JP6945294B2 - Fusobacterium nucleatum strain identification method - Google Patents

Description

The present invention relates to a method for identifying Fusobacterium nucleatum in a sample at the strain level. The present invention also relates to a combination of primers used in the method of the present invention and a kit containing the combination.

Fusobacterium nucleatum is a bacterium that inhabits the human oral cavity and large intestine. There are five subspecies (F. nucleatum subsp. Animalis), F. nucleatum subsp. Polymorphum, and F. nucleatum subsp. . nucleatum), Fusobacterium nucleatum subsp. Vincentii, and F. nucleatum subsp. Fusiforme are present, but their pathogenicity is even higher than that of the subspecies. It is known that the classification is different at the strain level (Non-Patent Document 1). Therefore, it is desirable that the strain level can be easily discriminated.

The existing method for discriminating strains is to obtain multiple pure cultures by separating and culturing from clinical specimens, and further, to determine whether they are the same strain by the DNA fingerprint method, at least about one week. It takes days.

Other methods for detecting fusobacterium nucleotam include 16S rRNA depending on the strain, such as identifying the sequence of the 16S ribosomal RNA gene (16S rRNA) or using a probe specific to 16S rRNA of a specific strain. Although there are detection methods that utilize the differences (Patent Documents 1 and 2), these methods are difficult to detect at the strain level.

CRISPR (clustered regularly interspaced short palindromic repeats) is a repetitive sequence region that is localized in one or more locations on the bacterial genome and is known to be involved in the adaptive immune system of bacteria (non-patent literature). 2). Specifically, CRISPR is a region that works together with CRISPR-associated proteins (Cas) in the cells of bacteria and paleontology and has a function related to infection defense of phages and plasmids. This region is commonly referred to as the CRISPR-Cas system, which combines CRISPR with CRISPR-related proteins (Cas). The CRISPR-Cas system is roughly divided into three types, type I, type II, and type III, depending on the type of Cas gene possessed by the system, and further, IA, IB, IC, ID, It is classified into 12 subtypes of IE, IF, I-U, II-A, II-B, III-A, III-B, and III-U (Non-Patent Documents 3 and 4). .. CRISPR is a site that records the history of phages and plasmids that the bacterium has infected in the past. A sequence fragment of 21 to 72 nucleotides derived from a phage or plasmid called a spacer is a sequence of 23 to 55 nucleotides called a repeat sequence. In parallel (50 or less in many cases) with both sides sandwiched between them (Non-Patent Document 5). Since the infection history of phages and plasmids differs depending on the strain, the amount of spacers contained in CRISPR differs, and as a result, it appears as a difference in CRISPR length and sequence. Although a strain typing method using CRISPR sequence detection has been developed (Patent Documents 3 and 4), there is no example of using it for strain typing of Fusobacterium nucleatum.

Japanese Unexamined Patent Publication No. 2013-183663 Japanese Unexamined Patent Publication No. 2015-231362 JP-A-2007-535325 Japanese Unexamined Patent Publication No. 2015-51907

Strauss, J. et al., Inflamm. Bowel. Dis., 2011 Sep., Vol.17, No.9, pp.1971-1978, doi: 10.1002 / ibd.21606 Takayasu Watanabe et al., "New Acquired Immunity Mechanism of Prokaryotes CRISPR / Cas System", Chemistry and Biology, Japan Society for Bioscience and Biotechnology, 2013, Vol. 51, No. 7, pp. 441-444 Makarova, K.S. et al., Biol. Direct., 2011 Jul., 6:38, doi: 10.1186 / 1745-6150-6-38 Makarova, K.S. et al., Biochem Soc Trans, 2013. Vol.41, No.6, pp. 1392-1400, doi: 10.1042 / BST20130038. Barrangou, R. and L.A. Marraffini, Mol. Cell, 2014. Vol.54, No.2, pp. 234-244, doi: 10.1016 / j.molcel.2014.03.011.

The present invention provides a method for identifying Fusobacterium nucleatum in a sample at the strain level. The present invention also provides a combination of primers used in the method of the present invention and a kit containing the combination.

In view of the above, the inventor of this case focused on CRISPR and started research. As a result of diligent studies, we identified a region in the genome of Fusobacterium nucleatum that may have CRISPR, and identified the DNA sequence of the region for designing primers that can be amplified by PCR for the DNA in this region. Then, when a primer was prepared based on the DNA sequence of the region for designing the primer, it was found that Fusobacterium nucleatum could be efficiently identified at the strain level. Based on this finding, the present invention has been completed.

That is, in one aspect, the present invention may be as follows.

