JP6976508B2 - Test strips and methods for detecting tetracycline antibiotics in water using biosensors - Google Patents

Description

The present invention belongs to the art of biological analysis and detection, and particularly relates to test strips and methods for detecting tetracycline antibiotics in water using biosensors.

With the progress of industrialization and the rapid occurrence of water pollution caused by various chemical products, the number of various chemical substances is rapidly increasing, which has a great impact on the human living environment, and elucidation of the acute toxicity of the increase in environmental pollutants. Is an urgent need.

Tetracyclines (TCs) have a wide spectrum, highly efficient bactericidal and antibacterial effects, and are widely used as medicines for the prevention and treatment of fish diseases or as feed additives that promote fish growth. ing. Because TCs can inhibit most Gram-positive and Gram-negative bacteria, they are naturally stable, cheap and easy to use, and feeds for adjuncts to prevent disease, increase feed conversion and promote fish growth. Often used as an additive. However, long-term use of drugs, residues in livestock and poultry products,
Increased drug resistance and side effects caused by ecological effects in the environment raise widespread concerns at home and abroad. The US FDA clearly stipulates that the total residual amount of tetracyclines, oxytetracyclines, and chlortetracyclines in animal muscle tissue should not exceed 2 μg / kg. Conventional chemical analysis methods include microbiological methods, high performance liquid chromatography (HPLC), enzyme binding immunoassay (ELISA), high speed capillary electrophoresis (HPCE), radioimmunoassay, and fluorescent photometry, which are the main contaminants. The content of the component can be accurately quantified. However, the comprehensive effects of various toxic substances on the environment and organisms cannot be directly and timely reflected. In conventional animal toxicity experiments, mammals and fish can be used as test subjects to reflect the direct effects of toxic substances on living organisms, but the method is complicated, the test period is long, and the acute toxicity test of water quality. Cannot meet the needs of. Given the shortcomings of traditional toxicity detection methods, domestic and foreign researchers have found a variety of microorganisms, algae, benthic soft animals, plankton, fish, etc. used to monitor the toxicity of environmental pollutants to aquatic organisms. Bacterial biosensors have received a lot of attention because of their unique physiological properties and their perfect match with the latest photoelectric detection methods.

The test paper has unique features such as low detection cost and easy operation, so it is widely applied in various fields. For example, pH test paper used in laboratories, potassium iodide starch test paper, etc.
There are temperature-sensitive test strips used in industry, wastewater detection test strips, and blood glucose test strips used in daily life. Different materials and methods for making test strips also have different detection areas and detection sensitivities for test strips. Currently, there is no way to detect tetracycline antibiotics in water by preparing test strips using whole cell biosensors.

The present invention fills the gap in preparing a test piece for detecting tetracycline antibiotics in water using a whole cell biosensor and a piece of test paper for detecting tetracycline antibiotics in water using a whole cell biosensor. And to provide a detection method.
The technical solution of the present invention is as follows.

The tetracycline biosensor inoculum includes a filter paper piece, a fixing agent, a sensitizer, and a tetracycline biosensor inoculum, which is Escherichia coli BL2.
It is a 1 / pMTLacZ strain and is Escherichia coli BL21 / pMTL.
A test strip that detects tetracycline antibiotics in water using a biosensor in which the acZ strain is wrapped with the fixative and sensitizer and immobilized onto the filter paper strip.
Further, in the above solution, the Escherichia coli BL21 / pMTL
The method for preparing the acZ strain includes the following.

(1) From plasmid pMTmCherry to Staphylococcus by PCR method
s rostri RST11: Cloning the gene sequence of the pMT fragment of the tetracycline-mediated regulatory system on Tn916 and transposon Tn10.
The forward primer sequence and the reverse primer sequence of the pMT primer are described in SEQ ID No. 1 and SEQ ID No. Shown in 2:
SEQ ID No. 1: TCGTCGCCAGCTGGCATTAAT
SEQ ID No. 2: TTCACTTTTTCTCATCATCACTGATAGG,
Table 1 Strains and plasmids used

(2) Using the primer polymerase chain reaction (PCR), the gene sequence of the LacZ (368 bp) reporter gene fragment was cloned from the pCU19 plasmid, the annealing temperature was 65 ° C., and the plasmid pMTmCherry to T7.
The gene sequence of the fragment (220 bp) is cloned, the annealing temperature is 60 ° C., and L is L by binding and fusion with the LacZ and T7 terminator sequences.
When the acZ-T7 fusion fragment (568 bp) is obtained and the primer is designed, it is necessary to add the homologous fragment.

