otherwise inactive. Such SSIIa polypeptides can be easily detected and quantified using immunological methods such as Western blot analysis.

[0187] Thus, as used herein, the expression “wild type” as used in relation to an SSIIa-A polypeptide means a polypeptide whose amino acid sequence is set forth in SEQ ID NO: 1, or enzymatically active variants that are at least 99% identical by amino acid sequence that occur in nature and that have substantially the same activity as SEQ ID NO:1; As used herein, the expression “wild type” as used in relation to an SSIIa-B polypeptide means a polypeptide whose amino acid sequence is set forth in SEQ ID NO: 2, or enzymatically active variants having at least 99% identical amino acid sequence that occur in nature and which have substantially the same activity as the polypeptide whose sequence is shown in SEQ ID NO:2; As used herein, the expression "wild type" as used in relation to an SSIIa-D polypeptide means a polypeptide whose amino acid sequence is set forth in SEQ ID NO: 3, or enzymatically active variants having at least 99% identical amino acid sequence that occur in nature and which have substantially the same activity as SEQ ID NO:3. In each case, the wild-type polypeptide has starch synthase II activity and has not been modified according to the present invention.

[0188] Wild-type wheat produces two other classes of SSII polypeptides, namely SSIIb and SSIIc polypeptides. As used herein, "SSIIb expressed from genome A" or "SSIIa-A" means a polypeptide whose amino acid sequence is set forth in SEQ ID NO:10 or which is at least 99% identical to the amino acid sequence set forth in SEQ ID NO:10 , or contains such a sequence. The amino acid sequence given as SEQ ID NO:10 (derived from the nucleotide sequence of Genbank accession no. AK332724) is used herein as the reference sequence for the wild type SSIIb-A polypeptide. The length of the polypeptide with SEQ ID NO:10 is 676 amino acid residues. Enzymatically active variants of this enzyme are included in "SSIIb-A". SSIIb-A does not include the homologous polypeptide SSIIb-D, which is about 90% identical to SEQ ID NO:8.

[0189] As used herein, “SSIIb expressed from genome D” or “SSIIb-D” means a polypeptide whose amino acid sequence is set forth in SEQ ID NO:11 or which is at least 99% identical to the amino acid sequence set forth in SEQ ID NO:11 or contains such a sequence. The amino acid sequence shown as SEQ ID NO:11 (Genbank accession no. ABY56824) corresponds to starch synthase IIb expressed from the common wheat D genome, which is used herein as the reference sequence for the wild-type SSIIb-D polypeptide. The length of the polypeptide with SEQ ID NO:11 is 674 amino acids. Enzymatically active variants of this enzyme are included in "SSIIb-D". SSIIb-D does not include the homologous polypeptide SSIIb-A, which is about 90% identical to SEQ ID NO:11.

[0190] The amino acid sequences of SSIIa homologues and SSIIb homologues are 71-79% identical and, therefore, the polypeptides can be easily distinguished even if they have similar enzymatic activity.

[0191] As described in Example 2 herein, wheat SSIIc sequences have also been identified that can be readily distinguished from SSIIa sequences.

[0192] As used herein, " SSIIa gene" and "wheat SSIIa gene" and similar terms refer to genes encoding an SSIIa polypeptide, including wild-type SSIIa polypeptides, such as homologous polypeptides present in other wheat varieties, as well as mutant forms genes that either encode SSIIa polypeptides with reduced activity or undetectable activity, or genes that are derived from them by mutation. SSIIa genes include, but are not limited to, wheat SSIIa genes that have been cloned, including the genomic DNA and cDNA sequences listed in Table 1, which are labeled as SSIIa genes. The term SSIIa gene includes, generally, each of the more specific terms " SSIIa-A gene", " SSIIa-B gene" and " SSIIa-D gene" encoding SSIIa-A, SSIIa-B and SSIIa-D polypeptides, respectively, or mutant forms derived from such genes. As used herein, SSIIa genes include mutant forms that do not encode any polypeptide at all, or polypeptides that do not have starch synthase activity, in which case the mutant forms represent null alleles of the genes. Gene alleles include mutant alleles in which at least a portion of a gene is deleted, including those in which an entire gene is deleted, which also represent null gene alleles.

[0193] "Endogenous SSIIa gene" refers to the SSIIa gene that is found in its native location in the wheat genome, including wild-type and mutant forms. As is known in the art, hexaploid wheat, such as common wheat, has three genomes, typically referred to as the A, B, and D genomes, while tetraploid wheat, such as durum wheat, has two genomes, typically referred to as the A and D genomes. B. Each genome contains 7 pairs of chromosomes, which can be observed by cytological methods during meiosis and thus identified, as is well known in the art. In hexaploid wheat, the endogenous SSIIa-A genes, SSIIa-B genes and SSIIa-D genes are located on the short arm of chromosomes 7A, 7B and 7D, respectively. In contrast, the terms "isolated SSIIa gene" and "exogenous SSIIa gene" refer to an SSIIa gene that is not found in its native location, for example removed from a wheat plant, cloned, synthesized, contained in a vector or as a transgene in a cell, for example transgene in a transgenic wheat plant. In this context, the SSIIa gene may be in any of certain forms described below.

Table 1. Starch synthase enzyme genes typical for cereals

View SS isoform Clone type Access no. Link Wheat SSI cDNA and genomic DNA AF091803 (cDNA) AF091802 (genomic DNA) Li et al., 1999
Li et al., 1999 SSIIa-A cDNA and genomic DNA AF155217 (cDNA) AB201445 (genomic DNA) Li et al., 1999
Shimbata et al., 2005 SSIIa-B cDNA and genomic DNA AJ269504 (cDNA) AB201446 (genomic DNA) Gao and Chibbar, 2000
Shimbata et al., 2005 SSIIa-D cDNA and genomic DNA AJ269502 (cDNA) AB201447 (genomic DNA) Gao and Chibbar, 2000
Shimbata et al., 2005 SSIIb-A cDNA and genomic DNA AK332724 (cDNA) Traes_6AL_AE01DC0EA, 6A: from bp 187503905 up to 187505233 p.o. (genomic DNA) Kawaura et al., 2009
IWGSC Databases SSIIb-B cDNA and genomic DNA Traes_6BL_61D83E262, 6B: 162116364-162116691 p.o. (genomic DNA) IWGSC Databases SSIIb-D cDNA and genomic DNA EU333947 (cDNA) Traes_6DL_19F1042C7, 6D: 147050072-147051031 bp. (genomic DNA) NCBI
IWGSC Databases SSIIc-A cDNA and genomic DNA Traes_1AL_729BF3204, 1A: 68687585-68688377, IWGSC Databases SSIIc-B cDNA and genomic DNA Traes_1BL_447468BDE, 1B: 31475067-314776087 p.o. IWGSC Databases SSIIc-D cDNA and genomic DNA EU307274 (cDNA) Traes_1DL_F667ED844, IWGSC_CSS_1DL_scaff_2205619:1950-3041 bp. NCBI
IWGSC Databases SSIIIa cDNA AF258608 (cDNA) AF258609 (genomic DNA) Li et al., 2000
Li et al., 2000 SSIIIb cDNA and genomic DNA EU333946 (cDNA) NCBI SSIVa cDNA AY044844 (cDNA) DQ400416 (genomic DNA) NCBI
Leterrier et al., 2008 Rice SSIIa cDNA AF419099 (cDNA) NCBI SSIIb cDNA AF395537 (cDNA) NCBI SSIIc cDNA AF383878 (cDNA) NCBI Barley SSIIa cDNA AY133249 (cDNA) Li et al., 2003 SSIIb cDNA AK372518 (cDNA) Matsumoto et al., 2011 SSIIc cDNA AK372414 (cDNA) Matsumoto et al., 2011 Corn SSIIa cDNA AF019296 (cDNA) Harn et al., 1998 SSIIb cDNA NM_001112544 (cDNA) Schnable et al., 2009 SSIIc cDNA EU284113 (cDNA) Yan et al., 2008 Arabidopsis SSII cDNA NM_110984 (cDNA) Salanoubat et al., 2000

[0195] As used herein, “ SSIIa gene in the wheat A genome” or “ SSIIa -A gene” means any polynucleotide that encodes an SSIIa-A polypeptide as defined herein or that is derived from a polynucleotide that encodes SBEIIa-A in a wheat plant , including naturally occurring polynucleotides, variant sequences, or synthetic polynucleotides, including “wild-type SSIIa-A gene(s)” that encode(s) an SSIIa-A polypeptide with activity predominantly of wild-type SSIIa, and “mutant SSIIa -A gene(s)" which does not encode an SSIIa-A polypeptide with predominantly wild-type activity, but which is clearly derived from the SSIIa gene -A wild type. Comparison of the nucleotide sequence of the mutant form of the SSIIa gene with the wild-type SSIIa gene set is used to determine which SSIIa gene it is derived from and thus to classify it. For example, a mutant SSIIa gene is considered a mutant SSIIa-A gene if its nucleotide sequence is more closely related, i.e., has a greater degree of sequence identity, to the wild-type SSIIa-A gene than to any other SSIIa gene. The mutant SSIIa-A gene encodes an SSIIa polypeptide with reduced starch synthase enzyme activity (partial mutant) or a polypeptide with no starch synthase activity or no protein at all (null mutant gene). A representative cDNA nucleotide sequence corresponding to the SSIIa-A gene is given in SEQ ID NO:4 (Genbank accession no. AF155217; Li et al., 1999). Other representative nucleotide sequences are given under Accession No. AK330838 (cDNA from the SSIIa-A gene of the Chinese Spring variety, Kawaura et al., 2009) and Accession No. AJ269503, which represents the cDNA from the SSIIa-A gene of the Fielder variety (Gao and Chibbar, 2000).

[0196] As used herein, the terms " SSIIa gene in genome B" or " SSIIa-B gene", and " SSIIa gene in genome D" or " SSIIa-D gene" have the same meanings as those for SSIIa-A in the previous paragraph . The exemplary cDNA nucleotide sequence corresponding to the SSIIa-B gene is given in SEQ ID NO:5 (Genbank accession no. AJ269504; Gao and Chibbar 2000), and that corresponding to the SSIIa-D gene is given in SEQ ID NO:6 (Genbank accession no. AJ269502 ; from the variety Fielder, Gao and Chibbar, 2000). The sequences of portions of the SSIIa genes are also provided herein, as shown in FIG. 2-4.

[0197] As used herein, “ SSIIb gene in the wheat A genome” or “ SSIIb -A gene” means any polynucleotide that encodes an SSIIb-A polypeptide as defined herein or that is derived from a polynucleotide that encodes SSIIb-A in a wheat plant , including naturally occurring polynucleotides, variant sequences, or synthetic polynucleotides, including “wild-type SSIIb-A gene(s)” that encode(s) an SSIIb-A polypeptide with activity predominantly of wild-type SSIIb, and “mutant SSIIb -A gene(s)" which does not encode an SSIIb-A polypeptide with predominantly wild-type activity, but which is clearly derived from the SSIIb gene -A wild type. Comparison of the nucleotide sequence of the mutant form of the SSIIb gene with the wild-type SSIIb gene set is used to determine which SSIIb gene it is derived from and thus to classify it. For example, a mutant SSIIb gene is considered a mutant SSIIb-A gene if its nucleotide sequence is more closely related, i.e., has a greater degree of sequence identity, to the wild-type SSIIb-A gene than to any other SSIIb gene. The mutant SSIIb-A gene encodes an SSIIb polypeptide with reduced starch synthase enzyme activity (partial mutant) or a polypeptide with no starch synthase activity or no protein at all (null mutant gene). A typical cDNA nucleotide sequence corresponding to the SSIIb-A gene is shown in SEQ ID NO:12 (Genbank accession number AK332724).

[0198] As used herein, the terms “ SSIIa gene in genome B” or “ SSIIa-B gene”, and “ SSIIa gene in genome D” or “ SSIIa-D gene” have the same meanings as those for SSIIa-A in the previous paragraph . The exemplary cDNA nucleotide sequence corresponding to the SSIIa-B gene is given in SEQ ID NO:5 (Genbank accession no. AJ269504; Gao and Chibbar 2000), and that corresponding to the SSIIa-D gene is given in SEQ ID NO:6 (Genbank accession no. AJ269502 ; from the variety Fielder, Gao and Chibbar, 2000).

[0199] SSIIa genes as defined above include any regulatory sequences located on the 5' or 3' strands of a transcribed region, including a promoter region that regulates the expression of the associated transcribed region, and introns in the transcribed regions. An exemplary nucleotide sequence of the SSIIa gene is given as SEQ ID NO:7, which represents the nucleotide sequence of the SSIIa-A gene from the wheat A genome; Accession No. AB201445. Similarly, the nucleotide sequence of the wild-type wheat SSIIa-B gene is given under accession number AB201446 (IWGSC: chromosome 7DS, Traes_7DS_E6C8AF743, 3877787: bp 1 to 396, bp 5137 to 5419 straight strand), and the gene sequence Wheat SSIIa-D is listed under accession number AB201447 (IWGSC: chromosome 7DS, Traes_7DS_E6C8AF743, 3877787: bp 1 to 396, bp 5137 to 5419 straight strand). Each of these wild-type genes was obtained from the Chinese Spring wheat variety (Shimbata et al., 2005).

[0200] It should be understood that there are natural variations in the SSIIa gene sequences of different wheat varieties. One skilled in the art can readily recognize homologous genes based on sequence identity. The degree of sequence identity between the nucleotide sequences of homologous wild-type SSIIa genes and the amino acid sequences of wild-type polypeptides is 95-96%.

[0201] An allele is a variant of a gene at a single genetic locus. A diploid organism has two sets of chromosomes. Hexaploid wheat has six sets of chromosomes, with 7 chromosomes in each set, and is thought to have been developed by hybridization of three diploid progenitor plants that contributed the A, B, and D genomes. Each chromosome in a pair of chromosomes has one copy (i.e., one allele) of each gene. If both alleles of a gene are the same, the organism is homozygous for that allele or gene. If two alleles of a gene are different, the organism is heterozygous for that gene. The relationship between alleles at a locus is generally described as dominant or recessive. Two alleles of a gene in a wheat plant or grain may have the same mutation and are thus considered homozygous for that mutation, or two alleles may contain different mutations to each other and are considered heterozygous for those mutations. Different alleles of a gene or multiple genes can be combined using methods known in the art. For example, you can cross two parent wheat plants that have different alleles of the same gene to produce offspring (F1) containing both alleles in a heterozygous state, and then self-fertilize the daughter plants to produce the next generation of plants (F2) that contain one or more the other of these alleles in a homozygous state or both alleles in a heterozygous state in accordance with Mendelian genetics.

[0202] Alleles that do not encode or are not capable of producing any active enzyme are null alleles. Such null alleles may or may not encode a polypeptide, for example encoding a truncated polypeptide or a polypeptide having an inactivating change in amino acid sequence compared to a wild-type SSIIa polypeptide.

[0203] Reference to null mutation(s) includes a null mutation independently selected from the group consisting of a deletion mutation, an insertion mutation, a splice site mutation, a premature translation termination mutation, and a frameshift mutation, or any combination of them. In one embodiment, one or more null mutations are non-conservative amino acid substitution mutations, or the null mutation includes a combination of two or more non-conservative amino acid substitutions. In this context, non-conservative amino acid substitutions are as defined herein.

[0204] A loss-of-function mutation, which includes a partial loss-of-function mutation in an allele of a gene as well as a complete loss-of-function mutation (null mutation), means a mutation in an allele that results in a decrease in the level or activity of an enzyme, such as an SSIIa enzyme, in grain A mutation in an allele may mean, for example, that less protein having wild-type or reduced activity is translated, or that wild-type or reduced levels of transcription are followed by translation of an enzyme with reduced enzymatic activity, or preferably the mutant allele is transcribed at a reduced level compared to with wild type and any translation product has less activity than the corresponding wild type polypeptide. The mutation may result, for example, in that no or less RNA is transcribed from the gene containing the mutation, or that the polypeptide produced has no or reduced activity compared to the wild type, preferably both. If it is not possible to detect a transcript from an allele, for example by RT-PCR, this result indicates that the allele is a null allele.

[0205] "Point mutation" refers to a single nucleotide base change that includes the deletion, substitution, or insertion of a single nucleotide. The point mutation may further be a splice site mutation, a premature translation termination mutation, a frameshift mutation, or other loss-of-function mutation that results in no protein production, or production of less protein, or production of a protein with less activity SSII. A frameshift mutation in the protein-coding region of a gene is considered a null mutation because it affects the structure of the encoded polypeptide. Likewise, a premature translation termination mutation is considered a null mutation unless it is very close to the C-terminus of the protein-coding region of the gene, in which case an enzyme assay can be used to determine whether the protein has enzymatic activity. In some embodiments, the point mutation results in a conservative or preferably non-conservative amino acid substitution.

[0206] “Reduced” or “lesser” amount or level of polypeptide or enzyme activity means reduced or lesser amount or level compared to the amount or level provided by the corresponding wild-type allele or gene. Typically the reduction is at least 40%, preferably at least 50% or at least 60%, more preferably at least 80% or 90% relative to wild type. In the most preferred embodiment, the protein is not detected, for example, in the Western blot analysis described herein, preferably in the case of each of SSIIa-A, SSIIa-B and SSIIa-D.

[0207] "Reduced" activity means a decrease relative to the corresponding wild-type enzyme, such as SSIIa, SSSIIa, or other enzyme.

[0208] Protein “activity” refers to SS activity, which can be measured directly or indirectly by various methods known in the art and described herein.

[0209] In some embodiments, the amount by weight of SSIIa or other polypeptide is reduced even though a large number of the polypeptide molecules in the grain are the same as the wild type, but each molecule has less activity than the wild type. For example, the polypeptides produced are shorter than the wild-type SSIIa protein or other protein, as occurs when a mutant SSIIa or other protein is truncated due to a premature translation termination signal.

[0210] As used herein, the expression “two identical alleles of the SSIIa-A gene” means that the two alleles of the SSIIa-A gene are identical to each other, i.e., the plant or grain is homozygous for those alleles or that gene; "two identical alleles of the SSIIa-B gene" means that two alleles of the SSIIa-B gene are identical to each other; "two identical alleles of the SSIIa-D gene" means that two alleles of the SSIIa-D gene are identical to each other.

[0211] It is possible to obtain wheat plants according to the invention and carry out their identification after mutagenesis. In some embodiments, the wheat plant is non-transgenic, as desired in some markets, or does not contain any exogenous nucleic acid that reduces expression of the SSIIa gene. In another embodiment, the wheat plant is transgenic, for example, contains an exogenous nucleic acid molecule other than one that reduces expression of the SSIIa gene and/or the SBEIIa gene, such as, for example, an exogenous nucleic acid molecule that encodes a polypeptide that confers herbicide resistance to the plant .

[0212] Mutant wheat plants containing a mutation in one SSIIa gene, which can be combined by crossing plants and selecting progeny containing other mutations in the SSIIa gene to create wheat plants according to the invention, can be synthetic, for example, by performing site-directed mutagenesis in nucleic acid, or induced by mutagenic treatment, or may be of natural origin, i.e., isolated from a natural source. In some embodiments, a cell, tissue, seed of a progenitor plant, or the plant itself can be mutagenized to create single or multiple mutations, such as nucleotide substitutions, deletions, insertions, and/or codon modifications. Preferred wheat plants and grains according to the invention contain at least one introduced mutation of the SSIIa gene, more preferably two or more introduced mutations of the SSIIa gene, and may not contain mutations of natural origin, i.e. all mutant SSIIa alleles in the plant are obtained synthetically or through mutagenic treatment. As used herein, an "introduced mutation" or "introduced mutation" is an artificially induced genetic variation that may result from chemical, radioactive, or biological mutagenesis, such as transposon or T-DNA insertion, or endonuclease-induced mutation.

[0213] Mutagenesis can be accomplished by chemical or radiation methods, such as seed treatment with EMS or sodium azide (Zwar and Chandler, 1995), or gamma irradiation, as is well known in the art. Chemical mutagenesis tends to favor nucleotide substitutions rather than deletions. Heavy ion beam irradiation (HIB) is known as an effective mutation breeding technology for developing new plant varieties, see for example Hayashi et al., 2007 and Kazama et al ., 2008. Ion beam irradiation is characterized by two physical factors, dose (Gy) and LET (linear energy transfer, keV/µm), in relation to the biological effect, which determines the degree of DNA damage and the size of DNA deletion, which can be adjusted according to the desired degree of mutagenesis. The PTI method allows the generation of a range of mutants, many of which contain deletions, which can be screened for mutations in specific SSIIa genes. It is possible to backcross identified mutants to unmutated wheat plants as recurrent parents to eliminate and therefore reduce the impact of unwanted mutations in the mutagenized genome.

[0214] Isolation of mutants can be accomplished by screening mutagenized plants or seeds. For example, a mutagenized wheat population can be screened directly for the SSIIa genotype, or indirectly by screening for a phenotype resulting from mutations in the SSIIa genes. Direct screening for genotype preferably involves testing for the presence of mutations in the SSIIa genes, which can be observed in a PCR assay for the absence of specific SSIIa markers, as expected when some genes are deleted, or in a heteroduplex assay such as TILLING. Screening is preferably based on nucleotide sequencing, which is often performed on pools of candidate mutants. Phenotypic screening may include screening for the absence or reduction of one or more SSIIa polypeptides by ELISA or affinity chromatography, or changes in starch phenotype in grain starch. In hexaploid wheat, the screen is preferably conducted for a genotype that already lacks one or more SSIIa activities, for example a wheat plant already containing mutations in the SSIIa genes of two or three genomes, so as to search for a mutant with an additional lack of functional activity. Affinity chromatography can be used to distinguish between SSIIa-A, SSIIa-B and SSIIa-D polypeptides. Large populations of mutagenized seeds (thousands or tens of thousands of seeds) can be screened for high amylose phenotypes using near-infrared spectroscopy (NIR). High-throughput screening can be easily carried out by these methods, allowing the isolation of mutants at a frequency of approximately one mutant per several hundred seeds.

[0215] The plants and seeds of the invention can be produced using a process known as TILLING (Targeting Induced Local Lesions IN Genomes), by which one or more mutations can be created in wheat plants or grains. In the first step, introduced mutations, such as new changes in a single base pair, are induced in a plant population by treating seeds or pollen with a chemical or radioactive mutagen, and then growing the plants to a generation in which the mutations are stably inherited, typically until the M2 generation, in which homozygous mutants can be identified. DNA is isolated and seeds of all members of a population are stored to create a resource that can be re-evaluated over time. For the TILLING assay, PCR primers are designed to specifically amplify one target gene of interest. Dye-labeled primers can then be used to amplify PCR products from the pooled DNA of many individual plants. These PCR products are denatured and rehybridized to produce mismatched base pairs. Mismatches or heteroduplexes represent both naturally occurring single nucleotide polymorphisms (SNPs) (i.e., several plants in a population have some probability of carrying the same polymorphism) and induced SNPs (i.e., only rare individual plants have some probability of exhibiting the mutation ). Once heteroduplexes are formed, an endonuclease such as Cel I is used to recognize and cleave mismatched DNA, or high-resolution melting is used to discover new SNPs in the TILLING population. For example, see Botticella et al. , 2011.

[0216] Using this approach, many thousands of plants can be screened to identify any individual plant with a single base pair change or small insertions or deletions (1-30 bp) in any gene or specific genomic region. The size range of the analyzed genomic fragments can be from 0.3 to 1.6 kb. With 8-fold pooling and amplification of 1.4 kb. fragments with 96 lanes per assay, this combination allows screening of up to a million base pairs of genomic DNA in a single assay, making TILLING a high-throughput technique. TILLING is further described in Slade and Knauf, 2005, and Henikoff et al., 2004.

[0217] In addition to providing efficient mutation detection, high-throughput TILLING technology is ideal for identifying natural polymorphisms. Consequently, a detailed study of unknown homologous DNA through heteroduplexing at a known sequence makes it possible to identify the number and location of polymorphism sites. Both nucleotide changes and small insertions and deletions, including at least some repeat polymorphisms, can be identified. This is called Ecotilling (Comai et al., 2004). It is possible to screen plates containing sequenced ecotypic DNA instead of pools of DNA from mutagenized plants. Because detection is performed on gels with nearly one base pair resolution and the background structures are the same for all lanes, it is possible to obtain matching bands of the same size, thereby performing mutation detection and genotyping in a single step. With this approach, silencing a mutant gene is simple and effective.

[0218] As used herein, the term “biological agent” means an agent used to create site-specific mutants and includes enzymes that induce double-strand breaks in DNA that stimulate endogenous repair mechanisms. These include endonucleases, zinc finger nucleases, TAL effector proteins, transposases, site-specific recombinases and are preferably CRISPR endonucleases. Zinc finger nucleases (ZFNs), for example, facilitate site-specific cleavage within a selected gene in the genome, allowing endogenous or other end-joining repair mechanisms to introduce deletions or insertions to close the gap. An overview of zinc finger nuclease technology is given in Le Provost et al., 2009, also see Durai et al., 2005 and Liu et al., 2010.

[0219] Clustered regularly interspaced short palindromic repeats (CRISPRs) are segments of prokaryotic DNA containing short repeats of base sequences. Each repeat is followed by a short segment of “spacer DNA” from previous exposure to a bacteriophage virus or plasmid. The CRISPR/Cas system is a prokaryotic immune system that confers resistance to foreign genetic elements, such as those found in plasmids and phages, and provides some form of acquired immunity. CRISPR spacers recognize and cut these exogenous genetic elements in a manner similar to RNA interference in eukaryotic organisms. CRISPR can be found in approximately 40% of sequenced bacterial genomes and 90% of sequenced archaea.

[0220] By delivering Cas9 nuclease and corresponding guide RNAs into a cell, the cell's genome can be cut at the desired location, allowing existing genes to be removed and/or new ones to be added. CRISPR has been used together with specific endonuclease enzymes for genome editing and gene regulation in various species. Additional information regarding CRISPR can be found in WO 2013/188638, WO 2014/093622 and Doudna et al., (2014).

[0221] Transcription activator-like effector nucleases (TALENs) are restriction enzymes that can be designed to cut specific DNA sequences. They are created by fusing the TAL effector DNA-binding domain with a DNA cleavage domain (a nuclease that cuts DNA strands). Transcription activator-like effectors (TALEs) can be designed to bind virtually any desired DNA sequence and thus, in combination with a nuclease, can cut the DNA at specific sites. Restriction enzymes can be introduced into cells for use in gene editing or for in situ genome editing, a technology known as engineered nuclease genome editing. Along with zinc finger nucleases and CRISPR/Cas9, TALEN is an important tool in the field of genome editing. Additional information regarding TALEN can be found in Boch (2011); Juong et al., (2013) and Sune et al., (2013).

[0222] The identified mutations can then be introduced into the desired genetic environment by crossing the mutant to a plant with the desired genetic environment and performing the required number of backcrosses to eliminate the inherently undesirable parental environment. See example 3 in this document for example.

[0223] In some embodiments, the mutations are null mutations, such as nonsense mutations, frameshift mutations, deletions, insertion mutations, or splice site variants that completely inactivate the gene. Derivatives with nucleotide insertions include 5' and 3' terminal fusions, as well as insertions of single or multiple nucleotides within a sequence.

[0224] Sequence variants with nucleotide insertions are those in which one or more nucleotides are inserted into some region of the nucleotide sequence, as in a predefined region, as possible with zinc finger nucleases (ZFNs), CRISPR nucleases, or other homologous recombination methods , and as a random insertion with appropriate screening of the resulting product.

[0225] Deletion variants are characterized by the removal of one or more nucleotides from a sequence. In one embodiment, the mutant gene contains only one insertion or deletion of nucleotide sequence compared to the wild type gene. The deletion may be large enough to include one or more exons or introns, both exons and introns, an intron-exon interface, part of a promoter, a translation start site, or even an entire gene. Deletions may extend far enough to include at least part of the SSIIa gene or the entire gene and one or more neighboring genes in genome A, B, or D. Insertion or deletion in exons of the protein-coding region of a gene that results in the addition or deletion of a number of nucleotides , which is not necessarily a multiple of three, thereby leading to a change in the reading frame during translation, almost always lead to the elimination of the activity of the mutant gene containing such an insertion or deletion; such mutations are null mutations. Insertions or deletions in exons of the protein-coding region of a gene that result in the addition or deletion of a number of nucleotides that is an exact multiple of three may or may not abolish the activity of the gene containing the insertion or deletion. In the case of a deletion of a number of nucleotides that is an exact multiple of three, the deletion is expected to inactivate the encoded polypeptide if the deleted nucleotides encode a highly conserved amino acid. Enzyme assays or phenotypic assays can be used to determine whether insertion or deletion mutations are null mutations.

[0226] Nucleotide substitution variants are those in which at least one nucleotide in the sequence has been deleted and another nucleotide has been inserted in its place. In some embodiments, the number of nucleotides at which substitutions are made in the mutant gene relative to the wild-type gene is a maximum of ten nucleotides, more preferably a maximum of 9, 8, 7, 6, 5, 4, 3, or 2, or most preferably only one nucleotide. Substitutions can be “silent” in the sense that a nucleotide change does not change the amino acid specified by that codon. Nucleotide substitutions can reduce translation efficiency and thereby reduce the level of expression of the corresponding SSIIa gene, for example, by reducing mRNA stability, or, if located near the exon-intron interface, alter splicing efficiency. Silent substitutions that do not alter the translation efficiency of the SSIIa gene are not expected to alter the activity of the gene and are therefore considered herein to be non-mutant, i.e. such genes represent active variants and are not included in the term "mutant gene" . Alternatively, the nucleotide substitution(s) may alter the encoded amino acid sequence and thereby alter the activity of the encoded enzyme, particularly if conserved amino acids are replaced by another amino acid that is sufficiently highly characterized, i.e. non-conservative replacement. For information regarding conservative substitutions, see Table 3. Conserved amino acids in wheat SSIIa polypeptides can be identified by aligning SSIIa amino acid sequences from different species, eg, aligning SEQ ID NO:1 with Arabidopsis thaliana SSII and determining which amino acids are common.

[0227] As used herein, the term “mutation” does not include silent nucleotide substitutions that do not affect the activity of the gene, and therefore only includes those changes in the gene sequence that affect the activity of the gene. The term "polymorphism" refers to any change in the nucleotide sequence of a gene, including such silent nucleotide substitutions. Screening methods may include, firstly, screening for polymorphisms and, secondly, for mutations in a group of polymorphic variants. Mutations include deletions of all or part of a gene, insertions such as insertion into an exon of a gene, and nucleotide substitutions, as well as any combination of these.

[0228] As used herein, the terms "plant(s)" and "wheat plant(s)" generally refer to whole plants, and the terms "plant" or "wheat" are used as descriptive terms to refer to any a substance that is present in, derived from, isolated from or associated with a plant or plant of wheat, such as, for example, plant organs (for example, leaves, stems, roots, flowers), single cells (for example, pollen), seeds or grains, wherein plant cells include, for example, tissue culture cells, products derived from the plant such as “wheat flour”, “wheat grain”, “wheat starch”, “wheat starch granules”, etc. Sprouts and sprouted grains, from which the roots and shoots emerged are also included in the meaning of the term plant. As used herein, the term “plant parts” refers to one or more plant tissues or organs that are obtained from a whole plant, preferably a wheat plant. As used herein, plant parts comprise plant cells. Plant parts include vegetative structures (e.g., leaves including leaf sheath and leaf blade, stems including internodes), roots, shoots, floral organs/structures such as spike (also called raceme or panicle), pollen, ovules, seed (including embryo, endosperm and seed coat), plant tissue (for example, vascular tissue, integumentary tissue, etc.), its cells and progeny. As used herein, the term “plant cell” refers to a cell derived from or contained within a plant, preferably a wheat plant, and includes protoplasts or other plant-derived cells, gamete-producing cells, and cells that regenerate into complete plants. Plant cells may be cells in culture. By "plant tissue" is meant differentiated tissue in or derived from a plant ("explant") or undifferentiated tissue derived from mature or immature embryos, seeds, roots, shoots, fruits, pollen and various forms of plant cell aggregation in culture, such as callus. Plant tissues in seeds or derived from seeds such as wheat grains are the seed coat, endosperm, endosperm, aleurone layer and embryo. All wheat plant tissues or organs and wheat cells contain genetic material (nucleic acid) from the wheat plant from which they are derived.

[0229] As used herein, cereals mean plants or grains of members of the monocot families Poaceae or Graminae that are cultivated for the edible components of their grains, and include wheat, barley, corn, oats, rye, rice, sorghum, triticale, millet, buckwheat. Preferably, the cereal plant or grain is a wheat plant or grain. In a further preferred embodiment, the wheat cell, plant or grain or products derived from them according to the invention belong to the species Triticum aestivum .

[0230] As used herein, the term “wheat” refers to any species of the genus Triticum , including its predecessors as well as its progeny resulting from crossing with other species. Wheat includes "hexaploid wheat" which has an AABBDD type genomic organization consisting of 42 chromosomes and "tetraploid wheat" which has an AABB type genomic organization consisting of 28 chromosomes. The plants and grains of the invention belong to the hexaploid species T. aestivum and do not include the tetraploid species T. durum , also called durum wheat or Triticum turgidum ssp. durum . The diploid progenitors of T. aestivum are thought to be T. uartu , T. monococcum or T. boeoticum in the case of genome A, Aegilops speltoides in the case of genome B, and T. tauschii (also known as Aegilops squarrosa or Aegilops tauschii ) in the case of genome D. Preferably, the T. aestivum plant according to the invention is suitable for industrial grain production and has suitable agronomic characteristics known to those skilled in the art. Most preferably, the wheat is Triticum aestivum ssp. aestivum , referred to herein as "common wheat".

[0231] Aspects of the invention provide methods for growing and harvesting wheat grain in accordance with the invention and methods for creating bins containing wheat grain in accordance with the invention. For example, after preparing the soil by plowing and/or some other means, the seeds are typically planted by furrow seeding and the seeds are planted in rows. To prevent dispersal of grain produced after the plant reaches maturity, wheat must be harvested before full maturity is reached, but is generally harvested when the plants have completely lost their green color. Harvesting consists of several stages: cutting or harvesting the stems; threshing and winnowing to separate grain from ears, husks and other chaff; sifting and sorting grain; usually carried out by a combine harvester, and then loading the grain into trucks. In some embodiments, the harvested wheat grain may be stored in dry, well-ventilated areas that are free from pests. In some embodiments, harvested wheat grain may be stored for short periods of time in bins or barns. The wheat grain can then be sent to storage elevators - tall structures in which grain is dried and stored before it is sold or transported to terminal elevators. Accordingly, embodiments of the invention provide a method for producing wheat grain bins, comprising: a) cutting wheat stalks containing wheat grain as defined herein; b) threshing and/or winnowing the stalks to separate the grain from the chaff; and c) sifting and/or sorting the grain separated in step b), and loading the sifted and/or sorted grain into bins, thereby obtaining bins containing wheat grain.

[0232] The wheat plants and grains of the invention have uses other than food or animal feed, such as research or breeding applications. In the case of seed-reproducing plants such as wheat, the plants can self-pollinate to produce a plant that is homozygous for the required genes, or haploid tissues such as developing germ cells can be induced to double their chromosome complement to produce a homozygous plant. Thus, the self-pollinated wheat plant according to the invention produces grain containing a combination of SSIIa mutant alleles that are homozygous. The grain can be grown to produce plants that can have a selected phenotype, such as, for example, high amylose content in starch.

[0233] Wheat plants of the invention can be crossed with plants containing a more advantageous genetic environment, and therefore the invention includes transfer of a reduced SSIIa trait to another genetic environment. As used herein, "crossbreeding" or "crossbreeding" refers to the process of transferring (artificially or naturally) pollen from a flower of one plant to the stigma of a flower from another plant. After the initial cross, a necessary number of backcrosses can be made to eliminate less favorable genetic environments. SSIIa allele-specific PCR markers, such as those described herein, can be used to screen or identify daughter plants or grains with the desired combination of alleles, thereby monitoring the presence of alleles in a crossbreeding program. The desired genetic environment may include a suitable combination of genes for commercial yield and other traits such as agronomic efficiency or abiotic stress tolerance. The genetic environment may also include other altered starch biosynthetic or modification genes, such as null alleles of the SSIIIa genes or preferred alleles of the GBSS genes. The genetic environment may contain one or more transgenes, such as, for example, a gene conferring resistance to herbicides such as glyphosate.

[0234] The preferred genetic environment of the wheat plant is selected based on commercial production yield and other characteristics. Such characteristics may include the need to be winter or spring type, agronomic efficiency, disease resistance, and abiotic stress tolerance. For use in Australia, it may be desirable to cross the altered starch-related wheat plant trait of the invention with wheat varieties such as Baxter, Kennedy, Janz, Frame, Rosella, Cadoux, Diamondbird or other commonly grown variants. Other options are suitable for other growing areas. Preferably, the wheat plant of the invention provides a grain yield (tonnes/hectare) that is at least 50% relative to the corresponding wild-type variant in at least some growing areas, more preferably at least 60% or at least 70% , or at least 80%, or at least 90% relative to the yield of a wild-type variant having approximately the same genetic environment and grown under the same conditions. In one embodiment, grain yield is less than 90% relative to a wild-type variant having approximately the same genetic background and grown under the same conditions. Yield can be easily determined in controlled field studies or simulated field studies in a greenhouse, but preferably in the field.

[0235] Marker-assisted selection is a well-known method for selecting heterozygous plants produced by backcrossing to a recurrent parent in a classical crossing program. The plant population in each backcross generation will be heterozygous for the gene(s) of interest, typically present at a 1:1 ratio in the backcross population, and the molecular marker associated with the gene can be used to in order to distinguish between two alleles of a gene. It is possible to analyze the presence of two markers: one for the mutant allele and one for the wild-type allele. By isolating DNA, for example from young shoots, and testing it with a specific marker for an introgressed desired trait, plants are selected early for additional backcrossing while energy and resources are concentrated in fewer plants. Procedures such as crossing wheat plants, selfing wheat plants, or marker-assisted selection are standard procedures and are well known in the art. Transfer of alleles from tetraploid wheat, such as durum, to hexaploid, or other forms of hybridization are more difficult, but are also known in the art.

[0236] To identify a desired phenotypic characteristic, wheat plants that contain a combination of mutant ssIIa genes or other desired genes are typically compared to a control plant. When assessing a phenotypic characteristic associated with mutant ssIIa genes, such as grain starch amylose content, or total fiber content, or grain weight or yield, test plants and control plants are grown in a climate chamber, greenhouse, or preferably field conditions, under under the same conditions (temperature, soil, moisture supply, fertilizer supply, season, etc.). Identification of a particular phenotypic trait and comparison with controls is based on conventional statistical analysis and scoring. Gene expression or enzymatic activity is compared with parameters of growth, development and yield, which include one or more of germination rate, seedling vigor including emergence, plant morphology, color, number, size, volumes, dry and wet weight, ripening, ratio above- and below-ground biomass, and the timing, rate and duration of various stages of growth up to senescence, including vegetative growth, fruiting, flowering, grain yield and dormancy, yield index and soluble carbohydrate content, including levels of sucrose, glucose, fructose and starch, and also endogenous starch levels. In some embodiments, wheat plants of the invention differ from wild-type plants in one or more of these parameters by less than 50%, more preferably by less than 40%, by less than 30%, by less than 20%, by less than 15 %, less than 10%, less than 5%, less than 2% or less than 1% when grown under the same conditions. Preferably, the plant or grain of the invention is approximately the same as the wild type plant or grain with respect to one or more of these parameters.

[0237] As used herein, the term “linked” or “genetically linked” refers to a marker locus and a second locus located sufficiently close on a chromosome such that they will be inherited together in more than 50% of cases of meiosis, for example, not randomly. This definition includes the situation where the marker locus and the second locus form part of the same gene. Additionally, this definition includes the situation where a marker locus contains a polymorphism that is responsible for the trait of interest, in which case the polymorphism will be 100% associated with that phenotype. Thus, the percentage of recombination observed between loci in one generation (calculated in centimorgans (cM)) will be less than 50. In particular embodiments of the invention, genetically related loci on a chromosome may be separated by 45, 35, 25, 15, 10, 5, 4 , 3, 2 or 1 or less cm. Preferably, the markers are separated by less than 5 cM or 2 cM, and most preferably, they are separated by substantially 0 cM.

[0238] As used herein, “other genetic markers” can be any molecules that are associated with a desired trait in the wheat plants of the invention. Such markers are well known to those skilled in the art and include molecular markers associated with genes that determine traits such as disease resistance, yield, plant morphology, grain quality, other dormancy traits such as grain color, gibberellic acid content of the seed , plant height, flour color, etc. Examples of such genes are stem rust resistance genes Sr2 or Sr38 , yellow rust resistance genes Yr10 or Yr17 , nematode resistance genes such as Cre1 and Cre3 , alleles at glutenin loci that determine the strength of waxy ripeness, such as the alleles Ax , Bx , Dx , Ay , By and Dy , Rht genes, which determine the semi-dwarf growth form and, therefore, resistance to lodging (Eagles et al., 2001; Langridge et al ., 2001; Sharp et al., 2001).

[0239] Wheat plants, parts of wheat plants and products thereof according to the invention are preferably non-transgenic with respect to genes that inhibit the expression of the SSIIa gene and/or the SBEIIa gene, i.e. they do not contain a transgene encoding an RNA molecule that reduces the expression of an endogenous SSIIa gene, although in this embodiment they may contain other transgenes, for example herbicide resistance genes such as glyphosate resistance. More preferably, the wheat plant, grain and products thereof are non-transgenic, i.e. they do not contain any transgene that is preferred in some markers. Such products are also described herein as “untransformed” products. Such non-transgenic plants and grains contain a variety of SSIIa mutant alleles as described herein, such as those produced by mutagenesis.

[0240] As used herein, the terms “transgenic plant” and “transgenic wheat plant” refer to a plant that contains a genetic construct (“transgene”) not found in a wild-type plant of the same species, variety, or cultivar. This means that transgenic plants (transformed plants) contain genetic material that was not contained before the transformation. The terms “transgene” or “genetic construct” as used herein have the meaning generally accepted in the field of biotechnology and refer to a genetic sequence that has been created or altered by recombinant DNA or RNA technology. If present in a plant cell, the transgene was introduced into the plant cell or progenitor cell by a person. A transgene may include genetic sequences obtained from a plant cell, or from a cell of another plant, or from a non-plant source, or a synthetic sequence. Typically, the transgene has been introduced into the plant due to human intervention, such as transformation, but as one skilled in the art will appreciate, any method can be used. The genetic material is usually stably integrated into the plant genome. The introduced genetic material may contain sequences that occur in nature in the same form, but in a rearranged order or with a different arrangement of elements, for example, as an antisense sequence or an inhibitory double-stranded RNA expression sequence. Plants containing such sequences are included herein under the term "transgenic plants". Transgenic plants as defined herein include all progeny of an initially transformed and regenerated plant (T0 plant) that has been genetically modified by recombinant methods such that the progeny contains the transgene. Such progeny can be produced by self-pollination of the primary transgenic plant or by crossing such plants with another plant of the same species. In one embodiment, the transgenic plants are homozygous for each gene that was introduced (the transgene), such that their progeny do not segregate for the desired phenotype. Transgenic plant parts include all parts and cells of said plants that contain the transgene, such as seeds, cultured tissues, callus and protoplasts.

[0241] A "non-transgenic plant", preferably a non-transgenic wheat plant, is a plant that has not been genetically modified by introducing genetic material through recombinant DNA technologies. According to this document, the presence in a plant or grain of deletions of part of a gene created by site-specific endonucleases such as ZFN, TAL effectors or CRISPR-type nucleases, followed by non-homologous joining of ends in the cell of the plant and its progeny, is included in the concept of “non-transgenic”. As used herein, “progeny” includes all progeny of the wheat plant, both in the immediate and subsequent generations, and both plants and seeds (grain). Progeny includes seeds and plants resulting from self-fertilization ("self-fertilization"), as well as grains and plants resulting from crosses between two parent plants, such as F1 (first generation) progeny, F2, F3, F4, etc. . are the offspring of the second, etc. generations after self-fertilization of F1 plants.