[1] A method for identifying Fusobacterium nucleatum in a sample at the strain level. In the DNA derived from the sample, the following:
(1) Fusobacterium nucleatum subsp. Animalis (Fusobacterium nucleatum subsp. Animalis), which has accession number CP012713 of the International Nucleotide Sequence Database (INSD), Cas gene existing in the genome of the KCOM 1279 strain at 2,454,881 bp to 2,463,504 bp or the corresponding region. CRISPR region located on the 3'side of the group (type IB);
(2) Of the Cas gene cluster (type IB) existing in the genome of the Fusobacterium nucleatum subsp. Polymorphum ChDC F306 strain, which has INSD accession number CP013121, in the region corresponding to 1,070,083 bp to 1,078,752 bp. CRISPR region on the 3'side;
(3) Cas gene group (type) present in the genome of the Fusobacterium nucleatum subsp. Vincentii ChDC F8 KCOM 1231 strain, which has INSD accession number CP012714, or in the corresponding region. II-A) CRISPR region located on the 3'side; and (4) 279,908 bp to 289,159 bp or the corresponding region of the genome of the Fusobacterium nucleatum subspecies polymorpham ChDC F306 strain with INSD accession number CP013121. CRISPR region located on the 3'side of the Cas gene group (type III-A);
The method comprising detecting the presence or absence of a CRISPR-Cas sequence containing the region and the length of the sequence for at least one region selected from the group consisting of.

[2] Primer capable of amplifying DNA containing the region for at least one region selected from the group consisting of (1) to (4) for detecting the presence or absence of the CRISPR-Cas sequence and the length of the sequence. The method according to the above [1], which comprises performing PCR using the combination of.

[3] The combination of primers capable of amplifying DNA containing the region (1) is a part of a base sequence having at least 85% or more identity with respect to SEQ ID NO: 1, and has 15 to 30 bases. It is a combination of a forward primer having a length and a reverse primer having a length of 15 to 30 bases, which is complementary to a part of the base sequence having at least 85% or more identity with respect to SEQ ID NO: 2. ,
The combination of primers capable of amplifying DNA containing the region (2) is a part of a base sequence having at least 85% or more identity with respect to SEQ ID NO: 3, and has a length of 15 to 30 bases. It is a combination of a forward primer having a length of 15 to 30 bases and a reverse primer having a length of 15 to 30 bases, which is complementary to a part of the base sequence having at least 85% or more identity with respect to SEQ ID NO: 4.
The combination of primers capable of amplifying DNA containing the region (3) is a part of a base sequence having at least 85% or more identity with respect to SEQ ID NO: 5, and has a length of 15 to 30 bases. It is a combination of a forward primer having a length of 15 to 30 bases and a reverse primer having a length of 15 to 30 bases, which is complementary to a part of the base sequence having at least 85% or more identity with respect to SEQ ID NO: 6.
The combination of primers capable of amplifying DNA containing the region (4) is a part of a base sequence having at least 85% or more identity with respect to SEQ ID NO: 7, and has a length of 15 to 30 bases. It is a combination of a forward primer having a length of 15 to 30 bases and a reverse primer having a length of 15 to 30 bases, which is complementary to a part of the base sequence having at least 85% or more identity with respect to SEQ ID NO: 8.
The method according to the above [2].

[4] The combination of primers capable of amplifying DNA containing the region (1)
Primers containing 5'-TGAAAAATATAAAYTATAATTATGCTTGGG -3'(SEQ ID NO: 9) and
A combination of primers containing 5'-TTTAAAAGRGTWTCTGGATCTGCTAA -3'(SEQ ID NO: 10).
The combination of primers capable of amplifying DNA containing the region (2)
Primers containing 5'- AAATCTTTTCAAATGTGGTGGTGA -3'(SEQ ID NO: 11) and
A combination of primers containing 5'-TTTTTTCTTAACTTGYCCTAAAAAACTCA -3'(SEQ ID NO: 12).
The combination of primers capable of amplifying DNA containing the region (3)
Primers containing 5'-CAAATGATTTATCATTAGTGAGA -3'(SEQ ID NO: 13) and
A combination of primers containing 5'-ACTATTGGTATTTTTTATGCAACTC -3'(SEQ ID NO: 14) and a combination of primers capable of amplifying DNA containing the region (4)
Primers containing 5'-TTTGATGAAAAAAGTGGAGGAG -3'(SEQ ID NO: 15) and
A combination of primers containing 5'-GTAAAGGCAAATTTYCCATGTAAAG -3'(SEQ ID NO: 16),
The method according to the above [2].