The forward primer sequence and the reverse primer sequence of the LacZ primer are described in SEQ ID No. 3 and SEQ ID No. Shown in 4
SEQ ID No. 3: CTATCAGTGATAGAGAAAAGTGAAATGA
CCATGATTACGCCAAGC
SEQ ID No. 4: GTGGCAGCCACTAGGTTAACTATGCGG
CATCAGAGCAG,
The forward primer sequence and the reverse primer sequence of the T7 primer are described in SEQ ID No. 5 and SEQ ID No. Shown in 6
SEQ ID No. 5: TTAACCTAGGCTGCTGCC
SEQ ID No. 6: TCATTAATTGCAGCTGGCACGGATTTCACA
CAGGAAACAGCTAGAC,
The forward and reverse primer sequences of the primers used for the fusion of LacZ-T7 are described in SEQ ID No. 7 and SEQ ID No. Shown in 8
SEQ ID No. 7: CTATCAGTGATAGAGAAAAGTGAA
SEQ ID No. 8: TCATTAAGCAGCTGGCAC,

(3) The above-mentioned LacZ-T7 and pMT are connected by a homologous recombinase, the gene fragment is placed in a PCR tube, gently pipetted with a pipette and mixed, and all the liquids are centrifuged at a low speed to the bottom of the centrifuge tube. Use 10-100 ng for the carrier. The molar ratio of carrier to insert fragment is 1: 1 to 1:10. When connecting multiple fragments, the molar ratio of each fragment is 1: 1.
pmols = (mass ng x 1000) / (fragment length bp x 650 daltons)
,
The mixture is reacted at 50 ° C. for 15 minutes. For multiple fragment clonings, the reaction time can be extended, but the total time should not exceed 60 minutes.

100 μL of thawed Escherichia coli BL21 competent cells are taken in an ice bath, target DNA (plasmid or use, ligation product) is added, mixed gently and left on ice for 25 minutes. Heat shock in a water bath at 42 ° C for 30-45 seconds, immediately transfer to an ice bath and leave for 2 minutes. Add 500 μL of sterile LB medium without antibiotics to the centrifuge tube, mix and revive at 37 ° C., 200 rpm for 1 hour. Aspirate various volumes of resurrection solution, apply evenly to LB medium containing Amp antibiotics, place the plate upside down in a 37 ° C. incubator and incubate overnight.

(4) Select a spot on the medium and use a sterile 10 μL pipette tip to draw a line on the LB medium containing ampicillin antibiotics and the LB medium containing ampicillin, 20 mg / L X-gal and tetracycline antibiotics, respectively. Strains that grow in two media and grow blue spots in LB medium containing ampicillin, 20 mg / L X-gal and tetracycline antibiotics are screened, recombinant plasmids are identified using primer PCR, and annealing temperature. Is 53 ° C and the core fragment of the plasmid is 3
Confirm that it is 590 bp.

The forward and reverse primer sequences of the primers used for identification are described in SEQ ID No. 9 and SEQ ID No. Shown in 10
SEQ ID No. 9: ACTGTCAATTGTGATAGCGGG
SEQ ID No. 10: ATTAAGCAGCTGGCACGA,
The sequence was measured and the recombinant plasmid strain was Escherichia coli BL.
Confirm that it is 21 / pMTLacZ.

Further, in the above solution, the fixative is 10% lactose.

Further, in the above solution, the sensitizer is 1/4 LB medium of PMB.

The present invention further provides a method for preparing the above-mentioned test paper piece, which method is:
(a) Prepare a filter paper piece base and cut it to the required size, preferably lcm x 4 cm.
(b) Mixing Escherichia coli BL21 / pMTLacZ bacteria and 10% lactose and 1/4 LB medium of PMB in a fixed ratio, and
(c) Escherichia coli BL21 / pMTLacZ bacteria and a mixture of 10% lactose and 1/4 LB medium of PMB are added dropwise onto a test strip base.
(d) Includes putting the test paper in a lyophilizer and fixing it.
Further, the administration ratio range of the mixture of Escherichia coli BL21 / pMTLacZ bacteria and 10% lactose and 1/4 LB medium of PMB is 3 to 4 m.
Mix 100 μL of 10% lactose and 1/4 LB medium of PMB with respect to g of the fungus.