[0242] As used herein, the term “corresponding non-transgenic plant” refers to a plant that is the same or similar in most characteristics, preferably isogenic or substantially isogenic, to the transgenic plant, but does not contain the transgene of interest. Preferably, the corresponding non-transgenic plant is of the same cultivar or variety as the predecessor of the transgenic plant of interest, or a related line of plants that lacks the construct, often referred to as a "segregant", or is a plant of the same cultivar or variety transformed with a "blank" construct. vector" and may be considered a non-transgenic plant.

[0243] As used herein, the term “wild type” refers to a cell, tissue, plant or plant part, preferably a Triticum aestivum plant, plant part or grain that has not been modified in accordance with the invention. Such a wild-type plant or grain is at least wild-type with respect to the SSIIa genes. “Corresponding wild type” refers to a cell, tissue, plant, plant part, or plant product suitable for comparison with the cell, tissue, plant, plant part, or plant product of the invention, as is generally known in the art. In general, the corresponding wild type is a wheat plant or plant part that is genetically similar, preferably isogenic, to the plant or plant part of the invention, but does not have mutations in the ssIIa gene. Wild-type cells, tissues, or plants are known in the art and can be used as controls to compare gene or polypeptide sequences, particularly SSIIa gene sequences, SSIIa gene expression levels, or the extent and nature of trait modification, with cells, tissues, or plants modified as described in this document. As used herein, the expression “wild-type wheat grain” means the corresponding non-mutagenized, non-transgenic wheat grain. As used herein, specific wheat grains include, but are not limited to, Sunstate, Chara and Cadoux. The wheat variety Sunstate is described in Ellison et al., (1994).

[0244] Any of several existing methods can be used to determine the presence of a transgene in a transformed plant. For example, polymerase chain reaction (PCR) can be used to amplify sequences unique to the transformed plant, with the amplified products detected by gel electrophoresis or other methods. DNA can be isolated from plants using traditional methods and PCR reactions carried out with primers that will separate transformed and non-transformed plants. An alternative method for confirming positive transformants is Southern blot hybridization, well known in the art. Transformed wheat plants can also be identified, i.e. distinguished from non-transformed or wild-type wheat plants, by their phenotype, for example due to the presence of a selectable marker gene, or by an immunoassay that determines the amount of expression of the enzyme encoded by the transgene, or any other phenotype caused by the transgene.

[0245] Wheat plants, preferably the Triticum aestivum species, of the present invention can be grown or harvested for grain production, advantageously for use as food for human consumption or as animal feed, or for fermentation or industrial feedstock production, such as ethanol production , among other uses. Alternatively, the green, above-ground parts of wheat plants can be directly used as animal feed, either directly through grazing or after harvest. Straw and chaff can also be used as food or for non-food applications. The plant of the present invention is preferably suitable for food production and, in particular, for industrial production of food for human consumption. Such food production may include the production of flour, dough, semolina, or other grain products such as starch granules or separated starch, which may be ingredients in industrial food production.

[0246] As used herein, the term “grain” generally refers to the mature, harvested seed (also called kernel) of a plant, but may also refer to the grain after swelling or germination, depending on the context. Grains include mature kernels produced by agricultural producers for purposes other than growing additional plants. Mature grains of a cereal plant, such as wheat, typically have a moisture content of less than about 18-20%, typically about 8-10% moisture. As used herein, the term “seed” includes harvested seeds, but also includes seeds that develop in the plant after flowering and mature seeds contained in the plant before harvest. The parts of a grain include the husk (seed coat), pericarp (fruit shell), aleurone layer, starchy endosperm, and embryo (embryo), which consists of a scutellum, a bud (sprout), and a radicle (primary root). The skin, pericarp, and aleurone layer together are commonly referred to as "bran", which can be removed from the grain by milling, and which may also contain the germ. The scutellum is an area that secretes some enzymes involved in germination and absorbs soluble sugars while breaking down starch in the endosperm for seedling growth after germination. The aleurone, which surrounds the starchy endosperm, also secretes enzymes during germination.

[0247] As used herein, "germination" refers to the emergence of the root tip (radicle) from the seed coat after imbibition. The root usually appears first, and then the bud. "Germination rate" refers to the percentage of seeds in a population that have germinated within some period of time after imbibition, such as 7 or 10 days. Germination levels can be calculated using techniques known in the art. For example, a seed population, typically of at least 100 grains, can be assessed daily over several days to determine germination percentage over time. With respect to the grains of the present invention, as used herein, the expression "degree of germination being substantially similar" means that the degree of germination of the grain is at least 90% of that of the corresponding wild-type grain.

In one embodiment, the grain of the invention has a germination rate of from about 70% to about 100% relative to the wild type grain, preferably from about 90% to about 100% relative to the wild type grain. When determining the level of germination, the wheat grain of the invention and the wild-type grain used as a control should be grown under the same conditions and stored under the same conditions for approximately the same time.

[0248] The invention also provides food ingredients such as flour, preferably whole grain, bran and other products made from grain. They may be unprocessed or processed, for example by heat treatment, fractionation or bleaching.

[0249] The grain of the invention can be processed to produce a food ingredient or food or non-food product using methods known in the art. In one embodiment, the food ingredient is a flour, such as, for example, whole wheat flour (grain flour) or white flour. As used herein, “flour” is a ground product of grain that has been ground into a powder. The powder is typically fractionated by sieving, centrifugation, or other methods known in the art, and may be further refined, thermally treated, and/or bleached. As used herein, the expression refined flour or “fine flour” refers to flour that has been enriched with an endosperm-derived portion of the ground powder relative to whole grain flour by removing at least some of the bran and germ components from the ground powder. The US Food and Drug Administration (FDA) requires flour to meet certain particle size standards in order to be classified as refined flour. According to the FDA, the particle size of refined flour is described as flour for which at least 98% passes through a material with openings no larger than a woven fabric with the designation "212 micrometers (U.S. Wire 70)."

[0250] As used herein, "whole grain flour", also referred to as wholemeal or wholemeal flour, is ground flour that has been derived from substantially 100% grain and which contains a refined flour component (premium flour) and a coarse fraction (coarse flour). ultrafine grinding fraction). The coarse fraction contains at least one component of bran and germ, usually both. The embryo is the plant in its embryonic state in the kernel of the grain, containing the embryo and scutellum. The germ contains lipids, fiber, vitamins, protein, minerals and phytonutrients such as flavonoids at levels greater than those found in the mature endosperm of the grain. Bran contains multiple cell layers, including the pericarp (fruit hull) and husk (seed husk), and also contains significant amounts of lipids, fiber, vitamins, protein, minerals and phytonutrients such as flavonoids. The aleurone layer, although technically considered part of the endosperm of the mature grain, exhibits many of the same characteristics as the bran and is therefore typically removed along with the bran and germ during the milling and/or sifting process. The aleurone layer also contains lipids, fiber, vitamins, protein, minerals and phytonutrients such as flavonoids, and ferulic acid.

[0251] In addition, the coarse fraction can be mixed with a refined flour component. Preferably, the coarse fraction is mixed homogeneously with the refined flour component. The coarse fraction can be mixed with a refined flour component to produce whole grain flour, thereby providing a whole grain flour with increased nutritional value, fiber content and antioxidant capacity compared to refined flour. For example, coarse or whole grain flour can be used in varying amounts to replace refined flour in baked goods, snack foods, and foods. The whole grain flour of the present invention (ie, ultrafine whole grain flour) can also be sold directly to consumers for use in home baking. In a typical embodiment, the granulation profile of the whole grain flour is such that 98% of the particles by weight of the whole grain flour have a diameter of less than 212 micrometers.

[0252] In additional embodiments, the enzymes contained in the bran and germ of the whole grain flour and/or the whole grain fraction are inactivated to stabilize the whole grain flour and/or the whole grain fraction. As used herein, "inactivated" can also mean inhibited, denatured, etc. Stabilization is a process that uses steam, heat, radiation or other treatments to inactivate the enzymes contained in the bran and germ layer. Without stabilization, naturally occurring enzymes in the bran and germ catalyze changes in compounds in the flour, which can have a negative impact on the cooking characteristics of the flour and its shelf life. Inactivated enzymes do not catalyze changes in the compounds contained in the flour, therefore, stabilized flour retains its culinary characteristics and has a longer shelf life. For example, in the present invention, two flow grinding methods can be used to grind the coarse fraction. After the coarse fraction is separated and stabilized, it is ground in a crusher, preferably a roller mill, to form a coarse fraction having a particle size distribution of less than or equal to approximately 500 micrometers. After screening, the crushed coarse fraction having a particle size greater than 500 micrometers can be returned to the process for additional grinding.

[0253] In additional embodiments, the flour, whole grain flour, or coarse grain may be a component of a food product, for example, it may be used as an ingredient in food production. The food product may be, for example, a bagel, sponge cake, bread, bun, croissant, dumpling, muffin such as an English muffin, pita bread, yeast-free bread, frozen or refrigerated dough products, dough, canned beans, burritos, chili, tacos , tamal, tortilla, covered pie, ready-to-eat cereal, ready-to-eat meal, filling, microwaveable meal, brownie, pie, cheesecake, coffee cake, cookie, dessert, pastry, sweet roll, candy bar, crust pie, pie filling, baby food, baking mix, batter, breading, gravy mix, meat filler, meat substitute, spice mix, soup mix, gravy, roux, salad dressing, soup, sour cream, noodles, pasta , ramen noodles, chow mein noodles, lo mein noodles, packaged ice cream, ice cream bar, ice cream cone, wafer ice cream, cracker, crouton, donut, egg roll, compressed snacks, fruit and cereal bar, microwaveable snack product , nutrition bar, pancake, convenience baked product, pretzel, pudding, granola product, chip snack, appetizer, snack mix, waffle, pizza crust, pet food or pet food.

[0254] In other embodiments, flour, whole grain flour, or whole grain may be components of the nutritional supplement. For example, a nutritional supplement may be a product added to the diet containing one or more ingredients, typically including: vitamins, minerals, lipids such as omega-3 fatty acids, amino acids, enzymes, antioxidants such as lutein, herbs , spices, probiotics, extracts, prebiotics and fiber. The flour, whole grain flour or coarse fraction according to the present invention contains vitamins, minerals, amino acids, enzymes and fibers. For example, the coarse fraction contains concentrated amounts of dietary fiber, as well as other important nutrients such as B vitamins, selenium, chromium, manganese, magnesium and antioxidants that are important for a healthy diet. For example, 15 grams of the coarse fraction of the present invention provides 33% of an individual's recommended daily fiber intake. Additionally, just 9 grams is enough to provide 20% of an individual's recommended daily fiber intake. Thus, the coarse fraction is an excellent additional source for consuming individually required amounts of fiber.

[0255] In additional embodiments, the whole grain flour or whole grain fraction may be a fiber additive or component thereof. Many modern fiber supplements, such as psyllium husk, cellulose derivatives, and hydrolyzed guar gum, have limited nutritional value beyond their fiber content. Additionally, many fiber supplements have an undesirable texture and poor taste. Therefore, in an embodiment, the food ingredients of the invention do not contain fiber-containing additives derived from sources other than wheat grains. Supplements derived from whole grain flour or the coarse fraction of the wheat grain thus provide fiber as well as protein and antioxidants. The fiber supplement may be provided in, without limitation, the following forms: instant drink mixes, ready-to-drink beverages, nutrition bars, wafers, cookies, crackers, gels, capsules, gum, chewable tablets and pills. In one embodiment, the fiber supplement is provided in the form of a flavored cocktail or malt beverage, which embodiment may be particularly attractive as a fiber supplement for children.

[0256] In an additional embodiment, the milling and mixing process can be used to produce multigrain flour or multigrain coarse fraction. For example, the bran and germ from one type of grain, such as the grain of the invention, can be ground and mixed with ground endosperm or whole grain flour from another type of wheat or other cereal. The present invention is intended to include mixing any combination of one or more components of bran, germ, endosperm and whole grain flour from one or more types of grains. This multigrain approach can be used to produce conventional flour and benefit from the quality and nutrient content of many types of grains, such as wheat grains, to produce flour.

[0257] The flour or whole grain flour of the present invention can be produced using any milling process known in the art. A typical implementation involves grinding grain in one stream without separating the endosperm, bran and germ of the grain into separate streams. The clean and conditioned grain is transferred to a first pass crusher such as hammer crusher, roller mill, pin mill, impact crusher, disc mill, air burr mill, roller mill, etc. After grinding, the grain is discharged and transferred to a screen. Any sieve known in the art can be used to sift the crushed particles. The material passing through the screen mesh is whole grain flour according to the present invention and does not require additional processing. The material that remains on the sieve is called the second fraction. In the case of the second fraction, additional particle grinding is necessary. Thus, the second fraction can be transferred to the crusher for a second pass. After grinding, the second fraction can be transferred to a second sieve.

[0258] It is understood that the flour, whole grain flour, coarse fraction and/or grain products of the present invention can be modified or improved through numerous other processes such as: fermentation, instantization, extrusion, encapsulation, baking, roasting, etc. The flours and whole grain flours of the invention may contain genetic material, including DNA, from the wheat grain from which they were derived, as well as the products prepared from them. See, for example, Tilley (2004) and Bryan et al., (1998).

[0259] Malt beverages provided by the present invention include alcoholic beverages (including distilled beverages) and non-alcoholic beverages that are produced using malt as part or all of the starting material. Examples include beer, happoshu (low-malt beer), whiskey, low-alcohol malt beverages (i.e., malt beverages containing less than 1% alcohol), and soft drinks.

[0260] Malting is a process of controlled soaking and sprouting followed by drying of the grain. This sequence of actions is important for the synthesis of numerous enzymes that cause grain modification, a process that primarily results in the depolymerization of dead endosperm cell walls and mobilizes grain nutrients. In the subsequent drying process, chemical darkening reactions develop flavor and color. Although the main use of malt is in the beverage industry, it can also be used in other industrial processes, for example as a source of enzymes in the baking industry or as a flavoring agent and coloring agent in the food industry, such as malt or malt flour, or indirectly in in the form of malt syrup, etc.

[0261] In one embodiment, the present invention relates to methods for producing a malt composition. This method preferably includes the steps:

(i) providing wheat grain according to the invention,

(ii) soaking said grain,

(iii) germinating soaked grains under specified conditions and

(iv) drying said sprouted grains.

[0262] Malt can be prepared using only the grains of the invention, or in a mixture containing other grains. Malt is mainly used for brewing, but also for the production of distilled alcoholic beverages. Brewing involves wort production, primary and secondary fermentations, and post-processing. First, the malt is ground, mixed into water and heated. During this “mash,” enzymes activated during malting break down the starch in the kernel into fermentable sugars. The resulting wort is clarified, yeast is added, and the mixture is fermented and further processed.

[0263] In general, the first step in the wort production process is to grind the malt so that water can access the grain particles during the mash phase, which is essentially a continuation of the malting process with enzymatic depolymerization of the substrate. During mashing, ground malt is incubated with a liquid fraction such as water. The temperature is either kept constant (isothermal mashing) or gradually increased. In either case, the solubles produced during malting and mashing are extracted into said liquid fraction before it is separated by filtration into wort and residual solids called brewer's grains. The wort composition can also be prepared by incubating wheat grain according to the invention or parts thereof with one or more suitable enzymes, such as enzyme compositions or enzyme mixture compositions, for example Ultraflo or Cereflo (Novozymes). The wort composition can also be prepared using a mixture of malt and unmalted plants or parts thereof, optionally adding one or more suitable enzymes during production.

[0264] When included in food products, starch from flour or whole grain flour provides modified digestive properties, for example, the food ingredient contains more resistant starch compared to the corresponding food ingredient derived from wild-type wheat grain, for example, from 1% to 20%, from 2% to 18%, 3% to 18%, or 5% to 15% resistant starch, and has a reduced glycemic index (GI), for example, reduced by at least 5 units, preferably 5-25 units. This may be combined with a higher total fiber content, for example 15% to 30% by weight of the food ingredient.

[0265] Carbohydrates, compounds containing one or more saccharide units consisting of carbon, hydrogen and oxygen, can be classified according to the number and composition of the monosaccharide units that make up the carbohydrate. They include polysaccharides (>10 monosaccharide units), oligosaccharides (3-10 monosaccharide units), disaccharides, and monosaccharides including glucose, fructose, xylose, and arabinose. Carbohydrates constitute more than 65% by weight of the mature wild-type wheat grain, including 65-75% starch and about 10% cell wall polysaccharides such as cellulose, arabinoxylan and BG.

[0266] Starch is the major stored carbohydrate in most plants, including cereals such as wheat. As defined herein, “starch” is a polysaccharide consisting of glucopyranose units polymerized through α-1,4 linkages and with no or few α-1,6 linkages. Starch is synthesized in amyloplasts and produced and stored in the granules of a developing storage organ such as grain; herein it is referred to as "stored starch" or "grain starch" or "grain starch". In cereal grains, including Triticum aestivum , the vast majority of stored starch is deposited in the endosperm as starch granules. Starch is synthesized and stored in amyloplasts during grain development, particularly during the grain filling phase of plant growth, and forms discrete crystalline structures called starch granules. In Triticum aestivum, starch granules are divided by size into two classes, namely large ellipsoidal granules with a diameter in the range of 10-40 µm (A-type granules) and smaller spherical granules with a diameter in the range of 1-10 µm (B-type granules).

[0267] Starch molecules are classified as belonging to two fractions of components known as amylose and amylopectin, which differ in the degree of polymerization (DP) and the ratio between α-1,6- and α-1,4-linkages in the polymers. Amylose contains almost entirely linear α-1,4-linked glucosyl chains, which may contain no or several glucan chains linked by an α-1,6 linkage to other α-1,4-linked chains, and has a molecular weight of 10 ⁴ -10 ⁵ dalton. As defined herein, the term “amylose” includes substantially linear molecules of α-1,4-linked glucosidic (glucopyranose) units, sometimes called “true amylose,” and amylose-like long-chain starch, sometimes called “intermediate material” or “amylose.” -like amylopectin, which is an iodine-binding material in iodometric analysis along with true amylose (Takeda et al ., 1993; Fergason, 1994). The linear molecules in true amylose typically have a DP of 500 to 5000 and contain less than 1% α-1,6 linkages. Recent studies have shown that amylose may contain about 0.1% α-1,6-glycosidic branching sites, hence it is described as "essentially linear". In this context, percentage (%) refers to the number of α-1,6-glycosidic bonds relative to the total number of glycosidic bonds, representing the sum of α-1,4-glycosidic bonds and α-1,6-glycosidic bonds. Granule-bound starch synthase (GBSS) is the main enzyme involved in amylose synthesis.

[0268] Amylopectin is a relatively highly branched glucan polymer in which α-1,4-linked glucosyl chains with 3-60 glucosyl units are linked by α-1,6 linkages such that approximately 4-6% of the total glucosyl bonds are α-1,6-bonds. Consequently, amylopectin is a much larger molecule with a DP ranging from 5,000 to 500,000 and is more highly branched than amylose. Amylose has a helical conformation with a molecular weight of about 10 ⁴ to about 10 ⁶ Dalton, whereas amylopectin has a molecular weight of about 10 ⁷ to about 10 ⁸ Dalton. These two types of starch can be easily distinguished or separated by methods well known in the art, for example, by size exclusion chromatography or by their different binding affinities for iodine. Amylose is broken down more slowly by α-amylases in the small intestine than amylopectin, and the latter has many sites for enzymatic hydrolysis due to its highly branched structure.

[0269] Wild-type Triticum aestivum grain starch typically contains 20%-30% amylose and about 70%-80% amylopectin as measured by iodometry, whereas grain starch according to the invention has an amylose content of from about 45% to about 70% in mass terms. The amylose content may be between 45% and 70%, in some embodiments between 45% and 65%, or about 50%, about 55%, about 60%, or about 65%. The higher the level, the more preferred the grain. The proportion of amylose in starch, as defined herein, is given on a weight/weight (w/w) basis, i.e., as the weight of amylose as a percentage of the weight of the total starch extracted from the grain, relative to the starch before fractionation amylose and amylopectin. The terms “starch amylose fraction” and “amylose content” as used herein in the context of a grain, flour or other product of the invention are essentially interchangeable terms. Amylose content can be determined by any methods known in the art, including size exclusion high performance liquid chromatography (HPLC), for example, in 90% (w/v) DMSO, methods using concanavalin A (Megazyme Int, Ireland), or, preferably by an iodometric method, such as described in Example 1. The HPLC method may or may not involve starch debranching (Batey and Curtin, 1996). It should be understood that methods such as the HPLC method of Batey and Curtin, 1996, in which only “true amylose” is analyzed, may result in an underestimation of amylose content as defined herein. Methods such as HPLC or gel permeation chromatography depend on the fractionation of starch into amylose and amylopectin fractions, whereas iodometric methods depend on differential binding of iodine and therefore do not require fractionation.

[0270] From grain weight and amylose content, the amount of amylose that is deposited per grain can be calculated and compared between test and control lines.

[0271] Starch can be easily isolated from wheat grain using standard methods, for example the method of Schulman and Kammiovirta, 1991. On an industrial scale, wet or dry grinding can be used. Starch granule size is important for industrial starch processing, which may involve separating larger A granules from smaller B granules.

[0272] Commercially grown wild-type wheat has a grain starch content that is typically in the range of 55-75%, depending somewhat on the variety grown. In comparison, the grain of the invention has a starch content of from about 25% to about 70%, thus, in most embodiments, the starch content is reduced compared to the corresponding wild type grain. In embodiments, the starch content of the grain according to the invention is from 25% to 65%, from 25% to 60%, from 25% to 55%, from 25% to 50%, from 30% to 70%, from 30% to 65 %, from 30% to 60%, from 30% to 55% or from 30% to 50%. In additional embodiments, the starch content is about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, or about 65% as a percentage of grain weight (w/w). The starch content of the grain according to the invention can also be determined in relative terms, i.e. relative to the starch content of the corresponding wild-type grain. In embodiments, the starch content is from about 50% to about 90%, or from 50% to 80%, from 50% to 75%, from 50% to 70%, from 60% to 90%, or from 60% to 80%, relative to content in wild type grain. The starch content may also be between 90% and 100% of the starch content of the wild type grain. In each case, comparisons should be made by growing plants under identical conditions, such as in field studies.

[0273] Flour, starch granules and bran according to the invention can be obtained from grains using a milling process, which is optionally followed by a sifting process. Refined starch can also be obtained from grains using a milling process, such as a wet milling process, followed by further separation of the starch from the protein, oil and fiber of the grain. As used herein, the term "ground product" refers to the product obtained by grinding grain, preferably wheat grain according to the invention, and includes flour (for example, whole grain flour), intermediate products (also known as wheat flour), bran (including germ) and starch granules. Intermediates are usually in the form of granular particles and include the bran and germ of the grain, and typically contain about 18% protein, 20-30% starch and about 5-6% lipids. This fraction, obtained during the milling process, is relatively rich in nutrients compared to premium flour. The shape of the grain is a trait that can influence the industrial suitability of the plant, since the shape can have an effect on the ease of grinding of the grain or some other influence. Milling is an important parameter for the industrial suitability of grain. The milling of the grain according to the invention may be reduced by at least 10% relative to the wild type grain, but alternatively may be the same as the wild type grain.

[0274] In another aspect, the invention provides starch granules or starch obtained from the grain or plant of the invention. Starch granules have an increased proportion of amylose and a reduced proportion of amylopectin compared to wild-type wheat starch granules. The feedstock of the milling process is a mixture or composition that contains starch granules, such as, for example, white flour or whole grain flour, and therefore the invention includes such granules. Starch granules from wild-type wheat contain starch granule-associated proteins, including GBSS, SSI, SBEIIa and SBEIIb, among other proteins, and therefore the presence of these proteins distinguishes wheat starch granules from other cereal starch granules. In contrast, the wheat grain starch granules of the invention contain wheat GBSS, including the GBSS polypeptides encoded by each of the hexaploid wheat genomes A, B, and D, but have reduced SSIIa polypeptide content, and indeed, in some embodiments, no SSIIa polypeptide. These starch granules may also contain reduced levels of one or more or all of the wheat SSI, SBEIIa and SBEIIb polypeptides, even if the wheat grain is wild type with respect to the genes encoding these enzymes. The starch granules from wheat grain according to the invention generally have a deformed shape and surface morphology when observed under a light microscope, see Example 7, in particular for wheat grain having an amylose content of at least 45% or at least 50 % as a percentage of the total starch content of the grain. In one embodiment, at least 50%, preferably at least 60%, or at least 70%, more preferably at least 80% of the starch granules obtained from the grains of the invention have a curved shape and/or surface morphology. Starch granules also show decreased birefringence when observed under polarized light. See, for example, Example 7 of this document regarding the determination of the level of birefringence. For example, less than 50% or less than 25% of starch granules exhibit the "Maltese cross" pattern observed when wild-type starch granules are observed under polarized light.

[0275] Starch from starch granules can be purified by removing proteins after breaking down and dispersing the starch granules by thermal and/or chemical treatment. The grain starch, starch granule starch, and purified starch of the invention may further be characterized by one or more or all of the following properties:

i) its amylose content is at least 45% (w/w), preferably from 45% to 70% (w/w), or at least 50% (w/w), or about 60% (w/w) ./wt.) amylose as a proportion of the total starch content;

ii) containing at least 2% resistant starch, preferably at least 3% resistant starch;

iii) starch has a reduced glycemic index (GI);

iv) starch granules are deformed;

v) starch granules have reduced birefringence when observed under polarized light;

vi) starch has reduced volume swelling;

vii) modified chain length distribution and/or branch frequency in starch;

viii) starch has a reduced peak gelatinization temperature;

ix) starch has a reduced peak viscosity;

x) the gelatinization temperature of starch is reduced;

xi) reduced peak molecular weight of amylose when determined by size exclusion chromatography;

xii) the degree of starch crystallization is reduced; And

xiii) the proportion of A-type and/or B-type starch is reduced and/or the proportion of V-type crystalline starch is increased;

each property being determined in comparison with starch granules or wild-type wheat starch.

[0276] The flour or starch of the invention can also be characterized by its volumetric swelling when exposed to heated excess water compared to wild-type flour or starch. Volume swelling is typically measured by mixing starch or flour with excess water and heating to elevated temperatures, typically over 90°C. Samples are then prepared by centrifugation, and volumetric swelling is expressed as the weight of deposited material divided by the dry weight of the sample. Low swelling characteristics are useful when it is necessary to increase the starch content of a food sample, in particular a moistened food sample. The flour or starch of the invention preferably has reduced volumetric swelling, eg reduced by 30-70% compared to wild type wheat flour or starch.

[0277] One indicator of changes in the structure of amylopectin is the chain length distribution or degree of polymerization of starch. Chain length distribution can be determined using fluorophore-assisted carbohydrate electrophoresis (FACE) followed by isoamylase debranching. Amylopectin from starch according to the invention may have a chain length distribution in the range from 5 to 60, or in a subrange, such as SP 7-11, that is greater than the corresponding chain length distribution for starch from wild-type plants, and/or be characterized by reduced frequency in other subbands, for example, SP 12-24. See example 7 in this document for example. Starch with longer chains is also characterized by a commensurate decrease in branching frequency. The grain starch of the invention is distinctly characterized from wheat grain starch having reduced SBEIIa activity (Regina et al., 2006), in which grain amylopectin contains an increased proportion of the fraction with chain lengths SP 4-12 compared to wild-type grain amylopectin as measured after debranching amylopectin isoamylase. This difference can be easily determined by the FACE method.

[0278] In another aspect of the invention, wheat starch may have an altered gelatinization temperature, preferably a reduced gelatinization temperature, which is readily measured by differential scanning calorimetry (DSC). Gelatinization is a thermally induced disruption (destruction) of molecular order in a starch granule in excess water with simultaneous and irreversible changes in properties such as volumetric swelling, melting of crystallites, loss of birefringence, appearance of viscosity and solubilization of starch. The gelatinization temperature can be either increased or decreased compared to starch from wild-type plants, depending on the chain lengths of the remaining amylopectin. High-amylose starch from amylose elongated (ae) maize mutants exhibited a higher gelatinization temperature than normal maize (Fuwa et al., 1999; Krueger et al., 1987).

[0279] The gelatinization temperature, in particular the first peak appearance temperature or the first peak apex temperature, can be reduced by at least 3°C, preferably by at least 5°C, or more preferably by at least 7°C as measured by DSC compared to starch extracted from similar but unaltered grains. Starch may contain elevated levels of resistant starch, where changes in structure are indicated by specific physical characteristics, including one or more of the group consisting of physical inaccessibility to digestive enzymes, which may cause changes in the morphology of starch granules, the presence of significant amounts of starch-associated lipids, changes in crystallinity and changes in chain length distribution for amylopectin. A high proportion of amylose also affects resistant starch levels when the starch is heated and then cooled.

[0280] The structure of the wheat starch of the present invention may also be characterized by a reduced degree of crystallinity and/or a modified type of crystallinity compared to starch isolated from wild-type wheat grain. Crystallinity is usually studied by X-ray crystallography. Reduced starch crystallinity is also thought to be associated with increased organoleptic properties and is responsible for a smoother mouthfeel.

[0281] The invention also provides wheat grain, flour, whole grain flour, starch granules and grain starch containing increased amounts of dietary fiber due to at least increased DO levels, but also due to increased levels of other dietary fiber components such as arabinoxylans, β - glucan and fructans. As used herein, the expressions “dietary fiber” (DF) or “total dietary fiber” (TDF) refer to the total amount of carbohydrate polymers in a food that are not broken down in the small intestine of a healthy person and have beneficial physiological effects in the large intestine. In the context of this document, DI is characterized by “total dietary fiber content” (below). PVs are not broken down or absorbed in the small intestine but pass into the large intestine where they can be degraded by bacteria. SPs include RA, non-α-glucan oligosaccharides, and non-starch polysaccharides (NSPs) such as arabinoxylans, β-glucan, and fructans. PF is usually divided into forms that are water soluble (soluble fiber) or insoluble (insoluble fiber), and RC. The most healthful fraction of dietary fiber in wild-type wheat grain is soluble fiber, which primarily contains the arabinoxylan (AA) component, since wild-type starch has very low AA content. In contrast, in oats and barley the soluble fibers are predominantly BG. The National Heart Foundation of Australia recommends a daily intake of 30-35g PI for cardiovascular and colon health. Many candidate genes have been identified in wheat that influence dietary fiber content (Quraishi et al., 2011), but none of them provide the level provided by the grain of the invention. PT can be determined using the AOAC 991.43 method (Megazyme).

[0282] As used herein, the term “prebiotic” means a non-digestible (by human digestive enzymes) food ingredient that beneficially affects a subject by selectively stimulating the growth and/or activity of one bacterium or a limited number of bacteria in the colon after passage of the small intestine. For example, fructans and BGs cannot be digested other than through bacterial activity, but can alter the composition of microorganisms in the human gut through specific fermentation, producing short-chain carboxylic acids including acetate, propionate and butyrate.

[0283] In embodiments, the wheat grain, flour, starch granules, and starch of the invention provide modified digestive properties, such as increased amounts of resistant starch. As used herein, “resistant starch” (RS) refers to starch and starch breakdown products that are not absorbed in the small intestine of healthy individuals, but end up in the large intestine. It is defined in terms of the percentage of total starch in the grain or the percentage of total starch in the food, depending on the context. Therefore, resistant starch eliminates foods that are broken down and absorbed in the small intestine. Therefore, DO is part of the dietary fiber content of the food ingredient (flour, etc.) or food product according to the invention. RK is divided into five categories: physically inaccessible starch (RKI), such as, for example, incompletely milled grains, resistant starch granules (RKII), such as those found in small quantities in potatoes and green bananas, retrograde starch (RKIII), which is formed by cooling gelatinized starch over a long period of time, chemically modified starch (PKIV), such as those formed by the esterification or esterification of free hydroxyl groups in glycosyl moieties, and starch capable of forming complexes between amylose or long branched chains of amylopectin and lipids ( PKV) (Birt et al., 2013). In particular, PKIII is formed from longer amylose chains, which tend to recrystallize and form retrograde starch after gelatinization. DO in starch-based products with high amylose content is mainly retrograde amylose (Hung et al., 2006). The increased amount of PK in grain starch, starch granules, starch and products thereof according to the invention is believed to be due to an increase in the content of PKII and PKV, as well as PKIII after retrogradation if the starch is heated and then cooled, compared to the corresponding wild type product. The starch-lipid association in determining V-complex crystallinity is also likely to influence resistant starch levels by increasing the PKV component by increasing the lipid content of the grain according to the invention. Some of the starch may also be in the PKI form, which is somewhat inaccessible to degradation.

[0284] Several methods are available to determine DO levels in food ingredients or foods, all of which rely on the initial removal of digestible starch using starch hydrolyzing enzymes (Dupuis et al., 2014). The Prosky method of DO (AOAC 985.29) uses gravimetric determination of dietary fiber after digestion by α-amylase, glucoamylase, and protease (Prosky et al., 1985). The McCleary method (AOAC 2009.01) is the official method of the AOAC and is commercially available (Megazyme International, Ireland). This is the preferred method for determining DO, see Example 1 of this document. In this assay, non-resistant starch is solubilized by treatment with pancreatic α-amylase, RA is reduced and dissolved in 2 M KOH, and then hydrolyzed to glucose with amyloglucosidase and determined.

[0285] In embodiments, the starch contains from 2% to 20%, from 2% to 18%, from 3% to 18%, from 3% to 15%, or from 5% to 15% resistant starch on a weight basis as a percentage of the total starch content. In embodiments, the DO content is increased by 2-10 times that of the corresponding food ingredient or food product made from an equivalent amount of wild-type wheat starch. In embodiments, the DO content is increased by about 3 times, about 4 times, about 5 times, about 6 times, about 7 times, about 8 times, or about 9 times compared to the wild type. The degree of increase in the amount of RA can be adjusted by mixing the products according to the invention with the corresponding wild type product. The change in starch structure and, in particular, the high levels of amylose in the starch according to the invention, provide an increase in the amount of DO when consumed as food. RA has beneficial physiological effects associated with metabolic products released during intestinal fermentation (Topping and Clifton, 2001), particularly the SCFAs butyrate, propionate and acetate, and is effective in reducing postprandial blood glucose levels.

[0286] The grains, food ingredients and food products derived from them according to the invention can be advantageously used to provide diets or to produce compositions rich in β-glucan, cellulose, fructan or arabinoxylan, based on the increased levels of these components in the grain according to the invention. The cell walls of cereal grains are complex and dynamic structures consisting of various polysaccharides, such as cellulose, xyloglucans, pectin (found in large quantities in galacturonic acid residues), callose (1,3-β-D-glucan), arabinoxylans (arabino -1,4-β-D-xylan, hereinafter referred to as AK) and BG, as well as polyphenols such as lignin. The cell walls of herbaceous and some other monocots are dominated by glucuronoarabinoxylans and BGs, and the levels of pectin polysaccharides, glucomannans and xyloglucans are relatively low (Carpita et al., 1993). These polysaccharides are synthesized by a wide variety of polysaccharide synthases and glycosyltransferases, with at least 70 gene families and, in many cases, multiple members of gene families represented in plants.

[0287] As used herein, the term "(1,3;1,4)-β-D-glucan", also referred to as "β-glucan" and abbreviated to "BG", refers to a substantially linear polymer of unsubstituted and essentially straight-chain β-glucopyranosyl monomers covalently linked primarily through 1,4-linkages, with some 1,3-linkages. Glucopyranosyl residues connected by 1,4- and 1,3-linkages are ordered in a non-repetitive but not random manner, i.e., 1,4- and 1,3-linkages are not randomly ordered, but neither are they ordered in the form regular, repeating sequences (Fincher, 2009a, 2009b). The majority (about 90%) of 1,3-linked residues follow 2 or 3 1,4-linked residues in wheat BG, as in oat and barley BG. Therefore, BG can be considered a chain consisting primarily of β-1,4-linked cellotriosyl (each with 3 glucopyranosyl residues) and cellotetrosyl (each with 4 glucopyranosyl residues) units linked together by β-1,3 single bonds, with approximately 10% longer β-1,4-linked cellodextrin units from about four to ten 1,4-linked glucopyranosyl residues, to about 28 glucopyranosyl residues (Fincher and Stone, 2004). Typically, BG polymers contain at least 1000 glycosyl residues and adopt an extended conformation in aqueous media. The ratio of tri- and tetrasaccharide units varies (SP3/SP4 ratio) among different species and is therefore a characteristic of the BG belonging to a particular species. BG from different cereals differ in solubility, with BG from oats being more soluble than BG from wheat. It is believed that this is due to the ratio between SP3 and SP4 in the BG polymer.

[0288] In wild-type wheat grain, BG levels are greater in the whole grain than in the endosperm (Henry, 1985). The BG content of wild-type whole wheat grain was 0.6% on a mass basis, compared with about 4.2% for barley, 3.9% for oats, and 2.5% for rye (Henry 1987). In wild-type wheat grain, the range was 0.4–1.4% by weight (Lazaridou et al., 2007). BG from wheat grain, as a rule, has a SP3/SP4 ratio of 3-4.5 (Lazaridou et al., 2007). Although barley GD has been associated with lower plasma cholesterol, a lower glycemic index, and a reduced risk of colon cancer, wheat GD has not been associated with similar effects, as wheat grain has much lower BG levels than barley. BG levels in grains are typically measured by grinding the grain into whole grain flour and testing for BG, such as the method described in Example 1.

[0289] In wild-type wheat grain, the level of fructan is only 0.6%-2.6% by weight of the grain. As used herein, the term "fructan" means polymers of fructose that contain fructosyl units polymerized with one terminal glucose unit. Fructans are synthesized from sucrose, which explains the presence of terminal glucose. The fructose components are linked to each other by β-1,2- and/or β-2,6-links, and glucose can be linked to the end of the chain by an α-1,2-linkage as in sucrose, resulting from repeated transfer of fructosyl from sucrose. Enzymes involved in fructan synthesis include sucrose-sucrose fructosyltransferase (EC 2.4.1.99), which forms ketose, and 1- or 6-fructan-fructan fructosyltransferase (EC 2.4.1.100). The degree of polymerization (DP) varies from 3 to several hundred, but, as a rule, is 3-60, and in the grain according to the invention it is mainly DP 3-10. Due to this composition, fructans are highly soluble in water and do not precipitate in 78% ethanol. The bonds between fructosyl residues are exclusively of the β-1,2 type, forming a linear molecule (inulin) in which the fructosyl residues are attached to the fructosyl residue of the initial sucrose, or of the β-2,6 type (levan), or in branched fructans both types are present (graminans). Graminans, which contain β-2,6-linked fructose units with β-1,2 branch points and are therefore more complex structures, may also be present in cereals, and can be mixed with levans. The level of fructan in the grains of the invention is typically measured by grinding the grains into whole grain flour and testing for fructan, for example the method described in Example 1, which is based on the method of Prosky and Hoebregs (1999). This method depends on the hydrolysis of fructans followed by determination of the released sugars.

[0290] Fructans are non-starch carbohydrates with potentially beneficial effects as a food ingredient on human health (Tungland and Meyer, 2002; Ritsema and Smeekens, 2003). The human digestive enzymes α-glucosidase, maltase, isomaltase and sucrase are unable to hydrolyze fructans due to the β-configuration of fructan bonds. In addition, the small intestine of humans and other mammals lacks the fructan exohydrolase enzymes that break down fructans and, therefore, dietary fructans are not broken down in the small intestine and reach the large intestine intact. However, the bacteria present there are able to ferment fructans and thus use them, for example, as a source of energy or carbon for growth and the production of short-chain fatty acids (SCFAs). Therefore, dietary fructans are able to stimulate the growth of beneficial bacteria such as bifidobacteria in the colon, which helps prevent intestinal diseases such as constipation and infection by pathogenic intestinal bacteria. Dietary fructans also enhance the absorption of dietary nutrients, particularly calcium and iron, possibly due to the production of SCFAs, which in turn reduces luminal pH and modifies the speciation and hence solubility of calcium compounds or has a direct effect on mucosal transport pathways, such thus improving bone mineralization and reducing the risk of iron deficiency anemia. In addition, a diet high in fructans may improve the health of patients with diabetes and reduce the risk of colon cancer by suppressing aberrant crypt lesions, which are precursors to colon cancer (Kaur and Gupta, 2002). Fructans also have a sweet taste and are increasingly used as low-calorie sweeteners and functional food ingredients.

[0291] Obtaining isolated fructans from grain according to the invention is expensive compared to existing methods for obtaining fructans, for example, involving the extraction of inulins from chicory. Large-scale extraction of fructans can be accomplished by grinding grains into whole grain flour and then extracting all the sugars, including fructans, from the flour into water. This can be done at ambient temperature and the mixture centrifuged or filtered. The supernatant is then heated to about 80°C and centrifuged to remove proteins and then dried. Alternatively, flour extraction can be carried out using 80% ethanol followed by a separation phase using a water/chloroform mixture, and the aqueous phase containing sugars and fructans is dried and re-dissolved in water. The sucrose in the extract obtained by either method can be removed enzymatically by adding α-glucosidase and then removing the hexoses (monosaccharides) by gel filtration to obtain fructan fractions of various sizes. This will result in an enriched fructan fraction containing at least 50%, preferably at least 60% or at least 70%, more preferably at least 80% fructans.

[0292] Development of small-scale analysis of fructans. The fructan content of cereal grains and derived foods is usually determined using high performance liquid chromatography (HPLC) (Huynh et al., 2008) or spectrophotometry (McCleary et al., 2000; McCleary et al., 2013; Steegmans et al. , 2004). The official spectrophotometric-based method AOAC 999.03 (AOAC, 2000b) was commercialized as the K-FRUCHK and K-FRUC kits by Megazyme International Limited (Bray, Ireland). These commercial kits are convenient and easy to use for determining fructan levels in cereal grains (Karppinen et al., 2003; Whelan et al., 2011). In the K-FRUCHK assay, sucrose and low degree of polymerization (DP) maltosaccharides are hydrolyzed to fructose and glucose. Their concentration is measured using a hexokinase/phosphorus-glucose isomerase/glucose-6-phosphate dehydrogenase (HK/PGI/G6PGH) system using a spectrophotometer. After hydrolysis of the fructans, the total fructose and glucose concentrations are remeasured and the fructan content is then determined from the difference between the two measurements. In the K-FRUC assay, sucrose, maltose, maltodextrins, and starch are hydrolyzed to fructose and glucose, which are further reduced with sodium borohydride to the corresponding sugar alcohols (sorbitol and mannitol). Fructose and glucose obtained from hydrolysis of fructans are combined with 4-hydroxybenzoic acid hydrazide (PAHBAH) to develop color in a boiling water bath, and their absorbance is read using a spectrophotometer to calculate the fructan content.

[0293] Recently, a simplified enzymatic hydrolysis followed by HPLC analysis was developed to investigate the fructan content of a double haploid (DH) wheat population (Huynh et al., 2008b). There is a need to accurately and quickly determine fructan content in large breeding populations with hundreds or thousands of lines. However, all current methods for fructan analysis used for cereal grains are relatively low-efficiency, allowing the analysis of about 10 samples per day by one worker, and require several grams of each flour sample. To develop a high-throughput method for fructan analysis, we downscaled the K-FRUCHK and K-FRUC assays to a plate format capable of this scale, as described in Example 1.