[5] When the electrophoresis pattern of the PCR product for the DNA derived from the sample to be identified and the electrophoresis pattern of the PCR product for the DNA derived from the sample to be compared match, Fusobacterium nucleatum in the sample to be identified is determined. The method according to any one of [2] to [4] above, which identifies the strain as the same strain as Fusobacterium nucleatum in the sample to be compared.

[6] Below:
A forward primer that is part of a sequence that has at least 85% or more identity to SEQ ID NO: 1 and has a length of 15 to 30 bases, and at least 85% or more identity to SEQ ID NO: 2. A combination of reverse primers with a length of 15-30 bases that is complementary to part of the sex sequence;
A forward primer that is part of a sequence that has at least 85% or more identity to SEQ ID NO: 3 and has a length of 15 to 30 bases, and at least 85% or more identity to SEQ ID NO: 4. A combination of reverse primers with a length of 15-30 bases that is complementary to part of the sex sequence;
A forward primer that is at least 85% or more identical to SEQ ID NO: 5 and has a length of 15 to 30 bases, and at least 85% or more identical to SEQ ID NO: 6. A combination of reverse primers having a length of 15 to 30 bases that is complementary to a portion of the sequence having sex; and a portion of the sequence having at least 85% or more identity to SEQ ID NO: 7. A forward primer with a length of 15-30 bases and a reverse primer with a length of 15-30 bases that is complementary to a portion of the sequence that has at least 85% or more identity to SEQ ID NO: 8. Combination;
A combination of at least one primer selected from the group consisting of.

[7] Below:
Combination of primer containing SEQ ID NO: 1 and primer containing SEQ ID NO: 2;
Combination of primer containing SEQ ID NO: 3 and primer containing SEQ ID NO: 4;
A combination of a primer containing SEQ ID NO: 5 and a primer containing SEQ ID NO: 6; and a combination of a primer containing SEQ ID NO: 7 and a primer containing SEQ ID NO: 8;
A combination of at least one primer selected from the group consisting of.

[8] The above [6] is a kit for identifying Fusobacterium nucleatum at the strain level, which comprises the combination of primers according to [7].

The present invention is useful in that Fusobacterium nucleatum in a sample can be used for strain-level identification. In particular, it is useful in that Fusobacterium nucleatum contained in clinical specimens such as saliva, feces, and tissues can be detected and identified at the strain level without culturing.

FIG. 1 is a schematic diagram showing the CRISPR-Cas region of Fusobacterium nucleatum type IB (1). FIG. 2 is a schematic diagram showing the CRISPR-Cas region of Fusobacterium nucleatum type IB (2). FIG. 3 is a schematic diagram showing the CRISPR-Cas region of Fusobacterium nucleatum type II-A. FIG. 4 is a schematic diagram showing the CRISPR-Cas region of Fusobacterium nucleatum type III-A. FIG. 5 is a photograph showing the electrophoresis pattern of the PCR amplified fragment of each CRISPR region of the isolate / standard strain shown in Example 2. Each primer set specific for amplification of each region of (a) type IB (1), (b) type IB (2), (c) type II-A, and (d) type III-A. The pattern in which each isolate / standard strain was electrophoresed in the same order is shown for the PCR amplified fragment obtained in. a1 to a10 are F. nucleatum subsp. Animalis, p1 to p9 are F. nucleatum subsp. Polymorphum, v1 is F. nucleatum subsp. Vincentii, and n1 is F. nucleatum subsp. Nucleatum. Starred a3 and a4, a5 and a6, p2 and p3, p7 and p8 indicate strains showing the same AP-PCR band pattern isolated from the same subject. a, p, v strains, represented by n and f are standard strains respectively ^{F. nucleatum subsp. animalis JCM 11025 T} , F. nucleatum subsp. polymorphum JCM 12990 T, F. nucleatum subsp. vincentii JCM 11023 T, F. nucleatum subsp. Nucleatum JCM 8532 ^T , and ^{F. nucleatum subsp. Fusiforme JCM 11024 T.}

The present invention will be specifically described below, but the present invention is not limited thereto.

Unless otherwise defined herein, scientific and technical terms used in the context of the present invention shall have meanings commonly understood by those skilled in the art.

As used herein, CRISPR refers to a repetitive sequence located downstream of a gene encoding a CRISPR-related protein (Cas) in the bacterial genome. As used herein, the term CRISPR region means a region that may have CRISPR. There are usually multiple sequence fragments called spacers in the CRISPR region, but some strains may not contain spacers. In the present specification, even for a strain that does not contain this spacer, the region existing on the downstream side of the Cas gene that may contain the spacer is referred to as a CRISPR region for convenience.