Further, the fixing time in the freeze-dryer is 4 hours.
The present invention further provides a method for detecting a tetracycline antibiotic in water using the test strip.
Revive the mixture of 100 μL water sample to be measured and 900 μL LB medium (approximately 13).
-18 minutes), after revival, put it in the test paper and detect the intensity of blue on the test paper.
Furthermore, the color intensity was obtained by comparing the initial color development and the color intensity after 1.5 hours, and 6 of the water body was obtained.
Achieves detection of various types of tetracycline antibiotics.
In addition, selectable,
To detect, take a color picture with a camera, transfer it to a computer and use ImageJ software to get the intensity of the blue color.

Compared with the prior art, the beneficial effects of the present invention are as follows.
(1) The pMTLacZ plasmid of the present invention is a synthetic plasmid originally designed by the inventor that can be induced by various tetracycline antibiotics, and the pMTLacZ plasmid is a different amount of β-galactosidase under the induction of different concentrations of tetracycline. The X-gal color-developing agent immobilized on the test paper piece can be decomposed, and the concentration of the tetracycline antibiotic in the sample is intuitively shown.
(2) The test paper piece of the present invention simultaneously contains 6 types of tetracycline antibiotics (tetracycline, oxytetracycline, chlortetracycline, doxicycline, minocycline and methoxytetracycline) in an aqueous body without introducing an organic chemical reagent. Can be detected effectively.
(3) The detection method of the present invention is simple, fast, intuitive, accurate, easy to carry, environmentally friendly, versatile, low cost, easy to disseminate and use.

It is a gel electrophoresis diagram of a gene fragment, of which FIG. A is a gene fragment used in a recombinant plasmid, and FIG. B is a recombinant plasmid confirmation fragment. Escherichia coli BL21 / pMTLacZ bacterium color development principle and effect, of which FIG. a is a recombinant plasmid color development principle, FIG. B is an x-gal chemical reaction, and FIG. C is a color development result diagram. pMTLacZ plasmid gene map. It is a preparation flow of the test paper of Escherichia coli BL21 / pMTLacZ bacteria. It is a color card that detects 6 kinds of tetracycline antibiotics with a test paper of Escherichia coli BL21 / pMTLacZ bacteria. It is a figure which detects 6 kinds of tetracycline antibiotics of an aqueous body by the test paper of Escherichia coli BL21 / pMTLacZ bacteria. It is a flowchart of the detection method of this invention.

1. Preparation of Escherichia coli BL21 / pMTLacZ strain:
(1) plasmid pMTmChe using primer polymerase chain reaction (PCR)
The gene sequence of the pMT fragment (5256 bp) of the tetracycline-mediated regulatory system on Staphylococcus rostri RST11: Tn916 and transposon Tn10 was cloned from rry and the annealing temperature was 55 ° C. (FIG. 1). The plasmids used are shown in Table 1.
The forward primer sequence and the reverse primer sequence of the pMT primer are described in SEQ ID No. 1 and SEQ ID No. Shown in 2
SEQ ID No. 1: TCGTCGCCAGCTGGCATTAAT
SEQ ID No. 2: TTCACTTTTTCTCATCATCACTGATAGG,
Table 1 Strains and plasmids used

(2) Using the primer polymerase chain reaction (PCR), the gene sequence of the LacZ (368 bp) reporter gene fragment was cloned from the pCU19 plasmid, the annealing temperature was 65 ° C., and the plasmid pMTmCherry to T7.
The gene sequence of the fragment (220 bp) is cloned, the annealing temperature is 60 ° C., and L is L by binding and fusion with the LacZ and T7 terminator sequences.
An acZ-T7 fusion fragment (568 bp) is obtained and a homologous fragment needs to be added when designing the primer (FIG. 1).