[0294] Arabinoxylan is another polysaccharide found in plant cell walls, including the cell walls of wheat grains. The levels of arabinoxylan in the grains and flours of the invention are increased relative to the corresponding wild-type grains or flours, for example by at least 1.5-fold or at least 2-fold on a weight basis. The level can be increased by 1.5-3 times. As used herein, "arabinoxylan" (AA) refers to a linear chain scaffold of β-D-xylopyranosyl residues linked via 1,4-glycosidic bonds to α-L-arabinofuranosyl residues attached to some of the xylopyranosyl residues at the O-2 positions , O-3 and/or O-2,3. Xylopyranosyl residues can be monosubstituted at O-2 or O-3, disubstituted at O-2,3, or unsubstituted. In addition to arabinose, the side branches may contain small amounts of xylopyranose, galactopyranose, α-D-glucuronic acid, or 4-O-methyl-α-D-glucuronic residues. In cereals, the Ara/Xyl (AA) ratio can vary from 0.3 to 1.1. AAs from the outer pericarp, scutum, and embryonic axis are relatively highly arabinose-substituted, whereas AAs from the aleurone and hyaline layers are less substituted. AA may additionally contain hydrocinnamic acids, ferulic acid and p-coumaric acid esterified with O-5 arabinose units linked to O-3 xylose units (Smith and Hartley, 1983). Biosynthesis of the 1,4-β-D-xylan scaffold is catalyzed by 1,4-β-xylosyltransferase, which uses UDP-D-xylose as a substrate and transfers a xylose unit to the non-reducing end of the xyloo-oligosaccharide chain.

[0295] AA synthesis in cereals involves xylosyltransferases that use UDP-Xyl as a substrate and may involve complex tetrasaccharides as primers (Carpita et al., 2011). Arabinoxylans are slightly soluble in water and require alkaline solvents for their effective extraction. For example, barium hydroxide can selectively extract AA (Gruppen et al., 1992). In contrast, sodium hydroxide extracts both BG and AA. The level of AA in grain is typically measured by grinding the grain into whole grain flour and testing for AA, such as the method described in Example 1.

[0296] Studies of AA in corn, rye, and wheat have demonstrated beneficial effects on caecal fermentation, SCFA production, reduction in serum cholesterol, and improvement in calcium and magnesium absorption (Hopkins et al. 2003).

[0297] As used herein, cellulose refers to a crystalline complex of about 24-36 chains of (1-4)-β-D-glucan that form microfibrils found primarily in plant cell walls. It is one of the most common polymers in nature. Glucan chains are formed by cellulose synthases of the CesA gene family in the plasma membrane (Giddings et al., 1980), and then 24-36 chains are assembled into a functional microfibril. Arabidopsis has 10 CesA genes, at least 3 of which are coexpressed during primary cell wall formation and three others during secondary cell wall formation (Carpita et al., 2011), with each adding glycosyl residues to a non-reducing end of acceptor glucan chains to extend polymers. The CesA genes are related to the Csl genes of both monocots and dicots, which are involved in the synthesis of other polysaccharides. For example, the enzymes CslF and CslH, found only in herbaceous plants, including cereals, are involved in the synthesis of BG.

[0298] Food products made from grains, food ingredients, starch granules and starch have a reduced glycemic index. GI is a simple marker of the effect of a carbohydrate-rich meal on postprandial glucose levels in a person's blood. As used herein, “glycemic index” or “GI” means the measurement of the area under the blood glucose concentration curve after consuming a serving of a test food containing 50 g of carbohydrates, divided by the additional area obtained by the presence of the same amount of carbohydrates in an equivalent amount of glucose or white bread. Therefore, GI refers to the level of digestion of starchy food and absorption of digestive products, and is a comparison of the effect of the food being tested with the effect of white bread or glucose on variations in blood glucose concentration. Therefore, GI is a measure of the effect of a food on postprandial serum glucose concentrations and is related to the insulin requirement for blood glucose homeostasis. One of the important characteristics provided by the food products of the invention is a reduced GI compared to corresponding food products prepared from the same amount of wild-type wheat, flour, starch granules or starch as a food ingredient. In addition, the food products of the invention may have a reduced level of final degradation and are therefore relatively low in calories compared to corresponding food products made from the same amount of wild-type wheat as a food ingredient. The low-calorie product may be based on the inclusion of flour obtained from ground wheat grains. Such foods may provide satiety effects, improve gut health, reduce postprandial serum glucose and lipid concentrations, and provide a low-calorie food product.

[0299] The GI of a starch of the invention, or a food ingredient or food product of the invention, is readily determined using an in vitro assay as described in Example 9 herein. In vitro, it simulates the breakdown of starch in foods that occurs after eating in healthy people, and is predictive of GI measured in people after eating such foods.

[0300] A method of treating a subject, particularly a human, may include the subject consuming a grain, flour, starch, or a food or drink product of modified wheat as defined herein in one or more doses, amounts and for a period of time during which improvement occurs one or more indicators of gut health or metabolism. This value may vary compared to consumption of the corresponding unchanged wheat starch, or wheat or wheat product thereof, over a period of up to 24 hours, as is the case for some indicators such as pH, increased SCFA levels, postprandial glucose fluctuations, or this may take several days, as in the case of increased fecal volume or improved intestinal motility, or perhaps even longer, on the order of weeks or months, as in the case of measuring butyrate-enhanced proliferation of normal colonocytes. There may be a need to take modified starch or wheat or a wheat product throughout life. However, there is a good chance that the treated individual will comply with such a regimen, given the relative ease of administration of the modified starch.

[0301] Dosages may vary depending on the pathological condition being treated or prevented, but for humans it is contemplated to be at least 10 g of wheat grain or starch of the invention per day, more preferably at least 15 g per day, preferably at at least 20 or at least 30 g per day. Intakes greater than about 100 grams per day may require significant intake and reduce compliance. Most preferably, the dosage for humans is from 10 to 100 g of wheat grain according to the invention, or flour, whole grain flour or modified starch according to the invention per day, or, for adults, from 20 to 100 g per day.

[0302] Indicators of improved gut health may include, but are not necessarily limited to:

i) decrease in pH of intestinal contents,

ii) increasing the total SCFA concentration or the total amount of SCFA in the intestinal contents,

iii) increasing the concentration or amount of one or more SCFAs in the intestinal contents,

iv) increased volume of faeces;

v) increase in total water volume in the intestines or feces without diarrhea,

vi) improvement of intestinal motility,

vii) increasing the number or activity of one or more species of probiotic bacteria,

viii) increased excretion of bile acids in feces,

ix) reduction of levels of putrefactive products in urine,

x) reduction of levels of putrefactive products in feces,

xi) increased proliferation of normal colonocytes,

xii) reducing inflammation in the intestines of individuals with inflamed intestines or a tendency to inflamed intestines,

xiii) reduction in the levels of any component of urine, creatinine and phosphate in the feces or colon in patients with uremia and

xiv) any combination of the above.

[0303] Indicators of improved metabolic health may include, but are not necessarily limited to:

i) stabilization of fluctuations in glucose levels after meals,

ii) improvement (decrease) in glycemic response,

iii) decrease in plasma insulin concentration before meals,

iv) improvement of blood lipid profile,

v)reduction of plasma LDL cholesterol,

vi) decrease in plasma levels of one or more components of urine, creatinine and phosphate in patients with uremia,

vii) improvement of dysglycemic response or

viii) any combination of the above.

[0304] The pH of the intestinal contents may be reduced by at least 0.1 unit, preferably by at least 0.15 or 0.2 unit. Each of the other indicators of gut health or metabolic health can be improved by at least 10%, preferably by at least 20%.

[0305] It should be understood that one of the advantages of the present invention is that it provides products such as bread that have exceptional nutritional value, and further, this occurs without the need for modification of starch or other components of the wheat grain after harvest . However, there may be a need to carry out such modifications in the starch or other grain component, and the invention includes such a modified component. Modification methods are well known and include extraction of starch or other component by traditional methods and modification of starch to increase the amount of the resistant form. Starch can be modified by heat and/or moisture treatment, physical (e.g. ball milling), enzymatic (using e.g. α- or β-amylase, pullulanase, etc.), chemical hydrolysis (wet or dry, using liquid or gaseous reagents), oxidation, cross-linking with difunctional reagents (eg, sodium trimetaphosphate, phosphorus oxychloride) or carboxymethylation.

[0306] Although the invention may be exclusively useful in the treatment or prevention of humans, it should be understood that the invention is also applicable to non-human subjects, including, but not limited to, farm animals such as cows, sheep, pigs, and the like. , pets such as dogs or cats, laboratory animals such as rabbits or rodents such as mice, rats, hamsters, or animals that can be used for sporting purposes such as horses. In particular, the method may be applicable to non-ruminant mammals or animals such as monogastric mammals. The invention may also be applicable to other farm animals, such as poultry, including, for example, chickens, geese, ducks, turkeys or quails, or fish.

[0307] The terms “polypeptide” and “protein” are generally used interchangeably herein. As used herein, the terms “proteins” and “polypeptides” also include variants, mutants, modifications and/or derivatives of the polypeptides of the invention described herein. As used herein, the expression “substantially purified polypeptide” refers to a polypeptide that has been separated from the lipids, nucleic acids, other peptides and other molecules to which it is associated in its native state. Preferably, the substantially purified polypeptide is at least 60% free, more preferably at least 75% free, and more preferably at least 90% free from other components with which it is naturally associated. By "recombinant polypeptide" is meant a polypeptide created by recombinant technology, ie, by expressing a recombinant polynucleotide in a cell, preferably a plant cell, and most preferably a wheat cell. In one embodiment, the polypeptide has starch synthase enzyme activity, particularly SSIIa activity, and is at least 98% identical to the SSIIa polypeptide described herein.

[0308] The % identity of a polypeptide relative to a reference polypeptide can be determined using any program known in the art for aligning amino acid sequences, such as the GAP program (Needleman and Wunsch, 1970, GCG program), with a gap opening penalty of 5. and a penalty for extending the gap = 0.3. This analysis allows the alignment of two sequences along the entire length of the amino acid sequence of the reference sequence. For example, if the reference sequence is the amino acid sequence shown as SEQ ID NO:1, the alignment is along the full length of SEQ ID NO:1. A gap in an aligned sequence is considered to be a “non-identity” position for each missing amino acid.

[0309] For a particular polypeptide, it should be understood that a % identity value greater than those given above will include preferred embodiments. Thus, where appropriate, in light of the minimum % identity, it is preferred that the polypeptide contains an amino acid sequence that is at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably by at least 96%, more preferably by at least 97%, more preferably by at least 98%, more preferably by at least 99%, more preferably by at least 99.1%, more preferably by at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6 %, more preferably at least 99.7%, more preferably at least 99.8%, and even more preferably at least 99.9% identical to the relevant specified SEQ ID NO.

[0310] Deletions or insertions in an amino acid sequence generally range from about 1 to 15 residues, more preferably from about 1 to 10 residues, and typically from about 1 to 5 contiguous residues. However, they can be more than 15 amino acids, up to the full length of the polypeptide. The polypeptide sequence may be a truncated sequence relative to the corresponding wild-type sequence or reference SEQ ID NO. For example, if the protein-coding region encoding a polypeptide has a premature translation termination codon (stop codon), the resulting polypeptide will be truncated upon translation. The extent of truncation depends on the position of the stop codon, shortening the polypeptide by at least 5%, preferably at least 10%, relative to the wild type sequence.

[0311] The protein coding region of a gene according to the invention can be disrupted by introducing a splice site mutation, which results in mis-splicing and can result in an alteration of the RNA transcript out of the open reading frame. The amino acid sequence of the polypeptide may then be identical to the wild type up to or below the point of missplicing, and then differ from the wild type. In general, the activity of such polypeptides is affected in the same way as in the case of a truncated polypeptide. Examples of stop codons and splice site mutations in the SSIIa gene are described in Example 11 herein.

[0312] Substitution mutants have at least one amino acid residue deleted with a different residue inserted in its place. Regions of greatest interest for replacement mutagenesis to reduce the activity of a polypeptide include those identified as active sites. Other regions of interest are those in which specific residues derived from different strains or species are identical, i.e., conserved amino acids. These positions are likely important for biological activity. These amino acids, especially those falling within a contiguous sequence of at least three other identically conserved amino acids, are preferably substituted in a relatively conservative manner that retains function, such as SSIIa enzymatic activity, or in a non-conservative manner that reduces activity. Conservative substitutions are listed in Table 3 under the heading “typical substitutions.” “Non-conservative amino acid substitutions” as defined herein are substitutions other than those listed in Table 3 (typical conservative substitutions). Non-conservative substitutions in the SSIIa polypeptide are expected to reduce enzyme activity and many will correspond to SSIIa, encoded by a “partial loss of function mutant SSIIa gene.”

Table 2. Subclassification of amino acids

Subclasses Amino acids Sour Aspartic acid, glutamic acid Basic Non-cyclic: Arginine, lysine; Cyclic: Histidine Charged Aspartic acid, glutamic acid, arginine, lysine, histidine Small Glycine, serine, alanine, threonine, proline Polar/neutral Asparagine, histidine, glutamine, cysteine, serine, threonine Polar/large Asparagine, glutamine Hydrophobic Tyrosine, valine, isoleucine, leucine, methionine, phenylalanine, tryptophan Aromatic Tryptophan, tyrosine, phenylalanine Residues that affect
on the orientation of the chains Glycine and proline

Table 3. Typical and preferred conservative amino acid substitutions

Original balance Typical conservative
replacements Preferred Conservative Substitutions Ala Val, Leu, Ile Val Arg Lys, Gln, Asn Lys Asn Gln, His, Lys, Arg Gln Asp Glu Glu Cys Ser Ser Gln Asn, His, Lys, Asn Glu Asp, Lys Asp Gly Pro Pro His Asn, Gln, Lys, Arg Arg Ile Leu, Val, Met, Ala, Phe Leu Leu Ile, Val, Met, Ala, Phe Ile Lys Arg, Gln, Asn Arg Met Leu, Ile, Phe Leu Phe Leu, Val, Ile, Ala Leu Pro Gly Gly Ser Thr Thr Thr Ser Ser Trp Tyr Tyr Tyr Trp, Phe, Thr, Ser Phe Val Ile, Leu, Met, Phe, Ala Leu

[0313] In some embodiments, the present invention includes modification of gene activity, particularly SSIIa gene activity, combinations of mutant genes, and the construction and use of chimeric genes. As used herein, the term “gene” includes any deoxyribonucleotide sequence that contains a protein coding region or that is transcribed but not translated in a cell, together with its associated noncoding and regulatory regions. The term "gene" also includes mutant forms of the wild type gene, and the mutant genes may not be transcribed and/or translated, for example, as in the case of deletion of the promoter region. The associated noncoding and regulatory regions are typically located adjacent to the protein coding region at both the 5' and 3' ends, a distance of about 2 kb. from each side. In this regard, the gene contains control signals, such as promoters, enhancers, transcription termination and/or polyadenylation signals, which are naturally associated with the gene, or heterologous control signals, in which case the gene is called a “chimeric gene”. Sequences that are located on the 5' strand of the protein coding region and that are present in the mRNA are called 5' untranslated sequences (5' UTRs). Sequences that are located on the strand 3' or downstream of the protein coding region and that are present in the mRNA are called 3' untranslated sequences (3' UTRs). The term "gene" includes both cDNA and genomic forms of the gene. “cDNA” is a DNA copy of an RNA transcript of a gene and is described herein as “corresponding to a gene.” For example, the cDNA nucleotide sequence shown as SEQ ID NO:4 corresponds to the SSIIa-A gene, whose wild type sequence is shown as SEQ ID NO:7. The term “gene” includes synthetic or fusion molecules encoding the proteins of the invention described herein. The genes are typically present in the wheat genome as double-stranded DNA. The chimeric gene can be introduced into an appropriate vector for extrachromosomal location in the cell or for integration into the host genome. In this document, genes or genotypes are shown in italics (eg SSIIa ), whereas proteins, enzymes or phenotypes are not shown in italics (SSIIa).

[0314] As used herein, the term “genotype” refers to the genetic makeup of a wheat cell, tissue, plant, plant part, or plant product. The genetic makeup may be identical to the wheat plant from which the product was derived. As used herein, the term "phenotype" refers to an observable characteristic or set of multiple characteristics of a cell, tissue, plant, plant part, or plant product that results from the interaction between the genotype of the plant and the environment in which the plant was grown.

[0315] The genomic form or clone of a gene containing the coding region may be interrupted by non-coding sequences called "introns" or "intervening regions" or "intervening sequences". As used herein, an “intron” is a segment of a gene that is transcribed as part of the primary RNA transcript but is not present in the mature mRNA molecule. Introns are removed or "cut" from the nucleus or primary transcript; therefore, introns are absent from messenger RNA (mRNA). Introns may contain regulatory elements such as enhancers. As used herein, "exons" refer to regions of DNA corresponding to RNA sequences that are present in a mature mRNA or mature RNA molecule in cases where the RNA molecule is not translated. mRNA functions during translation to determine the sequence or order of amino acids in the encoded polypeptide.

[0316] The present invention relates to various polynucleotides. As used herein, "polynucleotide" or "nucleic acid" or "nucleic acid molecule" means a polymer of nucleotides, which may be DNA or RNA and includes, for example, cDNA, mRNA, tRNA, siRNA, shRNA, shRNA and one - or double-stranded DNA. It may be DNA or RNA of cellular, genomic or synthetic origin. Preferably, the polynucleotide is exclusively DNA or exclusively RNA and is located in a cell. The polymer may be single-chain, predominantly double-chain or partially double-chain. An example of a partially double-stranded RNA molecule is hairpin RNA (shRNA), short hairpin RNA (shRNA), or self-complementary RNA, which contains a double-stranded "stem" formed by base pairing between a nucleotide sequence and its complementary sequence, and a loop sequence that covalently connects the nucleotide sequence and its complementary sequence. As used herein, base pairing refers to standard base pairing between nucleotides, including G:U base pairing in an RNA molecule. “Complementary” means that two polynucleotides are capable of base pairing along part of their length or along the entire length of one or both (full complementarity).

[0317] By “isolated” is meant a material that is essentially or substantially free of the components that would normally accompany it in its native state. As used herein, “isolated polynucleotide” or “isolated nucleic acid molecule” means a polynucleotide that is at least partially separated from, preferably substantially or substantially free from, polynucleotide sequences of the same type with which it is associated or linked in its native state. For example, an “isolated polynucleotide” includes a polynucleotide that has been purified or separated from the sequences that flank it in its natural state, i.e., a DNA fragment that has been removed from the sequences that normally flank the fragment. Preferably, the isolated polynucleotide is also at least 90% free from other components such as proteins, carbohydrates, lipids, etc. As used herein, the term "recombinant polynucleotide" refers to a polynucleotide formed in vitro by shaping a nucleic acid into a form which is not usually found in nature. For example, the recombinant polynucleotide may be in the form of an expression vector. In general, such expression vectors contain a transcriptional and translational regulatory nucleic acid operably linked to a nucleotide sequence to be transcribed in the cell.

[0318] The present invention relates to the use of oligonucleotides that can be used as "probes" or "primers". As used herein, "oligonucleotides" are polynucleotides up to 50 nucleotides in length, preferably 15-50 nucleotides in length. They may be RNA, DNA, or combinations or derivatives thereof. Oligonucleotides are typically relatively short single-stranded molecules of 10-30 nucleotides, typically 15-25 nucleotides in length, typically consisting of 10-30 or 15-25 nucleotides that are identical or complementary to part of the SSIIa gene or cDNA corresponding to the gene SSIIa . When using a probe or primer in an amplification reaction, the minimum size of such an oligonucleotide is the size necessary to form a stable hybrid between the oligonucleotide and a complementary sequence in the target nucleic acid molecule. Polynucleotides used as probes are typically conjugated to a detectable label, such as a radioisotope, enzyme, biotin, fluorescent molecule, or chemiluminescent molecule. The oligonucleotides and probes of the invention are useful in methods for detecting an SSIIa allele or other gene associated with a trait of interest, such as modified starch. Such methods use nucleic acid hybridization and in many cases involve extension of an oligonucleotide primer with a suitable polymerase, such as in PCR, to detect or identify wild-type or mutant alleles. Preferred oligonucleotides and probes hybridize to the SSIIa gene sequence from wheat or other cereals, including any sequence described herein, for example, SEQ ID NO: 15-49. Preferred oligonucleotide pairs are those that span one or more introns, or part of an intron, and therefore can be used to amplify the intron sequence in a PCR reaction. The examples in this document provide numerous examples.

[0319] The terms “polynucleotide variant,” “variant,” and the like refer to polynucleotides that exhibit substantial sequence identity to a reference polynucleotide sequence and are capable of functioning in a similar manner or with the same activity as the reference sequence. These terms also include polynucleotides that differ from the reference polynucleotide by the addition, deletion or substitution of at least one nucleotide or that contain one or more mutations compared to naturally occurring molecules. Accordingly, the terms “polynucleotide variant” and “variant” include polynucleotides in which one or more nucleotides have been added or deleted, or replaced by other nucleotides. In this regard, it is well known in the art that certain changes, including mutations, additions, deletions and substitutions, can be made to a reference polynucleotide, wherein the altered polynucleotide retains the biological function or activity of the reference polynucleotide. Accordingly, these terms include polynucleotides that encode polypeptides exhibiting enzymatic or regulatory activity, or polynucleotides capable of serving as selective probes or other hybridizing agents. The terms "polynucleotide variant" and "variant" also include naturally occurring allelic variants. Mutants can be either naturally occurring (that is, isolated from a natural source) or synthetic (for example, obtained by performing site-directed mutagenesis in a nucleic acid). Preferably, the polynucleotide variant of the invention that encodes a polypeptide with enzymatic activity has a length that is at least 90% of the wild type, up to the full length of the gene.

[0320] A variant of the oligonucleotide of the invention includes molecules of various sizes that are capable of hybridizing, for example, with the wheat genome at a position close to the specific oligonucleotide molecules defined herein. For example, variants may contain additional nucleotides (eg, 1, 2, 3, 4 or more) or fewer nucleotides, provided they hybridize to the target region. In addition, multiple nucleotides can be substituted without affecting the ability of the oligonucleotide to hybridize to the target region. In addition, variants that hybridize close to (eg, without limitation, within 50 nucleotides) the region of the plant genome to which specific oligonucleotides defined herein hybridize can be easily generated.

[0321] By “corresponding” or “corresponding” in the context of polynucleotides or polypeptides is meant a polynucleotide (a) having a nucleotide sequence that is substantially identical to or complementary to at least a portion, preferably all (fully complementary) of a reference polynucleotide sequence, or ( b) encoding an amino acid sequence identical to the amino acid sequence in the polypeptide. Also included within the scope of this expression is a polypeptide having an amino acid sequence that is substantially identical to the amino acid sequence of the reference polypeptide. Terms used to describe the relationship between two or more polynucleotides or polypeptides include "reference sequence", "sequence identity", "percent sequence identity", "substantial identity" and "identical" and are defined with respect to a certain minimum number of nucleotides or amino acids. residues or, preferably, relative to the entire length. The terms “sequence identity” and “identity” are used interchangeably herein and refer to the extent to which sequences are identical based on nucleotide-to-nucleotide or amino acid-to-amino acid comparisons in a comparison window. Thus, "percentage sequence identity" is calculated by comparing two optimally aligned sequences in a comparison window, determining the number of positions at which there are identical nucleic acid bases (e.g., A, T, C, G, U) or identical amino acid residues in both sequences , to obtain the number of matching positions by dividing the number of matching positions by the total number of positions in the comparison window (i.e., window size) and multiplying the result by 100 to obtain the percent sequence identity.

[0322] The % identity of a polynucleotide relative to a reference polynucleotide can be determined using any program known in the art for this purpose, such as, for example, the GAP program (Needleman and Wunsch, 1970, GCG program), with a gap opening penalty = 5, and a penalty for extending the gap = 0.3. Reference may also be made to the BLAST family of programs, such as those described by Altschul et al., 1997. A detailed discussion of sequence analysis can be found in Section 19.3 of Ausubel et al ., 1994-1998, Chapter 15. Unless otherwise noted, alignments are performed along the full length reference sequence.

[0323] Nucleotide or amino acid sequences are considered to be “substantially similar” if such sequences have sequence identity of at least 98%, particularly at least about 98.5%, particularly about 99%, especially about 99 .5%, especially about 99.8%, including cases of sequence identity. It is understood that RNA sequences are described in essentially the same way or have a certain degree of sequence identity with DNA sequences, with thymine (T) in the DNA sequence considered equivalent to uracil (U) in the RNA sequence.

[0324] For certain polynucleotides, it should be understood that a higher % identity value will include preferred embodiments. Thus, where appropriate, in light of the minimum % identity, it is preferred that the polynucleotide contains a polynucleotide sequence that is at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably by at least 96%, more preferably by at least 97%, more preferably by at least 98%, more preferably by at least 99%, more preferably by at least 99.1%, more preferably by at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6 %, more preferably at least 99.7%, more preferably at least 99.8%, and even more preferably at least 99.9% identical to the relevant specified SEQ ID NO.

[0325] In some embodiments, the present invention relates to the stringency of hybridization conditions to determine the degree of complementarity of two polynucleotides. In the context of this document, “stringency” refers to the conditions of temperature and ionic strength, as well as the presence or absence of certain organic solvents during hybridization. The higher the stringency, the greater will be the degree of complementarity between the target nucleotide sequence and the labeled polynucleotide sequence. “Stringent conditions” refer to temperature and ionic conditions under which only nucleotide sequences that have a high frequency of complementary bases will hybridize. As used herein, the term “hybridizes under low stringency, medium stringency, high stringency, or very high stringency conditions” describes the hybridization and washing conditions. Guidance for performing hybridization reactions can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6, incorporated herein by reference. The specific hybridization conditions used herein are as follows: 1) low stringency hybridization conditions in 6X sodium chloride/sodium citrate (SSC) solution at about 45°C, followed by two washes in 0.2X SSC, 0.1 % SDS at 50-55°C; 2) medium stringency hybridization conditions in 6X SSC at about 45°C, followed by one or more washes in 0.2X SSC, 0.1% SDS at 60°C; 3) high stringency hybridization conditions in 6X SSC at about 45°C, followed by one or more washes in 0.2X SSC, 0.1% SDS at 65°C; and 4) very high stringency hybridization conditions included 0.5 M sodium phosphate, 7% SDS at 65°C, followed by one or more washes in 0.2 X SSC, 1% SDS at 65°C.

[0326] As used herein, a "chimeric gene" or "genetic construct" refers to any gene that is not a native gene at its native location, i.e., has been artificially manipulated, including a chimeric gene or genetic construct integrated into the wheat genome . Typically, a chimeric gene or genetic construct contains regulatory and transcribed or protein-coding sequences that do not occur together in nature. Accordingly, a chimeric gene or genetic construct may contain regulatory sequences and coding sequences obtained from different sources, or regulatory sequences and coding sequences obtained from the same source but arranged in a manner that does not occur in nature. The term “endogenous” is used herein to mean a substance that is typically produced in an unmodified plant at the same stage of development as the plant being tested, preferably a wheat plant, such as starch or the SSIIa gene of the SSIIa polypeptide. "Endogenous gene" refers to a native gene at its natural location in the genome of an organism, preferably the SSIIa gene in a wheat plant. The terms "foreign polynucleotide" or "exogenous polynucleotide" or "heterologous polynucleotide" etc. refer to any nucleic acid that is introduced into the genome of a cell by experimental procedures, preferably the wheat genome, but which does not naturally occur in the cell . They include modified forms of gene sequences found in that cell, provided that the introduced gene contains some modification, such as an introduced mutation or the presence of a selectable marker gene, compared to the naturally occurring gene. Foreign or exogenous genes can be naturally occurring genes that are introduced into a non-native organism, native genes that are introduced into a new location in a native host organism, or chimeric genes or genetic constructs. The term "genetically modified" includes the introduction of genes into cells, the mutation of genes in cells, and the artificial change or modulation of gene regulation in a cell by modification of the genome, or the organisms to which these actions were applied, or their progeny, or parts, such as grain.

[0327] The present invention relates to elements that are operably connected or connected. The expressions "operably linked" or "operably linked" and the like refer to the linking of polynucleotide elements into a functional relationship. Typically, operably linked nucleic acid sequences are linked contiguously and, if necessary, connecting two protein coding regions, contiguously and in frame. A coding sequence is "operably linked" to another coding sequence if RNA polymerase transcribes the two coding sequences into a single RNA, which, when translated, is translated into a single polypeptide containing amino acids derived from both coding sequences. The coding sequences do not need to be contiguous with respect to each other, provided that the expressed sequences are ultimately processed to produce the desired protein.

[0328] As used herein, the term " cis -acting sequence", " cis -acting element" or " cis -regulatory region", or "regulatory region", or similar terms should be understood to mean any nucleotide sequence that regulates the expression of a genetic sequences. This may be a naturally occurring cis-acting sequence in its native environment, such as that regulating the wheat SSIIa gene, or a sequence in a genetic construct that, when appropriately positioned relative to the expressed genetic sequence, regulates its expression. Such a cis-regulatory sequence may be capable of activating, silencing, enhancing, repressing, or otherwise altering the level of expression and/or cell type specificity and/or stage specificity of the gene sequence at the transcriptional and posttranscriptional level. For example, the presence of an intron in the 5' leader sequence (UTS) of genes has been shown to enhance gene expression in monocots such as wheat (Tanaka et al., 1990). Another type of cis-acting sequence is the matrix attachment region (MAR), which can influence gene expression by attaching active chromatin domains to the nuclear matrix.

[0329] By “vector” is meant a nucleic acid molecule, preferably a DNA molecule derived from a plasmid or plant virus, into which a nucleic acid sequence can be inserted. The vector may also contain a selectable marker, such as an antibiotic resistance gene, which can be used to select suitable bacterial or plant transformants or sequences that enhance transformation of prokaryotic or eukaryotic (especially wheat) cells, such as T-DNA or P-DNA sequences . Examples of such resistance genes and sequences are well known to those skilled in the art.

[0330] By “marker gene” is meant a gene that confers a distinct phenotype on cells expressing the marker gene and thus allows such transformed cells to be distinguished from cells that do not contain the marker, as is well known in the art. A "selectable marker gene" provides a trait for which "selection" can be made based on resistance to a selective agent (eg, herbicide, antibiotic, radiation, temperature, or other treatment that damages untransformed cells) or based on growth-related benefits in the presence of a metabolizable substrate. Exemplary selectable marker genes for selecting plant transformants include, but are not limited to, the hyg gene, which confers resistance to hygromycin B; neomycin phosphotransferase ( npt ) gene conferring resistance to kanamycin, etc., for example, described by Potrykus et al., 1985; a glutathione S-transferase gene from rat liver conferring resistance to glutathione herbicides, for example described in EP-A-256223; a glutamine synthetase gene conferring, when overexpressed, resistance to glutamine synthetase inhibitors such as phosphinothricin, for example described in WO87/05327, an acetyltransferase gene from Streptomyces viridochromogenes conferring resistance to the selective agent phosphinothricin, for example described in EP-A-275957, a gene , encoding 5-enolshikimate-3-phosphate synthase (EPSPS), conferring resistance to N-phosphonomethylglycine, for example, described by Hinchee et al., 1988, the bar gene, conferring resistance to bialaphos, for example, described in WO91/02071; or a nitrilase gene such as bxn from Klebsiella ozaenae , which confers resistance to bromoxynil (Stalker et al., 1988). Preferred markers to be screened include, but are not limited to, the uidA gene encoding the β-glucuronidase (GUS) enzyme for which various chromogenic substrates are known, the β-galactosidase gene encoding the enzyme for which chromogenic substrates are known, the aequorin gene (Prasher et al ., 1985), which can be used in calcium-sensitive bioluminescent detection; green fluorescent protein gene (GFP, Niedz et al., 1995) or one of its variants; the luciferase gene ( luc ) (Ow et al., 1986), which allows bioluminescent detection, and other genes known in the art.

[0331] In some embodiments, the level of enzyme activity is modulated by decreasing the expression level of genes encoding the enzyme in the wheat plant or increasing the expression level of the nucleotide sequence that encodes the enzyme in the wheat plant. Increased expression can be accomplished at the transcriptional level, using promoters of varying strengths or inducible promoters that are capable of regulating the level of transcript expressed from the coding sequence. Heterologous sequences that encode transcription factors that modulate or enhance the expression of genes whose products down-regulate starch synthesis, such as SSIIa, can be introduced. The level of gene expression can be modulated by changing the copy number per cell of a construct comprising a coding sequence and a transcriptional regulatory element operably linked thereto, which is functional in the cell. Alternatively, multiple transformants can be selected and screened for those that have the appropriate level and/or specificity of transgene expression based on the influence of endogenous sequences near the site of transgene integration. A suitable level and profile of transgene expression is one that results in a significant increase in amylose content in the wheat plant. This can be easily revealed by examining transformants.

[0332] Reduction of gene expression can also be accomplished by introducing and transcribing a “chimeric gene for gene silencing” introduced into a wheat plant. The chimeric gene for gene silencing is preferably introduced in a stable manner into the wheat genome, preferably the wheat nuclear genome, so that it is stably inherited by the progeny. As used herein, “gene silencing effect” refers to the reduction of expression of a target nucleic acid in a wheat cell, preferably an endosperm cell, during seed development during plant growth, which can be accomplished by introducing silencing RNA. In a preferred embodiment, a chimeric gene is introduced for gene silencing that encodes an RNA molecule that reduces the expression of one or more endogenous genes, for example, genes other than SSIIa genes, or preferably three endogenous SSIIa genes. Such reduction may result from decreased transcription, including reduction due to methylation of promoter regions through chromatin remodeling or posttranscriptional modification of RNA molecules, including RNA degradation, or both. Gene silencing should not necessarily be interpreted as the cessation of expression of a target nucleic acid or gene. It is sufficient that the level of expression of the target nucleic acid in the presence of the silencing RNA is lower than in its absence. The expression level of the target gene may be reduced by at least about 40%, or at least about 45%, or at least about 50%, or at least about 55%, or at least about 60% , or at least about 65%, or at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least by about 90%, or at least by about 95%, or effectively reduced to an undetectable level.

[0333] Antisense technologies can be used to reduce gene expression in wheat cells. The term "antisense RNA" should be understood to mean an RNA molecule that is complementary to at least a portion of a particular mRNA molecule and is capable of reducing the expression of a gene encoding the mRNA, preferably the SSIIa gene. Such reductions are generally sequence dependent and are thought to be due to interference with post-transcriptional events such as transport of mRNA from the nucleus to the cytoplasm, mRNA stability, or inhibition of translation. The use of antisense methods is well known in the art (see, for example, Hartmann and Endres, 1999).

[0334] As used herein, “artificially introduced dsRNA molecule” refers to the introduction of a double-stranded RNA (dsRNA) molecule that is preferably synthesized in a wheat cell by transcription from a chimeric gene encoding such a dsRNA molecule. RNA interference (RNAi) is exceptionally suited to specifically reducing gene expression or inhibiting the production of a specific protein, also in wheat (see, for example, Regina et al ., 2006). This technology is based on the presence of dsRNA molecules that contain a sequence that is essentially identical to the mRNA of the gene or part thereof of interest and its complementary sequence, thereby forming dsRNA. dsRNA is conveniently produced from a single promoter in a host cell when the sense and antisense sequences are transcribed to produce hairpin RNA, in which the sense and antisense sequences hybridize to form a dsRNA region with a related (to the SSIIa gene) or unrelated sequence, forming a loop structure such that the hairpin RNA contains a stem-loop structure. The design and preparation of dsRNA molecules suitable for the present invention is within the competence of one skilled in the art, in particular taking into account the work of Waterhouse et al ., 1998; Smith et al., 2000; WO 99/32619; WO 99/53050; WO 99/49029; and WO 01/34815.

[0335] DNA encoding dsRNA typically contains both sense and antisense sequences arranged in an inverted repeat pattern. In a preferred embodiment, the sense and antisense sequences are separated by a spacer region, which may or may not contain an intron that is excised when transcribed into RNA. This ordering has been shown to result in higher efficiency of gene silencing (Smith et al ., 2000). The double-stranded region may contain one or two RNA molecules transcribed from one or two regions of DNA. dsRNA can be classified as a long shRNA, having long sense and antisense regions that can be highly complementary, but need not be completely complementary (typically more than about 200 bp, e.g. 200 to 1000 bp) . shRNA can also be quite small, with a double-stranded portion ranging in size from about 30 to about 42 bp, but not much longer than 94 bp. (see WO04/073390). The presence of the double-stranded RNA region is believed to initiate a response from the plant's endogenous system that degrades both the double-stranded RNA and the homologous RNA transcript from the target plant gene(s), effectively reducing or eliminating the activity of the target gene.

[0336] The length of each of the sense and antisense sequences that hybridize must be at least 19 or at least 21 contiguous nucleotides, preferably at least 30 or 50 nucleotides, and more preferably at least 100, 200, 500 or 1000 nucleotides. The full-length sequence corresponding to the entire gene transcript can be used. The length is most preferably 100-2000 nucleotides. The degree of identity of the sense and antisense sequences to the target transcript should be at least 85%, preferably at least 90%, and more preferably 95-100%. The longer the sequence, the less stringent the requirements regarding overall sequence identity. Of course, an RNA molecule may contain unrelated sequences whose function may be to stabilize the molecule. The promoter used to express the dsRNA-forming construct can be any type of promoter that is expressed in cells expressing the target gene, preferably a promoter that is preferentially expressed in the endosperm of the developing wheat grain compared to non-grain tissues of the wheat plant. If the target gene is SSIIa or another gene selectively expressed in the endosperm, an endosperm-specific promoter that is not expressed in leaf or stem tissues is preferred so as not to influence the expression of the target gene(s) in other tissues.

[0337] As used herein, “silencing RNAs” are RNA molecules that contain 21-24 contiguous nucleotides complementary to a region of the mRNA transcribed from the target gene, preferably SSIIa . The 21-24 nucleotide sequence is preferably completely complementary to the 21-24 contiguous nucleotide sequence of the mRNA, i.e., identical to the complementary 21-24 nucleotide sequence of the mRNA region. It is also possible to use siRNA sequences that contain up to five mismatches in the mRNA region (Palatnik et al., 2003), and the base pairing can include one or two GU base pairs. When not all of the 21-24 nucleotides of the silencing RNA are capable of base pairing with the mRNA, it is preferred that only one or two mismatches be present between the 21-24 nucleotides of the silencing RNA and the region of the mRNA. For siRNAs, it is preferred that any mismatches, up to a maximum of five, be towards the 3' end of the siRNA. In a preferred embodiment, there are no more than one or two mismatches between the sequences of the silencing RNA and the target mRNA.

[0338] The silencing RNAs are derived from longer RNA molecules that are encoded by the chimeric DNAs of the invention. The longer RNA molecules, also referred to herein as “precursor RNAs,” are the initial products produced by transcription from chimeric DNAs in wheat cells and have a partially double-stranded structure resulting from intramolecular base pairing between complementary regions. Precursor RNAs are processed by a special class of RNases, commonly called “dicers,” into silencing RNAs, typically 21–24 nucleotides in length. As used herein, silencing RNAs include short interfering RNAs (siRNAs) and microRNAs (miRNAs), which differ in their biosynthesis. siRNAs are derived from fully or partially double-stranded RNAs containing at least 21 contiguous base pairs, including possible G-U base pairs, with no mismatches or unpaired nucleotides protruding from the double-stranded region. Double-stranded RNAs are formed either from a single self-complementary transcript that is formed by folding to form a stem-loop structure, referred to herein as “hairpin RNA,” or from two separate RNAs that are at least partially complementary and hybridize to form a double-stranded RNA region . miRNAs are produced by processing longer single-stranded transcripts that contain complementary regions that are not fully complementary and thus form an incomplete base-pairing structure containing mismatches or unpaired nucleotides within the partially double-stranded structure. The base-paired structure may also contain G-U base pairs. Processing of precursor RNAs to form miRNAs results in the preferential accumulation of one or more distinct small RNAs, each with a specific sequence, or miRNAs. They are derived from a single strand of precursor RNA, typically the "antisense" precursor RNA strand, whereas processing long complementary precursor RNAs to form siRNAs produces a population of siRNAs that are heterogeneous in sequence but correspond to different parts from both precursor strands.

[0339] The miRNA precursor RNAs of the invention, also referred to herein as “artificial miRNA precursors,” are typically derived from naturally occurring miRNA precursors by altering the nucleotide sequence of the miRNA portion of the naturally occurring precursor so that it is complementary, preferably fully complementary, a 21-24 nucleotide region of the target mRNA, and changing the nucleotide sequence of the complementary region of the precursor miRNA, which is capable of base pairing with the miRNA sequence to maintain base pairing. The remainder of the miRNA precursor RNA may remain unchanged and thus have the same sequence as the naturally occurring precursor miRNA, or it may also be altered in sequence by nucleotide substitutions, nucleotide insertions, or preferably nucleotide deletions, or any their combinations. The remainder of the miRNA precursor RNA is believed to be involved in structure recognition by a Dicer enzyme called Dicer-like enzyme 1 (DCL1), and therefore it is preferable that as few changes as possible be made to the remainder of the structure. For example, paired nucleotides can be replaced by other paired nucleotides without significantly changing the overall structure. The naturally occurring precursor siRNA from which the precursor siRNA of the invention is derived may be derived from wheat, another plant such as another cereal plant, or from non-plant sources. Examples of such RNA precursors are the rice precursor mi395, the Arabidopsis precursor mi159b, or the mi172 precursor. The use of artificial siRNAs has been demonstrated in plants, for example, Alvarez et al., 2006; Parizotto et al., 2004; Schwab et al., 2006.

[0340] Another molecular biological approach that can be used to downregulate endogenous gene expression is cosuppression. The mechanism of cosuppression is not fully understood, but it is thought to involve posttranscriptional gene silencing (PTGS) and may therefore be very similar to many examples of antisense suppression. It involves introducing an extra copy of a gene or fragment thereof into a plant in a "sense orientation" relative to the promoter for its expression, which in the context of this document is called an orientation that matches the transcription and translation (if any) of the sequence relative to the sequence in the target gene. The size of the sense fragment, its correspondence to regions of the target gene, and the degree of homology to the target gene are the same as for the antisense sequences described above. In some cases, an extra copy of a gene sequence interferes with the expression of a plant's target gene. For methods of applying cosuppression approaches, reference may be made to the patent specification WO 97/20936 and the specification of European patent 0465572.

[0341] Any of these technologies for reducing gene expression can be used to coordinately reduce the activity of multiple genes. For example, a single RNA molecule can be targeted against a family of related genes by targeting a region of genes that is shared. Alternatively, targeting unrelated genes can be achieved by including multiple regions within a single RNA molecule, each targeting different genes. This is easily accomplished by merging multiple regions under the control of a single promoter.

[0342] As is well known to those skilled in the art, a large number of different techniques are available for introducing nucleic acid molecules into wheat cells. As used herein, the term “transformation” means a change in the genotype of a cell, such as a bacterial cell or a plant cell, in particular a wheat plant, by introducing a foreign or exogenous nucleic acid. By “transformant” we mean an organism that has been changed in this way. The introduction of DNA into a wheat plant by crossing parental plants or by mutagenesis per se is not included in the concept of transformation. The nucleic acid molecule can be replicated as an extrachromosomal element or, preferably, it is stably integrated into the plant genome. By "genome" we mean the complete heritable genetic makeup of a cell, plant, or plant part, including chromosomal DNA, plastid DNA, mitochondrial DNA, and extrachromosomal DNA molecules. In one embodiment, the transgene is integrated into the nuclear genome of wheat, which in the case of hexaploid wheat includes subgenomes A, B, and D, referred to herein as the “genomes” A, B, and D.

[0343] The most common methods for producing fertile transgenic wheat plants involve two steps: delivery of DNA into regenerative wheat cells and regeneration of the plant by in vitro tissue culture. Two methods are commonly used to deliver DNA: T-DNA transfer by Agrobacterium tumefaciens or related bacteria and direct introduction of DNA by particle bombardment, although other methods have been used to integrate DNA sequences into wheat or other cereals. One skilled in the art will appreciate that the particular choice of transformation system for introducing the nucleic acid construct into plant cells is not critical or limiting to the invention as long as it provides an acceptable level of nucleic acid transfer. Such technologies for wheat are well known in the art.