As used herein, the CRISPR-Cas region refers to a region in the bacterial genome that contains at least a portion of the CRISPR region and Cas gene. As used herein, the CRISPR-Cas sequence refers to a sequence containing at least a part of the Cas gene and a sequence of the CRISPR region.

The present inventors have found that there are four CRISPR regions in the genome of Fusobacterium nucleatum. These four CRISPR regions were identified as type IB (1), type IB (2), type II-A, and type III-A, respectively, according to the classification methods of Non-Patent Documents 3 and 4, respectively. The above-mentioned CRISPR region is represented by the schematic diagram of FIGS. 1 to 4, and can be specified as follows.
-Type IB (1): Cas gene cluster existing in the genome of Fusobacterium nucleatum subspecies Animalis KCOM 1279 strain, which is the international nucleotide sequence database (INSD) accession number CP012713, at 2,454,881 bp to 2,463,504 bp or the corresponding region. A CRISPR region located on the 3'side of (type IB). Here, the Cas gene of type IB (1) in the genome of the KCOM 1279 strain exists in the direction of 5'→ 3'on the complementary strand side with respect to the sequence disclosed in the accession number.
-Type IB (2): 3 of the Cas gene cluster (type IB) present in the genome of the Fusobacterium nucleatum subspecies polymorpham ChDC F306 strain with INSD accession number CP013121 at 1,070,083 bp to 1,078,752 bp or the corresponding region. 'The CRISPR region on the side. Here, the Cas gene of type IB (2) in the genome of the ChDC F306 strain exists in the direction of 5'→ 3'on the complementary strand side with respect to the sequence disclosed in the accession number.
-Type II-A: Cas gene cluster (Type II-A) present in the genome of the Fusobacterium nucleatum subspecies Vincenti ChDC F8 KCOM 1231 strain with INSD accession number CP012714 at 1,100,111 bp to 1,106,109 bp or the corresponding region. CRISPR region located on the 3'side of. Here, the Cas gene of type II-A in the genome of the ChDC F8 KCOM 1231 strain exists in the direction of 5'→ 3'on the complementary strand side with respect to the sequence disclosed in the above accession number.
-Type III-A: 3'of the Cas gene cluster (Type III-A) present in the genome of the Fusobacterium nucleatum subspecies polymorpham ChDC F306 strain with INSD accession number CP013121 at 279,908 bp to 289,159 bp or the corresponding region. The CRISPR region present on the side. Here, the Cas gene of type III-A in the genome of the ChDC F306 strain exists in the 5'→ 3'direction in the sequence disclosed by the accession number.

Therefore, in the present specification, when referring to a CRISPR region of type IB (1), type IB (2), type II-A or type III-A, the region is specified according to the above specification.

As used herein, DNA means deoxyribonucleic acid.

Method for Identifying Fusobacterium Nucleatum at Strain Level In one aspect, the present invention is a method for identifying Fusobacterium nucleatum in a sample at the strain level, and in the DNA derived from the sample, a CRISPR of type IB (1). A CRISPR-Cas containing a region, at least one region selected from the group consisting of a region, a type IB (2) CRISPR region, a type II-A CRISPR region, and a type III-A CRISPR region. The method relates to the above method, which comprises detecting the presence or absence of a sequence and the length of the sequence.

In a preferred embodiment, the method of the invention comprises a type IB (1) CRISPR region, a type IB (2) CRISPR region, a type II-A CRISPR region, and a type III-A CRISPR region. For at least two, at least three, or all four regions selected from the group, the region may include detecting the presence or absence of a CRISPR-Cas sequence and the length of the sequence.

The sample used in the method of the present invention may be any sample as long as it contains the genomic DNA of Fusobacterium nucleatum. Examples of samples include, but are not limited to, saliva, blood, feces, tissues, and isolated Fusobacterium nucleatum cells. The sample may be a frozen sample.

In the method of the present invention, the DNA derived from the sample may be DNA in a state of being isolated or extracted from the sample, or may be DNA in a crude state in which the sample is simply dissolved in a lysate or the like. ..

Therefore, the method of the present invention may include a step of obtaining a sample or a step of obtaining DNA derived from the sample before the step of detecting the presence or absence of the CRISPR-Cas sequence and the length of the sequence.