The forward primer sequence and the reverse primer sequence of the LacZ primer are described in SEQ ID No. 3 and SEQ ID No. Shown in 4
SEQ ID No. 3: CTATCAGTGATAGAGAAAAGTGAAATGA
CCATGATTACGCCAAGC
SEQ ID No. 4: GTGGCAGCCACTAGGTTAACTATGCGG
CATCAGAGCAG,
The forward primer sequence and the reverse primer sequence of the T7 primer are described in SEQ ID No. 5 and SEQ ID No. Shown in 6
SEQ ID No. 5: TTAACCTAGGCTGCTGCC
SEQ ID No. 6: TCATTAATTGCAGCTGGCACGGATTTCACA
CAGGAAACAGCTAGAC,
The forward and reverse primer sequences of the fused LacZ-T7 primer are described in SEQ ID No. 7 and SEQ ID No. Shown in 8
SEQ ID No. 7: CTATCAGTGATAGAGAAAAGTGAA
SEQ ID No. 8: TCATTAAGCAGCTGGCAC,

(3) The above-mentioned LacZ-T7 and pMT are connected by a homologous recombinase, the gene fragment is placed in a PCR tube, gently pipetted with a pipette and mixed, and all the liquids are centrifuged at a low speed to the bottom of the centrifuge tube. Use 10-100 ng for the carrier. The molar ratio of carrier to insert fragment is 1: 1 to 1:10. When connecting multiple fragments, the molar ratio of each fragment is 1: 1.
pmols = (mass ng x 1000) / (fragment length bp x 650 daltons)
,
The mixture is reacted at 50 ° C. for 15 minutes. For multiple fragment clonings, the reaction time can be extended, but the total time should not exceed 60 minutes.

100 μL of thawed Escherichia coli BL21 competent cells are taken in an ice bath, target DNA (plasmid or use, ligation product) is added, mixed gently and left on ice for 25 minutes. Heat shock in a water bath at 42 ° C for 30-45 seconds, immediately transfer to an ice bath and leave for 2 minutes. Add 500 μL of sterile LB medium without antibiotics to the centrifuge tube, mix and revive at 37 ° C., 200 rpm for 1 hour. Aspirate various volumes of resurrection solution, apply evenly to LB medium containing Amp antibiotics, place the plate upside down in a 37 ° C. incubator and incubate overnight.

(4) Select a spot on the medium and use a sterile 10 μL pipette tip to draw a line on the LB medium containing ampicillin antibiotics and the LB medium containing ampicillin, 20 mg / L X-gal and tetracycline antibiotics, respectively. Strains that grow in two media and grow blue spots in LB medium containing ampicillin, 20 mg / L X-gal and tetracycline antibiotics are screened, recombinant plasmids are identified using primer PCR, and annealing temperature. Is 53 ° C and the core fragment of the plasmid is 3
Confirm that it is 590 bp (Fig. 1).

The forward and reverse primer sequences of the primers used for identification are described in SEQ ID No. 9 and SEQ ID No. Shown in 10
SEQ ID No. 9: ACTGTCAATTGTGATAGCGGG
SEQ ID No. 10: ATTAAGCAGCTGGCACGA,
The sequence was measured and the recombinant plasmid strain was Escherichia coli BL.
Confirm that it is 21 / pMTLacZ. The pMTLacZ plasmid map is shown in FIG.

Preparation of Tetracycline Color Card:
To detect 6 types of tetracycline in water, a tetracycline color card is required, a test strip with biosensor bacteria is measured with different concentrations of tetracycline solution, a color photograph is taken with a camera, and it is transferred to a computer. The color intensity is acquired by ImageJ software (Fig. 5).

Tetracycline detection:
Place the resurrected Escherichia colli BL21 / pMTLacZ bacterium test strip in a water sample to measure, read the amount of light immediately after the reaction for 150 minutes, drop X-gal and wait for 1.5 hours, then wait 1.5 hours for a biosensor and a tetracycline antibiotic in water. After the reaction of the substance is completed, the color development is read again, calculated by the chromaticity of the constructed tetracycline color card, and the tetracycline content of the water sample is evaluated (FIG. 7). To prove the accuracy and reliability of this novel test strip, 250 μg / L oxytetracycline and 100 μg / L doxycycline were prepared in two types of pond water (Table 2), respectively, and Escherichia coli BL21 / pMTLacZ bacteria were prepared, respectively. A test strip was tested. As a result, it was shown that the result of the test paper was stable and reproducible. Therefore, this method is reliable, feasible and of practical value (Fig. 6).
Table 2 Physical and chemical properties of pond water

The description of the above examples is for understanding the method of the present invention and its spirit. It goes without saying that those skilled in the art may also implement the invention with some modifications and modifications without departing from the principles of the invention, all of which are within the scope of protection of the invention. stomach.
[Sequence list]