[0344] Transformed wheat plants can be produced by introducing a nucleic acid construct in accordance with the invention into a recipient cell and growing a new plant that contains and expresses a polynucleotide in accordance with the invention. The process of growing a new plant from a transformed cell in cell culture is referred to herein as “regeneration.” Regenerative wheat cells include cells from mature embryos, meristematic tissue such as mesophyll cells of the leaf base, or preferably cells from the scutellum of immature embryos obtained 12-20 days after anthesis, or callus derived from any of these components. The most common route for recovery of regenerated wheat plants is somatic embryogenesis using a medium such as MS agar supplemented with an auxin such as 2,4-D and low levels of cytokinin (see Sparks and Jones, 2004).

[0345] Agrobacterium -mediated transformation of wheat can be carried out by the methods of Cheng et al., 1997; Weir et al., 2001; Kanna and Daggard, 2003 or Wu et al., 2003. Any Agrobacterium strain with sufficient virulence can be used, preferably strains having additional virulence gene functions such as LBA4404, AGL0 or AGL1 (Lazo et al., 1991), or C58 versions . Bacteria related to Agrobacterium can also be used. The DNA that is transferred (T-DNA) from Agrobacterium to recipient wheat cells is contained in a genetic construct (chimeric plasmid) that contains one or two wild-type Ti-plasmid T-DNA border regions flanking the nucleic acid to be transferred. The genetic construct may contain two or more T-DNAs, for example, where one T-DNA contains the gene of interest and the second T-DNA contains the selectable marker gene, allowing independent insertion of the two T-DNAs and possible segregation of the selectable marker gene from the transgene of interest . The T-DNA vector is preferably a "super-binary" plasmid, as is known in the art.

[0346] Any type of wheat capable of regeneration can be used; Successful results have been reported for the Bob White, Fielder, Veery-5, Cadenza and Florida varieties. The transformation phenomena in one of these more regenerative varieties can be transferred to any other wheat varieties, including elite varieties, through standard backcrossing. Other methods involving the use of Agrobacterium include: co-cultivation of Agrobacterium with cultured isolated protoplasts; transformation of Agrobacterium seeds, tips or meristems , or in planta inoculation such as the Arabidopsis flower dipping method described by Bechtold et al ., 1993.

[0347] Another method commonly used to introduce a nucleic acid construct into a plant cell is high-velocity biolistic fine particle penetration (also known as particle bombardment or microparticle bombardment), where the nucleic acid to be introduced is contained either in a matrix of small granules or particles, or on their surfaces, for example, as described by Klein et al., 1987.

[0348] Preferred selectable marker genes for use in wheat transformation include the Streptomyces hygroscopicus bar gene or pat gene in combination with selection using the herbicide glufosinate ammonium, the hpt gene in combination with the antibiotic hygromycin, or the nptII gene with kanamycin or G418. Alternatively, positive selection markers such as the manA gene, which encodes phosphomannose isomerase (PMI) with the sugar mannose 6-phosphate as the sole source of C, can be used.

[0349] The present invention is further described using the following non-limiting examples.

Example 1. Materials and methods

[0350] Plant materials. Three wheat varieties, each containing one null mutation in the SSIIa gene in genomes A, B or D, were kindly provided by Dr M Yamamori, National Institute of Agrobiological Resources, Tsukuba, Japan ). These were Chousen 57 (C57), containing a null mutation in SSIIa-A and therefore not containing the SSIIa-A polypeptide (SGP-A1), Kanto 79 (K79), containing a null mutation in SSIIa-B and therefore not containing SSIIa-B polypeptide (SGP-B1), and Turkey 116 (T116), which contains a null mutation in SSIIa-D and therefore does not contain the SGP-D1 polypeptide (Yamamori et al., 2000).

[0351] Chinese Spring (CS) nullisomal/tetrasomic lines for the homologous group of seven chromosomes, designated N7AT7D, N7BT7D and N7DT7B (Sears and Miller, 1985), were kindly provided by Dr E. Lagudah (CSIRO Agriculture , Canberra, Australia).

[0352] Wheat plants, including C57, K79, T116, three Australian wheat varieties Sunco, EGA Hume and Westonia, were grown at CSIRO Agriculture, Canberra, in a greenhouse with natural light and temperatures of 18°C (night) and 24°C (day). ). Mature grain from each line was harvested and air dried to approximately 9% moisture content. Unless otherwise specified, 5 g of dried grain per line was ground on a Udy Cyclone (Fort Collins, CO, USA) with a 0.5 mm sieve to produce whole grain flour or on a Brabender Quadrumat Junior mill (Brabender® GmbH & Co . KG, Duisburg, Germany) to obtain premium flour.

[0353] For the analysis of proteins and starch in developing grain and mature grain described in Example 12, mutant wheat plants and wild-type wheat plants ( ssIIa and SSIIa , respectively) were obtained from the double haploid population described by Konik-Rose et al. (2007). Twenty to forty developing endosperms were collected at 15 days post-flowering (DAF) in tubes with dry ice and stored at -80°C for analysis of RNA, soluble proteins, and starch granule-bound proteins as described in Example 12. For analysis of proteins and properties of starch in grain, ripened grain of plants grown in a greenhouse or in the field was collected.

[0354] DNA analysis of wheat plants. To detect the presence or absence of mutant ssIIa alleles or wild-type SSIIa alleles, young plant leaves were collected by PCR of genomic DNA samples and genomic DNA was isolated using a Fast DNA Kit (BIO101 system, Q-BIOgene). For marker-assisted crossing, primer pairs JKSS2AP1F (5'-TGCGTTTACCCACAGAGCA CA-3' (SEQ ID NO:15), located between nucleotides 91 and 113 of the nucleotide sequence with accession number AB201445) and JKSS2AP2R (5'-TGCCAAAGGTCCGGAATCATGG-3' ( SEQ ID NO:16), located between nucleotides 1225 and 1246 AB201445) for the SSIIa gene of genome A (Fig. 2); primers JKSS2BP7F (5'-GCGGACCAGGTTGTCGTC-3' (SEQ ID NO:17), located between nucleotides 5978 and 5995 of the nucleotide sequence with accession number AB201446) and JLTSS2BPR1 (5'CTGGCTCACGATCCAGGGCATC-3' (SEQ ID NO:18), located between nucleotides 6313 and 6335 AB201446) for the SSIIa gene of genome B (Fig. 3); and primers JTSS2D3F (5'-GTACCAAGGTATGGGGACTATGAA-3' (SEQ ID NO:19), located between nucleotides 2369 and 2392 of the nucleotide sequence with accession number AB201447) and JTSS2D4R (5'-GTTGGAGAGATACCTCAACAGC-3' (SEQ ID NO:20), located between nucleotides 2774 and 2796 AB201447) for the SSIIa gene of the wheat D genome (Fig. 4).

[0355] PCR reactions included the use of 50 ng genomic DNA, 1.5 mM MgCl ₂ , 0.125 mM each dNTP, 10 pmol primers, 0.5 M glycine betaine, 1 μl dimethyl sulfoxide (DMSO) and 1.5-3.5 U Hot-star Taq polymerase (QIAGEN) in a reaction volume of 20 μl. Amplification reactions were performed using HYBAID PCR Express (Integrated Sciences) with one cycle at 95°C for 5 min, 35 cycles of melting at 94°C for 45 s, and a hybridization temperature of 52°C (genome A) or 60°C ( for genome B and D) for 30 s, and extension at 72°C for 2 min 30 s, then 1 cycle at 72°C for 10 min, followed by cooling to 25°C. The resulting PCR fragments were separated on a 1% or 2% agarose gel and visualized (UVitec) after staining with ethidium. Other standard amplification reactions used 59°C as the hybridization temperature but otherwise used the same PCR conditions unless otherwise noted.

[0356] Southern blot hybridization analysis was performed on DNA from a larger scale (9 ml) freeze-dried minced tissue extract (Stacey and Isaac, 1994). DNA samples were adjusted to 0.2 mg/ml and digested with restriction enzymes such as BamHI and EcoRI . Restriction enzyme digestion, gel electrophoresis and vacuum blotting were performed as described by Stacey and Isaac, (1994). ³² P-labeled probes were prepared from cDNA and used in hybridization with Southern blot analyses. Hybridizing sequences were detected by autoradiography according to the method of Jolly et al. (1996).

[0357] RNA extraction and quantitative real-time PCR (qRT-PCR). Total RNA from the endosperm at 15 SP was isolated using the NucleoSpin ^® RNA Plant Kit (Macherey-Nagel) and quantified using Nanodrop 1000 (Thermo Science). 0.5 μg of RNA templates were used to synthesize cDNA in 50 μl reaction mixtures at 50°C using SuperScript III reverse transcriptase (Invitrogen). The cDNA template (100 ng) was used in a 10 μl qRT-PCR reaction mixture with a hybridization temperature of 58°C using RT-PCR primers (Table 4). As a quantitative control, a pair of primers was used that amplified a region located in the exon at the 3' end of the tubulin gene. Amplification reactions were performed in a Rotor-Gene 6000 (Corbett) using the Rotor-Gene™ SYBR ^® Green PCR Kit (QIAGEN). Comparative quantification was analyzed using tubulin gene fragment amplification as a reference amplification using real-time rotary analyzer software (Corbett). For each sample, qRT-PCR reactions were performed in triplicate.

Table 4. qRT-PCR primers used to determine RNA expression

cereal plant Name Oligonucleotide sequence SEQ ID NO Link Barley ZLBSSI-1RTR3 AAGGTCTCCACCGTGTCTCGAAG 21 This research ZLBSSI-1RTF3 GACGTACAGTTTGTCATGCTTGG 22 This research ZLBSSIIaF CTGCTGGACAGGATATGGAAGTG 23 This research ZLBSSIIaR GTATCACCATAACGGAGCGACTG 24 This research ARHv2aF1 CAATCACTGATGGTGTAACCAAAGG 25 Regina et al., 2010 ARHv2aR3 CCTTCATGTTGGTCAATAGCAGC 26 Regina et al., 2010 ARHv2bF1 CAGAATGGACAAAGAATCATCCACG 27 Regina et al., 2010 ARHv2bR1 GAAAATACATCCATGCCTCCATCG 28 Regina et al., 2010 Wheat SSIFw AGGGTACAGGGTGGGCGTTCT 29 Sestili et al., 2010 SSIR GTAGGGTTGGTCCACGAAGG thirty Sestili et al., 2010 SSIIFw TTCGACCCCTTCAACCACTC 31 Sestili et al., 2010 SSIIR ACGTCCTCGTAGAGCTTGGC 32 Sestili et al., 2010 SBEIIaFw TGACGAATCTTGGAAAATGG 33 Sestili et al., 2010 SBEIIaR GGCGGCATTTATTCATAACTATTG 34 Sestili et al., 2010 SBEIIbFw GTAGATGCGGTCGTTTTACTTGA 35 Sestili et al., 2010 SBEIIbR CCAGCCACCTTCTGTTTGTT 36 Sestili et al., 2010 Rice JLRSSI-RTF GGGCCTTCATGGATCAACC 37 Ohdan et al., 2005 JLRSSI-RTR CCGCTTCAAGCATCCTCATC 38 Ohdan et al., 2005 JLRSSIIa-RTF CTGGACAGGATCTGGAAGTGAAA 39 This research JLRSSIIa-RTR GGAACCTCAACAGCAGCCTTAC 40 This research JLRSBEIIa-RTF GCCAATGCCAGGAAGATGA 41 Ohdan et al., 2005 JLRSBEIIa-RTR GCGCAACATAGGATGGGTTT 42 Ohdan et al., 2005 sbe2b-f TACGAATTCTCCAGCGGAATGAGAACACCA 43 Nishi et al., 2001 sbe2b-r TACGGTACCCAAGATGTACAGAAGTGCAGA 44 Nishi et al., 2001 α-tublin-f GGAAATACATGGCTTGCTGCTT 45 Toyota et al., 2006 α-tublin-r TCTCTTCGTCTTGATGGTTGCA 46 Toyota et al., 2006 Are common JLRHvTaTub-RTF CAGGCTTGTATCCCAGGTCA 47 This research JLRHvTaTub-RTR GCGTAGGAGGAAAGCATGAA 48 This research

[0358] Isolation of soluble and starch granule-bound proteins from developing endosperm. Developing endosperms from developing seeds, collected through 15 SPTs, were homogenized and suspended in pre-chilled protein extraction buffer at a ratio of 1.5 μl/mg (0.25 M K ₂ HPO ₄ , pH 7.5, 0.05 M EDTA, 20% glycerol, Sigma protease inhibitor cocktail and 0.5 M DTT). The homogenate was centrifuged at 16,000 g for 15 min at 4°C. The supernatant containing soluble proteins was used to estimate protein concentration using Coomassie Plus Protein Assay Reagent (Bio-Rad). If necessary, samples were stored at -20°C until analysis. The precipitate obtained from the soluble protein preparations was directly treated with proteinase K after washing with water, and then the starch was purified as follows. Starch granule-bound proteins were prepared from purified starch according to Rahman et al., (1995) with minor modifications. Starch granules were boiled for 5-10 min in denaturing protein extraction buffer (50 mM Tris buffer, pH 6.8, 10% glycerol, 5% SDS, 5% β-mercaptoethanol and bromophenol blue) at a ratio of 15 μl/mg starch. After centrifugation at 13,000 g for 20 min, the supernatant was used for SDS-PAGE analysis.

[0359] Isolation of starch and extraction of starch granule-associated proteins from mature grains. Whole grains (100-150 mg) from each plant were ground in a centrifugal ball mill at a speed of 30 rpm for 30 s using a WIG-L-BUG Mixer MSD (USA). Whole grains were first treated with 12.5 mM NaOH, filtered through 0.5 mm nylon sieves, washed three times with water, and then incubated with 0.5 mg proteinase K in 1 ml 50 mM phosphate buffer at 37°C for 2 h. The starch sediment obtained by centrifugation at 5000 g was suspended and washed with water 3 times, centrifuging after each wash. After washing with acetone, the remaining starch was air dried at 37°C overnight. The preparation of starch granule-associated proteins from mature grain starch was the same as described previously for starch from developing endosperm.

[0360] SDS-PAGE and staining of gels. To quantify the protein content of starch, equal amounts of starch (4 mg) were used to extract the proteins associated with starch granules. For each sample, the same volume of supernatant containing total protein was loaded onto 4-12% Bis-Tris NuPAGE Novex gels (Life technologies). This allowed the detection of variations in protein binding profiles in the same amount of starch. For soluble proteins, samples containing 20 μg of total protein were used. Experiments and SDS-PAGE detection of gels were performed as previously described (Butardo et al. 2012).

[0361] Immunoblotting. Antiserum variants against GBSSI, SSI, SSIIa, SBEIIa, and SBEIIb from previous studies are listed and numbered in Table 5, including their antigen sources and specificities. Western blotting and detection were performed as previously described (Butardo et al. 2012) using the same protein standards as above.

Table 5. Polyclonal antibodies used to detect cereal starch synthase proteins.

Antibody Breeding Antigen source Specificity Link Anti-GBSSI 1:3000 wheat barley, wheat, rice Li et al., 1999 Anti-SSI 1:4000 wheat barley, wheat, rice Rahman et al., 1995 Anti-SSIIa 1:500 rice barley, wheat, rice Kosar-Hashemi et al., 2007 Anti-SBEI 1:2000 wheat barley, wheat, rice Butardo et al., 2012 Anti-SBEIIa 1:2000 wheat, rice barley, wheat, rice Regina et al., 2005 Anti-SBEIIb 1:3000 wheat, rice barley, wheat, rice Regina et al., 2005

[0362] Quantification of protein bands in SDS-PAGE gels and immunoblots. To quantify and compare protein abundance between different genotypes, two protein bands (80 kDa and 60 kDa) in 5 μl MagicMark™ XP protein kits (Invitrogen) were used as a reference. After visualization of protein bands, SDS-PAGE gels and immunoblots (Epson Perfection 2450 PHOTO; Epson America Inc., CA, USA) were scanned to generate graphic files for band intensity analysis using the Quantity One software package and following recommended methods (Bio-Rad ). The 80 kDa band was used for quantification of SBEIIa, SBEIIb and SSIIa, and the 60 kDa band for SSI and GBSSI.

[0363] Mass spectrometry. In-gel proteolytic digestion can be performed on selected protein bands from Coomassie Blue-stained SDS-PAGE gels. Tandem MS using ion traps can be performed as described by Butardo et al. (2012). Proteins can be identified by correlating continuous MS data with data in SwissProt/TREMBL via the global ProteinLynx server (Version 1, Micromass) (Colgrave et al. 2013).

[0364] Mass of grains. Grain was collected from mature plants when the plants were completely yellow. The ears were harvested and stored at 37°C for at least two weeks to ensure complete drying, then stored at room temperature if further storage was required, and then threshed to produce mature grain. This grain or the whole grain flour obtained from it was analyzed in relation to the parameters described in this document, which depend on the weight of the grain, as well as the weight of the grain itself. The weight of grains for each wheat line was determined by the total weight of 100 grains. Grain moisture content was measured using an MPA FT-NIR spectrometer (BRUKER); for mature grain it was usually about 9% by weight. Parameters that depend on grain weight, such as starch content, BG content, fructan content, etc., described in this document were calculated based on dry weight, taking the moisture content as 9% (w/w) if it has not been measured using NIR.

[0365] Analysis of lipids in wheat grain. Total lipids from approximately 300 mg of whole grain flour samples were extracted with chloroform/methanol/0.1 M KCl (2:1:1, v/v/v). Fatty acid methyl esters (FAMEs) were prepared by incubating lipid samples in 1 N methanol HCl (Supelco, Bellefonte, PA) at 80°C for 2 h. TAG and polar membrane lipid pools were fractionated from total lipids by thin layer chromatography (TLC) ) (silica gel 60, Merck, Germany) using a solvent mixture of hexane:diethyl ether:acetic acid (70:30:1, v/v/v), and individual classes of membrane lipids were separated using a solvent mixture of chloroform/methanol /acetic acid/water (90/15/10/3, v/v/v/v). Current lipid standards were loaded and assayed in separate lanes on the same plates to identify lipid classes. Silica bands containing a distinct class of lipids were used to prepare FAMEs as described above and analyzed by gas chromatography GC-FID 7890A (Agilent Technologies, Palo Alto, CA, USA) using a BPX70 30 m column ( SGE, Austin, TX, USA) to quantify individual fatty acids based on the peak area of a known amount of heptadecanoin, which was added as an internal standard.

[0366] Starch extraction. Unless otherwise stated, starch was extracted from grain samples by first grinding the grain (10 g) to whole grain flour using a Cyclone mill (Cyclote 1093, Tecator, Sweden). Starch was isolated from whole grain flour by protease extraction (Morrison et al., 1984) and washed with water using 10 ml water per gram of whole grain flour at room temperature to remove residues. The starch was then lyophilized and weighed for analysis. Starch is also isolated on a small scale from developing wheat grains using the method of Regina et al., (2006).

[0367] Starch content. Total grain starch content was assessed by the 76.13 AACC method using a total starch assay (K-TSTA) kit provided by Megazyme (Bray, Co, Wicklow, Republic of Ireland) and calculated on a mass basis as a percentage of the weight of the mature unmilled grain. Subtracting the starch weight from the total grain weight to obtain the non-starch grain content allows one to determine whether the decrease in total weight was due to a decrease in starch content.

[0368] Amylose content. Unless otherwise stated, amylose content of starch samples was determined in triplicate by the iodometric (iodine binding) method according to Morrison and Laignelet (1983) with the following minor modifications. Approximately 2 mg of starch was accurately weighed (to within 0.1 mg) into 2 ml screw cap tubes having a rubber gasket in the cap area. To remove lipids, mix 1 ml of 85% (v/v) methanol with starch and heat the tube in a water bath at 65°C for 1 hour with occasional stirring. After centrifugation at 13,000 g for 5 min, the supernatant was carefully removed and the extraction step was repeated. The starch was then dried at 65°C for 1 hour and dissolved in a solution of urea and dimethyl sulfoxide (MDMSO; 9 volumes of dimethyl sulfoxide to 1 volume of 6 M urea), using 1 ml of MDMSO per 2 mg of starch. The mixture was immediately vigorously vortexed and incubated in a water bath at 95°C for 1 hour with occasional stirring to completely dissolve the starch. An aliquot of the starch-MDMSO solution (50 μl) was treated with 20 μl of I2-KI reagent, which contained 2 mg iodine and 20 mg potassium iodide per ml water. The mixture was made up to 1 ml with water. The absorbance of the mixture at 620 nm was measured by transferring 200 μL into a microplate and reading the absorbance using an Emax Precision microplate reader (Molecular Devices, USA). Standards containing 0 to 100% amylose and 100% to 0% amylopectin were prepared from potato amylose (Sigma, Cat. No. A-0512) and potato amylopectin (Sigma, Cat. No. A-8515) and processed as samples under study. Amylose content (percent amylose) was determined from absorbance values using a regression equation derived from absorbance data for standard samples.

[0369] Where indicated, the amylose content of the starch samples was also determined by debranching the starch samples and subsequent measurement by size exclusion chromatography (SEC) as previously described (Butardo et al. 2012; Castro et al. 2005). This method separated the short chains resulting from debranching of amylopectin from the longer amylose chains and determined their relative amount. Pullulan standards (Shodex P-82) calibrated using the Mark-Houwink-Sakurada equation were used to estimate molecular weight from elution time. Samples were prepared and analyzed in triplicate.

[0370] It is also possible to analyze the amylose/amylopectin ratio of non-branched starches according to Case et al., (1998) or by HPLC using 90% DMSO to separate branched starches as described in Batey and Curtin, (1996).

[0371] Resistant starch (RS) content. Grain DO content was determined in triplicate using a DO assay kit (K-RSTARCH) provided by Megazyme (Bray, Co, Wicklow, Republic of Ireland) and calculated on a mass basis as a percentage of starch content. Instead of the 100 mg sample offered in the PK assay kit, a reduced amount of whole wheat flour (40 mg) was used for each assay in this work in 15 ml capped tubes (cat. no. 188271, Greiner bio-one) using pro rata number of solutions and buffers from the kit. Standard samples containing 0 to 20 mg/mL glucose were prepared from glucose (K-RSTARCH kit) and processed as the test samples. The content of DO in mass ratio and the content of non-resistant starch for the studied samples were determined from the absorption values using a regression equation obtained from the absorption data for standard samples. The RA content was then calculated as the weight of RA as a percentage of the weight of the total starch content.

[0372] DO levels in food samples such as bread can also be measured in vitro, as described, for example, in WO2012/058730. This method describes sample preparation and in vitro digestion of starch in commonly consumed foods. This method consists of two parts: firstly, starch in food is hydrolyzed under artificially created physiological conditions; secondly, by-products are removed by washing, and the determination of DO is carried out after homogenization and drying of the sample. Starch, quantified at the end of digestion, represents the DO content of the food.

[0373] β-glucan (BG). BG levels were determined in triplicate using a kit (K-BGLU) provided by Megazyme (Bray, Co, Wicklow, Republic of Ireland).

[0374] Fructan content. Fructan extraction and analysis were performed in 2 mL tubes or 96-well plates (2 mL per well) using a modified Megazyme Fructan Assay Kit (K-FRUC) procedure as follows. Whole wheat flour (40 mg) was mixed with 1 ml water (80°C) and incubated with shaking (1200 rpm) at 80°C for 30 min. After cooling to room temperature, the tubes were centrifuged for 5 min, and 20 μl of the supernatant containing fructans and other sugars was collected for fructan analysis. Sucrose, maltose, maltodextrins and starch in the supernatant were hydrolyzed to glucose and fructose by adding 20 μl of enzyme solution containing sucrase, amylase and maltase from the K-FRUC kit, and the mixtures were incubated at 40°C with shaking (1000 rpm) for 30 min. Glucose and fructose in the samples were then reduced by adding 20 μL of 10 mg/mL alkaline borohydride solution and incubating at 40°C with shaking (1000 rpm) for 30 min. The fructans in this solution were hydrolyzed by fructanases (40°C for 30 min with shaking at 1000 rpm) to glucose and fructose. p-Hydroxybenzoic acid hydrazide (PAHBAH) was added to form a color complex at 98°C for 6 min. After cooling the samples, the color complex was measured at 410 nm using a spectrophotometer, and absorbance values were converted to fructan content using a standard curve that contained 0 to 0.27 mg/ml fructose (Megazyme, K-FRUC kit), which was treated as and test samples after hydrolysis with fructanase. The fructan content (percentage of fructan) for the test samples was determined from absorbance values using a regression equation derived from the absorbance data for standard samples.

[0375] Downscaled fructan assay in plate format. For downscaled fructan analysis, all enzyme solutions, buffers, and reagents in Megazyme kits were reduced by a factor of 10 and reactions were performed in a 96-well plate. Whole grain flour samples were used at 20 mg for high fructan samples or 40 mg for lower fructan levels of around 0.5-2%. Pre-soaking the flour in ethanol was not necessary for fructan extraction, as the whole grain flour was well dispersed in hot water when stirred before fructan extraction. An extraction time of 20 min was sufficient to extract fructan. Hydrolysis reactions were carried out in 1.1 ml in capped 96-well plates at 40°C for 30 min with shaking at 1000 rpm using BioShake iQ and 96-well adapter (Q Instruments, Jena, Germany). In a modified K-FRUC assay, plates after fructan hydrolysis and addition of p-hydroxybenzoic acid hydrazide (PAHBAH) were capped and clamped tightly in a custom-made color development plate holder at 100°C for 6 min using a water bath (WiseBath, Thermoline Scientific, Wetherill Park, NSW, Australia). Hydrolyzed samples (250 μl) were transferred to a 96-well flat-bottom microtiter plate (UV-Sta®Microplate or PS-Microplate, Greiner Bio-One, Germany) for absorbance reading at 340 nm (in the case of K-FRUCHK) or 410 nm (in the case of K-FRUC) using a Multiskan Spectrum plate reader (Thermo Scientific, Finland).

[0376] Total arabinoxylan (AA). AA was measured using 20 mg whole grain flour samples in 2 ml screw cap tubes. Each sample was mixed with 1 ml of 0.5 M sulfuric acid, vortexed, and the mixtures were incubated at 99°C with shaking (1000 rpm) for 30 min. The tubes were then cooled in ice water for 5 min. The tubes were centrifuged at 10,000 g for 5 min, and the supernatant (800 μl) from each tube was transferred to a 96-well plate. If necessary, these plates were stored at -20°C before further processing. For dilution, 100 μL aliquots of the supernatant were transferred to another 96-well plate (Greiner bio-one masterblock) and 900 μL of Milli Q water was added to each well. The diluted supernatant (100 μl) was transferred to an assay plate (BioRad Titre tube Microtubes Racked, catalog no. 223-9390). To create xylose standards, 100 μL standard solutions were prepared at concentrations of 30, 50, 75, 100, 150, and 200 μg/mL using a 2 mg/mL stock solution (Sigma, Cat. No. X-3877). 0.5 ml of freshly prepared phloroglucinol reagent (PGR, see below) was added to each well. The plates were sealed with MicroCap tapes (National Scientific, TN3346-08C), clamped, and incubated at 100°C for 25 min in a fume hood. The samples were then mixed thoroughly by inverting the plates. Afterwards, 200 μL samples were transferred to a UV star plate in a fume hood. The absorbance of each sample was measured at 510 and 552 nm using a plate spectrophotometer such as a Thermo multiscan.

[0377] Phloroglucinol reagent (PGR) was prepared anew for each run in a fume hood. To do this, two solutions were prepared separately and then mixed. Solution 1 was prepared by dissolving 0.6 g phloroglucinol (Sigma, catalog no. 7933) in 2.4 ml absolute ethanol for several minutes in a 50 ml tube. Solution 2 contained 55 ml of glacial acetic acid with 1.1 ml of concentrated hydrochloric acid (HCl), which was slowly added to the acetic acid. Solution 1 was transferred to a 250 ml bottle. The 50 mL tube containing the remainder of Solution 1 was then washed with Solution 2 to quantitatively transfer all of Solution 1, and then all of Solution 2 was mixed with Solution 1 in the bottle. Finally, 0.6 ml of glucose solution (70 mg/ml in Milli Q water) was added to the mixture of solutions 1 and 2.

[0378] Cellulose content. Cellulose assays were performed in 2 mL tubes or 96-well plates (2 mL per well) using 50 mg whole grain flour samples. Lignin, hemicellulose and solubilized starch from whole grain flour were removed by adding 600 μl of nitrate reagent (10:1 (v/v) mixture of 80% acetic acid: 70% nitric acid) and incubating the mixture at 99°C with shaking (1000 vol /min) for 1 hour. After cooling, the samples were centrifuged at maximum speed for 5 minutes and the supernatants were discarded. Each precipitate was washed with 1 ml of water, centrifuged at maximum speed for 5 min, and each supernatant was discarded. To solubilize the crystalline cellulose in each precipitate, 1 ml of 72% H ₂ SO ₄ was added to each sample tube. Samples were diluted based on estimated cellulose content and cellulose standards. To develop color, 100 μl of anthrone reagent (0.2% anthrone in 72% H ₂ SO ₄ ) was added to each sample tube and the mixtures were incubated at 98°C for 10 minutes. The absorbance of the treated samples was read at 620 nm using a spectrophotometer and the cellulose content was calculated using a standard curve using 0 to 0.75 mg/ml cellulose (Sigma: Cat. No. G-6413).

[0379] Chain length distribution analysis. Determination of the chain length distribution of amylopectin was performed by fluorescence-activated capillary electrophoresis (FACE) after debranching of starch samples, using a capillary electrophoresis apparatus according to Morell et al., (1998). Samples were prepared as previously described (O'Shea and Morell, 1996).

[0380] Gelatinization of starch. Gelatinization temperature profiles of starch samples were determined using a Pyris 1 differential scanning calorimeter (Perkin Elmer, Norwalk, CT, USA). The viscosity of the starch samples was measured using a rapid viscosity analyzer (EAV, Newport Scientific Pty Ltd, Warriewood, Sydney), for example using the conditions described by Batey et al., (1997). Parameters measured included peak viscosity (maximum hot paste viscosity), holding force, final viscosity, and tack temperature. Volume expansion of flour or starch was determined according to the method of Konik-Rose et al., (2001). Water absorption was measured by weighing a sample before and after mixing a sample of flour or starch in water at specified temperatures and subsequently collecting the gelatinized material.

[0381] Morphology of starch granules. The morphology of starch granules was examined under a microscope. Suspensions of purified starch granules in water were examined under normal and polarized light using a Leica-DMR compound microscope to determine the morphology of the starch granules. Scanning electron microscopy experiments were performed on a Joel JSM 35C instrument. The purified starch was sputter coated with gold and scanned at 15 kV at room temperature.

[0382]Analysis of protein expression in endosperm.The specific expression of SBEI, SBEIIa and SBEIIb proteins in the endosperm, in particular the level of expression or accumulation of these proteins, was analyzed using Western blotting procedures. Endosperm was removed from all maternal tissues, and approximately 0.2 mg samples were homogenized in 600 μl of 50 mM potassium phosphate buffer (42 mM K₂HPO₄ and 8 mM KH₂P.O.₄), pH 7.5, containing 5 mM EDTA, 20% glycerol, 5 mM DTT and 1 mM Pefabloc. Ground samples were centrifuged for 10 min at 13,000 g, and the supernatant was aliquoted and frozen at -80°C until use. To estimate total protein, a BSA standard curve was generated using 0, 20, 40, 60, 80, and 100 μL aliquots of 0.25 mg/mL BSA standard. Samples (3 µl) were diluted to 100 µl with distilled water and 1 ml of Coomassie Plus Protein reagent was added to each. Absorbance was read after 5 min at 595 nm using a BSA null sample with a standard curve as a control, and protein levels in the samples were determined. Samples containing 20 μg of total protein from each endosperm were run on an 8% nondenaturing polyacrylamide gel containing 0.34 M Tris-HCl (pH 8.8), acrylamide (8.0%), ammonium persulfate (0.06%) and TEMED (0.1%). After electrophoresis, proteins were transferred to a nitrocellulose membrane according to Morellet al.,1997 and carried out an immune reaction with specific antibodies to SBEIIa, SBEIIb or SBEI (Table 5). Antiserum against wheat SBEIIa protein (anti-wBEIIa) was generated using a synthetic peptide having the amino acid sequence of the N-terminal sequence of mature wheat SBEIIa, AASPGKVLVPDGESDDL (SEQ ID NO: 49) (Rahmanet al., 2001). Wheat anti-SBEIIb antiserum (anti-wBEIIb) was generated in a similar manner using the N-terminal synthetic peptide AGGPSGEVMI (SEQ ID NO: 50) (Reginaet al.,(2005). This peptide was thought to represent the N-terminal sequence of the mature SBEIIb peptide and, moreover, it was identical to the N-terminus of the barley SBEIIb protein (Sunet al., 1998). A polyclonal anti-wheat SBEI antibody was synthesized in a similar manner using the N-terminal synthetic peptide VSAPRDYTMATAEDGV (SEQ ID NO:51) (Morellet al., 1997). This antiserum was obtained from rabbits immunized with synthetic peptides according to standard methods.

[0383] Statistical analysis. Statistical analysis of amylose data was performed using Genstat 16th edition for Windows (VSN International Ltd, Hertfordshire, UK). Other data were subjected to statistical analysis ( t -test and one-way ANOVA with Tukey's post hoc test) using GraphPad Prism, version 5.01. Error bars represent standard error of the mean (SEM). Statistical significance was defined as P < 0.05 and P < 0.01.

Example 2: Identification of cDNA sequences and genomic DNA sequences for genes SSIIb And SSIIc wheat and encoded polypeptides and comparison with SSIIa

[0384] To identify genes encoding starch synthase II isoenzymes (SSIIb and SSIIc) in wheat corresponding to SSIIb and SSIIc in rice (Ohdan et al., 2005), and compare them with SSIIa, the NCBI database was searched using sequences cDNAs from rice, namely the corresponding accession numbers AF419099 for SSIIa, AF395537 for SSIIb and AF383878 for SSIIc. Wheat homologs were identified as follows. For the wheat SSIIa genes, three homologous cDNA sequences have been identified corresponding to the SSIIa genes in wheat. They corresponded to accession nos: AF155217 (SEQ ID NO:4) for SSIIa-A in genome A, AJ269504 (SEQ ID NO:5) for SSIIa-B in genome B, and AJ269502 (SEQ ID NO:6) for SSIIa-D in genome D. DNA nucleotide sequences corresponding to these three homologous cDNA sequences were identified: accession no. AB201445 for the SSIIa-A gene (SEQ ID NO:7), AB201446 for the SSIIa-B gene (SEQ ID NO:8) and AB201447 for the SSIIa gene -D (SEQ ID NO:9). A search of the IWGSC database allowed us to identify the positions of three corresponding homologous genes on chromosome 7AS (Traes_7AS_53CAFB43A, 7A:52346437-52346905 bp, reverse strand), 7BS (IWGSC: chromosome 7BS, Traes_7BS_7BEAF5EC0, 7B: 31821573-31821749 bp. o. , straight strand) and 7DS (IWGSC: chromosome 7DS, Traes_7DS_E6C8AF743, IWGSC_CSS_7DS_scaff_3877787: 1 to 396 bp, 5137 to 5419 bp, straight strand), respectively. The amino acid sequences were respectively as follows: Accession No.: AAD53263 for SSIIa-A, CAB96627 for SSIIa-B and CAB86618 for SSIIa-D polypeptides.

[0385] When the amino acid and corresponding nucleotide sequences of SSIIa were compared pairwise using BLAST along the entire length of the sequences, the homologous sequences were 95-96% identical for each comparison. Consequently, they were easy to distinguish from each other.

[0386] Two cDNA sequences encoding wheat SSIIb genes were identified in the NCBI database, which corresponded to accession no. AK332724 from genome A and EU333947 from genome D. No corresponding genomic DNA sequences were identified in the NCBI database, however genomic DNA sequences were found in the IWGSC database. Three homologous genomic DNA sequences encoding SSIIb have been identified, namely the SSIIb-A gene on chromosome 6AL (homology with IWGSC: chromosome 6AL, Traes_6AL_AE01DC0EA, 6A: bp 187503905 to bp 187505233, straight strand by BLAST search EnsemblPlants website) (cDNA sequence SEQ ID NO:12), SSIIb-B gene on chromosome 6BL (chromosome 6BL, gene: Traes_6BL_61D83E262, 6B:162116364-162116691 bp, reverse strand from BLAST search on website EnsemblPlants) (cDNA sequence SEQ ID NO:13) and the SSIIb-D gene in chromosome 6DL (homology with IWGSC: chromosome 6DL, gene: Traes_6DL_19F1042C7, 6D: from bp 147050072-147051031, reverse strand by BLAST search on the web EnsemblPlants website) (cDNA sequence SEQ ID NO:14). One amino acid sequence was identified (Accession No: ABY56824, SEQ ID NO:11) in the NCBI database that was 100% identical to the amino acid sequences obtained from EU333947; therefore, it was the polypeptide sequence SSIIb-D. The full-length amino acid sequence (SEQ ID NO:10) was obtained from the nucleotide sequence AK332724 for the SSIIb-A polypeptide, which had 90% homology with ABY56824 from SSIIb genome D. The amino acid sequence for the SSIIb-B polypeptide was obtained from a DNA fragment from IWGSC (Traes_6BL_61D83E262 , 6B:162116364 - 162116691 bp, reverse strand). The full-length amino acid sequences of SSIIb-A and SSIIb-D were approximately 90% identical. In a pairwise comparison, the three corresponding DNA nucleotide sequences were 91-95% identical. Compared with the amino acid or nucleotide sequences of SSIIa, the SSIIb sequences were 71-79% identical to the corresponding SSIIa paralogue. Therefore, any SSII sequences can be easily identified as SSIIa or SSIIb either by amino acid or nucleotide sequences.

[0387] In the case of wheat SSIIc genes, one cDNA sequence was identified (Accession No: EU307274) in the NCBI database that corresponded to a gene located on wheat chromosome 1DL (homology with IWGSC: chromosome 1DL, gene: Traes_1DL_F667ED844, IWGSC_CSS_1DL_scaff_2205619:1950-3 041 bp, forward strand in a BLAST search on the EnsemblPlants website), hence it corresponds to SSIIc-D . The cDNA sequence for another SSIIc gene was identified through a search of the IWGSC database as a gene located on chromosome 1AL (IWGSC: chromosome 1AL, gene: Traes_1AL_729BF3204, 1A: 68687585-68688377, forward strand from a BLAST search on the EnsemblPlants website) . The cDNA sequence had 98% identity with the sequence of nucleotides 1679-2469 under accession number: EU307274. A sequence from chromosome 1BL was also identified which was a partial length cDNA sequence for SSIIc-B (IWGSC: chromosome 1BL, gene: Traes_1BL_447468BDE, 1B: 31475067-314776087 bp, forward strand from BLAST search on the EnsemblPlants website) . One amino acid sequence was identified (accession no: ABY639) in the NCBI database that had 100% identity with the amino acid sequence obtained from the cDNA sequence accession no. EU307274. Two partial-length amino acid sequences were also obtained from the nucleotide sequences of other genomic DNA fragments for SSIIc from genomes A and B. In pairwise comparisons, the SSIIc sequences were almost 98% identical to each other. They were quite different from the SSIIa sequences.

[0388] It was concluded that the SSIIa genes and SSIIa polypeptide sequences can be readily distinguished from the corresponding SSIIb and SSIIc sequences.

Example 3 Genome-Specific DNA Markers for Marker-Assisted Crossing

[0389] To create triple null ssIIa mutant plants isogenic with wild-type plants in several different genetic environments, plants of three wheat lines C57 (null for SSIIa-A ), K79 (null for SSIIa-B ) and T116 were used (null for SSIIa-D ) (Yamamori et al., 2000) in a series of crosses, backcrosses and crosses with each other. To identify and track mutations, each of which is recessive, a molecular marker crossbreeding program created and used genome-specific DNA markers based on SSIIa gene sequences. Specific mutations in the SSIIa genes from C57, K79 and T116 in genomes A, B and D, respectively, were described by Shimbata et al., (2005). Each of the mutations was a DNA deletion or insertion in the corresponding SSIIa genes (Figures 2-4) and, therefore, these mutations were ideal for the development of molecular markers. A DNA marker was created for each gene by placing a forward oligonucleotide primer upstream of each mutation site and a reverse primer after each mutation site, and the sequences are described in Example 1, DNA Analysis of Wheat Plants.

[0390] These primers were used to amplify genome-specific DNA fragments from wild-type and ssIIa null mutant plants. In the case of the SSIIa gene, 1072 bp were amplified from genome A. fragment from wild type and 778 bp. fragment from the null mutant gene ssIIa -A. In the case of the SSIIa gene, 374 bp of genome B was amplified. fragment from wild type and 522 bp. fragment from the null mutant gene ssIIa -B. In the case of the SSIIa gene, 427 bp were amplified from the D genome. fragment from wild type and 364 bp. fragment from the null mutant gene ssIIa -D. These genome-specific fragments could be easily distinguished by size using gel electrophoresis and could therefore be used as codominant DNA markers to identify mutant and wild-type alleles. To obtain alternative molecular markers, other specific primer pairs can easily be designed based on the SSIIa gene sequence.

Example 4: Creating triple zeros ssIIa -mutants in different genetic environments

[0391] To create triple null ssIIa mutant plants isogenic to several different genetic environments, plants from three wheat lines C57 (null for SSIIa-A ), K79 (null for SSIIa-B ), and T116 (null for SSIIa-B) were used. SSIIa-D ) (Yamamori et al., 2000) in a series of crosses, backcrosses, intercrosses and progeny selection, as schematically shown in Fig. 5-7. The DNA markers described in Example 1 were used to screen daughter plants in each generation, allowing discrimination between ssIIa null mutant alleles and the corresponding wild-type alleles in the Sunco, EGA Hume or Westonia wheat varieties that were used as recurrent parents. First, plants from the C57, K79, and T116 lines were crossed with Sunco wheat plants, using Sunco plants as female plants, to produce C57-Sunco F1, K79-Sunco F1, and T116-Sunco F1. Double null ssIIa mutants for C57-K79-Sunco F1 and K79-T116-Sunco F1 were then generated by crossing plants with one null mutation in the Sunco genetic environment, followed by selfing of the progeny to produce F2 plants from the cross. DNA markers were used to select offspring heterozygous for two ssIIa null mutations. These mutants were then used in three sequential backcrosses to Sunco as recurrent parents to generate BC3 heterozygotes having two null mutations. BC3 plants were then crossed and the progeny selfed with selection for triple null ssIIa mutants (C57-K79-T116-Sunco BC3 F2) in the Sunco genetic environment (Figure 5).

[0392] Production of BC3F8 seeds for ssIIa null mutants and wild-type wheat lines in the genetic environment of EGA Hume, Sunco and Westonia cultivars. To obtain plants and grains in two different genetic environments other than Sunco, double mutants in Sunco (C57-K79-Sunco F1 or F2, K79-T116-Sunco F1 or F2) were used as pollen donors when crossed with EGA plants. Hume and Westonia (Figs. 6 and 7), using DNA markers in each generation to identify and select mutant alleles in the offspring. Selected progeny of ssIIa double mutants were used in three successive backcrosses with EGA Hume or Westonia as recurrent parents, resulting in BC3 plants. The double mutants were crossed and selfed to produce 466 F2 generation daughter plants, from which a total of 21 plants with the ssIIa triple null mutation (referred to as the “abd” genotype) were selected (Figs. 6 and 7). The 466 daughter plants had wild-type genotypes, including one ssIIa null mutation and two ssIIa null mutations, as well as all combinations of heterozygotes for the three SSIIa genes.

[0393] After generating and selecting 21 triple null mutants spanning all genetic environments, three generations of progeny from one seed (POS) were generated to increase homozygosity in each of the three genetic environments, producing grain generations BC3F3, BC3F4, and BC3F5. The BC3F5 caryopsis further increased in volume over the three generations grown, yielding 10 to 20 g of BC3F8 caryopsis for each line.