The presence or absence of a CRISPR-Cas sequence and the detection of the length of the sequence in the method of the present invention are determined by detecting a CRISPR region of type IB (1), a CRISPR region of type IB (2), and a CRISPR region of type II-A. , And a CRISPR region of type III-A, for at least one region selected from the group, preferably at least two regions, at least three regions, or all four regions, a CRISPR-Cas sequence containing that region. It can be performed by using a known method capable of detecting the presence or absence of the sequence and the length of the sequence. Preferably, such a technique involves performing a polymerase chain reaction (PCR) with a combination of primers capable of amplifying the DNA containing the region.

The PCR conditions can be appropriately determined by those skilled in the art based on the Tm and the like of the primers used. For example, the reaction solution and reaction conditions shown in Example 4 (2) described later can be adopted.

The combination of primers used in the method of the present invention may be a combination containing the primers described in the following "Primer" item.

The presence or absence of a CRISPR-Cas sequence and the detection of the length of the sequence can be detected, for example, by electrophoresis of a PCR product. The electrophoresis may be carried out by a method known to those skilled in the art, for example, agarose gel electrophoresis. In another embodiment, the presence or absence of a CRISPR-Cas sequence and the detection of the length of the sequence can also be performed, for example, by sequencing the PCR product.

In the method of the present invention, the identification of Fusobacterium nucleatum in a sample matches the electrophoresis pattern of the PCR product with respect to the DNA derived from the sample to be identified and the electrophoresis pattern of the PCR product with respect to the DNA derived from the sample to be compared. In this case, the Fusobacterium nucleatum in the sample to be identified may include identifying that it is the same strain as the Fusobacterium nucleatum in the sample to be compared. When the electrophoresis patterns match, the position of the band appearing in the electrophoresis of the PCR product (that is, the length of the PCR product) is that of the PCR product obtained for the DNA derived from the sample to be identified and the DNA derived from the sample to be compared. It means that it matches with the obtained PCR product.

As used herein, the term "sample to be identified" refers to a sample to be tested or analyzed for the presence or absence of Fusobacterium nucleatum or the identification of a strain of Fusobacterium nucleatum contained in the sample.

In the present specification, the "sample to be compared" is not particularly limited as long as it is a sample containing Fusobacterium nucleatum to be compared. The Fusobacterium nucleatum to be compared may be isolated / identified at the strain level (that is, an isolate of F. nucleatum or a known standard strain), and the strain has not been isolated / identified. You may.

When the Fusobacterium nucleatum to be compared is isolated and identified at the strain level, the method of the present invention determines whether the Fusobacterium nucleatum in the sample to be identified is the same as the already identified strain. Can be used for.

When the Fusobacterium nucleatum to be compared is not isolated and identified at the strain level, for example, it is assumed that the method of the present invention is applied to the following purposes.
-Identify whether the Fusobacterium nucleatum contained in the sample to be identified is the same strain as the Fusobacterium nucleatum of unknown strain contained in another sample to be compared.
-For a sample of a certain population, identify whether or not the same strain exists across individual differences. -Determine how many types of strains are present in a sample of a certain individual or a sample of a certain population.

Primer In one aspect, the present invention comprises the CRISPR region of type IB (1), the CRISPR region of type IB (2), the CRISPR region of type II-A, and the CRISPR region of type III-A. With respect to at least one region selected from the group, preferably at least two regions, at least three regions, or all four regions, a primer capable of amplifying the DNA containing the region.

The primer capable of amplifying DNA containing the CRISPR region of type IB (1) is a part of a base sequence having at least 85% or more identity with respect to SEQ ID NO: 1 and is 15 to 30. Forward primers with a base length and / or reverse primers with a length of 15 to 30 bases that are complementary to a portion of the base sequence that has at least 85% or more identity to SEQ ID NO: 2. included. The above forward primer and reverse primer may be used as a combination of primers. A schematic diagram of the positions of the primers is shown in FIG. SEQ ID NO: 1 is a partial sequence of the Cas gene located upstream (5'side) of the CRISPR region of type IB (1). SEQ ID NO: 2 is a sequence of a part of a conserved gene existing on the downstream side (3'side) of the CRISPR region of the above type IB (1). Here, it should be noted that the Cas gene of type IB (1) exists in the direction of 5'→ 3'on the complementary strand side with respect to the genomic sequence disclosed in INSD accession number CP012713. be. The upstream and downstream sides of the CRISPR region follow the direction of the Cas gene coding strand that exists in close proximity. By designing the forward primer and the reverse primer from the above viewpoint, a combination of primers that sandwich the CRISPR region of the above type IB (1) can be obtained.