SEQUENCE LISTING

<110> Nanjing ▲ Agriculture ▼ University

<120> Test strips and methods for detecting tetracycline antibiotics in water using biosensors

<130> No

<170> PatentIn version 3.5

<210> 1
<211> 19
<212> DNA
<213> Artificial sequence

<221> misc_feature
<222> (1) .. (19)
<223> F-primer as a pMT primer designed according to the requirements of the experiment
<400> 1
tcgtgccagc tgcattaat 19


<210> 2
<211> 25
<212> DNA
<213> Artificial sequence

<221> misc_feature
<222> (1) .. (25)
<223> R-primer as a pMT primer designed according to the requirements of the experiment
<400> 2
ttcacttttc tctatcactg atagg 25


<210> 3
<211> 45
<212> DNA
<213> Artificial sequence

<221> misc_feature
<222> (1) .. (45)
<223> F-primer as LacZ primer designed according to the requirements of the experiment
<400> 3
ctatcagtga tagagaaaag tgaaatgacc atgattacgc caagc 45


<210> 4
<211> 39
<212> DNA
<213> Artificial sequence

<221> misc_feature
<222> (1) .. (39)
<223> R-primer as LacZ primer designed according to the requirements of the experiment
<400> 4
gtggcagcag cctaggttaa ctatgcggca tcagagcag 39


<210> 5
<211> 18
<212> DNA
<213> Artificial sequence

<221> misc_feature
<222> (1) .. (18)
<223> F-primer as a T7 primer designed according to the requirements of the experiment.
<400> 5
ttaacctagg ctgctgcc 18


<210> 6
<211> 45
<212> DNA
<213> Artificial sequence

<221> misc_feature
<222> (1) .. (45)
<223> R-primer as a T7 primer designed according to the requirements of the experiment.
<400> 6
tcattaatgc agctggcacg atttcacaca ggaaacagct atgac 45


<210> 7
<211> 24
<212> DNA
<213> Artificial sequence

<221> misc_feature
<222> (1) .. (24)
<223> F-primer as a fusion LacZ-T7 primer designed according to the requirements of the experiment.
<400> 7
ctatcagtga tagagaaaag tgaa 24


<210> 8
<211> 19
<212> DNA
<213> Artificial sequence

<221> misc_feature
<222> (1) .. (19)
<223> R-primer as a fused LacZ-T7 primer designed according to the requirements of the experiment.
<400> 8
tcattaatgc agctggcac 19


<210> 9
<211> 20
<212> DNA
<213> Artificial sequence

<221> misc_feature
<222> (1) .. (20)
<223> F-primer as an appraisal primer designed according to the requirements of the experiment
<400> 9
actgtcaatt tgatagcggg 20


<210> 10
<211> 19
<212> DNA
<213> Artificial sequence

<221> misc_feature
<222> (1) .. (19)
<223> R-primer as an appraisal primer designed according to the requirements of the experiment
<400> 10
attaatgcag ctggcacga 19

Claims (1)

Tetracycline biosensor for detecting tetracycline antibiotics in water
-A method for preparing test strips containing bacterial inoculum.
The preparation method is
Tetracycline in 1/4 LB medium of 10% lactose and polymyxin B (PMB)
The process of preparing a suspension in which a biosensor inoculum is suspended,
Including the step of preparing the test paper by dropping the suspension onto a piece of filter paper and drying it.
In the test paper, the tetracycline biosensor inoculum is the lactose.
And wrapped in 1/4 LB medium of the polymyxin B (PMB) and on the filter paper piece
Is fixed to
The tetracycline biosensor inoculum is Escherichia coli.
Escherichia into which the pMTLacZ plasmid was introduced into BL21
coli BL21 / pMTLacZ recombinant strain,
The pMTLacZ plasmid has the structure shown in FIG. 3, and the Ampr gene, Tet.
Includes R gene, TetO gene, TetM gene, and LacZ gene,
The Escherichia coli BL21 / pMTLacZ recombinant strain is different.
A strain that produces different amounts of β-galactosidase under the induction of a high concentration of tetracycline.
the law of nature,
The test paper and X-gal are put into a mixture of water and LB medium to be tested and reacted.
Then, when the tetracycline antibiotic is present in the water to be tested, the test paper is blue.
Characterized by developing color,
The preparation method.

Images