[0394] Triple segregants of wild type SSIIa (genotype ABD) were also created through crosses and selected as control lines. At each generation, DNA markers for all three genomes were used to select ssIIa mutants or wild-type SSIIa alleles for each genome for each generation. Ultimately, 4, 6, and 11 BC3F8 generation ssIIa triple null mutation lines were generated for the EGA Hume, Sunco, and Westonia genetic backgrounds, respectively, and 5 SSIIa BC3F8 wild-type lines were generated for the EGA Hume, Sunco, and Westonia genetic backgrounds. They were grown at the same time under the same growth conditions, the grain was harvested when the plant reached maturity and the grain was dried to a moisture content of about 9% (w/w). These batches of grains were analyzed for various parameters including seed weight, starch content, amylose content, total dietary fiber content, lipid content, etc., as described below.

Example 5. Analysis of grain and starch parameters

[0395] Mass of grains. The average grain weight (mg per grain) of triple null ssIIa mutants and wild-type grains in three genetic environments was calculated by measuring the weight of 100 grains from each line. The average weight per grain ranged from 25 mg to 36 mg for ssIIa null mutants and from 29 mg to 48 mg for wild-type lines (Table 6, Fig. 8). The plants were grown under less than ideal growth conditions, which explains the low weight even for wild-type controls. The average data is shown in Fig. 9. Compared to wild-type lines, the grain of the ssIIa triple null mutants had lower grain weight with a significant difference (P < 0.05) for each genetic environment, including Sunco (Table 7, Fig. 9). Mutants in Sunco, EGA Hume and Westonia had 25%, 15% and 30% less grain weight, respectively. This was not surprising given that SSIIa encodes starch synthase, which is involved in starch production, and mutants in SSIIa were known to produce less starch (Yamamoto et al., 2000; Konik-Rose et al., 2007).

[0396] There was no statistically significant difference between the grain weight of the Sunco and Westonia mutants. The grain of the EGA Hume mutant was significantly heavier in weight than that of the triple null ssIIa mutants in the other two genetic environments.

[0397] Lipid content. Total fatty acid content (TFA, lipid content) was determined as described in example 1. Data for individual lines are shown in Table 5 and Fig. 8. It was noted that there was a significant increase in TFA content in the ssIIa triple null lines compared to the wild type. Specifically, grain from three Sunco mutant lines (JTSBC3F7_190, JTSBC3F7_287, and JTSBC3F7_294) had significantly increased lipid content, expressed as a percentage of grain weight.

[0398] When lipid content was determined on a per grain basis, it was observed that the mutant lines exhibited increased lipid levels expressed in mg per grain (FIGS. 15 and 16).

[0399] Amylose content. Amylose content as a proportion of starch content in the ssIIa triple null mutants and wild-type grains in the three genetic environments was determined in the iodine binding assay described in Example 1. Data are also shown in Table 6 and FIG. 10, and the average values are given in table 7 and Fig. 11 (Sunco). Amylose content for triple null mutants ranged from 36.6% to 64%, and for wild-type grains ranged from 22.6% to 31.0%. Compared to wild-type grain, ssIIa null mutants had higher amylose content, expressed as a proportion of total starch content, and the difference was statistically significant. Sunco, EGA Hume and Westonia mutant grains had amylose levels of 187%, 135% and 165%, respectively, compared to the corresponding wild type. When comparing grain from triple null mutants in three genetic environments, Sunco grain contained a significantly higher proportion of amylose compared to grain samples from the other two null mutants. There was no statistically significant difference between the EGA Hume and Westonia mutants. Likewise, there was no statistically significant difference between the three wild-type grain samples. Grain from three of the 6 Sunco triple null mutant lines contained 61.6%, 64%, and 55.1% amylose as a proportion of grain starch content. These values were much higher than those previously observed for ssIIa mutant grains in hexaploid wheat (Yamamoto et al., 2000; Konik-Rose et al., 2007) and were therefore unexpected and surprising to the inventors.

[0400] When amylose content was determined on a per grain basis (mg amylose per grain), it was observed that the mutant lines overall did not exhibit increased levels of amylose on a mg per grain basis (FIGS. 17 and 18), but rather exhibited decreased levels of amylopectin and, hence reduced total starch content. The inventors concluded that this was due to mutations in the three SSIIa genes and therefore loss of SSIIa enzyme activity during endosperm development during plant growth.

[0401] Starch content. Grain starch content for three ssIIa triple null mutants and three wild-type lines was determined as described in Example 1. Data are presented in Table 6 and FIG. 10, and the average values are given in Table 7 (Sunco) and Fig. 11. Starch content ranged from 30.4% to 70.0% for ssIIa triple null mutants and from 58.1% to 74.3% for wild-type grains. Compared with the starch content of the wild-type lines, the EGA Hume, Sunco, and Westonia mutant grains contained, on average, 15%, 28%, and 18% less starch, respectively, than the corresponding wild-type lines. This difference was statistically significant (p < 0.05). The Sunco mutant grain contained significantly less starch than the ssIIa mutant grain in the other two genetic environments. The starch content of the EGA Hume mutant grain was not significantly different from Westonia grain. Grain from three Sunco mutant lines (JTSBC3F7_190, JTSBC3F7_287 and JTSBC3F7_294) had low starch content of 42.5%, 34.8% and 30.4%, respectively. These same lines also had the highest amylose content as a proportion of their starch content, indicating that amylopectin synthesis was most severely reduced in these lines. When calculated in mg of starch per grain, a decrease in starch content in the ssIIa mutant grain was evident (Figures 17 and 18), which was again caused by loss of SSIIa activity.

[0402] β-Glucan content. The content of β-glucan (BG) in the grain of triple null ssIIa mutants and wild-type grain was determined as described in example 1. The data are shown in Table 6 and Fig. 12 as a percentage w/w of whole grain, and the average values are given in Table 7 (Sunco) and FIG. 13. BG content ranged from 1.3% to 3.3% for ssIIa triple null mutants and from 0.3% to 0.8% for wild-type grain. Compared with wild-type grain, the EGA mutants Hume, Sunco, and Westonia had 144%, 245%, and 177% more BG, respectively. This increase, approximately 1.5-2.5 times, was unexpected by the inventors, since such a manifestation had not previously been reported in hexaploid wheat. The Sunco mutant grain contained significantly more BG than the EGA Hume and Westonia mutant grains (P < 0.05). The grain of the three Sunco mutant lines (JTSBC3F7_190, JTSBC3F7_287 and JTSBC3F7_294), which had the highest levels of amylose, also contained the highest amount of BG at 2.5%, 3.3% and 3.2%, respectively. This demonstrates a correlation between increased amylose content and increased BG content in ssIIa mutants, in each case on a mass basis.

[0403] On a per grain basis, it was observed that the mutant grain had significantly increased levels of BG (Figures 19 and 20). The inventors believe that this is due to the difference in the amount of carbon supplied to the grain as disaccharides or monosaccharides from amylopectin in BG compared to the wild type.

[0404] Fructan content. The fructan content of ssIIa triple-null mutant and wild-type grain was determined as described in Example 1. The data are shown in Table 6 and FIG. 14 as a percentage w/w of whole grain, and the average values are given in Table 7 for Sunco. Fructan content ranged from 3.1% to 10.8% for ssIIa triple null mutants and from 0.7% to 1.5% for wild-type grains. Compared to wild-type grain, the EGA Hume, Sunco, and Westonia mutant grains contained 242%, 521%, and 376% more fructans, respectively. The Sunco mutant grain contained significantly more fructans than the EGA Hume and Westonia mutant grains (P < 0.05). Three high-amylose Sunco mutant lines (JTSBC3F7_190, JTSBC3F7_287, and JTSBC3F7_294) also had the highest fructan contents of 7.7%, 10.8%, and 10.5%, respectively. Such levels of fructan in hexaploid wheat on a mass basis have never been reported before. This demonstrates a correlation not only between increased amylose content and increased BG content, but also increased fructan content in ssIIa mutants.

[0405] On a per grain basis, it was observed that the mutant grain had significantly increased levels of fructan (Figures 21 and 22). The inventors believe that this is due to the difference in the amount of carbon supplied to the grain as disaccharides or monosaccharides from amylopectin to fructan compared to the wild type during endosperm development.

[0406] Arabinoxylan content. The content of arabinoxylan (AA) in the grain of triple null ssIIa mutants and wild-type grain was determined as described in example 1. The data are shown in table 6 and Fig. 14 as a percentage w/w of whole grain, and the average values are given in Table 7 for Sunco. AA content ranged from 6.7% to 8.8% for ssIIa triple null mutants and from 4.3% to 5.7% for wild-type grains. Compared with wild-type grain, EGA Hume, Sunco, and Westonia mutant grains contained 35%, 65%, and 43% more AA, respectively. The Sunco mutant grain contained significantly more AA than the EGA Hume and Westonia mutant grains (P < 0.05). Three high-amylose Sunco mutant lines (JTSBC3F7_190, JTSBC3F7_287, and JTSBC3F7_294) also had the highest AA contents of 8.7%, 8.5%, and 8.4%, respectively. This demonstrates the correlation between four parameters, namely increased amylose content, increased BG content, increased fructan content and increased AA content in ssIIa mutants. The arabinoxylan content per grain was also significantly increased (Figures 21 and 22).

[0407] Cellulose content. The cellulose content of ssIIa triple-null mutant and wild-type grain was determined as described in Example 1. Data are shown in Table 6 and FIG. 14 as a percentage w/w of whole grain, and the average values are given in Table 7 for Sunco. Cellulose content ranged from 2.6% to 4.6% for ssIIa triple null mutants and from 2.0% to 3.4% for wild-type grain. Compared to wild-type lines, EGA mutants Hume, Sunco, and Westonia contained 19%, 43%, and 29% more cellulose, respectively. There was no significant difference in cellulose content between the three null mutants. Three high-amylose Sunco mutant lines (JTSBC3F7_190, JTSBC3F7_287, and JTSBC3F7_294) also had the highest cellulose contents of 4.3%, 3.9%, and 4.6%, respectively. The cellulose content per grain was not significantly increased (Figures 21 and 22).

[0408] Total fiber content. The total fiber content of ssIIa triple-null mutant and wild-type grains was calculated as the sum of β-glucan (BG), fructan, arabinoxylan (AA), and cellulose contents (each as a percentage of grain weight). The data is shown in Table 6 and Fig. 12 as a percentage w/w of whole grains, and the average values are given in Table 7 and FIG. 13. Total grain fiber content ranged from 15.9% to 27.5% for ssIIa null mutants and from 8.5% to 10.4% for wild-type grain. Compared to wild-type grain, the EGA mutants Hume, Sunco, and Westonia had 68%, 125%, and 88% higher total fiber content, respectively. The Sunco mutant grain had significantly higher total fiber content than the EGA Hume and Westonia mutant grains (P < 0.05). There was no significant difference in total fiber content between the EGA Hume and Westonia mutant grains. Three high-amylose Sunco mutant lines (JTSBC3F7_190, JTSBC3F7_287, and JTSBC3F7_294) had the highest total fiber content of 23.2%, 26.5%, and 27.5%, respectively. The total fiber content per grain was also significantly increased (Figures 19 and 20).

[0409] Resistant starch (RS) content. DO content as a percentage of starch content in ssIIa triple null mutants and wild-type grain in the Sunco genetic environment was determined using a commercial resistant starch assay kit as described in Example 1. Data are shown in Table 8 and average values are shown in FIG. . 23. DO contents for triple null mutants ranged from 1.0% to 3.8%, and for wild-type grains ranged from 0.4% to 0.8%. Compared to wild-type grain, ssIIa -mutants had approximately 5 times higher PA content, and this difference was statistically significant. Grain from three of the 6 triple null ssIIa mutant lines in the Sunco genetic background contained 3.8%, 2.8% and 3.1% RA as a percentage of grain starch content (Figure 23, top panel). DO levels, calculated as mg per grain, were also significantly increased (Figure 23, bottom panel).

[0410] Discussion. Modification of a number of starch properties in triple null ssIIa hexaploid wheat has previously been reported, including starch granule morphology, amylose content, amylopectin chain length distribution, starch crystallinity and gelatinization temperature, EAB analysis, and swelling properties (Yamamori et al. 2000; Yamamori et al. 2000). 2006; Konik-Rose et al. 2007). The present invention found that the genetic environment of ssIIa null mutations influenced grain composition parameters including, to the inventors' surprise, starch amylose content, which was increased to over 45% in some lines. Three backcrossed populations were created in different genetic environments using commercially grown wheat varieties and genotyped using DNA markers for ssIIa triple null mutations. Four to eleven ssIIa triple-null mutant lines in each genetic environment and five wild-type lines from each of the three breeding populations were selected and analyzed.

[0411] By analyzing seed weight and grain composition, three lines characterized by high amylose, high fiber, high AA and BG, and high fructan were identified in each genetic environment. These three lines were obtained by crossing plants with the same genetic environment, namely Sunco. Wheat lines containing about 60% amylose, more than 23% total fiber and more than 7% fructan were identified and selected. These levels have never been reported before for hexaploid wheat and were a complete surprise to the inventors. An increase was also observed per grain. These high-amylose ssIIa null mutants also had increased BG, AA, and cellulose contents, demonstrating the correlation of these parameters. However, these three mutant lines also showed reduced starch content and grain weight due to significantly reduced amylopectin synthesis.

Table 6. Grain parameters for triple mutants ssIIa (abd) and SSIIa wild-type wheat (ABD) in three genetic environments.

Wheat line ID Genotype Genetic environment Weight of grain (mg) Amylose % Total starch % Total fiber % Beta glucan % Fructan % AK % Cellulose % Lipid content % SS533 abd EGA Hume 35.76 38.4 67.98 16.67 1.54 3.87 7.66 3.60 3.31 SS299 abd EGA Hume 36.04 36.6 63.03 17.01 1.29 4.55 7.48 3.68 3.42 SS412 abd EGA Hume 33.23 39.6 62.57 16.87 1.45 4.88 7.52 3.02 3.74 SS393 abd EGA Hume 33.00 43.0 64.47 18.14 1.78 5.82 7.73 2.81 3.76 SS344 abd Sunco 30.25 37.0 63.75 16.96 1.54 3.36 8.81 3.25 3.27 SS497 abd Sunco 32.00 45.4 65.16 18.26 1.96 3.75 9.48 3.08 3.66 SS435 abd Sunco 28.83 45.0 56.79 19.62 1.72 4.79 9.69 3.42 3.84 SS274 abd Sunco 24.95 64.0 46.65 25.14 2.42 8.45 9.57 4.70 5.13 SS110 abd Sunco 27.81 55.1 33.37 28.94 3.09 11.56 9.24 5.04 5.74 SS047 abd Sunco 27.16 61.6 38.22 28.74 3.20 11.86 9.38 4.30 5.72 SS104 abd Westonia 32.90 37.7 76.88 17.62 1.53 4.05 7.78 4.26 3.53 SS224 abd Westonia 28.94 39.4 70.36 16.97 1.40 4.42 7.31 3.85 3.80 SS403 abd Westonia 28.84 49.9 62.34 17.96 1.87 4.73 8.11 3.25 3.99 SS446 abd Westonia 30.45 49.1 59.25 18.56 1.97 4.87 8.38 3.34 4.16 SS066 abd Westonia 28.35 46.4 56.33 19.91 1.87 5.00 8.62 4.43 4.30 SS324 abd Westonia 30.82 50.5 56.38 19.21 1.97 5.56 8.10 3.58 4.17 SS135 abd Westonia 31.76 43.68 58.92 18.74 1.80 5.84 7.36 3.75 4.15 SS131 abd Westonia 29.78 43.66 54.10 20.53 1.73 6.10 8.32 4.38 4.57 SS306 abd Westonia 32.54 42.35 56.12 19.97 1.81 6.25 7.69 4.22 3.96 SS627 abd Westonia 33.94 38.77 57.25 19.81 1.83 7.10 7.32 3.56 4.36 SS028 abd Westonia 34.78 43.81 55.22 21.28 1.67 7.91 7.51 4.19 4.61 SS199 ABD EGA Hume 39.68 30.1 69.90 9.95 0.61 1.13 4.70 3.51 2.30 SS581 ABD EGA Hume 43.59 29.9 70.10 10.68 0.72 1.23 6.02 2.70 2.13 SS386 ABD EGA Hume 39.40 27.0 73.00 10.18 0.59 1.47 5.51 2.62 2.34 SS366 ABD EGA Hume 43.81 31.9 68.10 10.14 0.55 1.52 5.73 2.35 2.09 SS427 ABD EGA Hume 37.72 27.61 72.39 11.13 0.63 1.63 6.25 2.63 2.26 SS077 ABD Sunco 43.63 31.0 69.00 10.77 0.57 0.85 5.95 3.41 2.10 SS421 ABD Sunco 41.35 29.8 70.20 9.59 0.66 1.07 5.41 2.46 2.23 SS532 ABD Sunco 39.98 27.1 72.90 9.97 0.81 1.18 5.29 2.69 2.26 SS293 ABD Sunco 28.93 26.2 73.80 10.09 0.52 1.32 5.68 2.57 2.27 SS048 ABD Sunco 36.03 23.44 76.56 11.12 0.81 1.46 6.10 2.75 2.21 SS073 ABD Westonia 40.88 30.5 69.50 10.22 0.68 0.78 5.46 3.30 2.34 SS422 ABD Westonia 41.29 30.5 69.50 10.79 0.73 1.07 5.57 3.42 2.30 SS628 ABD Westonia 47.72 22.59 77.41 11.32 0.70 1.21 5.71 3.69 2.32 SS584 ABD Westonia 46.16 25.66 74.34 9.30 0.53 1.31 5.27 2.19 2.41 SS415 ABD Westonia 44.06 24.81 75.19 10.01 0.55 1.53 5.37 2.56 2.49

Table 7. Means and standard deviations (std) for grain parameters for three triple ssIIa mutants (abd) compared to wild type (ABD) wheat in the Sunco genetic environment

° ° Seed weight (mg) Amylose (iodine) % Amylopectin % Total starch % Total fiber % Beta glucan % Fructan % Arabinoxylan % Cellulose % Total lipids % Sunco-abd average 26.64 60.23 39.77 39.41 27.60 2.90 10.62 9.40 4.68 5.53 Sunco-DT average 37.98 27.51 72.49 70.80 10.31 0.67 1.17 5.68 2.78 2.22 Sunco-abd std. 1.50 4.60 4.60 6.72 2.14 0.42 1.89 0.17 0.37 0.35 Sunco-DT std. 5.77 2.99 2.99 4.51 0.62 0.14 0.24 0.34 0.37 0.07

Table 8 . Content of resistant starch in grain starch of ssIIa mutants in the Sunco environment

Wheat ID Line name RK (%) std. RK (%) std. per seed weight (mg) DO per seed (mg) average std. SS344 JTSBC3F7_255 1.04 0.13 2.56 0.94 30.25 0.31 0.71 0.23 SS497 JTSBC3F7_109 2.45 0.05 32.00 0.78 SS435 JTSBC3F7_260 2.1 0.15 28.83 0.61 SS274 JTSBC3F7_190 3.79 0.22 24.95 0.95 SS110 JTSBC3F7_294 2.81 0.22 27.81 0.78 SS047 JTSBC3F7_287 3.14 0.49 27.16 0.85 SS077wt JTSBC3F7_300 0.41 0.18 0.55 0.16 43.63 0.18 0.20 0.04 SS421wt JTSBC3F7_008 0.64 0.11 41.35 0.26 SS532wt JTSBC3F7_182 0.38 0.11 39.98 0.15 SS293wt JTSBC3F7_021 0.75 0.63 28.93 0.22 SS048wt JTSBC3F7_005 0.59 0.5 36.03 0.21 n. h. c. ° 0.97 0.23

*The average weight of 100 seeds was taken as an indicator of seed mass

Example 6. Combination of SSIIa mutations and other mutations in genes associated with starch synthesis or inhibitor constructs.

[0412] Wheat plants that are triple null mutants for three SSIIa genes, as described in Example 1, were crossed with plants containing a hairpin RNA construct designated hp-SBEIIa and having reduced starch branching enzyme II (SBEII) activity in the endosperm (Regina et al., 2006). hp-SBEIIa parent plants exhibited a high-amylose phenotype for grain starch (Regina et al., 2006). F1 plants were obtained and self-pollinated to obtain grain from F2 progeny. Screening of 288 F2 grains was performed by PCR using three different primer pairs described in Konik-Rose et al. (2007), and each pair of primers was specific for the mutant ssIIa gene from a particular genome. This allowed the identification of one homozygous ssIIa triple null grain, designated YDH7, which lacked wild-type alleles for each of the three SSIIa genes. Additional examination of YDH7 DNA confirmed the presence of the hp-SBEIIa genetic construct in this grain in addition to three mutated ssIIa genes. The grain was germinated to produce daughter plants and grain, referred to herein as line YDH7.

[0413] Similarly, plants containing triple null mutations in SSIIa were crossed with plants of the triple null sbeI wheat line described in Regina et al., 2004. DNA isolated from half F2 seeds was examined for null mutations in each of the genes SBEI using a split PCR amplification product (PCR) marker constructed from the intron 2 region of the wheat SBEI gene. This marker creates 460 bp. DNA fragment from the SBEI-D gene from the D genome, 390 bp. DNA fragment from the SBEI-B gene from the B genome and 200 bp. DNA fragment from the SBEI-A gene from the A genome. In addition to these genome-specific SBEI fragments, this RPA marker also creates a 250 bp. a DNA fragment that is nonspecific to SBEI genes and is used as an internal control in PCR reactions. Beads that lack SBEI -specific DNA fragments amplified from wild-type genes are identified, indicating that they are triple null mutants for sbeI . These triple null grains are then examined by PCR for the presence of ssIIa null mutations. These grains are sown to produce plants that contain a combination of the ssIIa and sbeI mutations, homozygous for each of the mutant alleles.

Example 7 Analysis of Starch Granules and Starch Properties

[0414] Starch granules in whole grain flour produced from triple ssIIa mutant grains were examined. The properties of starch isolated from whole grain flour were also analyzed as follows. For this analysis, five ssIIa -mutant wheat lines, designated A24, B22, B29, B63 and E24, were selected from a double haploid population according to Konik-Rose et al. (2007) and analyzed in relation to starch and granule properties. Grain samples (20 g) from each line and the corresponding wild-type line were ground to whole grain flour in a Quadramat Jnr mill. (Brabender, Cyrulla's Instruments, Sydney, Australia) after conditioning the grains to 14% moisture content. Starch was isolated from whole grain flour samples by protease extraction (Morrison et al., 1984), followed by washing with water to remove residues.

[0415] Change in morphology and birefringence of starch granules. The morphology of starch granules and their birefringence under polarized light were examined for granules in whole grain flour samples. Scanning electron microscopy was used to detect macroscopic changes in the size and structure of starch granules. Compared with wild-type granules, starch granules from endosperm lacking SSIIa showed significant morphological changes. They were very different in shape and many of the A-granules (diameter > 10 µm) were crescent-shaped. In contrast, both A and B (<10 μm diameter) starch granules in wild-type whole wheat flour had a smooth surface and a spherical or ellipsoidal shape.

[0416] When observed under a microscope under polarized light, wild-type starch granules generally exhibited strong birefringence. However, the manifestation of birefringence was greatly reduced for granules from triple zero ssIIa grains. Less than 10% of starch granules from ssIIa mutant grains were birefringent when imaged under polarized light. In contrast, about 94% of wild-type starch granules exhibited complete birefringence. Therefore, the decrease in birefringence was correlated with the absence of SSIIa and the increase in amylose content.

[0417] Chain length distribution in starch according to FACE. The chain length distribution of isoamylase-debranched starch was determined by fluorophore-assisted carbohydrate electrophoresis (FACE) as described in Example 1. This technology provides high-resolution analysis of chain length distributions ranging from DP 1 to 50 and the relative frequencies of chain lengths of different lengths. in modified starch compared to wild type. In the molar difference plot (Figure 24), where the normalized chain length distribution for wild-type starch is subtracted from the normalized distribution for ssIIa triple null mutant starch, there is a marked increase in the proportion of chain lengths with DP 7-10 and a significant decrease in the number of chain lengths with DP 11-24 in triple zero ssIIa grain starch. There was also a slight increase in the number of chain lengths with SP 26-36.

[0418] Molecular weight of amylopectin and amylose. The molecular weight distribution for starch from the mutant grain was determined by size exclusion chromatography (SEC) after debranching with isoamylase. Debranching treatment with isoamylase cleaves each of the α-1,6-linkages in amylopectin to release individual chains, but leaves the amylose as a whole intact, thus allowing size-based separation of amylose (eluting first) and glucan chains from amylopectin. In FIG. Figure 25 shows the obtained EC tracks for debranched starch in accordance with the degree of its polymerization. The relative content of amylose (first peak) in grain starch of triple null ssIIa mutants was significantly increased relative to wild type starch, and the amount of amylopectin (peak III) was greatly reduced compared to wild type. The average molecular weight of amylose in the grain starch of ssIIa triple null mutants was reduced compared to amylose in wild-type starch, with the amylose peak position being at 274 kDa compared to 330 kDa for the wild type (Figure 25).

[0419] Swellability of starch (SS). The swelling properties of starch for gelatinized starch were determined by performing a small-scale study according to Konik-Rose et al. , (2001), which measured water uptake during starch gelatinization. The estimated NC value was significantly lower for starch from the triple null ssIIa grain and was 6.85 compared to 11.79 for wild-type starch.

[0420] Gelatinization properties of starch. Starch paste viscosity parameters were determined using a rapid viscosity analyzer (EAV) generally as described in Regina et al., (2004). The temperature profile for EAS included the following stages: holding at 60°C for 2 min, heating to 95°C for 6 min, holding at 95°C for 4 min, cooling to 50°C for 4 min, and holding at 50°C for 4 min. The results showed that peak and final viscosity were significantly lower in ssIIa triple-null grain starch (105.5 and 208.6, respectively) compared to wild-type wheat starch (232.3 and 350.6, respectively).

[0421] Starch gelatinization properties. Starch gelatinization properties were examined using differential scanning calorimetry (DSC) as described in Regina et al ., (2004). DSC was performed on a Perkin Elmer Pyris 1 Differential Scanning Calorimeter. Starch and water were pre-mixed in a 1:2 ratio and approximately 50 g was weighed into a DSC cuvette, which was sealed and left overnight to equilibrate. Heating at a rate of 10°C per minute was used to heat the test and reference samples from 30 to 130°C. Data were analyzed using the software supplied with the instrument. The results clearly showed a reduction in the final gelatinization temperature (61.5°C) for triple zero ssIIa grain starch compared to the control (67.1°C). Peak gelatinization temperature was also lower in triple zero ssIIa starch (55.4°C) compared to control starch (61.3°C). Consequently, starch from triple zero ssIIa grains had a significantly lower gelatinization temperature and reduced gelatinization enthalpy.

[0422] Changes in grain composition. The approximate composition of triple null ssIIa wheat grain was analyzed to determine changes induced in grain components due to loss of SSIIa activity. Sucrose levels in ssIIa whole grain flour were increased compared to wild-type NB1 wheat. Total sugar content was also higher in ssIIa -mutant starch compared to wild-type starch. Whole grain flour from ssIIa grain and a second grain type containing the hp-SBEIIa genetic construct (Regina et al., 2006) had increased protein levels of >19% in the grain, whereas wild type whole grain flour had levels in the 11-13% range. . Total dietary fiber (TDF) content was higher in ssIIa starch with a level of 19.2% compared to the wild type value of 11.0%. The levels of other grain components such as neutral non-starch polysaccharides (NSPPs), total antioxidant content and total lipid content were comparatively higher in ssIIa flour compared to wild-type wheat flour. In the case of NNPC, the highest value of 13.8% was recorded for the ssIIa -mutant compared to 8.3% in wild-type NB1. The total starch content was about 53% in the ssIIa -mutant grain compared to >60% in NB1 and YDH7.

Example 8: Cooking Bread and Other Foods

[0423] Food products such as bread and breakfast cereals provide effective ways to introduce modified wheat starch into the diet. To demonstrate that high-amylose wheat can be easily incorporated into breads and breakfast cereals and to investigate factors that maintain food quality, flour samples were obtained, analyzed, and used in baking or pressing experiments. Small-scale bread baking was carried out using YDH7 flour at three addition levels, 30%, 60% and 100%, compared with baking from grain flour containing the hp-SBEIIa genetic construct and wild-type NB1. Increasing the level of YDH7 or hp-SBEIIa in flour led to a significant increase in RA and a decrease in GI.

[0424] A compressed breakfast cereal was prepared from ssIIa mutant wheat whole grain flour and compared to a corresponding wild-type wheat breakfast cereal. Breakfast cereal contained increased PA levels (4.3%) with triple null ssIIa wheat compared to wild type wheat (1.3%). Increasing the melting point from 110°C to 140°C during the pressing process slightly reduced the DO content when using triple zero ssIIa wheat. The results also show that whole-grain breakfast cereals made from triple-null ssIIa wheat had a lower HI (hydrolysis index to estimate GI value) of 72 compared to wild-type wheat's index of 82.

[0425] The following methods are used to make bread from ssIIa wheat on a larger scale. Some wheat grain is conditioned to a moisture content of 16.5% overnight before milling and sifting to produce a final average particle size of about 150 µm. Protein and moisture content of ground samples is determined by infrared reflectance (NIR) in accordance with the AACC 39-11 (1999) method or the Dumas method using the air-thermal method in accordance with AACC 44-15 A (AACC ₅ 1999).

[0426] Mixing with a micro-Z mixer. Optimal water absorption values for wheat flour were determined using a Z-mixer, for example using 4 g of test flour per mixture (Gras et al. , (2001); Bekes et al. , (2002), with constant angular and shaft speed for fast or slow blades 96 and 64 rpm respectively. Mixing was carried out for about 20 minutes. Before adding flour to water, the initial level was automatically recorded for 30 s when mixing only solid ingredients. Adding water was carried out in one step using an automatic water pump The following parameters were determined in separate mixing experiments, taking average values: PT% - water absorption was determined at a dough consistency of 500 Brabender units (BU) Dough formation time (BOT): time to peak resistance (s).

[0427]Mixograms.To determine the optimal mixing parameters for modified wheat flour dough, samples with different water absorption corresponding to the water absorption determined on a Z-mixer were mixed in a mixograph, keeping the total dough weight constant. For each of the flour samples, the following parameters were recorded: BC - mixing time (s); PS - peak resistance of the mixograph (arbitrary units, U.E.); ShPPS - bandwidth at peak resistance (arbitrary units, U.E.); NS - resistance violation (%); NShP - violation bandwidth (%); VMSH - time to reach maximum bandwidth (s); and MShP - maximum bandwidth (arbitrary units, CU). The dough extensibility parameters were determined as follows: the dough was kneaded until peak dough formation in a mixograph. Elongation studies at 1 cm/s were performed on a TA.XT2i Texture Analyzer with a Kieffer Modified Geometry Dough and Gluten Extensibility Tester (Mannet al., 2003). Elongation test samples (~1.0 g/run) were molded using a Kieffer molder and left at 30°C and 90% RH for 45 min before elongation testing. R_Max and Ext_Rmax are determined from the data using Exceed Expert software (Smewing, TX2 Texture Analyzer User's Guide, SMS Ltd: Surrey, UK, 1995).

[0428] An illustrative recipe based on 14 g of flour, taken as 100%, is as follows: 100% flour, 2% salt, 1.5% dry yeast, 2% vegetable oil and improver (ascorbic acid, 100 ppm, fungal amylose, 15 ppm, xylanase, 40 ppm, soya flour 0.3% obtained from Goodman Fielder Pty Ltd, Australia) 1.5%. The water addition level is based on the water absorption values obtained on the Z-mixer, which were adjusted for the full formula. Flour (14 g) and other ingredients are mixed in until the peak time of dough formation in the mixograph. Molding and placement into the mold is carried out with two testing stages at 40C at 85% RH. Baking is carried out in a Rotel oven for 15 minutes at 190°C. Measurements of volume (determined by the canola seed displacement method) and weight of the loaves were taken after the loaves had been cooled on a shelf for 2 hours. Total water loss is determined by weighing the loaves over time.

[0429] Flour or whole grain flour can be mixed with flour or whole grain flour from unmodified wheat or other grains such as barley to provide necessary dough or bread baking or nutritional qualities. For example, Chara or Glenlea flour has a high dough strength, while Janz flour has a medium dough strength. In particular, the levels of high and low molecular weight glutenin subunits in flour are positively correlated with dough strength, and are further dependent on the nature of the alleles present.

[0430] Flour from the YDH7 line was used at addition levels of 100%, 60% and 30% in accordance with the methods described above for making dough and baking bread. This means that either 100% of the flour produced from YDH7 or the control flour, or 60% or 30% by weight of the YDH7 flour was mixed with the baking control flour (B. extra). Percentage values are taken relative to the total flour content in the bread composition. The unmodified wheat flour was of the NB1 variety. Grain samples were ground on a Brabender Quadramat Junior mill. Water absorption for all flour mixtures was determined on a Z-mixer and optimal mixing time was determined on a mixograph as described above. These conditions were used to make test baked loaves.

[0431] Mixing properties. With the exception of a control sample that used all wild-type flour (baking control, NB1), all other flour samples showed increased water absorption values. Increased inclusion levels of YDH7 flour also resulted in lower optimal mixing times on the mixograph. Consistent with the water absorption data, all breads containing YDH7 flour exhibited a decrease in specific loaf volume (loaf volume/loaf weight), which correlated with increased levels of YDH7 flour addition.

[0432] These studies showed that bread with commercial potential, including acceptable crumb structure, texture and appearance, could be produced using ssIIa modified wheat flour mixed with control flour samples. Additionally, high amylose ssIIa wheat can be used in combination with preferred genetic environment characteristics (e.g., preferential high and low molecular weight glutenins) or modifications in food processing, such as, for example, the addition of improvers such as gluten, ascorbate, or emulsifiers, or using different styles of bread making (e.g. sponge, sourdough, mixed grain or whole grain bread) to produce a range of products with specific practical value or nutritional benefit to improve gut health and metabolism.

[0433] Other food products. Yellow egg noodles (YEL) (100% flour, 32% water, 1% Na ₂ CO ₃ ) were prepared in a Hobart mixer using a standard noodle production method from BRI Research (AFL 029). The noodle blank sheet is formed using stainless steel rollers in an Otake noodle making machine. After resting (30 minutes), the noodle blank sheet is reduced and cut into strips. The noodle dimensions are 1.5 × 1.5 mm.

[0434] Instant noodles (100% flour, 32% water, 1% NaCl and 0.2% Na ₂ CO ₃ ) are prepared in a Hobart mixer using a standard noodle production method from BRI Research (AFL 028). The noodle blank sheet is formed using stainless steel rollers in an Otake noodle making machine. After resting (5 minutes), the noodle blank sheet is reduced and cut into strips. The noodle dimensions are 1.0 × 1.5 × 25 mm. The noodle strips are steamed for 3.5 minutes and then fried in oil at 150°C for 45 seconds.

[0435] Sponge Dough Bread (S&D). Baking sponge bread according to BRI Research involves a two-step process. At the first stage, a dough is made by mixing part of the flour with water, yeast and a nutrient medium for yeast. The dough is left to ferment for 4 hours. In the second stage, the dough is mixed with the remaining flour, water and other ingredients to make a dough. The sponge stage of the process is carried out with 200 g of flour and given 4 hours for fermentation. The dough is prepared by mixing the remaining 100 g of flour and other ingredients with the fermented dough.

[0436] Spaghetti pasta. The method used to obtain the paste is as described in Sissons et al., (2007). Flours from ssIIa -modified wheat and wild-type wheat are mixed with Manildra semolina in various percentages (test sample: 0, 20, 40, 60, 80, 100%) to produce flour mixtures for small-scale paste making. Samples are adjusted to 30% moisture content. Add the required amount of water to the samples and mix lightly before transferring to a 50 g farinograph cup for an additional 2 minutes of mixing. The resulting dough, which resembles lumps the size of coffee beans, is transferred to a stainless steel chamber and left under a pressure of 7000 kPa for 9 minutes at 50°C. The paste is then pressed at a constant speed and cut into strips approximately 48 cm long. The paste is dried using a temperature and humidity chamber. The drying cycle uses a hold temperature of 25°C followed by an increase to 65°C for 45 minutes, followed by a period of approximately 13 hours at 50°C followed by cooling. Humidity is monitored during the cycle. The dried paste is cut into 7 cm strips for the following tests.

Example 9. In vitro determination of the glycemic index (GI) of food samples

[0437] The glycemic index (GI) of food samples was determined in vitro as follows. The in vitro method simulates what happens to food samples when consumed by humans and is predictive of in vivo GI determinations. Food samples were homogenized using a home food processor. An amount of sample representing approximately 50 mg of carbohydrates was weighed into a 120 ml plastic sample container and 100 μl of carbonate buffer without α-amylase was added. Approximately 15-20 seconds after adding the carbonate buffer, 5 ml of pepsin solution (65 mg pepsin (Sigma) dissolved in 65 ml of 0.02 M HCl, pH 2.0, prepared on the day of use) was added and the mixture was incubated at 37°C for 30 minutes in a shaking water bath at 70 rpm. After incubation, the sample was neutralized with 5 ml NaOH (0.02 M) and 25 ml of 0.2 M acetate buffer, pH 6, was added. Then 5 ml of an enzyme mixture containing 2 mg/ml pancreatin (α-amylase, Sigma) and 28 U ./ml amyloglucosidase from Aspergillus niger (AMG, Sigma), dissolved in Na-acetate buffer (sodium acetate buffer, 0.2 M, pH 6.0, containing 0.20 M calcium chloride and 0.49 mM magnesium chloride), and incubated the mixture for 2-5 minutes. Transfer 1 ml of solution from each vial to a 1.5 ml tube and centrifuge at 3000 rpm for 10 minutes. The supernatant was transferred to a new tube and stored in the freezer. The remainder of each sample was covered with aluminum foil and the containers were incubated at 37°C for 5 hours in a water bath. Then, an additional 1 ml of solution was taken from each bottle, centrifuged, and the supernatant was transferred as before. Supernatants were stored in a freezer until absorbance readings could be made.

[0438] All supernatants were thawed and centrifuged at 3000 rpm for 10 minutes. Samples were diluted as needed (usually a 1 in 10 dilution is sufficient), and 10 μl of supernatant from each sample was transferred into 96-well microtiter plates in duplicate or triplicate. A standard curve for each microtiter plate was generated using glucose (0 mg, 0.0625 mg, 0.125 mg, 0.25 mg, 0.5 mg, and 1.0 mg). 20 μl of Glucose Trinder reagent (Microgenetics Diagnostics Pty Ltd, Lidcombe, NSW) was added to each well and the plates were incubated at room temperature for approximately 20 minutes. The absorbance of each sample was measured at 505 nm using a plate reader, and the amount of glucose was calculated using a standard curve.

[0439] Bread loaves baked using flour from the YDH7 wheat line were tested for GI using the method described above, along with breads made from untransformed wild-type wheat, as well as mixtures of the two flours, using inclusion levels of 60% and 30% YDH7 flour with the remainder 40% or 70% wild type flour. Increased inclusion of YDH7 flour resulted in a significant reduction in GI as measured in an in vitro study.

Example 10: High-Amylose Wheat Treatment and Resulting DO Levels

[0440] A small study was conducted to determine the resistant starch (RS) content of processed YDH7 wheat grain that had been flattened or flaked. This method involved conditioning the grain to a moisture level of 25% for one hour, followed by steaming the grains. After steaming, the grains were converted into flakes using small, fine-scale rollers. The flakes were then roasted in the oven at 120°C for 35 minutes. Two roller widths and three steaming times were used for approximately 200 g of samples from high amylose wheat having reduced SSIIa and a wild-type control wheat (cv. Hartog). The tested roller widths were 0.05 mm and 0.15 mm. The steam treatment times were 60', 45' and 35'.

[0441] This study showed a clear and significant increase in the amount of PA in treated high amylose wheat compared to the control. Some influence of processing conditions on DO levels was also observed. For example, in the case of high-amylose grains, increasing the steaming time resulted in a slight decrease in DO levels, most likely due to increased starch gelatinization during steaming. A larger gap between the rollers caused a higher level of DO, with the exception of the option with the longest steam treatment time. This may be due to increased shear damage to starch granules when grains are rolled at a smaller gap, which slightly reduces DO levels. The smaller roll gap also resulted in higher DO levels in the Hartog control, despite much lower overall DO levels. In contrast to the results for high-amylose samples, increasing steaming time resulted in higher DO levels, possibly due to increased starch gelatinization with longer steaming time, which influences starch retrogradation during subsequent processing and cooling.

Example 11: Generation and identification of additional mutations ssIIa

[0442] Mutagenesis of wheat using heavy ion bombardment. Mutagenesis using irradiation, such as heavy ion bombardment (HIB), makes it possible to easily introduce deletion mutations into the wheat genome at a practically acceptable frequency. A mutagenesisable wheat population was created in the Chara variety, a widely used commercial variety, by BTI of wheat seeds. Two heavy ion sources, namely carbon and neon, were used for mutagenesis, which was carried out at the Riken Nishina Center, Wako, Saitama, Japan. The mutagenized seeds were sown in a greenhouse to obtain M1 plants. They were then selfed to produce the M2 generation. DNA samples were isolated from each of approximately 15,000 M2 plants, each from an individual M1 plant.

[0443] Each DNA was individually screened for mutations in each of the SSIIa genes by PCR using genome-specific oligonucleotide primers that produced amplified fragments for each of the SSIIa genes in genomes A, B, and D. Such diagnostic PCR primers can easily be constructed by those skilled in the art by comparing three genomic nucleotide sequences (SEQ ID NOs: 7, 8 and 9) and selecting oligonucleotide sequences that specifically hybridize to one genomic sequence but not to the other two, or when the resulting amplified fragments are differentially digested by a restriction enzyme to produce fragments of different sizes for the three genomic SSIIa genes. Thus, each of the PCR reactions on wild-type DNA samples (not subjected to mutagenesis) gave 3 different amplification products that corresponded to the amplified regions of the SSIIa genes in genomes A, B and D, while one of the fragments was missing in the PCR of mutagenized DNA samples M2 indicates the absence of a corresponding region in one of the genomes, i.e., the presence of a mutant allele in which at least part of the gene has been deleted. Such mutant alleles are definitely null alleles. This screen using SBEIIa and SBEIIb specific primers for 15,000 M2 plants identified a total of 34 mutants that were deletion mutants for the SBEIIa and/or SBEIIb genes (WO2012/058730), indicating that the frequency of deletion mutations for the gene of interest in these mutagenesized populations, M2 was about 1 in 1000 lines. Consequently, screening of M2 lines allowed the identification of approximately 15 mutants, each containing a deletion mutation in or in the SSIIa gene. Since the SSIIa genes in genomes A, B and D can be distinguished using diagnostic PCR reactions, mutant alleles are assigned to one of the genomes according to which amplification product is missing. In this way, about 5 mutants were identified for each of the SSIIa-A , SSIIa-B and SSIIa-D genes in a population of 15,000 M2 plants.

[0444] The extent of chromosomal deletion in each of the mutants is determined by microsatellite mapping. Microsatellite markers have previously been mapped to the short arm of chromosomes 7A, 7B and 7D, and the chromosomal locations of the SSIIa genes are examined in these mutants to determine the presence or absence of each marker in each mutant. Mutant plants in which all or most of the specific chromosomal microsatellite markers have been retained according to the production of the corresponding amplification product in the reactions are considered relatively minor deletion mutants. Such mutants were preferred given that the mutations were less likely to damage important genes.

[0445] Mutant crossing. Mutant plants that were homozygous for or in smaller deletions of the SSIIa gene, as judged by microsatellite marker analysis, are selected for crossing to create daughter plants and grains that have mutant ssIIa alleles in multiple genomes. The F1 daughter plants resulting from the cross self-pollinate and produce F2 seeds, which are analyzed for the SSIIa genotype. Such mutants can also be crossed with mutants containing point mutations in the SSIIa genes to produce triple gene mutants containing combinations of deletions and ssIIa point mutations.