The primer capable of amplifying DNA containing the CRISPR region of type IB (2) is a part of a base sequence having at least 85% or more identity with respect to SEQ ID NO: 3 and is 15 to 30. Forward primers with a base length and / or reverse primers with a length of 15 to 30 bases that are complementary to a portion of the base sequence that has at least 85% or more identity to SEQ ID NO: 4. included. The above forward primer and reverse primer may be used as a combination of primers. A schematic diagram of the positions of the primers is shown in FIG. SEQ ID NO: 3 is a partial sequence of the Cas gene located upstream (5'side) of the CRISPR region of type IB (2). SEQ ID NO: 4 is a sequence of a part of a conserved gene existing on the downstream side (3'side) of the CRISPR region of the above type IB (2). Here, it should be noted that the Cas gene of type IB (2) exists in the direction of 5'→ 3'on the complementary strand side with respect to the genomic sequence disclosed in INSD accession number CP013121. be. The upstream and downstream sides of the CRISPR region follow the direction of the Cas gene coding strand that exists in close proximity. By designing the forward primer and the reverse primer from the above viewpoint, it is possible to obtain a combination of primers that sandwich the CRISPR region of the above type IB (2).

The primer capable of amplifying DNA containing the CRISPR region of type II-A is a part of a base sequence having at least 85% or more identity with respect to SEQ ID NO: 5 and has a length of 15 to 30 bases. Includes forward primers with a stake and / or reverse primers with a length of 15-30 bases that are complementary to a portion of the base sequence that has at least 85% or more identity to SEQ ID NO: 6. The above forward primer and reverse primer may be used as a combination of primers. A schematic diagram of the positions of the primers is shown in FIG. SEQ ID NO: 5 is a partial sequence of the Cas gene located upstream (5'side) of the CRISPR region of type II-A. SEQ ID NO: 6 is a sequence of a part of a conserved gene existing on the downstream side (3'side) of the CRISPR region of type II-A. Here, it should be noted that the Cas gene of type II-A exists in the direction of 5'→ 3'on the complementary strand side with respect to the genomic sequence disclosed in INSD accession number CP012714. The upstream and downstream sides of the CRISPR region follow the direction of the Cas gene coding strand that exists in close proximity. By designing the forward primer and the reverse primer from the above viewpoint, a combination of primers that sandwich the CRISPR region of the above type II-A can be obtained.

The primer capable of amplifying DNA containing the CRISPR region of type III-A is a part of a base sequence having at least 85% or more identity with respect to SEQ ID NO: 7 and has a length of 15 to 30 bases. Includes forward primers with a stagnation and / or reverse primers with a length of 15-30 bases that are complementary to a portion of the base sequence having at least 85% or more identity to SEQ ID NO: 8. The above forward primer and reverse primer may be used as a combination of primers. A schematic diagram of the positions of the primers is shown in FIG. SEQ ID NO: 7 is a partial sequence of the Cas gene located upstream (5'side) of the CRISPR region of type III-A. SEQ ID NO: 8 is a sequence of a part of a conserved gene existing on the downstream side (3'side) of the CRISPR region of type III-A. Here, the Cas gene of type III-A exists in the direction of 5'→ 3'of the genome sequence disclosed in INSD accession number CP013121, and the upstream side and the downstream side of the CRISPR region are present in close proximity. Follows the direction of the Cas gene coding strand. By designing the forward primer and the reverse primer from the above viewpoint, a combination of primers that sandwich the CRISPR region of the above type III-A can be obtained.

In the present specification, "at least 85% or more identity" with respect to a specific base sequence is preferably at least 90% or more, at least 95% or more, at least 98% or more, and at least 99 with respect to a specific base sequence. It may be% or more, or 100% identity.

As used herein, the identity of a DNA sequence can be determined by visual inspection or mathematical calculation, but it may also be determined by comparing the sequence information of two nucleic acids using a computer program. .. Sequence comparison computer programs include, for example, MUSCLE (Edgar, RC, Nucleic acids research, Vol.32, No.5, 1792-1797, 2004) and Clustal W (Higgins D. et al., Nucleic Acids Res. Vol.22, pp). .4673-4680, 1994) and so on. The standard default parameter settings used for array alignment are -400 for gap open and 0 for gap extend for the gap penalties parameter in MUSCLE. Other parameters are max memory 849MB, max iterations 8 times, all optional clustering methods UPGMB, and min diag length 24. In ClustalW, the gap opening penalty for pairwise alignment and multiple alignment parameters is 15, the gap extension penalty is 6.66, the DNA weight matrix is IUB, the transition weight is 0.5, the negative matrix specification is OFF, and the delay divergent cutoff is 30%. be.

In another embodiment, primers capable of amplifying DNA containing the CRISPR region of type IB (1) include a forward primer containing SEQ ID NO: 9 and / or a reverse primer containing SEQ ID NO: 10. The above forward primer and reverse primer may be used as a combination of primers.

Primers capable of amplifying DNA containing the CRISPR region of type IB (2) include a forward primer containing SEQ ID NO: 11 and / or a reverse primer containing SEQ ID NO: 12. The above forward primer and reverse primer may be used as a combination of primers.

Primers capable of amplifying DNA containing the CRISPR region of type II-A include a forward primer containing SEQ ID NO: 13 and / or a reverse primer containing SEQ ID NO: 14. The above forward primer and reverse primer may be used as a combination of primers.

Primers capable of amplifying DNA containing the CRISPR region of type III-A include a forward primer containing SEQ ID NO: 15 and / or a reverse primer containing SEQ ID NO: 16. The above forward primer and reverse primer may be used as a combination of primers.

In one aspect of the kit, the invention relates to a kit for identifying Fusobacterium nucleatum at the strain level, which comprises the primers described in the "Primers" section above.

The kit of the present invention may contain the primers of the present invention as a solution or a lyophilized product. The solution or lyophilized product may be properly packaged. The kit of the present invention may also include instructions for carrying out the methods of the present invention.

Although the present invention has been described in general, specific embodiments are provided herein for reference in order to gain further understanding. However, these are for illustrative purposes only, and the scope of the present invention is not limited thereto.

Example 1: Search for the CRISPR-Cas region of Fusobacterium nucleatum
Search for CRISPR-related protein (Cas) genes in the genome sequences of 28 strains of 5 subspecies of Fusobacterium nucleatum (Table 1) registered in the NCBI database, and the CRISPRfinder program (http: // CRISPR. i2bc.paris-saclay.fr/Server/) was used to search for CRISPR, and the CRISPR-Cas region was searched.

As a result of the above search, it was found that F. nucleatum possesses four regions in the genome that may conserve CRISPR-Cas, not limited to subspecies, and the genes before and after that are conserved ( 1 to 4). CRISPR is classified according to the type of Cas gene (Non-Patent Documents 3 and 4), but the four CRISPR types found in F. nucleatum are type IB (type IB (1)). , Type IB (2)), type II-A, and type III-A, one type each (Table 1). Type IB (1) is the subspecies animalis (F. nucleatum subsp. Animalis), and type IB (2) is the subspecies polymorphum (F. nucleatum subsp. Polymorphum) and the subspecies Nucleatum (F. nucleatum subsp. Nucleatum). ), Type II-A tended to be possessed by the subspecies Vincenti (F. nucleatum subsp. Vincentii), and type III-A tended to be possessed by the subspecies polymorpham.

Here, the CRISPRs found in the above F. nucleatum can also be identified as follows.
Type IB (1) is of the Cas gene cluster (type IB) present in the genome of the Fusobacterium nucleatum subspecies Animalis KCOM 1279 strain with INSD accession number CP012713 at 2,454,881 bp to 2,463,504 bp or the corresponding region. It is a CRISPR region existing on the 3'side.
-Type IB (2) is of the Cas gene cluster (Type IB) present in the genome of the Fusobacterium nucleatum subspecies polymorpham ChDC F306 strain with INSD Accession Number CP013121 at 1,070,083 bp to 1,078,752 bp or the corresponding region. It is a CRISPR region existing on the 3'side.
-Type II-A is a Cas gene cluster (Type II-A) present in the genome of the Fusobacterium nucleatum subspecies Vincenti ChDC F8 KCOM 1231 strain with INSD accession number CP012714 at 1,100,111 bp to 1,106,109 bp or the corresponding region. ) Is a CRISPR region located on the 3'side.
-Type III-A is 3 of the Cas gene cluster (Type III-A) present in the genome of the Fusobacterium nucleatum subspecies polymorpham ChDC F306 strain with INSD accession number CP013121 at 279,908 bp to 289,159 bp or the corresponding region. It is a CRISPR region that exists on the'side.