[0446] Point mutations. Point mutations, including single nucleotide polymorphisms (SNPs), can be identified in publicly available libraries of mutagenized wheat plants. Such libraries include, for example, those available from the John Innes Centre, UK. The nucleotide sequence of wheat SSIIa (Genbank accession no: AB201445) was used to query the John Innes Center wheat database using BLAST software, and lines containing SNPs in each of the three SSIIa genes were identified. SNPs were classified into three classes. The first group contained mutants that had a mutated SSIIa gene containing a new stop codon in the protein-coding region of the gene. These mutations are predicted to lead to premature termination of translation of the SSIIa protein encoded by this gene. Premature termination mutations, also known as nonsense mutations or “stop codon mutations,” are almost always null mutations, provided the mutation is not close to the 3' end of the protein-coding region, although even these can be null mutations . The second group of mutants contained lines that had nucleotide polymorphism in the splice site of the SSIIa gene, both in the donor splice site and in the acceptor splice site. Such mutations were expected to mis-splice the RNA transcript from the SSIIa gene and greatly affect the mRNA; splice site mutations are most often null mutations. The third group consisted of mutants that contained a point mutation in one of the SSIIa genes, which resulted in an amino acid substitution in the encoded SSIIa polypeptide; these are called "missense mutations". The effect of each missense mutation on the structure of the encoded protein is predicted using the Blosum 62 and Pam 250 matrices.

[0447] The SSIIa gene mutants that were identified in the first and second groups are listed in Table 9. In the case of the SSIIa-A gene, 5 nonsense mutations, 2 splice site mutations, and 49 missense mutations were identified from the database. Two of the nonsense mutations identified in different pools were identical. For the SSIIa-B gene, 2 nonsense mutations, 7 splice site variant mutations, and 22 missense mutations were identified. In the case of the SSIIa-D gene, 2 splice mutations and 49 missense mutations were identified. Several mutants had more than one polymorphism in the SSIIa gene, including some that had a polymorphism in the intron as well as a polymorphism in the protein-coding region.

[0448] Identification of mutations using the TILLING method. A population of mutated plant lines was grown after mutagenesis by treating Sunstate wheat seeds with sodium azide using the method described in WO2014/028980. Five thousand M1 plants were grown to maturity, allowing them to self-pollinate. M2 seeds were collected separately from each plant, thereby obtaining a mutagenized population of 5000 lines. DNA was isolated from the leaf part (~2 cm) of plants in each line. DNA from wheat leaves was quantified using a plate reader (FLUOstar Omega, BMG LABTECH) and normalized to 10 ng/μl using a robotic machine (Corbett Life Science). For TILLING, DNA samples from sets of 8 plants were pooled together in each well of a 96-well plate. PCR reactions were performed to amplify SSIIa gene segments, for example with one cycle at 95°C for 5 min, then 35 cycles of melting at 94°C for 45 s, a hybridization temperature of 60 to 62°C for 30 s, and extension at 72°C for 2 min 30 s, then 1 cycle at 72°C for 10 min followed by cooling to 25°C. The resulting PCR fragments (5 μl) were separated on 1% or 2% agarose gels and visualized (UVitec) after staining with ethidium to examine the quality of PCR amplification.

[0449] Heteroduplexing of PCR fragments with wild-type RNA transcript is performed using a PCR setup with 1 cycle at 99°C for 5 minutes, 70 cycles of hybridization starting at 70°C, and recovery at a rate of 0.6°C per cycle for 20 s, followed by cooling to 25°C. Heteroduplexes are digested with Cel I enzyme using 5 µl of heteroduplexed PCR product with 5 µl of 2x buffer mixture and 0.5 µl of Cel I enzyme. The buffer mixture consists of 20 mM HEPES, pH 7.5, 20 mM MgSO ₄ , 20 mM KCl, 0.004% Triton X-100 and 0.4 μg/ml BSA. The completed reactions are mixed and incubated at 45°C for 15-30 min. The digested DNA fragments are then loaded into a DNA fragment analyzer (Advanced Analytical Technologies) to separate the DNA fragments according to the mutation detection kit (DNF-910-K1000T). Alternatively, sets of 10 amplification products are pooled after normalization of the PCR products and sequenced using one pool of DNA per flow cell. Sequencing data is analyzed to select lines that have the ssIIa gene polymorphism. SNP assays are developed for each polymorphism based on kaspar technology and genotyping of M1 lines in each pool positive for a particular polymorphism is performed. In this way, the individual mutant line containing each mutant gene is identified and the mutant SSIIa sequences are confirmed.

[0450] Plants containing a point mutation in one SSIIa gene are crossed with plants containing mutations in the other two SSIIa genes to produce ssIIa triple null mutants.

Table 9. ssIIa mutants identified in the JIC mutagenized library

Line Chromosome Mutation type Mutation position Position in chromosome Foundation of DT Mutant base cDNA position Amino acid change Codon change ssIIa-A mutants Kronos2261 7AS Introduction of a stop codon 322 52346758 C T 1013 W269* tgG/tgA Cadenza0110 7AS Introduction of a stop codon 114 52346550 G A 1221 Q339* Cag/Tag Cadenza0403 7AS Introduction of a stop codon 114 52346550 G A 1221 Q339* Cag/Tag Cadenza1738 7AS Introduction of a stop codon 3460 52349896 C T 563 W119* tgG/tgA Cadenza1097 7AS Introduction of a stop codon 323 52346759 C T 1012 W269* tGg/tAg Cadenza1237 7AS Acceptor splice site variant 5153 52351589 C T N/A N/A N/A Cadenza0413 7AS Splice region variant and intronic variant 5081 52351517 G A N/A N/A N/A ssIIa-B mutants Cadenza1731 7BS Introduction of a stop codon 1811 31821582 G A 342 W82* tGg/tAg Kronos3900 7BS Introduction of a stop codon 1812 31821583 G A 343 W82* tgG/tgA Kronos2209 7BS Acceptor splice site variant 1172 31820943 G A N/A N/A N/A Cadenza1031 7BS Splice region variant and intronic variant 40 31819811 G A N/A N/A N/A Cadenza1788 7BS Splice region variant and intronic variant 41 31819812 G A N/A N/A N/A Kronos2375 7BS Splice region variant, intronic variant 1001 31820772 C T N/A N/A N/A Kronos2187 7BS Splice region variant, intronic variant 1088 31820859 G A N/A N/A N/A Kronos3229 7BS Splice region variant, intronic variant 1167 31820938 C T N/A N/A N/A Cadenza1176 7BS Splice region variant and intronic variant 1378 31821149 C T N/A N/A N/A ssIIa-D mutants Cadenza0627 7DS Splice region variant, intronic variant 555 N/A N/A N/A Cadenza1762 7DS Splice region variant, intronic variant 1612 N/A N/A N/A

Example 12. Analysis of protein in ssIIa -mutant grain

[0451] Expression of starch biosynthesis genes in ssIIa mutants. Five ssIIa mutant wheat lines, designated A24, B22, B29, B63 and E24, were selected from a double haploid population according to Konik-Rose et al. (2007), and the contents of several starch biosynthetic mRNAs and proteins were analyzed as follows. The level of mRNA expression in developing grains of ssIIa -mutant wheat plants at 15 STP was compared with the wild type using quantitative reverse transcription PCR (qRT-PCR) as described in Example 1. Quantification of RNA in each sample was performed in comparison with the constitutively expressed gene tubulin. qRT-PCR data showed that the level of ssIIa mRNA in the endosperm of homozygous ssIIa triple mutants was significantly lower than in the corresponding wild-type grain (p < 0.01), being only about 8% of the level compared to the corresponding endosperm of wild-type wheat. In contrast, the levels of SSI, SBEIIa , and SBEIIb transcripts in the mutant grain were approximately the same as in the corresponding developing wild-type grain. This indicates a specific effect on ssIIa mRNA in the mutant endosperm.

[0452] Analysis of the abundance of granule-associated proteins in mature grain starch. To compare the intensity of bands in the protein gel and the amount of protein loaded into the gel, one to four mg of starch in the form of starch granules from mature grain ssIIa mutants and wild-type SSIIa were used to extract starch granule-associated proteins. The proteins were separated in a protein gel as described in Example 1. Four proteins with a molecular mass of at least 60 kDa were observed to be associated with starch granules in wild-type mature grain. In the case of the ssIIa mutant grain, one protein was observed at approximately 60 kDa, identified as GBSSI. After quantification of the protein bands, a positive correlation was found between the intensity of the protein bands and the amount of starch used for protein extraction for each of SSIIa, SBEII and SSI from the wild type grain and for GBSSI from the mutant grain. Due to the low levels of SSIIa, SBEII and SSI proteins within starch granules, an amount of four mg of starch was chosen to extract starch granule-associated proteins for additional analysis described below.

[0453] Four starch granule-associated proteins having a molecular weight of about 60 kDa were observed when wild-type wheat grain protein extracts were subjected to gel electrophoresis and stained with Sypro. They were identified as SSIIa (∼88 kDa), SBEIIa and SBEIIb (each ∼83 kDa), SSI (∼75 kDa), and GBSSI (∼60 kDa) polypeptides in immunoblotting analysis. SBEIIa and SBEIIb moved to almost the same position in the gels, but the abundance of SBEIIb within wild-type starch granules was much greater than SBEIIa, as judged by Sypro staining.

[0454] When proteins from starch granules of ssIIa -mutant wheat were analyzed by gel electrophoresis, SSIIa and SBEIIa proteins were not detected. SSI and SBEIIb proteins were not detected by Sypro staining but could be detected by immunoblotting assays, although their abundance was too low to permit accurate enumeration (Figure 26).

[0455] Analysis of the abundance of starch biosynthetic enzyme proteins in the soluble stroma and within starch granules of the developing endosperm. To determine whether the low concentration of SSI, SBEIIa, and SBEIIb within starch granules in the mature mutant grain was associated with lower levels of synthesis during grain development, while SSIIa protein was absent from the mutant grain, SSI, SBEIIa, and SBEIIb proteins in the soluble fraction stroma and within the starch granules of developing endosperms were quantified through 15 SPCs. Quantitative assessment was carried out by immunodetection. When soluble proteins from developing endosperms were analyzed, significantly increased amounts of SBEIIb and SSI were present in ssIIa mutant grain compared to SSIIa of developing wild-type grain at the same stage (15 SPC). In contrast, the level of SBEIIa was similar in ssIIa mutant grain and wild-type SSIIa grain. SBEIIa was more represented in the soluble fraction of amyloplasts than SBEIIb. It was concluded that the reduced levels of SSI, SBEIIa and SBEIIb proteins within starch granules were not associated with reduced expression levels, but instead reflected decreased binding within starch granules, indicating localization away from starch granules and into the soluble fraction of the stroma.

[0456] When starch granule-associated proteins in developing grain were analyzed, no SSIIa protein was detected in ssIIa mutant wheat grain by immunoblotting analysis. The level of SBEIIb was reduced to about 25% compared to the wild type. The level of SSI within the starch granules of the ssIIa mutant was also approximately 25% of the wild type. Similar reduction profiles of starch granule-associated proteins were observed in mature endosperms. However, on a per starch basis, the concentration of starch biosynthetic enzymes in the starch granule-associated proteins of developing endosperms was higher than in mature grains as a result of the dilution effect of higher levels of starch in the endosperm of mature grains.

LITERATURE

Abel et al., (1996). Plant Journal 10:981–991.

Altschul et al., (1997). Nucl. Acids Res. 25:3389–3402.

Alvarez et al., (2006). Plant Cell 18:1134–1151.

Asai et al., (2014). J. Exp. Biol. 65:5497–5507.

Batey and Curtin, (1996). Starch 48:338–344.

Batey et al., (1997). Cereal Chemistry 74:497–501.

Bechtold et al., (1993). C.R. Acad. Sci. Paris 316:1194–1199.

Bekes et al., (2002). Crit Care Med. 30:1906-1907.

Birt et al., (2013). Adv. Nutrition 4:587–601.

Boch (2011). Nature Biotechnology 29:135–136.

Botticella et al., (2011). BMC Plant Biology 11: 156.

Boyer and Preiss, (1978). Carbohydrate Research 61: 321–334.

Boyer and Preiss, (1981). Plant Phys. 67: 1141-1145.

Bryan et al., (1998). J Cereal Sci. 28:135-145.

Butardo et al., (2012). J Agr Food Chem 60:11576-11585. Ausubel et al., "Current Protocols in Molecular Biology", John Wiley & Sons Inc, Chapter 15, 1994-1998

Carpita et al., (1993). Plant J. 3:1-30.

Carpita et al., (2011) Plant Physiol. 155:171-184.

Case et al., (1998). Journal of Cereal Science 27: 301-314.

Castro et al., (2005). Biomacromolecules 6:2260–2270.

Cheng et al., (1997). Plant Physiol 115:971–980.

Colgrave et al., (2013). Food Res Int 54:1001–1012.

Comai et al., (2004). Plant J 37: 778–786.

Doudna et al., (2014) Science 346 (6213).

Dupuis et al., (2014). Comprehensive Reviews in Food Science and Food Safety 13:1219–1234.

Durai et al., (2005). Nucleic Acids Research 33: 5978–5990.

Eagles et al., (2001). Aust. J. Agric. Res. 52: 1349-1356.

Ellison et al., (1994) Aust. J. Exp. Agric. 34:869-869.

Fergason, (1994). Specialty Corns eds, CRC Press Inc. pp 55-77.

Fontaine et al., (1993). J Biol Chem 268:16223–16230.

Fujita et al., (2006). Plant Physiol 140:1070–1084.

Fuwa et al., (1999). Starch-Stärke 51: 147–151.

Gao et al., (1997). Plant Physiol 114:69–78.

Gao and Chibbar (2000). Genome 43:768–775.

Giddings et al., (1980). J Cell Biol. 84:327-339.

Gras et al., (2001). In: Proc. ICC 11th Int. Cereal and Bread Congress. RACI: Melbourne.

Gruppen et al., (1992). J Cereal Sci. 16:41-51.

Guan and Keeling (1998). Trends Glycosci. Glycotechnol. 10:307-319.

Harn et al., (1998). Plant Mol. Biol. 37:639-649.

Hartmann and Endres, (1999). Manual of Antisense Methodology, Kluwer.

Hayashi et al., (2007). Cyclotrons and Their Applications. Eighteenth International Conference 237-239.

Hedman and Boyer, (1982). Biochemical Genetics 20: 483–492.

Henikoff et al., (2004). Plant Physiol. 135: 630-636.

Henry (1985). J. Sci. Food Agric. 36:1243–1253.

Hinchee et al., (1988). Biotech., 6: 915-922.

Hopkins et al., (2003). Appl. Environ. Microbiol. 69:6354–6360.

Hung et al., (2006). Trends Food Sci. Technol. 17:448-456.

Huynh et al (2008a). J Cereal Sci. 48:369-378.

Huynh et al (2008b). Theor. Appl. Genet. 117:701-709.

Jobling et al.,(1999). Plant Journal 18: 163-171.

Jolly et al. (1996). Proc. Natl. Acad. Sci. U.S.A. 93: 2408-2413.

Juong et al, (2013). Nat Rev Mol Cell Biol 14:49–55.

Kanna and Daggard, (2003). Plant Cell Rep 21:429–436.

Karppinen et al., (2003). Cereal Chem. 80:168-171.

Kaur and Gupta (2002) J. Biosci. 27:703-714.

Kawaura et al., (2009). BMC Genomics 10:271.

Kazama et al., (2008). Plant Biotechnology 25: 113–117.

Klein et al., (1987). Nature 327:70-73.

Konik-Rose et al., (2001). Starch-Stärke, 53: 14-20.

Konik-Rose et al., (2007). Theor Appl Genet 115:1053–1065.

Kosar-Hashemi et al., (2007). Funct Plant Biol. 34:431-438.

Krueger et al., (1987). Cereal Chemistry 64: 187–190.

Langridge et al., (2001). Aust. J. Agric. Res. 52: 1043-1077.

Lazaridou et al., (2007). In: Biliaderis and Izydorczyk (Eds.) Functional food carbohydrates (pp 1-72). CRC Press, Boca Raton FL.

Lazo et al., (1991). Biotechnology (N Y). 9(10): 963-967.

Le Provost et al., (2009). Trends in Biotechnology 28(3): 134-141.

Leterrier et al., (2008) BMC Plant Biol. 8:98.

Li et al., (1999a). Plant Physiol 120:1147–1155.

Li et al., (1999b). Theor. Appl. Genet. 98: 1208-1216.

Li et al., (2000). Plant Physiol 123:613–624.

Li et al., (2003). Funct. Integr. Genomics 3:76–85.

Liu et al., (2010). Biotechnology and Bioengineering, 106: 97-105.

Luo et al., (2015). Theor. Appl. Genet. 128: 1407-1419.

Mann et al., (2003). In 'Workshop on gluten proteins' Eds. Lafiandra et al., The Royal Society of Chemistry: Cambridge, UK, pp. 215-218.

Matsumoto et al., (2011). Plant Physiol. 156:20-28.

McCleary et al., (2000). J AOAC Int. 83:997-1005.

McCleary et al., (2013). Cereal Chem. 90:396-414.

Mizuno et al., (1992). J Biochem 112:643–651.

Mizuno et al., (1993). J Biol. Chem. 268:19084-19091.

Morell et al., (1998). Electrophoresis 19:2603–2611.

Morell et al., (1997). Plant Physiol 113:201–208.

Morell et al., (2003). Plant J 34:172–184.

Morrison and Laignelet, (1983). J Cereal Sci 1:9-20.

Morrison et al., (1984). J Cereal Sci. 2:257-271.

Nakamura et al., (1996). Planta 199:209–218.

Nakamura and Yamanouchi, (1992). Plant Physiol. 99:1265-1266.

Needleman and Wunsch, (1970). J. Mol. Biol. 48:443-453.

Niedz et al., (1995). Plant Cell Reports 14:403–406.

Nishi et al., (2001). Plant Physiol 127:459-472.

Ohdan et al., (2005). J Exp Bot 56:3229–3244.

O'Shea and Morell (1996). Electrophoresis 17:681–686.

Ow et al., (1986). Science, 234:856-859.

Palatnik et al., (2003). Nature 425:257–263.

Parizotto et al., (2004). Genes Dev 18:2237–2242.

Potrykus et al., (1985). Mol. Gen. Genet., 199:183–188.

Prasher et al., (1985). Biochem. Biophys. Res. Comm. 126:1259-1268.

Prosky et al., (1985). J Assoc. Off. Anal. Chem. Int. 68:677-679.

Quraishi et al., (2011). Funct Integr Genomics 11:71–83.

Rahman et al., (1999). Theor. Appl. Genet. 98:156-163.

Rahman et al., (1995). Aust. J. Plant Physiol. 22:793-803.

Rahman et al., (2001). Plant Physiol 125:1314–1324.

Regina et al., (2006). Proc. Natl. Acad. Sci. U.S.A. 103:3546–3551.

Regina et al., (2005). Planta 222:899–909.

Regina et al., (2010). J Exp Bot. 61(5): 1469-1482.

Regina et al., (2004). Funct Plant Biol 31: 591–601.

Ritsema and Smeekens (2003) Curr. Opin. Plant Biol. 6:223-230.

Salanoubat et al., (2000). Nature 408:820–822.

Schnable et al., (2009). Science 326:1112–1115.

Schondelmaier et al., (1992) Plant Breeding 109:274-280.

Schulman and Kammiovirta, (1991). Starch 43: 387–389.

Schwab et al., (2006). Plant Cell 18: 1121–1133.

Schwall et al., (2000). Nature Biotechnology 18: 551–554.

Sestili et al., (2010). Mol Breeding 25:145–154.

Sharp et al., (2001). Aust J Agric Res 52:1357–1366.

Shimbata et al., (2005). Theor. Appl. Genet. 111:1072–1079.

Sidebottom et al., (1998). J Cereal Sci 27:279–287.

Sissons et al., (2007). J. Sci. Food and Agriculture. 87: 1874-1885.

Slade and Knauf, (2005). Transgenic Res. 14: 109-115.

Smewing, (1995). TX2 texture analyzer handbook, SMS Ltd: Surrey, UK.

Smith et al., (2000). Nature, 407: 319-320.

Smith and Hartley (1983). Carbohydrate Research 118: 65-80.

Sparks and Jones (2004). In Transgenic Crops of the World-Essential protocols, Ed. IP Curtis, Kluwer Academic Publishers, Dordrecht, Netherlands, pp. 19-34.

Stalker et al., (1988). Science, 242: 419-423.

Steegmans et al (2004). J. AOAC Int. 87, 1200e1207.

Stone and Morell (2009). In: Khan and Shewry (Eds.) Wheat: Chemistry and Technology. American Association of Cereal Chemists, St Paul, MN, pp 299-362.

Sun et al., (1997). New Phytol. 137:215-222.

Sun et al., (1998). Plant Physiol 118:37–49.

Sune et al., (2013). Biotechnology and Bioengineering 110:1811–1821.

Takeda et al., (1993). Carbohydrate Research 246: 273–281.

Tanaka et al., (1990). Nucl. Acids Res. 18: 6767-6770.

Tilley (2004). Cereal Chem 81:44–47.

Toyota et al., (2006). Planta 223:248–257.

Tungland and Meyer (2002) Comprehensive Reviews in Food Science and Food Safety 2:73-77.

Waterhouse et al., (1998). Proc. Natl. Acad. Sci. U.S.A.95: 13959-13964.

Weir et al., (2001). Aust J Plant Physiol 28:807–818.

Whelan et al (2011). Int J. Food Sci. Nutr. 62:498-503.

Wu et al., (2003). Plant Cell Rep 21:659–668.

Yamamori et al., (2000). Theor Appl Genet 101:21–29.

Yamamori et al., (2006). Aust. J. Agric. Res. 57:531-535.

Yan et al., (2008). Plant Sci. 176:51-57.

Zwar and Chandler, (1995). Planta 197: 39-48.

--->

LIST OF SEQUENCES

<110> State Association of Scientific and

applied research

<120> HIGH-AMILOSIC WHEAT – III

<130> 35269906/WJP

<160> 51

<170> PatentIn version 3.5

<210> 1

<211> 799

<212> Protein

<213> Triticum aestivum

<400> 1

Met Ser Ser Ala Val Ala Ser Ala Ala Ser Phe Leu Ala Leu Ala Ser

1 5 10 15

Ala Ser Pro Gly Arg Ser Arg Arg Arg Ala Arg Val Ser Ala Pro Pro

20 25 30

Pro His Ala Gly Ala Gly Arg Leu His Trp Pro Pro Trp Pro Pro Gln

35 40 45

Arg Thr Ala Arg Asp Gly Gly Val Ala Ala Arg Ala Ala Gly Lys Lys

50 55 60

Asp Ala Arg Val Asp Asp Asp Ala Ala Ser Ala Arg Gln Pro Arg Ala

65 70 75 80

Arg Arg Gly Gly Ala Ala Thr Lys Val Ala Glu Arg Arg Asp Pro Val

85 90 95

Lys Thr Leu Asp Arg Asp Ala Ala Glu Gly Gly Ala Pro Ala Pro Pro

100 105 110

Ala Pro Arg Gln Asp Ala Ala Arg Pro Pro Ser Met Asn Gly Thr Pro

115 120 125

Val Asn Gly Glu Asn Lys Ser Thr Gly Gly Gly Gly Ala Thr Lys Asp

130 135 140

Ser Gly Leu Pro Ala Pro Ala Arg Ala Pro His Pro Ser Thr Gln Asn

145 150 155 160

Arg Val Pro Val Asn Gly Glu Asn Lys Ala Asn Val Ala Ser Pro Pro

165 170 175

Thr Ser Ile Ala Glu Val Val Ala Pro Asp Ser Ala Ala Thr Ile Ser

180 185 190

Ile Ser Asp Lys Ala Pro Glu Ser Val Val Pro Ala Glu Lys Pro Pro

195 200 205

Pro Ser Ser Gly Ser Asn Phe Val Val Ser Ala Ser Ala Pro Arg Leu

210 215 220

Asp Ile Asp Ser Asp Val Glu Pro Glu Leu Lys Lys Gly Ala Val Ile

225 230 235 240

Val Glu Glu Ala Pro Asn Pro Lys Ala Leu Ser Pro Pro Ala Ala Pro

245 250 255

Ala Val Gln Glu Asp Leu Trp Asp Phe Lys Lys Tyr Ile Gly Phe Glu

260 265 270

Glu Pro Val Glu Ala Lys Asp Asp Gly Trp Ala Val Ala Asp Asp Ala

275 280 285

Gly Ser Phe Glu His His Gln Asn His Asp Ser Gly Pro Leu Ala Gly

290 295 300

Glu Asn Val Met Asn Val Val Val Val Ala Ala Glu Cys Ser Pro Trp

305 310 315 320

Cys Lys Thr Gly Gly Leu Gly Asp Val Ala Gly Ala Leu Pro Lys Ala

325 330 335

Leu Ala Lys Arg Gly His Arg Val Met Val Val Val Pro Arg Tyr Gly

340 345 350

Asp Tyr Glu Glu Ala Tyr Asp Val Gly Val Arg Lys Tyr Tyr Lys Ala

355 360 365

Ala Gly Gln Asp Met Glu Val Asn Tyr Phe His Ala Tyr Ile Asp Gly

370 375 380

Val Asp Phe Val Phe Ile Asp Ala Pro Leu Phe Arg His Arg Gln Glu

385 390 395 400

Asp Ile Tyr Gly Gly Ser Arg Gln Glu Ile Met Lys Arg Met Ile Leu

405 410 415

Phe Cys Lys Ala Ala Val Glu Val Pro Trp His Val Pro Cys Gly Gly

420 425 430

Val Pro Tyr Gly Asp Gly Asn Leu Val Phe Ile Ala Asn Asp Trp His

435 440 445

Thr Ala Leu Leu Pro Val Tyr Leu Lys Ala Tyr Tyr Arg Asp His Gly

450 455 460

Leu Met Gln Tyr Thr Arg Ser Ile Met Val Ile His Asn Ile Ala His

465 470 475 480

Gln Gly Arg Gly Pro Val Asp Glu Phe Pro Phe Thr Glu Leu Pro Glu

485 490 495

His Tyr Leu Glu His Phe Arg Leu Tyr Asp Pro Val Gly Gly Glu His

500 505 510

Ala Asn Tyr Phe Ala Ala Gly Leu Lys Met Ala Asp Gln Val Val Val

515 520 525

Val Ser Pro Gly Tyr Leu Trp Glu Leu Lys Thr Val Glu Gly Gly Trp

530 535 540

Gly Leu His Asp Ile Ile Arg Gln Asn Asp Trp Lys Thr Arg Gly Ile

545 550 555 560

Val Asn Gly Ile Asp Asn Met Glu Trp Asn Pro Glu Val Asp Val His

565 570 575

Leu Lys Ser Asp Gly Tyr Thr Asn Phe Ser Leu Gly Thr Leu Asp Ser

580 585 590

Gly Lys Arg Gln Cys Lys Glu Ala Leu Gln Arg Glu Leu Gly Leu Gln

595 600 605

Val Arg Ala Asp Val Pro Leu Leu Gly Phe Ile Gly Arg Leu Asp Gly

610 615 620

Gln Lys Gly Val Glu Ile Ile Ala Asp Ala Met Pro Trp Ile Val Ser

625 630 635 640

Gln Asp Val Gln Leu Val Met Leu Gly Thr Gly Arg His Asp Leu Glu

645 650 655

Ser Met Leu Arg His Phe Glu Arg Glu His His Asp Lys Val Arg Gly

660 665 670

Trp Val Gly Phe Ser Val Arg Leu Ala His Arg Ile Thr Ala Gly Ala

675 680 685

Asp Ala Leu Leu Met Pro Ser Arg Phe Glu Pro Cys Gly Leu Asn Gln

690 695 700

Leu Tyr Ala Met Ala Tyr Gly Thr Val Pro Val Val His Ala Val Gly

705 710 715 720

Gly Val Arg Asp Thr Val Pro Pro Phe Asp Pro Phe Asn His Ser Gly

725 730 735

Leu Gly Trp Thr Phe Asp Arg Ala Glu Ala His Lys Leu Ile Glu Ala

740 745 750

Leu Gly His Cys Leu Arg Thr Tyr Arg Asp Tyr Lys Glu Ser Trp Arg

755 760 765

Gly Leu Gln Glu Arg Gly Met Ser Gln Asp Phe Ser Trp Glu His Ala

770 775 780

Ala Lys Leu Tyr Glu Asp Val Leu Leu Lys Ala Lys Tyr Gln Trp

785 790 795

<210> 2

<211> 798

<212> Protein

<213> Triticum aestivum

<400> 2

Met Ser Ser Ala Val Ala Ser Ala Ala Ser Phe Leu Ala Leu Ala Ser

1 5 10 15

Ala Ser Pro Gly Arg Ser Arg Arg Arg Thr Arg Val Ser Ala Ser Pro

20 25 30

Pro His Thr Gly Ala Gly Arg Leu His Trp Pro Pro Ser Pro Pro Gln

35 40 45

Arg Thr Ala Arg Asp Gly Ala Val Ala Ala Arg Ala Ala Gly Lys Lys

50 55 60

Asp Ala Gly Ile Asp Asp Ala Ala Pro Ala Arg Gln Pro Arg Ala Leu

65 70 75 80

Arg Gly Gly Ala Ala Thr Lys Val Ala Glu Arg Arg Asp Pro Val Lys

85 90 95

Thr Leu Asp Arg Asp Ala Ala Glu Gly Gly Ala Pro Ser Pro Pro Ala

100 105 110

Pro Arg Gln Glu Asp Ala Arg Leu Pro Ser Met Asn Gly Met Pro Val

115 120 125

Asn Gly Glu Asn Lys Ser Thr Gly Gly Gly Gly Ala Thr Lys Asp Ser

130 135 140

Gly Leu Pro Ala Pro Ala Arg Ala Pro Gln Pro Ser Ser Gln Asn Arg

145 150 155 160

Val Pro Val Asn Gly Glu Asn Lys Ala Asn Val Ala Ser Pro Pro Thr

165 170 175

Ser Ile Ala Glu Val Ala Ala Pro Asp Pro Ala Ala Thr Ile Ser Ile

180 185 190

Ser Asp Lys Ala Pro Glu Ser Val Val Pro Ala Glu Lys Ala Pro Pro

195 200 205

Ser Ser Gly Ser Asn Phe Val Pro Ser Ala Ser Ala Pro Gly Ser Asp

210 215 220

Thr Val Ser Asp Val Glu Leu Glu Leu Lys Lys Gly Ala Val Ile Val

225 230 235 240

Lys Glu Ala Pro Asn Pro Lys Ala Leu Ser Pro Pro Ala Ala Pro Ala

245 250 255

Val Gln Gln Asp Leu Trp Asp Phe Lys Lys Tyr Ile Gly Phe Glu Glu

260 265 270

Pro Val Glu Ala Lys Asp Asp Gly Arg Ala Val Ala Asp Asp Ala Gly

275 280 285

Ser Phe Glu His His Gln Asn His Asp Ser Gly Pro Leu Ala Gly Glu

290 295 300

Asn Val Met Asn Val Val Val Val Ala Ala Glu Cys Ser Pro Trp Cys

305 310 315 320

Lys Thr Gly Gly Leu Gly Asp Val Ala Gly Ala Leu Pro Lys Ala Leu

325 330 335

Ala Lys Arg Gly His Arg Val Met Val Val Val Pro Arg Tyr Gly Asp

340 345 350

Tyr Glu Glu Ala Tyr Asp Val Gly Val Arg Lys Tyr Tyr Lys Ala Ala

355 360 365

Gly Gln Asp Met Glu Val Asn Tyr Phe His Ala Tyr Ile Asp Gly Val

370 375 380

Asp Phe Val Phe Ile Asp Ala Pro Leu Phe Arg His Arg Gln Glu Asp

385 390 395 400

Ile Tyr Gly Gly Ser Arg Gln Glu Ile Met Lys Arg Met Ile Leu Phe

405 410 415

Cys Lys Ala Ala Val Glu Val Pro Trp His Val Pro Cys Gly Gly Val

420 425 430

Pro Tyr Gly Asp Gly Asn Leu Val Phe Ile Ala Asn Asp Trp His Thr

435 440 445

Ala Leu Leu Pro Val Tyr Leu Lys Ala Tyr Tyr Arg Asp His Gly Leu

450 455 460

Met Gln Tyr Thr Arg Ser Ile Met Val Ile His Asn Ile Ala His Gln

465 470 475 480

Gly Arg Gly Pro Val Asp Glu Phe Pro Phe Thr Glu Leu Pro Glu His

485 490 495

Tyr Leu Glu His Phe Arg Leu Tyr Asp Pro Val Gly Gly Glu His Ala

500 505 510

Asn Tyr Phe Ala Ala Gly Leu Lys Met Ala Asp Gln Val Val Val Val

515 520 525

Ser Pro Gly Tyr Leu Trp Glu Leu Lys Thr Val Glu Gly Gly Trp Gly

530 535 540

Leu His Asp Ile Ile Arg Gln Asn Asp Trp Lys Thr Arg Gly Ile Val

545 550 555 560

Asn Gly Ile Asp Asn Met Glu Trp Asn Pro Glu Val Asp Val His Leu

565 570 575

Lys Ser Asp Gly Tyr Thr Asn Phe Ser Leu Gly Thr Leu Asp Ser Gly

580 585 590

Lys Arg Gln Cys Lys Glu Ala Leu Gln Arg Glu Leu Gly Leu Gln Val

595 600 605

Arg Gly Asp Val Pro Leu Leu Gly Phe Ile Gly Arg Leu Asp Gly Gln

610 615 620

Lys Gly Val Glu Ile Ile Ala Asp Ala Met Pro Trp Ile Val Ser Gln

625 630 635 640

Asp Val Gln Leu Val Met Leu Gly Thr Gly Arg His Asp Leu Glu Gly

645 650 655

Met Leu Arg His Phe Glu Arg Glu His His Asp Lys Val Arg Gly Trp

660 665 670

Val Gly Phe Ser Val Arg Leu Ala His Arg Ile Thr Ala Gly Ala Asp

675 680 685

Ala Leu Leu Met Pro Ser Arg Phe Glu Pro Cys Gly Leu Asn Gln Leu

690 695 700

Tyr Ala Met Ala Tyr Gly Thr Val Pro Val Val His Ala Val Gly Gly

705 710 715 720

Leu Arg Asp Thr Val Pro Pro Phe Asp Pro Phe Asn His Ser Gly Leu

725 730 735

Gly Trp Thr Phe Asp Arg Ala Glu Ala Gln Lys Leu Ile Glu Ala Leu

740 745 750

Gly His Cys Leu Arg Thr Tyr Arg Asp Tyr Lys Glu Ser Trp Arg Gly

755 760 765

Leu Gln Glu Arg Gly Met Ser Gln Asp Phe Ser Trp Glu His Ala Ala

770 775 780

Lys Leu Tyr Glu Asp Val Leu Val Lys Ala Lys Tyr Gln Trp

785 790 795

<210> 3

<211> 799

<212> Protein

<213> Triticum aestivum

<400> 3

Met Ser Ser Ala Val Ala Ser Ala Ala Ser Phe Leu Ala Leu Ala Ser

1 5 10 15

Ala Ser Pro Gly Arg Ser Arg Arg Arg Ala Arg Val Ser Ala Gln Pro

20 25 30

Pro His Ala Gly Ala Gly Arg Leu His Trp Pro Pro Trp Pro Pro Gln

35 40 45

Arg Thr Ala Arg Asp Gly Ala Val Ala Ala Leu Ala Ala Gly Lys Lys

50 55 60

Asp Ala Gly Ile Asp Asp Ala Ala Ala Ser Val Arg Gln Pro Arg Ala

65 70 75 80

Leu Arg Gly Gly Ala Ala Thr Lys Val Ala Glu Arg Arg Asp Pro Val

85 90 95

Lys Thr Leu Asp Arg Asp Ala Ala Glu Gly Gly Gly Pro Ser Pro Pro

100 105 110

Ala Ala Arg Gln Asp Ala Ala Arg Pro Pro Ser Met Asn Gly Met Pro

115 120 125

Val Asn Gly Glu Asn Lys Ser Thr Gly Gly Gly Gly Ala Thr Lys Asp

130 135 140

Ser Gly Leu Pro Thr Pro Ala Arg Ala Pro His Pro Ser Thr Gln Asn

145 150 155 160

Arg Ala Pro Val Asn Gly Glu Asn Lys Ala Asn Val Ala Ser Pro Pro

165 170 175

Thr Ser Ile Ala Glu Ala Ala Ala Ser Asp Ser Ala Ala Thr Ile Ser

180 185 190

Ile Ser Asp Lys Ala Pro Glu Ser Val Val Pro Ala Glu Lys Thr Pro

195 200 205

Pro Ser Ser Gly Ser Asn Phe Glu Ser Ser Ala Ser Ala Pro Gly Ser

210 215 220

Asp Thr Val Ser Asp Val Glu Gln Glu Leu Lys Lys Gly Ala Val Val

225 230 235 240

Val Glu Glu Ala Pro Lys Pro Lys Ala Leu Ser Pro Pro Ala Ala Pro

245 250 255

Ala Val Gln Glu Asp Leu Trp Asp Phe Lys Lys Tyr Ile Gly Phe Glu

260 265 270

Glu Pro Val Glu Ala Lys Asp Asp Gly Arg Ala Val Ala Asp Asp Ala

275 280 285

Gly Ser Phe Glu His His Gln Asn His Asp Ser Gly Pro Leu Ala Gly

290 295 300

Glu Asn Val Met Asn Val Val Val Val Ala Ala Glu Cys Ser Pro Trp

305 310 315 320

Cys Lys Thr Gly Gly Leu Gly Asp Val Ala Gly Ala Leu Pro Lys Ala

325 330 335

Leu Ala Lys Arg Gly His Arg Val Met Val Val Val Pro Arg Tyr Gly

340 345 350

Asp Tyr Glu Glu Ala Tyr Asp Val Gly Val Arg Lys Tyr Tyr Lys Ala

355 360 365

Ala Gly Gln Asp Met Glu Val Asn Tyr Phe His Ala Tyr Ile Asp Gly

370 375 380

Val Asp Phe Val Phe Ile Asp Ala Pro Leu Phe Arg His Arg Gln Glu

385 390 395 400

Asp Ile Tyr Gly Gly Ser Arg Gln Glu Ile Met Lys Arg Met Ile Leu

405 410 415

Phe Cys Lys Ala Ala Val Glu Val Pro Trp His Val Pro Cys Gly Gly

420 425 430

Val Pro Tyr Gly Asp Gly Asn Leu Val Phe Ile Ala Asn Asp Trp His

435 440 445

Thr Ala Leu Leu Pro Val Tyr Leu Lys Ala Tyr Tyr Arg Asp His Gly

450 455 460

Leu Met Gln Tyr Thr Arg Ser Ile Met Val Ile His Asn Ile Ala His

465 470 475 480

Gln Gly Arg Gly Pro Val Asp Glu Phe Pro Phe Thr Glu Leu Pro Glu

485 490 495

His Tyr Leu Glu His Phe Arg Leu Tyr Asp Pro Val Gly Gly Glu His

500 505 510

Ala Asn Tyr Phe Ala Ala Gly Leu Lys Met Ala Asp Gln Val Val Val

515 520 525

Val Ser Pro Gly Tyr Leu Trp Glu Leu Lys Thr Val Glu Gly Gly Trp

530 535 540

Gly Leu His Asp Ile Ile Arg Gln Asn Asp Trp Lys Thr Arg Gly Ile

545 550 555 560

Val Asn Gly Ile Asp Asn Met Glu Trp Asn Pro Glu Val Asp Ala His

565 570 575

Leu Lys Ser Asp Gly Tyr Thr Asn Phe Ser Leu Arg Thr Leu Asp Ser

580 585 590

Gly Lys Arg Gln Cys Lys Glu Ala Leu Gln Arg Glu Leu Gly Leu Gln

595 600 605

Val Arg Ala Asp Val Pro Leu Leu Gly Phe Ile Gly Arg Leu Asp Gly

610 615 620

Gln Lys Gly Val Glu Ile Ile Ala Asp Ala Met Pro Trp Ile Val Ser

625 630 635 640

Gln Asp Val Gln Leu Val Met Leu Gly Thr Gly Arg His Asp Leu Glu

645 650 655

Ser Met Leu Gln His Phe Glu Arg Glu His His Asp Lys Val Arg Gly

660 665 670

Trp Val Gly Phe Ser Val Arg Leu Ala His Arg Ile Thr Ala Gly Ala

675 680 685

Asp Ala Leu Leu Met Pro Ser Arg Phe Glu Pro Cys Gly Leu Asn Gln

690 695 700

Leu Tyr Ala Met Ala Tyr Gly Thr Val Pro Val Val His Ala Val Gly

705 710 715 720

Gly Leu Arg Asp Thr Val Pro Pro Phe Asp Pro Phe Asn His Ser Gly

725 730 735

Leu Gly Trp Thr Phe Asp Arg Ala Glu Ala His Lys Leu Ile Glu Ala

740 745 750

Leu Gly His Cys Leu Arg Thr Tyr Arg Asp Phe Lys Glu Ser Trp Arg

755 760 765

Ala Leu Gln Glu Arg Gly Met Ser Gln Asp Phe Ser Trp Glu His Ala

770 775 780

Ala Lys Leu Tyr Glu Asp Val Leu Val Lys Ala Lys Tyr Gln Trp

785 790 795

<210> 4

<211> 2821

<212> DNA

<213> Triticum aestivum

<400> 4

gctgccacca cctccgcctg cgccgcgctc tgggcggagg accaacccgc gcatcgtacc

60

atcgcccgcc ccgatcccgg ccgccgccat gtcgtcggcg gtcgcgtccg ccgcgtcctt

120

cctcgcgctc gcctccgcct cccccgggag atcacgcagg cgggcgaggg tgagcgcgcc

180

gccaccccac gccggggccg gcaggctgca ctggccgccg tggccgccgc agcgcacggc

240

tcgcgacgga ggtgtggccg cgcgcgccgc cgggaagaag gacgcgaggg tcgacgacga

300

cgccgcgtcc gcgaggcagc cccgcgcacg ccgcggtggc gccgccacca aggtcgcgga

360

gcggagggat cccgtcaaga cgctcgatcg cgacgccgcg gaaggtggcg cgccggcacc

420

gccggcaccg aggcaggacg ccgcccgtcc accgagtatg aacggcacgc cggtgaacgg

480

tgagaacaaa tctaccggcg gcggcggcgc gaccaaagac agcgggctgc ccgcacccgc

540

acgcgcgccc catccgtcga cccagaacag agtaccagtg aacggtgaaa acaaagctaa

600

cgtcgcctcg ccgccgacga gcatagccga ggtcgtggct ccggattccg cagctaccat

660

ttccatcagt gacaaggcgc cggagtccgt tgtcccagcc gagaagccgc cgccgtcgtc

720

cggctcaaat ttcgtggtct cggcttctgc tcccaggctg gacattgaca gcgatgttga

780

acctgaactg aagaagggtg cggtcatcgt cgaagaagct ccaaacccaa aggctctttc

840

gccgcctgca gcccccgctg tacaagaaga cctttgggac ttcaagaaat acattggctt

900

cgaggagccc gtggaggcca aggatgatgg ctgggctgtt gcagatgatg cgggctcctt

960

tgaacatcac cagaaccatg attccggacc tttggcaggg gagaacgtca tgaacgtggt

1020

cgtcgtggct gctgaatgtt ctccctggtg caaaacaggt ggtcttggag atgttgccgg

1080

tgctttgccc aaggctttgg cgaagagagg acatcgtgtt atggttgtgg taccaaggta

1140

tggggactat gaggaagcct acgatgtcgg agtccgaaaa tactacaagg ctgctggaca

1200

ggatatggaa gtgaattatt tccatgctta tatcgatgga gttgattttg tgttcattga

1260

cgctcctctc ttccgacacc gccaggaaga catttatggg ggcagcagac aggaaattat

1320

gaagcgcatg attttgttct gcaaggccgc tgtcgaggtt ccttggcacg ttccatgcgg

1380

cggtgtccct tatggggatg gaaatctggt gtttattgca aatgattggc acacggcact

1440

cctgcctgtc tatctgaaag catattacag ggaccatggt ttgatgcagt acactcggtc

1500

cattatggtg atacataaca tcgcgcacca gggccgtggc ccagtagatg aattcccgtt

1560

caccgagttg cctgagcact acctggaaca cttcagactg tacgaccccg tgggtggtga

1620

gcacgccaac tacttcgccg ccggcctgaa gatggcggac caggttgtcg tggtgagccc

1680

cgggtacctg tgggagctca agacggtgga gggcggctgg gggcttcacg acatcatacg

1740

gcagaacgac tggaagaccc gcggcatcgt caacggcatc gacaacatgg agtggaaccc

1800

cgaggtggac gtccacctca agtcggacgg ctacaccaac ttctccctgg ggacgctgga

1860

ctccggcaag cggcagtgca aggaggccct gcagcgcgag ctgggcctgc aggtccgcgc

1920

cgacgtgccg ctgctcggct tcatcggccg cctggacggg cagaagggcg tggagatcat

1980

cgcggacgcc atgccctgga tcgtgagcca ggacgtgcag ctggtcatgc tgggcaccgg

2040

ccgccacgac ctggagagca tgctgcggca cttcgagcgg gagcaccacg acaaggtgcg

2100

cgggtgggtg gggttctccg tgcgcctggc gcaccggatc acggcgggcg ccgacgcgct

2160

cctcatgccc tcccggttcg agccgtgcgg gttgaaccag ctttacgcca tggcctacgg

2220

caccgtcccc gtcgtgcacg ccgtcggcgg ggtgagggac accgtgccgc cgttcgaccc

2280

cttcaaccac tccggcctcg ggtggacgtt cgaccgcgcc gaggcgcaca agctgatcga

2340

ggcgctcggg cactgcctcc gcacctaccg ggactacaag gagagctgga ggggcctcca

2400

ggagcgcggc atgtcgcagg acttcagctg ggagcatgcc gccaagctct acgaggacgt

2460

cctcctcaag gccaagtacc agtggtgaac gctagctgct agccgctcca gccccgcatg

2520

cgtgcatgca tgagagggtg gaactgcgca ttgcgcccgc aggaacgtgc catccttctc

2580

gatgggagcg ccggcatccg cgaggtgcag tgacatgaga ggtgtgtgtg gttgagacgc

2640

tgattccgat ctcgatctgg tccgtagcag agtagagcgg acgtagggaa gcgctccttg

2700

ttgcaggtat atgggaatgt tgtcaacttg gtattgtagt ttgctatgtt gtatgcgtta

2760

ttacaatgtt gttacttatt cttgttaagt cggaggcaaa gggcgaaagc tagctcacat

2820

g

2821

<210> 5

<211> 2793

<212> DNA

<213> Triticum aestivum

<400> 5

gcactccagt ccagtccagc ccactgccgc gctactcccc actcccactg ccaccacctc

60

cgcctgcgcc gcgctctggg cggaccaacc cgcgcatcgt atcacgatca cccaccccga

120

tcccggccgc cgccatgtcg tcggcggtcg cgtccgccgc gtccttcctc gcgctcgcgt

180

ccgcctcccc cgggagatca cggagggagga cgagggtgag cgcgtcgcca ccccacaccg

240

gggctggcag gttgcactgg ccgccgtcgc cgccgcagcg cacggctcgc gacggagcag

300

tggccgcgcg cgccgccggg aagaaggacg cggggatcga cgacgccgcg cccgcgaggc

360

agccccgcgc actccgcggt ggcgccgcca ccaaggttgc ggagcggagg gatcccgtca

420

agacgctcga tcgcgacgcc gcggaaggtg gcgcgccgtc cccgccggca ccgaggcagg

480

aggacgcccg tctgccgagc atgaacggca tgccggtgaa cggtgaaaac aaatctaccg

540

gcggcggcgg cgcgactaaa gacagcgggc tgcccgcacc cgcacgcgcg ccccagccgt

600

cgagccagaa cagagtaccg gtgaatggtg aaaacaaagc taacgtcgcc tcgccgccga

660

cgagcatagc cgaggtcgcg gctccggatc ccgcagctac catttccatc agtgacaagg

720

cgccagagtc cgttgtccca gccgagaagg cgccgccgtc gtccggctca aatttcgtgc

780

cctcggcttc tgctcccggg tctgacactg tcagcgacgt ggaacttgaa ctgaagaagg

840

gtgcggtcat tgtcaaagaa gctccaaacc caaaggctct ttcgccgcct gcagcacccg

900

ctgtacaaca agacctttgg gacttcaaga aatacattgg tttcgaggag cccgtggagg

960

ccaaggatga tggccgggct gttgcagatg atgcgggctc cttcgaacac caccagaatc

1020

acgattccgg gcctttggca ggggagaacg tcatgaacgt ggtcgtcgtg gctgctgaat

1080

gttctccctg gtgcaaaaca ggtggtcttg gagatgttgc cggtgctttg cccaaggctt

1140

tggcgaagag aggacatcgt gttatggttg tggtaccaag gtatggggac tatgaggaag

1200

cctacgatgt cggagtccga aaatactaca aggctgctgg acaggatatg gaagtgaatt

1260

atttccatgc ttatatcgat ggagttgatt ttgtgttcat tgacgctcct ctcttccgac

1320

accgccagga agacatttat gggggcagca gacaggaaat tatgaagcgc atgattttgt

1380

tctgcaaggc cgctgtcgag gttccatggc acgttccatg cggcggtgtc ccttatgggg

1440

atggaaatct ggtgtttatt gcaaatgatt ggcacacggc actcctgcct gtctatctga

1500

aagcatatta cagggaccat ggtttgatgc agtacactcg gtccatatg gtgatacata

1560

acatcgctca cccaggccgt ggcccagtag atgagttccc gttcaccgag ttgcctgagc

1620

actacctgga acacttcaga ctgtacgacc ccgtgggtgg tgaacacgcc aactacttcg

1680

ccgccggcct gaagatggcg gaccaggttg tcgtcgtgag cccggggtac ctgtgggagc

1740

tgaagacggt ggagggcggc tggggggcttc acgacatcat acggcagaac gactggaaga

1800

cccgcggcat cgtgaacggc atcgacaaca tggagtggaa ccccgaggtg gacgtccacc

1860

tcaagtcgga cggctacacc aacttctccc tggggacgct ggactccggc aagcggcagt

1920

gcaaggaggc cctgcagcgg gagctgggcc tgcaggtccg cggcgacgtg ccgctgctcg

1980

gcttcatcgg gcgcctggac gggcagaagg gcgtggagat catcgcggac gcgatgccct

2040

ggatcgtgag ccaggacgtg cagctggtca tgctgggcac cgggcgccac gacctggagg

2100

gcatgctgcg gcacttcgag cgggagcacc acgacaaggt gcgcgggtgg gtggggttct

2160

ccgtgcggct ggcgcaccgg atcacggccg gcgccgacgc gctcctcatg ccctcccggt

2220

tcgagccgtg cggactgaac cagctctacg ccatggccta cggcaccgtc cccgtcgtgc

2280

atgccgtcgg cggcctgagg gacaccgtgc cgccgttcga ccccttcaac cactccgggc

2340

tcgggtggac gttcgaccgc gcagaggcgc agaagctgat cgaggcgctc gggcactgcc

2400

tccgcaccta ccgggactac aaggagct ggagggggct ccaggagcgc ggcatgtcgc

2460

aggacttcag ctgggagcat gccgccaagc tctacgagga cgtcctcgtc aaggccaagt

2520

accagtggtg aacgctagct gctagccggt ccagccccgc atgcgtgcat gacaggatgg

2580

aattgcgcat tgcgcacgca ggaatgtgcc atggagcgcc ggcatccgcg aagtacagtg

2640

acatgaggtg tgtgtggttg agacgctgat tccgatctgg tccgtagcag agtagagcgg

2700

aggtagggaa gcgctccttg ttacaggtat atgggaatgt tgttaacttg gtattgtaat

2760

ttgttatgtt gtgtgcatta ttacaaaggg caa

2793

<210> 6

<211> 2846

<212> DNA

<213> Triticum aestivum

<400> 6

ggagaatagc cacatccctg gtttggagag accatcgcag caacaaccat taccaccaca

60

acaaacatta tcgcaccaac aaccacaaca acccatccag tccagcccac tgccaccgcg

120

ctactctcca ctcccactgc caccacctcc gcctgcgccg cgctctgggc ggaccaccc

180

gcgaaccgta ccatctcccg ccccgatcca tgtcgtcggc ggtcgcgtcc gccgcatcct

240

tcctcgcgct cgcgtcagcc tcccccggga gatcacgcag gcgggcgagg gtgagcgcgc

300

agccacccca cgccggggcc ggcaggttgc actggccgcc gtggccgccg cagcgcacgg

360

ctcgcgacgg agctgtggcg gcgctcgccg ccgggaagaa ggacgcgggg atcgacgacg

420

ccgccgcgtc cgtgaggcag ccccgcgcac tccgcggtgg cgccgccacc aaggtcgcgg

480

agcgaaggga tcccgtcaag acgctcgacc gcgacgccgc ggaaggcggc gggccgtccc

540

cgccggcagc gaggcaggac gccgcccgtc cgccgagtat gaacggcatg ccggtgaacg

600

gcgagaacaa atctaccggc ggcggcggcg cgactaaaga cagcgggctg cccacgcccg

660

cacgcgcgcc ccatccgtcg acccagaaca gagcaccggt gaacggtgaa aacaaagcta

720

acgtcgcctc gccgccgacg agcatagccg aggccgcggc ttcggattcc gcagctacca

780

tttccatcag cgacaaggcg ccggagtccg ttgtcccagc tgaggagacg ccgccgtcgt

840

ccggctcaaa tttcgagtcc tcggcctctg ctcccgggtc tgacactgtc agcgacgtgg

900

aacaagaact gaagaagggt gcggtcgttg tcgaagaagc tccaaagcca aaggctcttt

960

cgccgcctgc agcccccgct gtacaagaag acctttggga tttcaagaaa tacattggtt

1020

tcgaggagcc cgtggaggcc aaggatgatg gccgggctgt cgcagatgat gcgggctcct

1080

ttgaacacca ccagaatcac gactccggac ctttggcagg ggagaatgtc atgaacgtgg

1140

tcgtcgtggc tgctgagtgt tctccctggt gcaaaacagg tggtctggga gatgttgcgg

1200

gtgctctgcc caaggctttg gcaaagagag gacatcgtgt tatggttgtg gtaccaaggt

1260

atggggacta tgaagaagcc tacgatgtcg gagtccgaaa atactacaag gctgctggac

1320

aggatatgga agtgaattat ttccatgctt atatcgatgg agttgatttt gtgttcattg

1380

acgctcctct cttccgacac cgtcaggaag acatttatgg gggcagcaga caggaaatta

1440

tgaagcgcat gattttgttc tgcaaggccg ctgttgaggt tccatggcac gttccatgcg

1500

gcggtgtccc ttatggggat ggaaatctgg tgtttattgc aaatgattgg cacacggcac

1560

tcctgcctgt ctatctgaaa gcatattaca gggaccatgg tttgatgcag tacactcggt

1620

ccattatggt gatacataac atcgctcacc agggccgtgg ccctgtagat gaattcccgt

1680

tcaccgagtt gcctgagcac tacctggaac acttcagact gtacgacccc gtgggtggtg

1740

aacacgccaa ctacttcgcc gccggcctga agatggcgga ccaggttgtc gtggtgagcc

1800

ccgggtacct gtgggagctg aagacggtgg agggcggctg ggggcttcac gacatcatac

1860

ggcagaacga ctggaagacc cgcggcatcg tcaacggcat cgacaacatg gagtggaacc

1920

ccgaggtgga cgcccacctc aagtcggacg gctacaccaa cttctccctg aggacgctgg

1980

actccggcaa gcggcagtgc aaggaggccc tgcagcgcga gctgggcctg caggtccgcg

2040

ccgacgtgcc gctgctcggc ttcatcggcc gcctggacgg gcagaagggc gtggagatca

2100

tcgcggacgc catgccctgg atcgtgagcc aggacgtgca gctggtgatg ctgggcaccg

2160

ggcgccacga cctggagagc atgctgcagc acttcgagcg ggagcaccac gacaaggtgc

2220

gcgggtgggt ggggttctcc gtgcgcctgg cgcaccggat cacggcgggg gcggacgcgc

2280

tcctcatgcc ctcccggttc gagccgtgcg ggctgaacca gctctacgcc atggcctacg

2340

gcaccgtccc cgtcgtgcac gccgtcggcg gcctcaggga caccgtgccg ccgttcgacc

2400

ccttcaacca ctccggggctc gggtggacgt tcgaccgcgc cgaggcgcac aagctgatcg

2460

aggcgctcgg gcactgcctc cgcacctacc gagacttcaa ggagagctgg agggccctcc

2520

aggagcgcgg catgtcgcag gacttcagct gggagcacgc cgccaagctc tacgaggacg

2580

tcctcgtcaa ggccaagtac cagtggtgaa cgctagctgc tagccgctcc agccccgcat

2640

gcgtgcatga caggatggaa ctgcattgcg cacgcaggaa agtgccatgg agcgccggca

2700

tccgcgaagt acagtgacat gaggtgtgtg tggttgagac gctgattcca atccggcccg

2760

tagcagagta gagcggaggt atatgggaat cttaacttgg tattgtaatt tgttatgttg

2820

tgtgcattat tacaatgttg ttactt

2846

<210> 7

<211> 6898

<212> DNA

<213> Triticum aestivum

<400> 7

gggggccgtt cgtacgtacc cgcccctcgt gtaaagccgc cgccgtcgtc gccgtccccc

60

gctcgcggcc atttccccgg cctgaccccg tgcgtttacc ccacagagca cactccagtc

120

cagtccagcc cactgccgcc gcgctactcc ccactcccgc tgccaccacc tccgcctgcg

180

ccgcgctctg ggcggaggac caacccgcgc atcgtaccat cgcccgcccc gatcccggcc

240

gccgccatgt cgtcggcggt cgcgtccgcc gcgtccttcc tcgcgctcgc ctccgcctcc

300

cccgggagat cacgcaggcg ggcgagggtg agcgcgccgc caccccacgc cggggccggc

360

aggctgcact ggccgccgtg gccgccgcag cgcacggctc gcgacggagg tgtggccgcg

420

cgcgccgccg ggaagaagga cgcgagggtc gacgacgacg ccgcgtccgc gaggcagccc

480

cgcgcacgcc gcggtggcgc cgccaccaag gtagttggtt cgttatgact tgctgtatgg

540

cgcgtgcgcc tcgagatcag ctcacgaatt gtttctacaa aacgcacgcg ctcgtgtgca

600

ggtcgcggag cggagggatc ccgtcaagac gctcgatcgc gacgccgcgg aaggtggcgc

660

gccggcaccg ccggcaccga ggcaggacgc cgcccgtcca ccgagtatga acggcacgcc

720

ggtgaacggt gagaacaaat ctaccggcgg cggcggcgcg accaaagaca gcgggctgcc

780

cgcacccgca cgcgcgcccc atccgtcgac ccagaacaga gtaccagtga acggtgaaaa

840

caaagctaac gtcgcctcgc cgccgacgag catagccgag gtcgtggctc cggattccgc

900

agctaccatt tccatcagtg acaaggcgcc ggagtccgtt gtcccagccg agaagccgcc

960

gccgtcgtcc ggctcaaatt tcgtggtctc ggcttctgct cccaggctgg acattgacag

1020

cgatgttgaa cctgaactga agaagggtgc ggtcatcgtc gaagaagctc caaacccaaa

1080

ggctctttcg ccgcctgcag cccccgctgt acaagaagac ctttgggact tcaagaaata

1140

cattggcttc gaggagcccg tggaggccaa ggatgatggc tgggctgttg cagatgatgc

1200

gggctccttt gaacatcacc agaaccatga ttccggacct ttggcagggg agaacgtcat

1260

gaacgtggtc gtcgtggctg ctgaatgttc tccctggtgc aaaacaggca tggacattac

1320

ctcttcagtc tctcttcccg ttgttcataa aactttgctc gaatcactca taagaacaaa

1380

cattgtgttg cataggtggt cttggagatg ttgcgggtgc tctgcccaag gctttggcaa

1440

agagaggaca tcgtgttatg gtactgcagg ctttcactta actctgttga gtccatatgt

1500

tcgaataata tcagtgattg gcataatgtt attaagtgca agacatgaaa gtgttcttct

1560

gttagagtat ttcatagcca accctggagg ttaggttgtt ggggcctact gggtgcggga

1620

gggggtttgc aaaaagtggt ggttagcagt cggatttcac aaataaggag gctgataacc

1680

acgccatcag tgaagggaat gagtgtcggg tacccgatcg accgttttgc ccgacgtcag

1740

gtttacctgc cctgtagatc cgaataagta gttcctatcc tcagttaagt accaaatatc

1800

gccagcaccc gtgtgtgtat ttatagtact ggatgatcaa tttatcaaca tttccggtta

1860

atggttgcta tcatattcac tgtaattgtt agtaaacagt ggatgtttgt aatgtagatg

1920

atggctaaat gtatgttgtc aagctttcat tttaaagaaa attttattgg gagctagttt

1980

tcgggtttgg ttagagccac caaaacccca gaatttttgg gagttggctt gtgacagagg

2040

gttttgggga gttaactttc gggattcagt tagagacgct cttactagtt ccagtaaaga

2100

gtaaactatt ttctgcagtc atcccaattg ttctgtagaa attaaaagta gaaaatagtt

2160

gtggtatcat ataaaccata tattattcaa aatctagaat catggacttg gctagacttt

2220

gatgatctga aattttaaat ttgatgataa ttgagaaatg atcctttcta tcttaggttg

2280

tggtaccaag gtatggggac tatgaggaag cctacgatgt cggagtccga aaatactaca

2340

aggctgctgg acaggtaagc gaaaatgcaa tcaaagggga gctgaaattt caatgcttac

2400

tatcataata aatcaatttt aagtaaaaaa atttgtcctg caggatatgg aagtgaatta

2460

tttccatgct tatatcgatg gagttgattt tgtgttcatt gacgctccta tcttccgaca

2520

ccgtcaggaa gacatttatg ggggcagcag acaggttaat tttctatatg ttggtgtttg

2580

attgcactga taaactgaga ataagccaag gcctactgac tggcatatga ttacacattt

2640

tattttttca ggaaattatg aagcgcatga ttttgttctg caaggccgct gtcgaggtat

2700

cctctccaac tcaattgaca acctattacc actatacaat tatgtgtatg catgtatttc

2760

aacagatacg taatctccct tgtgaagtgt atatatacta ataacatttc aatacctcac

2820

atgcacattt ggtcaagcgt tatgatttaa cttctgataa tctattgcac tgatgaacaa

2880

taatattgat gatccttgtt acttcatcgt tatgtttatg ttctcttcac cggcgcattg

2940

attttggaaa tagcatttcc acctgccaca aacaataata tatactccta ctttcatcca

3000

atgtagatat tttcgcactt ggcatatcat cccattaaat attattggtc catcattttt

3060

attcctctat aatttgcagg ttccttggca cgttccatgc ggcggtgtcc cttatgggga

3120

tggaaatctg gtgtttattg caaatgattg gcacacggca ctcctgcctg tctatctgaa

3180

agcatattac agggaccatg gtttgatgca gtacactcgg tccattatgg tgatacataa

3240

catcgcgcac caggttcctt ttctcctaat cttgtttttt ctctagtctc tactattcac

3300

tccacattgt ttgaggaaac taaaggggtt gcaaaattat gatggcttat gaaagttatg

3360

gaggtaaatg catcagtggt gcttgaactt gtcacgcatg ttcactttgg tgcttacagt

3420

tgtagactac ggaaaactgg tgcaaaaact tggctattgt gtgcaatacg gtgtattttc

3480

cgtatgtagg gtcaaatgtt gcctatgtgg cattgtattc ccgtctatag atgttagacc

3540

gtgcctacat cgccattggg cccacacact ccctattaca tgtgggaccc acttgtcagc

3600

ctatgacata aataaaatgg aaatttataa taaaaatgat ggcctggggt cttgaaaatg

3660

ggacctcgca ggtatgccgc tagccagcac gccctaatca ttaatcccct atgcacttca

3720

gtatgtgtgt gtctgtgtgt ggagtcgggg gggggggggg tatgtattct tatatccttt

3780

gctctaaggc tatcattggc gtgctagcac cgccgggtct ccatcaacac cgacatcatc

3840

cacgacccca tccagctctt cctcaacaag cccacctcca gcctcaactc gggcagcacc

3900

ttcatggtgg cctaggtgct ctgcaccatc gctcgaagtg gcaacgtcgt tgtcatgacc

3960

atccaccaac ccaacacgca aaatcctcaa catcatttga cagtgagcat gcccctcttg

4020

tcatttcccc ctcataccca aacctgtctc gataaccctt ggagctgcac aagttgtgac

4080

catcgcctgc gtcgctgcac aacgcctgac ctagccggac cattatagaa gcctgccttg

4140

ggagcccata cctccctgca catcctcctc tttccccata gaccgtgccg ccatcgcaaa

4200

tcgacttctc ctctcctcct tctcctgctc tggccgtttt ccccgccgcg aagctgcaat

4260

ccatggcgag ttggccatgg ccctattccc caattgctcg cactaggagg tcctccttga

4320

agcctagcac ctttccccct cactaattgc aagttgggga gcccctcacg agctccctac

4380

attggccgta gtcgcctgcc gcctcaactc tggtccagac ctcgttcccg tggcctcgac

4440

gacatctcct cgacctccca ttccacacgc ggcctggaga ggatcaccgc atgttcatcc

4500

atccgacccg aatcatcata gaaccaacgc cagagaggtc atcccgacga cgtcgcactg

4560

ttcctctatt tcccccaagc tgtgtcgcgt cataatataa gacgggcttg tttgtatctc

4620

taggggtcat cgggttcaat ggctagctca tgcatggacc tgactttagg tcccaggttc

4680

gaacccccgc gtgcacataa tttatttgct atttatttct cctatctact aataagtggg

4740

acccacacat catactaagc cctttttgtc tcttgcctgc tgataagtgg gacccacacg

4800

caatacttag ccagagagag aacatgagct tgttggtgcc gcgttggcaa gccacgccag

4860

cagtcttaac ggctacaaac agaggatatg gtgtcacatc aacgtgcaga gcgtttacga

4920

atggaaagtg tactatatgc acacaagagc cagagccagg tttttgcacc agttttttgt

4980

attctacaac tgcgagcacc aaagtgtaca tgccgaacca aagtgaacac ggcgagtcca

5040

ttcttttctg gtacgatggg tggctcaaag acaccccaat agaagctatc acctcggaca

5100

ttgccaattg ggtgccgaac tacattaaag tggcaaggtc agttgattgc gctatgtgtt

5160

ggatcaggga cataaacgat tccataaata ttgcaatgtt cattcaaatt cttaacattt

5220

gcgaggcgct tcatgatttc catctccctc atatcagaga catttggtcg tgtacactaa

5280

atttctcagg tcacttctcg tctaaatccg catatgtagc tcacttcaat gacttgactt

5340

tggtccagct aacgccattt ggcgctcttg ggcccctttg cgtagcaatt ttttcatatg

5400

gctcgctccg cgcaatagga tttggatcac gggcagacgc gctagatgag gtcttccaca

5460

caatgaacat tgcgttcttt gctctgctct tccagaagac acttgtgatt ttattacgag

5520

ttgtgccata gatgccggtg ggtttcagct aggaacaggg tgtcaccttc ggacaagaag

5580

aagttgcata gtttggtcgt cttaactgct tggtcgattt ggaaggagca caacaacagt

5640

ctttgaaggc aaagctaatt ccctcgatca agttattaga cggatcaaat gtggtacagt

5700

gccatggcta gttgcttgga gtcactttta agctaggtcg cttgccatca cgctttgtgt

5760

taagcgcttg gggtcgcttt tgctcaattt gtattttgtt gttatgtgtt tttagttatg

5820

tagcctgaac tttctggact tagttttttc ctctataatg atcacatgct ttggtcagtt

5880

attcctttct tgggtactcc gttgggctaa ttctttctct tgattgatgt tgtatatgca

5940

gggccgtggc ccagtagatg aattcccgtt caccgagttg cctgagcact acctggaaca

6000

cttcagactg tacgaccccg tgggtggtga gcacgccaac tacttcgccg ccggcctgaa

6060

gatggcggac caggttgtcg tggtgagccc cgggtacctg tgggagctca agacggtgga

6120

gggcggctgg gggcttcacg acatcatacg gcagaacgac tggaagaccc gcggcatcgt

6180

caacggcatc gacaacatgg agtggaaccc cgaggtggac gtccacctcc agtcggacgg

6240

ctacaccaac ttctccctga gcacgctgga ctccggcaag cggcagtgca aggaggccct

6300

gcagcgcgag ctgggcctgc aggtccgcgc cgacgtgccg ctgctcggct tcatcggccg

6360

cctggacggg cagaagggcg tggagatcat cgcggacgcc atgccctgga tcgtgagcca

6420

ggacgtgcag ctggtcatgc tgggcaccgg ccgccacgac ctggagagca tgctgcggca

6480

cttcgagcgg gagcaccacg acaaggtgcg cgggtgggtg gggttctccg tgcgcctggc

6540

gcaccggatc acggcgggcg ccgacgcgct cctcatgccc tcccggttcg agccgtgcgg

6600

gctgaaccag ctctacgcca tggcctacgg caccgtcccc gtcgtgcacg ccgtcggcgg

6660

gctgagggac accgtgccgc cgttcgaccc cttcaaccac tccggcctcg ggtggacgtt

6720

cgaccgcgcc gaggcgcaca agctgatcga ggcgctcggg cactgcctcc gcacctaccg

6780

ggactacaag gagagctgga ggggcctcca ggagcgcggc atgtcgcagg acttcagctg

6840

ggagcatgcc gccaagctct acgaggacgt cctcctcaag gccaagtacc agtggtga

6898

<210> 8

<211> 6811

<212> DNA

<213> Triticum aestivum

<400> 8

gggggccgtt cgtacgtacc cacccctcgt gtaaagccgc cgccgtcgtc gccgtccccc

60

gctcgcggcc atttcctcgg cctgaccccg tgcgtttacc ccacacagag cacactccag

120

tccagtccag cccactgccg cgctactccc cactcccact gccaccacct ccgcctgcgc

180

cgcgctctgg gcggaccaac ccgcgcatcg tatcacgatc acccaccccg atcccggccg

240

ccgccatgtc gtcggcggtc gcgtccgccg cgtccttcct cgcgctcgcg tccgcctccc

300

ccggggagatc acggaggagg acgaggtga gcgcgtcgcc accccacacc ggggctggca

360

ggttgcactg gccgccgtcg ccgccgcagc gcacggctcg cgacggagca gtggccgcgc

420

gcgccgccgg gaagaaggac gcggggatcg acgacgccgc gcccgcgagg cagccccgcg

480

cactccgcgg tggcgccgcc accaaggtag ttagttatga ccaagttatg acgcgtgcgc

540

gcgccttgag atcatcgtcg tctcgctgac aaattgttta tacaaaacgc acgcgcgcgc

600

gtgtgtgcag gttgcggagc ggagggatcc cgtcaagacg ctcgatcgcg acgccgcgga

660

aggtggcgcg ccgtccccgc cggcaccgag gcaggaggac gcccgtctgc cgagcatgaa

720

cggcatgccg gtgaacggtg aaaacaaatc taccggcggc ggcggcgcga ctaaagacag

780

cgggctgccc gcacccgcac gcgcgcccca gccgtcgagc cagaacagag taccggtgaa

840

tggtgaaaac aaagctaacg tcgcctcgcc gccgacgagc atagccgagg tcgcggctcc

900

ggatcccgca gctaccattt ccatcagtga caaggcgcca gagtccgttg tcccagccga

960

gaaggcgccg ccgtcgtccg gctcaaattt cgtgccctcg gcttctgctc ccgggtctga

1020

cactgtcagc gacgtggaac ttgaactgaa gaagggtgcg gtcattgtca aagaagctcc

1080

aaacccaaag gctctttcgc cgcctgcagc acccgctgta caacaagacc tttgggactt

1140

caagaaatac attggtttcg aggagcccgt ggaggccaag gatgatggcc gggctgttgc

1200

agatgatgcg ggctccttcg aacaccacca gaatcacgat tccgggcctt tggcagggga

1260

gaacgtcatg aacgtggtcg tcgtggctgc tgaatgttct ccctggtgca aaacaggcat

1320

ggacattacc tcttcagtgt cttttttctc tctgttcata aaacctggct tgaattactc

1380

ataagaacaa acgttgtgtt gcataggtgg tcttggagat gttgccggtg ctttgcccaa

1440

ggctttggcg aagagaggac atcgtgttat ggtaccacat gctttcattt aactctgttg

1500

aatccatatg ttcgaataat atcagtgagc agtataatgt tattaagtgc aagacatgaa

1560

agtgttcttc tgttatagag tatttcatag ccaaccctgg aggttaggtt gttggggcct

1620

actgggtgtg ggagggggtt tgaaaaaagt gttggttagc agtcggattt cacaaagaac

1680

gctgataacc acgccatcag tgaagggaat gaatgtcggg tacccgatcg accgttttgc

1740

ccgacgtcag gtttacccgc cctgtaggtc cgaataagta gttcctatcc tcagttaagt

1800

accaaatatc ggcagcgccc gtgtgtgtat ttatagtact ggatgatcaa tttatcaaca

1860

ttttcagtta atggttgcta tcatattcac tgtaattgtt agtaaacagt ggatgtttgt

1920

aatgtagatg atggctaaat gtatgttgtc aagctttcat ttcaatgcaa tttttattgg

1980

gagctagttt tggggttcgg ttagagccac caaaacccca gaatttctgg gagttggctt

2040

gtgagagagg gttttggcga gttgactttc gggattcagt tagagacgct cttactagtt

2100

ccagtaaaga agtaaactat tttctgcaga catcccaatt attctgtaga aattagaagt

2160

agaaaatagt tatggtatca tataaccata tattattcaa aatctagaat catggacttg

2220

gctagacttt gatgatctga aattttaaat ttgatgataa ttgagaaatg atcctttcta

2280

tcttaggttg tggtaccaag gtatggggac tatgaggaag cctacgatgt cggagtccga

2340

aaatactaca aggctgctgg acaggtaagc gaaaatgcaa tcaaagggga gctgaaattt

2400

caatgcttac tatcataata aatcaatttt aagtgttttt ttttgtcctg caggatatgg

2460

aagtgaatta tttccatgct tatatcgatg gagttgattt tgtgttcatt gacgctcctc

2520

tcttccgaca ccgccaggaa gacatttatg ggggcagcag acaggttaat cttctatatg

2580

ttggtgtttg attgcactga taaactgaga acaagccaag gcctactgac cggcatatga

2640

ttacacattt tattttttca ggaaattatg aagcgcatga ttttgttctg caaggccgct

2700

gtcgaggtat cctctccaac tcaattgaca acctattaca actatacaat tatgtgtatg

2760

catgtatttc aacagatacg taatctcttg tgaagtgcat atatactaac aacatttcaa

2820

taccttacat gcacatttgg tcaagcgtta tgatttaact tctaataatc tattgcactg

2880

atgaacaatt atcttgatga tccttggtac ttcatcgtta tgtttccatg ttctcttcac

2940

cgattgattt ggaaatagca tttccacctg ccacaaacaa taatatacac tcctactttc

3000

atccaatgta gatattttcg cacttggcat atcatcccat taaatattat tggtccatca

3060

tttttattcc tctataattt gcaggttcca tggcacgttc catgcggcgg tgtcccttat

3120

ggggatggaa atctggtgtt tattgcaaat gattggcaca cggcactcct gcctgtctat

3180

ctgaaagcat attacaggga ccatggtttg atgcagtaca ctcggtccat tatggtgata

3240

cataacatcg ctcaccaggt tccttttctc caaatcttga tttttctcta gtctctacta

3300

tttactccac attgtttgag gaaactaaac gggttgcaaa attatgatgg cttatgaaag

3360

ttatagtctt atataggtaa atgcaccagt ggtgcttgca cttgtcacgc gtgttcactt

3420

tggtgcttac agttgtagac aataaaaaac tagtgcaaaa acttggctgt tgtgtgcaat

3480

acggtgcatt ttccgtatgt aggagtcaaa tattgcctgt gtggcattgt attcccgtct

3540

atagctgtta gaccatgcct acgtcgccat tgggcccaca caccctctat tacatgtggg

3600

ccccacttgt cagcctatga cataaataaa tggaaattta taatgaaaat gatggcctgg

3660

ggtcttgaaa atgggccgtc gcaggtatgc tggtagccag catgccctaa tcattaatcc

3720

ccctatgcac ttcatgtctt gtgtatgtgt gtgtgggaaa gggggggggt atgtatgctt

3780

atgcttatat cctttgctcc aaggctgcca tcctcaacaa gcccacctcc agcttcaaca

3840

cggccagcgc cttcatgatg gcccaggtgc tccgcaccat cgatcgaagc ggcaacgtcg

3900

tcgtcacgac catccaccaa cccaacgcac aaaatcctca ggctccgttc ggtacggagg

3960

aagagaaaat gcaggaaaaa acaacttcat gggaacaagg tttggtgaac agtaaaaaca

4020

tgtggaatct gaaaatgtag gtaccagaaa aaccggcctg ttcggtttgc aggaaaaagc

4080

atacttgcag cagcactgtt tggccctttc cagtgtaagg ctaaccatag tgggagtaac

4140

ataactaata ttatgtactt ggaactcaca aacatgctta tgtggcaggc aattaaagaa

4200

gagagagaga gtcatagtaa catagttaga taccgtatca taataaatat tatgttacta

4260

tgtgtcatgc atgacaataa atgagaccat ctgtgatact acgttatgat attatgcact

4320

atagatgtag tatcatacac tagtatcata tgcatgatac tagtgtatgt tactccccac

4380

tatgaccagc ctaacgaggg gatgggcatc agtagtgatt accagttttt attatttttt

4440

attcggctgg acgccctact cttgtggtgc gtagcggaaa aaggcagtgc tagcttcggg

4500

actccgcgag cacatgaggt tctaccggat tttagatttc ctataaaaag tacaggctca

4560

cgcaactttt caatggaaca gaccatcaag attcctttga accgaacgca ctgcatgcaa

4620

gaattccaat gaaaaacgag ccgtcaaatg ttcctgcgaa tttcctctat accgaacaga

4680

ccctcaacat cctcaaatag tgagcatgcc cctcttgtcc tttccccctc gtacccaaac

4740

gccatttggc gctcttggtg ttggatcatt tgcctcgggc atttgccaat ttggcgccga

4800

accatattaa agctatgact acttggtgtt ggatcaggga cgcaaagaat cccataaata

4860

ttgcaacgtt cattcaaatt cttaacattt gcgaggcgct tcatgatttc catctccgtc

4920

aggtctgaga catttggtcg tgtacactaa atttctcagg tcacttctcg tctaaatccg

4980

catatgtagc tcacttcaat gacttgcctt tggtctagct aacgccattt ggcgctcttg

5040

ggcccccttg cttagcaaat ttttcatatg gctcgcactg cgcaagagga tttagatcac

5100

gggcagacgc gctagacgag gtcttccgca caatgaacat tgcgttcttt gctctgctct

5160

tcccggagac acttgtgatc ttattacgag ttgtgccatt tcaaacatct gtctctccat

5220

ggtcgctcca gccatagatg ccttgttctc tgaatggtgg gtttcagcta ggaacagggt

5280

gccaccttcg acaagaagtt gcatagtttg gtcgtcttga ctgcttggtc gatttggaag

5340

gaacgcaaca taagagtctt tgaaggcaaa gctaatttct ttgatcaagt tattagccag

5400

atcaaatgtg atgtattcta ctggtacaag gccggggcta tttgctttga gtcacttttt

5460

agctaaggcc gcttgggcta agcgcttggg gtcgtttttg ctcaactgta gcctgaactt

5520

tctggacttt gtaatttttt ttatcctcta taatgatcac atacagctct cctgcatggt

5580

tcgaaaagga aaaatgtgaa catgtgtggc aagtttaagc acaacccgtg catttacctc

5640

aaagttatac aacactgaca tgctgaatta catttttttt gaggatctga catgccgaat

5700

tacatgcttt ggacagttat tcatttcttc ggtacaccat tggctaatta tttctcttga

5760

cagttgctga attagtacat gctttggtcg cagttattcc tttgttcggt actctgttgg

5820

gctaattatt tctcttgatt gatgttgcat gcagggccgt ggcccagtag atgagttccc

5880

gttcaccgag ttgcctgagc actacctgga acacttcaga ctgtacgacc ccgtgggtgg

5940

tgaacacgcc aactacttcg ccgccggcct gaagatggcg gaccaggttg tcgtcgtgag

6000

cccggggtac ctgtgggagc tgaagacggt ggagggcggc tgggggcttc acgacatcat

6060

acggcagaac gactggaaga cccgcggcat cgtgaacggc atcgacaaca tggagtggaa

6120

ccccgaggtg gacgtccacc tcaagtcgga cggctacacc aacttctccc tggggacgct

6180

ggactccggc aagcggcagt gcaaggaggc cctgcagcgg gagctgggcc tgcaggtccg

6240

cggcgacgtg ccgctgctcg gcttcatcgg gcgcctggac gggcagaagg gcgtggagat

6300

catcgcggac gcgatgccct ggatcgtgag ccaggacgtg cagctggtca tgctgggcac

6360

cgggcgccac gacctggagg gcatgctgcg gcacttcgag cgggagcacc acgacaaggt

6420

gcgcgggtgg gtggggttct ccgtgcggct ggcgcaccgg atcacggccg gcgccgacgc

6480

gctcctcatg ccctcccggt tcgagccgtg cggactgaac cagctctacg ccatggccta

6540

cggcaccgtc cccgtcgtgc atgccgtcgg cggcctgagg gacaccgtgc cgccgttcga

6600

ccccttcaac cactccggggc tcgggtggac gttcgaccgc gcagaggcgc agaagctgat

6660

cgaggcgctc gggcactgcc tccgcaccta ccgggactac aagggagagct ggagggggct

6720

ccaggagcgc ggcatgtcgc aggacttcag ctgggagcat gccgccaagc tctacgagga

6780

cgtcctcgtc aaggccaagt accagtggtg a

6811

<210> 9

<211> 6950

<212> DNA

<213> Triticum aestivum

<400> 9

gggggccgtt cgtacgtacc cgcccctcgt gtaaagccgc cgccgtcgtc gccgtccccc

60

gctcgcggcc atttcttcgg cctgaccccg ttcgtttacc cccacacaga gcacactcca

120

gtccagtcca gcccactgcc accgcgctac tctccactcc cactgccacc acctccgcct

180

gcgccgcgct ctgggcggac caacccgcga accgtaccat ctcccgcccc gatccatgtc

240

gtcggcggtc gcgtccgccg catccttcct cgcgctcgcg tcagcctccc ccggggagatc

300

acgcaggcgg gcgagggtga gcgcgcagcc accccacgcc ggggccggca ggttgcactg

360

gccgccgtgg ccgccgcagc gcacggctcg cgacggagct gtggcggcgc tcgccgccgg

420

gaagaaggac gcggggatcg acgacgccgc cgcgtccgtg aggcagcccc gcgcactccg

480

cggtggcgcc gccaccaagg tagttagtta tgaccaagtt atgacgcgtg cgcgcgcctc

540

gagatcatcg tcgtctcgct cacgaattgt ttatttatac aaaacgcacg cccgcgtgtg

600

caggtcgcgg agcgaaggga tcccgtcaag acgctcgacc gcgacgccgc ggaaggcggc

660

gggccgtccc cgccggcagc gaggcaggac gccgcccgtc cgccgagtat gaacggcatg

720

ccggtgaacg gcgagaacaa atctaccggc ggcggcggcg cgactaaaga cagcgggctg

780

cccacgcccg cacgcgcgcc ccatccgtcg acccagaaca gagcaccggt gaacggtgaa

840

aacaaagcta acgtcgcctc gccgccgacg agcatagccg aggccgcggc ttcggattcc

900

gcagctacca tttccatcag cgacaaggcg ccggagtccg ttgtcccagc tgagaagacg

960

ccgccgtcgt ccggctcaaa tttcgagtcc tcggcctctg ctcccgggtc tgacactgtc

1020

agcgacgtgg aacaagaact gaagaagggt gcggtcgttg tcgaagaagc tccaaagcca

1080

aaggctcttt cgccgcctgc agcccccgct gtacaagaag acctttggga tttcaagaaa

1140

tacattggtt tcgaggagcc cgtggaggcc aaggatgatg gccgggctgt cgcagatgat

1200

gcgggctcct ttgaacacca ccagaatcac gactccggac ctttggcagg ggagaatgtc

1260

atgaacgtgg tcgtcgtggc tgctgagtgt tctccctggt gcaaaacagg catggacatt

1320

acctcttcag tctctcttcc tgttgttcat aaaactttgc tcgaattact cataagaaca

1380

aacattgtgt tgcataggtg gtctgggaga tgttgcgggt gctctgccca aggctttggc

1440

aaagagagga catcgtgtta tggtactaca agctttcatt taactctgtt gggtccatat

1500

gttcgaataa tatcagtgag tagtataatg ttattaagtg caagacatga aagtgttctt

1560

ttgtcatact ccctccgtaa attaatataa gagcgtttag attactactt tagtgatcta

1620

aacgctctta tagtagttta cagacggagt agagtatttc atagccaacc ctggaggtta

1680

ggttgctgag gcctactggg tgggggaggg ggtttgaaac aagtggtggt tagcagccag

1740

atttcacaaa gaaggaggct gataaccaca ccatcagtga aggaatgaat gtcgggtacc

1800

cgatcgaccg ttttgcccaa cgtcgggttt acccgcccta tagatccgaa taagtagttc

1860

ctatcttcaa ttaggtacca aatatcgcca gcgcccgtgt gtgtatttat actactggat

1920

gatcaattta tcaacatttc cggttaatgg tttctatcat attcactgta attgttagta

1980

aacagtagat gtttgtaatg tagatgatgg ataaatgtat gttgtcgagc tttcatttca

2040

atgcaatttt gattgggagc tagtttcgcg gttcggttag agccatcaaa accccagaat

2100

ttttgggagt tggcttgtga gagagggttt tggggagtta actttcggga ttcagttaga

2160

gacgctctta ctagttccag taaagagtaa actattttct gcaggcatcc caattattct

2220

gtagaaatta gaagtggaaa atagttatgg tatcatataa accatatatt attcaaaatc

2280

tagaatcatg gacttggcta gactttgata atctgaaatt ttaaatttga tgataattga

2340

gaaatgatcc tttctatctt aggttgtggt accaaggtat ggggactatg aagaagccta

2400

cgatgtcgga gtccgaaaat actacaaggc tgctggacag gtaagcaaaa atgcaatcga

2460

aggggagctg aaattttatt gcttattgtc ataataaatc aatttttaag tgtttttttt

2520

gtcctgcagg atatggaagt gaattatttc catgcttata tcgatggagt tgattttgtg

2580

ttcattgacg ctcctctctt ccgacaccgt caggaagaca tttatggggg cagcagacag

2640

gttaatcttc tatatgttgg tgtttgattg cactgataaa ctgagaacaa gccaaggcct

2700

actgactggc atatgattac acattttatt ttttcaggaa attatgaagc gcatgatttt

2760

gttctgcaag gccgctgttg aggtatctct ccaactcaat tgacaaccta ttaccactat

2820

acaattatgt gtatgcatgt atttcaacag atacataatc tcttgtgaag tgcatatata

2880

ctaataacat ttcaatacct tacatgcaca tttggtcaag cgttatgatt taacttctga

2940

taatctattg cactgatgaa caattatctt gatgatcctt gttacttcat cgttatgttt

3000

ccatgttctc ttcaccgcga attgatttgg aaatagcatt tccacctgcc acaaacaata

3060

atatacactc ctactttcat ccaatttaga tattttcgta cttggcatat catcccatta

3120

aatattattg gtccatcatt tttattcctc tataatttgc aggttccatg gcacgttcca

3180

tgcggcggtg tcccttatgg ggatggaaat ctggtgttta ttgcaaatga ttggcacacg

3240

gcactcctgc ctgtctatct gaaagcatat tacagggacc atggtttgat gcagtacact

3300

cggtccatta tggtgataca taacatcgct caccaggttc cttttctcct aatcttgatt

3360

tttctctagt ctctactatt tactccacat tgtttgagga aactaaacgg gttgcaaaat

3420

tatgatggct tatgaaagtt atagtcttat agaggtaaat gcaccagtgg tgcttgaact

3480

tgtcacgcgt gttcactttg gtgcttacag ttgtagacta tgaaaaacgg gtgcaaaaac

3540

ttgctgttgt gtgccatacg gtgcattttc cgtatgtagg agtcaaacgt tgcctatgtg

3600

ggcattgtat tcccgtctat agctgttaga ccgtgcctac gtcgccattg ggcccacaca

3660

ctctctattt acatgtgggc cccacttgtc aacctatgac ataaataaat ggaaatttat

3720

aataaaaatg atggcctggg gtcttgaaaa tgggacctcg caggtatgct ggtagccagc

3780

acgccctaaa cattaatccc ctatgcactt catgtcttgt gtatgtgtgt gtctgtgtgg

3840

ggaggggggg ggtatgtatg cttatatcct ttgctccaag gctaccatcc tcaacaagcc

3900

cacctccgct tcaacacggc cagcgccttc atgatggccc aggtgctccg caccatcgct

3960

caaagcggca acgtcgttgt catgaccatc caccaaccca acacacaaaa tcctcaacat

4020

ccgcaaatag tgagcatgcc cctcttgtcc tttcccctcg tacccaaaca tgtcttgata

4080

acccttggag ctgcacaagt tgtgaccatc gcctgcgtcg cctcatagag cccgacctag

4140

ccggaccgtt atagaagcct acttgggagc ccatacctcc ctgcacatcc tcctctttcc

4200

ccatagatcg tgccgccatc gcaaaccaac ttctcctctc cttctcccac tctggccgtt

4260

tcccccgccg cgaagctgca atacatgccg agttggccat ggccctattc cccaattgct

4320

cgcactagga ggtcctcctc taagcctagc accttttccc ctcaccaatt gcaagttggg

4380

gagcccctcg cgagctccct acgtcggctg cagttgcctg ccgcctcaac tctgatccag

4440

acctcgttcc cgtggcctcg gcgacatctc ctcgacctcc cattccacac gtggcctggc

4500

gaggatcacc gcatgttcat ccatgtgaac cgaatcatca tagaactaac accggagagg

4560

tcatcccgac ggcgtcgcac tgttcctcta ttccccccaa gccgtgtcgc gtcataatat

4620

aagacggact tatttgtatc ccttgggtca tcggttcaat ggctatttct ttctcctgtc

4680

tactgataag tgggacccac acgccacact aagccctttc tttctcctac ccgttgataa

4740

gtgggaccca cacacagtac ttagccagag agagaacatg agcttgttgg tgccacgtcg

4800

gcaagccatg tcagcagtct taacggctac aaacaacgga tatggtgtca cgtgagcgtt

4860

tacgaatgga aagtgcatca tactgcatgc gagagccaga gccaggtttt tgcaccagtt

4920

ttctgtattt tacaactgcg agcatcaaag tgtacatatg ccgaaccaaa gtgaacatgg

4980

tgagtccatt cttttctggt gcggtgggtg gctcaaagac accccaatag aagctattgc

5040

ctccgacatt gccaattcgg tgccgaacca tattgaagtg gtgaggtcag ttgcttgtgc

5100

tatgactact aggtattgga tgagggacat aaaggatctc ataaatattg caatgttcat

5160

tcaaattctt aacatttgcg aagcgcttca tgatttccat ctcccctaga tcagagacac

5220

ttggtcgtgt acactgaatt tctcaggtcg cttctcgtct aaatccgcat atgtagctca

5280

cttcaatgac ttgcctttgg tccagctaac gccatttgcg tagcaaattt ttcatatggc

5340

tcgctctgcg caagaggatt tggatcacgg gcagacgcgc tagacaaggt cttccgcaca

5400

atgaacattg agttttttga tccgctcttc ccgaagacac ttgtgatctt attacgagtt

5460

gtgccatttc aaacatctgt ctctccatgg tcgccccagc catagatgcc ttgttctctg

5520

aatggtgggt ttcagctagg aacagggtgc caccttcgga caagaagttg cgtagtttgg

5580

tcgtcttaac tgcttggttg atttggaagg aacacaacaa cagtctttga aggcaaagct

5640

aattccttcg atcaagttat tagacggatc aagtgtgatg aatcctactg gtacaatgcc

5700

gttgctagtt gcttggagtc actatttggc taggtcgctt gccatcccgc tctgtgctaa

5760

gcgcttgggg tcgcttttgc tcaatttgta ttttgttgtt atgtgttttt agtaatgtaa

5820

cctgaacttt ctggactaag tagaaaaaaa ttctcctcca taatgatcac atacagttct

5880

cctgcatggt tcgaaaaaaa aatgagaaca tccgtggcaa gtttaagcac caccggtgca

5940

tttttacctc aaagttatat acaacactga catgccgaat tacatgcttt ggtcagttat

6000

tccattcttc ggtactccgt tgggctaatt ctttctcttc atgttgcatg cagggccgtg

6060

gccctgtaga tgaattcccg ttcaccgagt tgcctgagca ctacctggaa cacttcagac

6120

tgtacgaccc cgtgggtggt gaacacgcca actacttcgc cgccggcctg aagatggcgg

6180

accaggttgt cgtggtgagc cccgggtacc tgtgggagct gaagacggtg gagggcggct

6240

gggggcttca cgacatcata cggcagaacg actggaagac ccgcggcatc gtcaacggca

6300

tcgacaacat ggagtggaac cccgaggtgg acgcccacct caagtcggac ggctacacca

6360

acttctccct gaggacgctg gactccggca agcggcagtg caaggaggcc ctgcagcgcg

6420

agctgggcct gcaggtccgc gccgacgtgc cgctgctcgg cttcatcggc cgcctggacg

6480

ggcagaaggg cgtggagatc atcgcggacg ccatgccctg gatcgtgagc caggacgtgc

6540

agctggtgat gctgggcacc gggcgccacg acctggagag catgctgcag cacttcgagc

6600

ggggagcacca cgacaaggtg cgcgggtggg tggggttctc cgtgcgcctg gcgcaccgga

6660

tcacggcggg ggcggacgcg ctcctcatgc cctcccggtt cgagccgtgc gggctgaacc

6720

agctctacgc catggcctac ggcaccgtcc ccgtcgtgca cgccgtcggc ggcctcaggg

6780

acaccgtgcc gccgttcgac cccttcaacc actccgggct cgggtggacg ttcgaccgcg

6840

ccgaggcgca caagctgatc gaggcgctcg ggcactgcct ccgcacctac cgagacttca

6900

aggagagctg gagggccctc caggagcgcg gcatgtcgca ggacttcagc

6950

<210> 10

<211> 676

<212> Protein

<213> Triticum aestivum

<400> 10

Met Leu Gly His Ile Ala Ser Ser Ser Ala Ala Phe Leu Leu Leu Val

1 5 10 15

Ala Ser Ser Ser Ser Ser Arg Arg Trp Arg Ser Ser Ser Pro Arg Ser

20 25 30

Phe Gly Ala Ala Gly Thr Arg Leu His Trp Glu Arg Arg Gly Phe Ser

35 40 45

Arg Asp Gly Ser Val Pro Cys Arg Arg Val Ser Ala Ala Ala Ala Val

50 55 60

Ala Gly Gly Glu Glu Gly Ala Gly Lys Ala Ile Ala Gly Glu Gly Ser

65 70 75 80

Arg Gln Ala Ala Ser Gly Gln Arg Gly Lys Leu Glu Ala Ala Glu Asn

85 90 95

Glu Asp Ala Val Ser Gln Lys Ser Val Ala Ser Ala Pro Arg Pro Asp

100 105 110

Ser Thr Val Ala Glu Gln His Trp Ala Ala Gly Ser Arg Ser Glu Val

115 120 125

Asp Pro Ser Ala Pro Val Ser Ala Ala Ala Ser Gly Tyr Trp Lys Asp

130 135 140

Val Val Val Ala Glu Gln Val Gly Ala Lys Val Asp Ala Gly Gly Asp

145 150 155 160

Ala Ala Lys Val Trp Ser Ser Pro Val Asp Ser Glu Asn Met Gly Ser

165 170 175

Ala Pro Leu Ala Gly Pro Asn Val Met Asn Val Ile Val Val Ala Ser

180 185 190

Glu Cys Ala Pro Phe Cys Lys Thr Gly Gly Leu Gly Asp Val Val Gly

195 200 205

Ala Leu Pro Lys Ala Leu Ala Arg Arg Gly His Arg Val Met Val Val

210 215 220

Ile Pro Lys Tyr Gly Asp Tyr Gly Glu Ala Arg Asp Leu Gly Val Arg

225 230 235 240

Lys Arg Tyr Lys Val Ala Gly Gln Asp Ser Glu Val Ser Tyr Phe His

245 250 255

Ser Tyr Ile Asp Gly Val Asp Phe Val Phe Leu Glu Ala Pro Pro Phe

260 265 270

Arg His Arg His Asn Asp Ile Tyr Gly Gly Glu Arg Pro Asp Val Leu

275 280 285

Lys Arg Met Ile Leu Phe Cys Lys Ala Ala Val Glu Val Pro Trp Tyr

290 295 300

Ala Pro Cys Gly Gly Thr Ile Tyr Gly Asp Gly Asn Leu Val Phe Ile

305 310 315 320

Ala Asn Asp Trp His Thr Ala Leu Leu Pro Val Tyr Leu Lys Ala Tyr

325 330 335

Tyr Arg Asp Asn Gly Leu Met Gln Tyr Thr Arg Ser Val Leu Val Ile

340 345 350

His Asn Ile Ala His Gln Gly Arg Gly Pro Val Asp Asp Phe Asn Ile

355 360 365

Met Asp Leu Pro Glu His Tyr Met Asp His Phe Lys Leu Tyr Asp Pro

370 375 380

Leu Gly Gly Gln His Asn Asn Val Phe Ala Ala Gly Leu Lys Met Ala

385 390 395 400

Asp Arg Val Val Thr Val Ser His Gly Tyr Met Trp Glu Leu Lys Thr

405 410 415

Met Glu Gly Gly Trp Gly Leu His Asp Ile Ile Asn Gln Asn Asp Trp

420 425 430

Lys Leu Asp Gly Ile Val Asn Gly Ile Asp Thr Ala Glu Trp Asn Pro

435 440 445

Ala Val Asp Val His Leu His Ser Asp Asp Tyr Thr Asn Tyr Thr Arg

450 455 460

Asp Thr Leu Asp Ile Gly Lys Arg Gln Cys Lys Ala Ala Leu Gln Arg

465 470 475 480

Glu Leu Gly Leu Gln Val Arg Asp Asp Val Pro Leu Ile Gly Phe Ile

485 490 495

Gly Arg Leu Asp His Gln Lys Gly Val Asp Ile Ile Ala Ala Ala Met

500 505 510

Pro Trp Ile Ala Gln Gln Asp Val Gln Leu Val Met Leu Gly Thr Gly

515 520 525

Arg Pro Asp Leu Glu Asp Met Leu Arg Arg Phe Glu Gly Glu His Arg

530 535 540

Asp Lys Val Arg Gly Trp Val Gly Phe Ser Val Arg Met Ala His Arg

545 550 555 560

Ile Thr Ala Gly Ala Asp Val Leu Leu Met Pro Ser Leu Phe Glu Pro

565 570 575

Cys Gly Leu Asn Gln Leu Tyr Ala Met Ala Tyr Gly Thr Val Pro Val

580 585 590

Val His Ala Val Gly Gly Leu Arg Asp Thr Val Ala Pro Phe Asp Pro

595 600 605

Phe Gly Gly Thr Gly Leu Gly Trp Thr Phe Asp Arg Ala Asp Ala Gly

610 615 620

Arg Met Ile Asp Ala Leu Gly His Cys Leu Asn Thr Tyr Trp Asn Tyr

625 630 635 640

Lys Glu Ser Trp Arg Gly Leu Gln Val Arg Gly Met Ser Gln Asp Leu

645 650 655

Ser Trp Asp Arg Ala Ala Glu Leu Tyr Glu Asn Val Leu Val Lys Ala

660 665 670

Lys Tyr Gln Trp

675

<210> 11

<211> 674

<212> Protein

<213> Triticum aestivum

<400> 11

Met Ser Gly Ala Ile Ala Ser Ser Ser Ala Ala Phe Leu Leu Leu Val

1 5 10 15

Ala Ser Ser Ser Cys Ser Ser Ser Ser Pro Arg Arg Trp Arg Ser Ser

20 25 30

Ser Pro Arg Ser Phe Ala Ala Ala Gly Thr Arg Leu His Trp Glu Arg

35 40 45

Arg Gly Phe Ser Arg Asp Gly Pro Val Pro Cys Arg Ser Pro Cys Ala

50 55 60

Ala Ala Gly Gly Glu Asp Gly Ala Ala Ala Gly Glu Ser Ser Lys Glu

65 70 75 80

Gly Val Ala Gly Leu Arg Gly Lys Leu Lys Ala Ala Glu Asn Glu Asp

85 90 95

Pro Val Ser Gln Lys Ser Val Ala Ser Ala Pro Arg Leu Asp Ser Ser

100 105 110

Val Ala Glu Gln Asn Gly Ala Ala Ala Thr Arg Ser Lys Ala Asp Pro

115 120 125

Ser Ala Pro Val Ser Ala Ala Ala Ser Gly Tyr Trp Lys Asp Val Val

130 135 140

Val Ala Glu Gln Val Gly Thr Lys Val Asp Thr Gly Gly Asp Ala Ala

145 150 155 160

Glu Val Ser Arg Ser Pro Val Asp Ser Glu Asn Lys Gly Ser Ala Pro

165 170 175

Leu Ala Gly Pro Asn Val Met Asn Val Ile Val Val Ala Ser Glu Cys

180 185 190

Ala Pro Phe Cys Lys Thr Gly Gly Leu Gly Asp Val Val Gly Ala Leu

195 200 205

Pro Lys Ala Leu Ala Arg Arg Gly His Arg Val Met Val Val Ile Pro

210 215 220

Lys Tyr Gly Asp Tyr Ala Glu Ala Arg Asp Leu Gly Val Arg Lys Arg

225 230 235 240

Tyr Lys Val Ala Gly Gln Asp Ser Glu Val Ser Tyr Phe His Ser Tyr

245 250 255

Ile Asp Gly Val Asp Phe Val Phe Leu Glu Ala Pro Pro Phe Arg His

260 265 270

Arg His Asn Asp Ile Tyr Gly Gly Glu Arg Pro Asp Val Leu Lys Arg

275 280 285

Met Ile Leu Phe Cys Lys Ala Ala Val Glu Val Pro Arg Tyr Ala Leu

290 295 300

Cys Gly Gly Thr Ile Tyr Gly Asp Gly Asn Leu Val Phe Ile Ala Asn

305 310 315 320

Asp Trp His Thr Ala Leu Leu Pro Val Tyr Leu Lys Ala Tyr Tyr Arg

325 330 335

Asp Asn Gly Leu Met Gln Tyr Thr Arg Ser Val Leu Val Ile His Asn

340 345 350

Ile Ala His Gln Gly Arg Gly Pro Val Asp Asp Phe Asn Ile Met Asp

355 360 365

Leu Pro Asp His Tyr Met Gly His Phe Lys Leu His Asp Pro Leu Gly

370 375 380

Gly Glu His Asn Asn Val Phe Ala Ala Gly Leu Lys Met Ala Asp Arg

385 390 395 400

Val Val Thr Val Ser His Gly Tyr Met Trp Glu Leu Lys Thr Val Glu

405 410 415

Gly Gly Trp Gly Leu His Asp Ile Ile Asn Gln Asn Asp Trp Lys Leu

420 425 430

Asp Gly Ile Val Asn Gly Ile Asp Thr Ala Glu Trp Asn Pro Ala Val

435 440 445

Asp Val His Leu His Ser Asp Asp Tyr Thr Asn Tyr Thr Arg Asp Thr

450 455 460

Leu Asp Ile Gly Lys Arg Gln Cys Lys Ala Ala Leu Gln Arg Glu Leu

465 470 475 480

Gly Leu Gln Val Arg Asp Asp Val Pro Leu Ile Gly Phe Ile Gly Arg

485 490 495

Leu Asp His Gln Lys Gly Val Asp Ile Ile Ala Ala Ala Met Pro Trp

500 505 510

Ile Ala Gln Gln Asp Val Gln Leu Val Met Leu Gly Thr Gly Arg Pro

515 520 525

Asp Leu Glu Asp Met Leu Arg Arg Phe Glu Gly Glu His Arg Asp Lys

530 535 540

Val Arg Gly Trp Val Gly Phe Ser Val Arg Met Ala His Arg Ile Thr

545 550 555 560

Ala Gly Ala Asp Val Leu Leu Met Pro Ser Leu Phe Glu Pro Cys Gly

565 570 575

Leu Asn Gln Leu Tyr Ala Val Ala Tyr Gly Thr Val Pro Val Val His

580 585 590

Ala Val Gly Gly Leu Arg Asp Thr Val Ala Pro Phe Asp Pro Phe Gly

595 600 605

Gly Thr Gly Leu Gly Trp Thr Phe Asp Arg Ala Asp Ala Gly Arg Met

610 615 620

Ile Asp Ala Leu Gly His Cys Leu Asn Thr Tyr Trp Asn Tyr Lys Glu

625 630 635 640

Ser Trp Arg Gly Leu Gln Val Arg Gly Met Ser Gln Asp Leu Ser Trp

645 650 655

Asp His Ala Ala Glu Leu Tyr Glu Asn Val Leu Val Lys Ala Lys Tyr

660 665 670

Gln Trp

<210> 12

<211> 2727

<212> DNA

<213> Triticum aestivum

<400> 12

acccgtcgtc ttcctcggcg cgggcgctct agctcttccc agtctcggcc tccgagctcc

60

accacacaag ccgctcgcct gtccccggcc tccagttcct ccgcctcccg cccccccccc

120

cccccccgct ccgtaccgcc gcaaaaaacc tgcagccaca cgtagccagc gcagatcttt

180

cttccacccg cgcttaattt ccctcgtgct cgcgccgctc gccgtcgccc tcgtccacta

240

ctactctgcc ttgtttgtcc ggctgtttct gttcatcccc gaagacttct ggcgcgtcgg

300

atcccgggat gttggggcac atcgcttcct cgtccgcggc gttcctcttg ctcgtggcct

360

cctcctcgtc gtcgcggcgc tggcggagca gctcaccgcg ctctttcggt gccgccggta

420

cgcggctgca ttgggaacgg cgagggtttt ctcgggacgg atcggtgccg tgccgccgtg

480

tttcagcagc agcggcagtg gctggtggtg aggagggcgc ggggaaggca atagcagggg

540

agggctcgag gcaggcagcc tctgggcagc gcggcaagct cgaggctgct gaaaatgagg

600

atgctgtttc acaaaaatca gttgcatctg cacccaggcc agatagtacc gttgcagagc

660

aacattgggc agctgggagc agatccgaag tcgatccgtc agctcctgtc tcggcggcgg

720

catcaggtta ttggaaagac gtcgttgtcg ctgaacaggt tggggctaag gttgatgccg

780

gtggagatgc agcaaaagtg tggagttctc cggttgacag tgagaacatg gggtctgctc

840

ctttggctgg cccgaatgtg atgaatgtca tcgttgtggc ttctgaatgt gctcctttct

900

gtaaaacagg tgggcttgga gatgttgtgg gtgctttgcc gaaggctctg gcaagaagag

960

ggcatcgtgt tatggtcgtg ataccaaaat atggagatta cggagaagct cgtgatctag

1020

gtgttcgcaa acgttacaag gtagctggcc aggattcaga agtgagctac tttcattctt

1080

atatcgatgg agttgatttt gtgttcttag aggccccgcc cttccgccac cggcacaatg

1140

atatttatgg aggagaaaga ccggatgtgc tgaagcgcat gattttgttc tgcaaggctg

1200

ctgtggaggt tccttggtac gctccatgcg gtggtactat ctacggtgat ggcaatttag

1260

tcttcattgc aaacgattgg catactgcac ttctacctgt ttatctgaag gcgtattacc

1320

gagacaatgg cctgatgcag tatactcgtt ctgttctcgt gatccataac attgctcatc

1380

agggacgtgg ccctgtagat gacttcaaca tcatggactt gcctgagcac tacatggatc

1440

acttcaaact gtatgatccc cttggcggcc agcacaacaa cgtgttcgct gctggcctga

1500

agatggcaga ccgggtggtc accgtcagcc atggctacat gtgggagctg aagacgatgg

1560

aaggcggctg gggcctccac gacataataa accagaacga ctggaagctg gacggcatcg

1620

tgaacggcat cgacacggcc gagtggaacc ccgcagtcga cgtgcacctg cactccgacg

1680

actacaccaa ctacacccga gacacgctgg acatcggcaa gcggcagtgc aaggcggccc

1740

tgcagcgcga gctgggcctg caggtccgcg acgacgtgcc gctcatcggg ttcatcgggc

1800

ggctggacca ccagaagggc gtggacatca tcgcggcggc gatgccgtgg atcgcgcagc

1860

aggacgtgca gctggtgatg ctgggcacgg ggcggccgga cctggaggac atgctgcggc

1920

ggttcgaggg ggagcaccgg gacaaggtgc gcgggtgggt ggggttctcg gtgcggatgg

1980

cgcaccggat cacggcgggc gcggacgtgc tcctcatgcc gtcgctgttc gagccgtgcg

2040

ggctgaacca gctgtacgcg atggcgtacg ggaccgtgcc cgtggtgcac gccgtcggcg

2100

ggctccggga cacggtggcg ccgttcgacc cgttcggcgg caccgggctg gggtggacgt

2160

tcgaccgcgc ggacgccggc aggatgatcg acgcgctcgg gcactgcctc aacacgtact

2220

ggaactacaa ggagagctgg aggggcctgc aggtccgcgg catgtcgcag gacctcagct

2280

gggaccgcgc cgccgagctc tacgagaacg tcctcgtcaa ggccaagtac cagtggtgat

2340

gcggctgatg ctgacccctc tactgcaacg catgcacgta cttaggggac agccggaagt

2400

ggtgcccacg atcgcgatca ctggcgcccc ggagtagcca agtgtcacgc gatgccaccg

2460

gcggcagccg gacgacggtg gaggtagtga accgtgcccg tggcgccgcc caacttttgg

2520

gttcacgagt tgtacacacc agttcagtca ggttcgtggc ttctgtgaat taccgagtcg

2580

taggcgatca aataggaagt tgcagagttt ctatactgcc aattttctca gctcttggtg

2640

tggaaaaaca cagttctgag aaggttcatc actggacgct gaccacgttc acgttctgtt

2700

tcatgctcaa aaaaaaaaaa aaaacga

2727

<210> 13

<211> 1282

<212> DNA

<213> Triticum aestivum

<400> 13

tggtgaggat ggcgcggcgg caggggagag ctcgaaggag ggggtcgctg ggctgcgcgg

60

caagctcaag gttggtaacg ctatcattcc ttcttctgat ggattccatt tcgtgctcag

120

gctgctgaaa atgaggatcc ggtttcacaa aaatcagttg catctgcacc caggctagac

180

agtagcgttg cagagcaaaa tggggcagct gcgaccagat ccaaagccga tccgtcagct

240

cctgtctcgg cggcagcatc aggttattgg aaagacgtcg ttgtcgctga acaggttgga

300

actaaggttg acaccggtgg agatgcagca gaagtgtcga gatctcccgt tgacagtgag

360

aacaaggggt ctgctccttt ggctggcccg aatgtgatga atgtcatcgt tgtggcttct

420

gagtgtgctc ctttctgtaa aacaggtgcg catacataaa ctgagcaatt tgaccaataa

480

tgatatcatg cataggcggg cttggagatg tcgtgggtgc tttgcccaag gctctggcca

540

gaagagggca tcgcgttatg gtacccactc ctttgctttt ctcttataca agtatttctt

600

tcaattttag gttgtgatac caaagtatgg cgattacgca gaagctcgtg atcttggtgt

660

tcgcaaacgt tacaaggtag ctggccaggt atgttaaata acgagtctgc agtaattgaa

720

ttgtgttctg gtttgcagga ttcagaagtg agttactttc actcttatat cgatggagtt

780

gattttgtat tcttagaggc cccgcccttc cgccaccggc acaatgatat ttatggagga

840

gaaagaccgg taagcgtctg tttccctaga gctttgtaca tttccatcat ttttggcagg

900

atgtgctgaa gcgcatgatt ttgttctgca aggctgctgt cgaggtacct tcacaaattg

960

tattgctatt gttcatctgt tcgagcattt gtaggttcct tggtacgctc catgtggtgg

1020

tactatctac ggagatggca atttggtctt cattgcaaac gattggcata ctgcacttct

1080

acctgtttat ctaaaggcat attaccgaga caatggcctg atgcagtata ctcgttctgt

1140

tctcgtgatc cataacattg ctcatcaggt tttacacctc aatctttaac tgctggacac

1200

taaaattttg ctttgcaggg acgtggccct gtagatgact tcaacatcat ggacttgcct

1260

gaccactaca tgggtcactt ca

1282

<210> 14

<211> 2025

<212> DNA

<213> Triticum aestivum

<400> 14

atgtcggggg caatagcttc ctcgtccgcg gcgttcctct tgctcgtggc ctcctcctcc

60

tgctcctcct cgtcgccgcg gcgctggcgg agcagctcac cgcgctcttt cgctgccgcc

120

ggtacgcggc tgcattggga acggcgagga ttctctcggg acggaccggt gccgtgccgg

180

agcccctgcg cagcagctgg tggtgaggat ggcgcggcgg caggggagag ctcgaaggag

240

ggggtcgctg ggctgcgcgg caagctcaag gctgctgaaa atgaggatcc ggtttcacaa

300

aaatcagttg catctgcacc caggctagac agtagcgttg cagagcaaaa tggggcagct

360

gcgaccagat ccaaagccga tccgtcagct cctgtctcgg cggcagcatc aggttattgg

420

aaagacgtcg ttgtcgctga acaggttgga actaaggttg acaccggtgg agatgcagca

480

gaagtgtcga gatctcccgt tgacagtgag aacaaggggt ctgctccttt ggctggcccg

540

aatgtgatga atgtcatcgt tgtggcttct gagtgtgctc ctttctgtaa aacaggcggg

600

cttggagatg tcgtgggtgc tttgcccaag gctctggcca gaagagggca tcgcgttatg

660

gttgtgatac caaagtatgg cgattacgca gaagctcgtg atcttggtgt tcgcaaacgt

720

tacaaggtag ctggccagga ttcagaagtg agttactttc actcttatat cgatggagtt

780

gattttgtat tcttagaggc cccgcccttc cgccaccggc acaatgatat ttatggagga

840

gaaagaccgg atgtgctgaa gcgcatgatt ttgttctgca aggctgctgt cgaggttcct

900

aggtacgctc tatgtggtgg tactatctac ggagatggca atttggtctt cattgcaaac

960

gattggcata ctgcacttct acctgtttat ctaaaggcat attaccgaga caatggcctg

1020

atgcagtata ctcgttctgt tctcgtgatc cataacattg ctcatcaggg acgtggccct

1080

gtagatgact tcaacatcat ggacttgcct gaccactaca tgggtcactt caaactgcat

1140

gacccccttg gtggcgagca caacaacgtg ttcgccgctg gcctgaagat ggcagaccgg

1200

gtggtcaccg tcagccatgg ctacatgtgg gagctgaaga cggtggaagg cggctggggc

1260

ctccacgaca taataaacca gaacgactgg aaactggacg gcatcgtgaa cggcatcgac

1320

acggccgagt ggaaccccgc ggtcgacgtg cacctgcact ccgacgacta caccaactac

1380

acccgagaca cgctggacat cggcaagcgg cagtgcaagg cggccctgca gcgcgagctg

1440

ggcctgcagg tccgcgacga cgtgccgctc atcgggttca tcgggcggct ggaccaccag

1500

aagggcgtgg acatcatcgc ggcggcgatg ccgtggatcg cgcagcagga cgtgcagctg

1560

gtgatgctgg gcacggggcg gccggacctg gaggacatgc tgcggcggtt cgagggggag

1620

caccgggaca aggtgcgcgg gtgggtgggg ttctcggtgc ggatggcgca ccggatcacg

1680

gcgggcgcgg acgtcctgct gatgccgtcg ctgttcgagc cgtgcgggct gaaccagctg

1740

tacgcggtgg cgtacgggac cgtgcccgtg gtgcacgccg tcggcgggct ccgggacacg

1800

gtggcgccgt tcgacccgtt cggcggcacc gggctggggt ggacgttcga ccgcgcggac

1860

gccggcagga tgatcgacgc gctcgggcac tgcctcaaca cgtactggaa ctacaaggag

1920

agctggaggg gcctccaggt ccgcggcatg tcgcaggacc tcagctggga ccacgccgcc

1980

gagctctacg agaacgtcct cgtcaaggcc aagtaccagt ggtga

2025

<210> 15

<211> 20

<212> DNA

<213> Synthetic sequence

<400> 15

tgcgtttaccccaccagagca

20

<210> 16

<211> 22

<212> DNA

<213> Synthetic sequence

<400> 16

tgccaaaggt ccggaatcat gg

22

<210> 17

<211> 18

<212> DNA

<213> Synthetic sequence

<400> 17

gcggaccagg ttgtcgtc

18

<210> 18

<211> 22

<212> DNA

<213> Synthetic sequence

<400> 18

ctggctcacg atccagggca tc

22

<210> 19

<211> 24

<212> DNA

<213> Synthetic sequence

<400> 19

gtaccaaggt atggggacta tgaa

24

<210> 20

<211> 22

<212> DNA

<213> Synthetic sequence

<400> 20

gttggagaga tacctcaaca gc

22

<210> 21

<211> 23

<212> DNA

<213> Synthetic sequence

<400> 21

aaggtctcca ccgtgtctcg aag

23

<210> 22

<211> 23

<212> DNA

<213> Synthetic sequence

<400> 22

gacgtacagt ttgtcatgct tgg

23

<210> 23

<211> 23

<212> DNA

<213> Synthetic sequence

<400> 23

ctgctggaca ggatatggaa gtg

23

<210> 24

<211> 23

<212> DNA

<213> Synthetic sequence

<400> 24

gtatcaccat aacggagcga ctg

23

<210> 25

<211> 25

<212> DNA

<213> Synthetic sequence

<400> 25

caatcactga tggtgtaacc aaagg

25

<210> 26

<211> 23

<212> DNA

<213> Synthetic sequence

<400> 26

ccttcatgtt ggtcaatagc agc

23

<210> 27

<211> 25

<212> DNA

<213> Synthetic sequence

<400> 27

cagaatggac aaagaatcat ccacg

25

<210> 28

<211> 24

<212> DNA

<213> Synthetic sequence

<400> 28

gaaaatacat ccatgcctcc atcg

24

<210> 29

<211> 21

<212> DNA

<213> Synthetic sequence

<400> 29

agggtacagg gtgggcgttc t

21

<210> 30

<211> 20

<212> DNA

<213> Synthetic sequence

<400> 30

gtaggttgg tccacgaagg

20

<210> 31

<211> 20

<212> DNA

<213> Synthetic sequence

<400> 31

ttcgacccct tcaaccactc

20

<210> 32

<211> 20

<212> DNA

<213> Synthetic sequence

<400> 32

acgtcctcgt agagcttggc

20

<210> 33

<211> 20

<212> DNA

<213> Synthetic sequence

<400> 33

tgacgaatct tggaaaatgg

20

<210> 34

<211> 23

<212> DNA

<213> Synthetic sequence

<400> 34

ggcggcattt atcataacta ttg

23

<210> 35

<211> 22

<212> DNA

<213> Synthetic sequence

<400> 35

gtagatgcgg tcgtttactt ga

22

<210> 36

<211> 20

<212> DNA

<213> Synthetic sequence

<400> 36

ccagccacct tctgtttgtt

20

<210> 37

<211> 19

<212> DNA

<213> Synthetic sequence

<400> 37

gggccttcat ggatcaacc

19

<210> 38

<211> 20

<212> DNA

<213> Synthetic sequence

<400> 38

ccgcttcaag catcctcatc

20

<210> 39

<211> 23

<212> DNA

<213> Synthetic sequence

<400> 39

ctggacagga tctggaagtg aaa

23

<210> 40

<211> 22

<212> DNA

<213> Synthetic sequence

<400> 40

ggaacctcaa cagcagcctt ac

22

<210> 41

<211> 19

<212> DNA

<213> Synthetic sequence

<400> 41

gccaatgcca ggaagatga

19

<210> 42

<211> 20

<212> DNA

<213> Synthetic sequence

<400> 42

gcgcaacata ggatgggttt

20

<210> 43

<211> 30

<212> DNA

<213> Synthetic sequence

<400> 43

tacgaattct ccagcggaat gagaacacca

thirty

<210> 44

<211> 30

<212> DNA

<213> Synthetic sequence

<400> 44

tacggtaccc aagatgtaca gaagtgcaga

thirty

<210> 45

<211> 22

<212> DNA

<213> Synthetic sequence

<400> 45

ggaaatacat ggcttgctgc tt

22

<210> 46

<211> 22

<212> DNA

<213> Synthetic sequence

<400> 46

tctcttcgtc ttgatggttg ca

22

<210> 47

<211> 20

<212> DNA

<213> Synthetic sequence

<400> 47

caggcttgta tcccaggtca

20

<210> 48

<211> 20

<212> DNA

<213> Synthetic sequence

<400> 48

gcgtaggagg aaagcatgaa

20

<210> 49

<211> 17

<212> Protein

<213> Synthetic sequence

<400> 49

Ala Ala Ser Pro Gly Lys Val Leu Val Pro Asp Gly Glu Ser Asp Asp

1 5 10 15

Leu

<210> 50

<211> 10

<212> Protein

<213> Synthetic sequence

<400> 50

Ala Gly Gly Pro Ser Gly Glu Val Met Ile

1 5 10

<210> 51

<211> 16

<212> Protein

<213> Synthetic sequence

<400> 51

Val Ser Ala Pro Arg Asp Tyr Thr Met Ala Thr Ala Glu Asp Gly Val

1 5 10 15

<---

Claims (72)

1. Wheat grain of the Triticum aestivum species with a high content of amylose, fructan, β-glucan, arabinoxylan and cellulose, containing i) mutations in each of the SSIIa genes, wherein the grain is homozygous for a mutation in the SSIIa-A gene, homozygous for a null mutation in the SSIIa-B gene and homozygous for a null mutation in the SSIIa-D gene, ii) total starch content, including amylose content and amylopectin content, iii) fructan content, which is increased compared to wild-type wheat grain in a mass ratio, preferably from 3 to 12% of the grain weight, iv) β-glucan content, v) arabinoxylan content, vi) cellulose content, in this case, the grain has a caryopsis weight from 25 to 60 mg, and the amylose content ranges from 45 to 70% by weight of the total starch content of the grain when determined by iodine binding analysis, the amylopectin content is reduced in mass terms compared to wild-type wheat grain, each of β-glucan content, arabinoxylan content and cellulose content is increased compared to wild-type wheat grain in a mass ratio so that the total fructan content, β-glucan content, arabinoxylan content and cellulose content is from 15 to 30% of the grain weight. 2. Grain according to claim 1, which is additionally characterized by one or more or all of the following characteristics: i) starch content from 30 to 70% relative to the weight of the grain, ii) the amylose content is between 45 and 65% by weight of the total starch content of the grain as determined by iodine binding assay, iii) starch content has a chain length distribution when determined by fluorescence-activated capillary electrophoresis (FACE) after debranching of starch samples, in which the proportion of chain lengths with a DP (degree of polymerization) of 7-10 is increased and the proportion of chain lengths with a DP of 11-24 is reduced compared to wild type wheat starch, iv) the fructan content includes fructan with SP 3-12 such that at least 50% of the fructan content is represented by SP 3-12, v) the fructan content is increased by 2-10 times compared to wild-type wheat grain in mass terms, vi) β-glucan content and increased by 1% or 2% in absolute value and/or increased by 2-7 times compared to wild-type wheat grain in mass terms, vii) the β-glucan content is from 1 to 4% of the grain weight, viii) arabinoxylan content is increased by 1 – 5% in absolute value, ix) cellulose content increased by 1 – 5% in absolute value, x) the grain has a germination rate of about 70% to about 100% compared to wild-type wheat grain, xi) The grain when sown produces wheat plants with male and female fertility. 3. Grain according to claim 1 or 2, in which all of the SSIIa-A protein, SSIIa-B protein and SSIIa-D protein are absent. 4. Grain according to any one of paragraphs. 1-3, wherein each null mutation is independently selected from the group consisting of a deletion mutation, an insertion mutation, a premature translation stop codon, a splice site mutation, and a non-conservative amino acid substitution mutation, preferably the grain containing mutations with deletions in each of two or three SSIIa genes. 5. Grain according to any one of paragraphs. 1-4, which further comprises a loss-of-function mutation in an endogenous gene that encodes a starch synthesis polypeptide, wherein said starch synthesis polypeptide is selected from the group consisting of starch synthase I (SSI), starch synthase IIIa (SSIIIa) and starch synthase IV (SSIV), wherein said mutation is selected from the group consisting of a deletion mutation, an insertion mutation, a premature translation stop codon, a splice site mutation, and a non-conservative amino acid substitution mutation. 6. Grain according to any one of paragraphs. 1–5, being homozygous for a null mutation in the SSIIa-A gene, homozygous for a null mutation in the SSIIa-B gene, and homozygous for a null mutation in the SSIIa-D gene. 7. Grain according to any one of paragraphs. 1-6, wherein the at least one mutation is i) an introduced mutation, ii) was induced in the wheat parent plants or seeds by mutagenesis using a mutagenic agent, such as a chemical agent, biological agent or irradiation, or iii) was introduced to modify the plant genome. 8. Grain according to any one of paragraphs. 1–7, in which the amylose content is about 60% by weight of the total starch content of the grain as determined by the iodine binding assay. 9. Grain according to any one of paragraphs. 1-8, wherein the starch granules in the grain and/or the starch in the grain are characterized by one or more properties selected from the group consisting of: i) content of at least 2% resistant starch; ii) starch has a reduced glycemic index (GI); iii) starch granules are deformed; iv) starch granules have reduced birefringence when observed under polarized light; v) starch is characterized by reduced volumetric swelling; vi) modified chain length distribution and/or branch frequency in starch; vii) starch has a reduced peak gelatinization temperature; viii) starch has a reduced peak viscosity; ix) the gelatinization temperature of starch is reduced; x) reduced peak molecular weight of amylose when determined by size exclusion chromatography; xi) reduced degree of starch crystallization; And xii) the proportion of A-type and/or B-type starch is reduced and/or the proportion of V-type crystalline starch is increased; each property being determined in comparison to wild-type wheat starch granules or wild-type wheat starch. 10. Grain according to any one of paragraphs. 1-9 that has been processed so that it is no longer capable of germinating, for example, as heat-treated grain or coarsely ground, cracked, steamed, flattened, crushed, crushed or milled grain. 11. Use of grain according to any one of paragraphs. 1–10 to obtain flour, which is preferably whole grain flour or wheat bran. 12. Use of grain according to any one of paragraphs. 1–10 to obtain wheat starch granules. 13. Use according to claim 12, wherein the wheat starch granules contain from 45 to 70% amylose by weight as a proportion of the total starch content of the starch granules, wherein the starch granules preferably contain a wheat GBSSI polypeptide, and wherein the starch granules are characterized by one or more from: i) absence of detectable SSIIa polypeptide when determined by immunological methods; ii) the presence of a deformed shape; And iii) the presence of reduced birefringence when observed in polarized light; each property being determined in comparison with wild-type wheat starch granules. 14. Use of grain according to any one of paragraphs. 1-10 to obtain wheat starch. 15. Use according to claim 14, wherein the wheat starch contains from 45 to 70% amylose by weight as a proportion of the total starch content of the starch granules, wherein the starch granules preferably contain a wheat GBSSI polypeptide, and wherein the starch granules are characterized by one or more of : i) absence of detectable SSIIa polypeptide when determined by immunological methods; ii) containing at least 2% resistant starch by weight; iii) reduced glycemic index (GI); iv) reduced volumetric swelling; v) modified chain length distribution and/or branching frequency; vi) reduced peak gelatinization temperature; vii) reduced peak viscosity; viii) reduced starch gelatinization temperature; ix) reduced peak molecular weight of amylose when determined by size exclusion chromatography; x) reduced degree of starch crystallization; And xi) reduced proportion of A-type and/or B-type starch and/or increased proportion of V-type crystalline starch; each property being determined in comparison with wild-type wheat starch. 16. A food ingredient that contains grain according to any one of paragraphs. 1-10 or flour, preferably whole grain, wheat bran, wheat starch granules or wheat starch obtained from grain according to any one of paragraphs. 1-10, preferably at a level of at least 10% on a dry weight basis. 17. The food ingredient of claim 16, which is a coarse, crushed, steamed, rolled, crushed, crushed or ground grain, or any combination of these options. 18. A food product containing a food ingredient at a level of at least 10% on a dry weight basis, wherein the food ingredient is a grain of wheat according to any one of claims. 1-10 or flour, preferably whole grain, wheat bran, wheat starch granules or wheat starch obtained from grain according to any one of paragraphs. 1-10. 19. Composition for producing a food product or food ingredient with an increased content of amylose, fructan, β-glucan, arabinoxylan and cellulose, containing wheat grain according to any one of paragraphs. 1-10 or flour, preferably whole grain, wheat bran, wheat starch granules or wheat starch obtained from grain according to any one of paragraphs. 1-10, at a level of at least 10% by weight, and wheat grain having an amylose level of less than 45% (w/w), or flour, whole grain flour, starch granules or starch derived therefrom. 20. A method for producing a wheat plant that produces grain according to any one of claims. 1-9, comprising the step of (i) crossing two wheat parent plants, each of which contains a null mutation in each of one, two or three SSIIa genes selected from the group consisting of SSIIa-A, SSIIa-B and SSIIa-D, or the effect of mutagenesis on a parent plant containing said null mutations; and step (ii) screening plants or grains obtained by crossing or mutagenesis, or daughter plants or grains derived therefrom, by DNA, RNA or protein analysis from the plants or grain, and step (iii) selecting a fertile wheat plant having reduced SSIIa activity compared to at least one of the parent plants from step (i). 21. A method for screening wheat grain or a wheat plant, comprising (i) determining the amount or activity of SSIIa compared to the amount or activity in the wild-type wheat grain or wild-type wheat plant and selecting the grain or a plant that produces the grain, according to any one of claims. 1–9. 22. A method of producing a food product, comprising the steps of (i) adding the food ingredient of claim 16 or 17 to another food ingredient and (ii) mixing the food ingredients to thereby obtain a food product. 23. The method according to claim 22, which additionally includes the step of grain processing according to any one of claims. 1 to 10 to obtain the food ingredient before step (i) or the step of heating the mixed food ingredients from step (ii) at a temperature of at least 100°C for at least 10 minutes. 24. The food product of claim 18 for use in improving one or more parameters of metabolic, gut or cardiovascular health or preventing or reducing the severity or incidence of metabolic, gut or cardiovascular disease in a subject. 25. A method for producing starch, comprising the steps of i) producing wheat grain according to any one of claims. 1-10 and ii) separating the starch from the grain, thereby obtaining starch.

Images