Example 2: Preparation of Fusobacterium nucleatum strain used in the test (1) F. nucleatum strain standard strain used in the test was F. nucleatum subsp. Animalis JCM 11025 ^T , ^{F. nucleatum subsp. Fusiforme JCM 11024 T} , F. ^{. nucleatum subsp. nucleatum JCM 8532 T} , F. nucleatum subsp. polymorphum JCM 12990 T, F. nucleatum subsp. vincentii JCM 11023 T 5 shares of the (standard strains that are registered with the National research and development RIKEN Bioresource Center) , 21 isolates isolated from clinical specimens stored at Kyodo Dairy Co., Ltd. laboratory were used. Each strain was purely cultured, and the total length of the 16S rRNA gene was 27F (5'-AGAGTTTGATCCTGGCTCAG-3'(SEQ ID NO: 17)) (Young, BK et al., Prostaglandins and medicine, Vol.6, No.3, pp.257. -265 (1981)) and 1492R (5'-GGTTACCTTGTTACGACTT-3' (SEQ ID NO: 18)) (Lane, D. et al., Proc. Natl. Acad. Sci. USA, Vol.82, pp.6955-6959 (1985) )) Amplification was performed using a primer, and the amplified fragment was sanger-sequenced. Subspecies of the isolate was determined from the obtained sequence and used for the experiment. The breakdown of the variants of the isolates was 10 for Animalis, 9 for Polymorphum, 1 for Vincenti, and 1 for Nucleatum.

Arbitrarily primed polymerase chain reaction (AP-PCR)
Whether or not the isolated colonies were derived from the same strain was confirmed by the AP-PCR method (Haraldsson, G., et al., J. Med. Microbiol., Vol.53, pp.161- 165, doi: 10.1099 / jmm.0.5441-0 (2004)). Primers are C1 (5'-GATGAGTTCGTGTCCGTACAACTGG-3' (SEQ ID NO: 19)), D8635 (5'-GAGCGGCCAAAGGGAGCAGAC-3' (SEQ ID NO: 20)), or D11344 (5'-AGTGAATTCGCGGTGAGATGCCA-3' (SEQ ID NO: 21)). It was used. Using the crude sample as a template, a PCR reaction solution containing a total solution volume of 15 μl containing 1 × Ex Taq Buffer, 200 μM each dNTP, 800 nM primer, and 0.38 U Ex Taq Hot Start Version (TaKaRa) was used. The temperature conditions are the same as those of Haraldsson et al. (Same as above) (denaturation at 94 ° C for 5 minutes and annealing at 35 ° C for 5 minutes, followed by 5 steps of 94 ° C for 3 minutes, 37 ° C for 3 minutes, and 72 ° C for 3/3, and 94 more. PCR was performed at ° C. for 1 minute, 55 ° C. for 1 minute, and 72 ° C. for 3 minutes, repeating 30 times, and finally stretching at 72 ° C. for 10 minutes). The PCR product was loaded into 1.5% agarose dissolved in 1 × TBE and electrophoresed in 1 × TBE at 50 V for 60 minutes. The gel was stained with ethidium bromide and the band pattern of the DNA fragment was visualized using an ultraviolet imager. Bacteria derived from the same strain were defined as those showing the same band pattern in all the amplification products of the three types of primers.

Example 3: Design of Primer for CRISPR Detection Based on the genomic sequence of 28 strains of F. nucleatum in Table 1 and the sequence obtained by the sequence of the isolates of Example 2, the four locations identified in Example 1 PCR primers specific for each of the CRISPR regions were designed. The forward primer is designed in the Cas1 or Cas2 gene sequence that is always present upstream of CRISPR, and the reverse primer targets the conserved gene that is present downstream of CRISPR that all 28 strains of F. nucleatum registered in the database have. Primers were designed and prepared. The prepared primers are as follows.
-Primer set that amplifies the CRISPR region of type IB (1)
Type IB No. 1 F: 5'-TGAAAAATATAAAYTATAATTATGCTTGGG -3'(SEQ ID NO: 9)
Type IB No. 1 R: 5'-TTTAAAAGRGTWTCTGGATCTGCTAA -3'(SEQ ID NO: 10)
-Primer set that amplifies the CRISPR region of type IB (2)
Type IB No.2 F: 5'-AAATCTTTTCAAATGTGGTGGTGA -3'(SEQ ID NO: 11)
Type IB No.2 R: 5'-TTTTTTCTTAACTTGYCCTAAAAAACTCA -3'(SEQ ID NO: 12)
-Primer set that amplifies the CRISPR region of type II-A
Type II-A F: 5'-CAAATGATTTATCATTAGTGAGA -3'(SEQ ID NO: 13)
Type II-A R: 5'-ACTATTGGTATTTTTTTATGCAACTC -3'(SEQ ID NO: 14)
-Primer set that amplifies the CRISPR region of type II-A
Type III-A F: 5'-TTTGATGAAAAAAGTGGAGGAG -3'(SEQ ID NO: 15)
Type III-A R: 5'-GTAAAGGCAAATTTYCCATGTAAAG -3'(SEQ ID NO: 16)
Example 4: CRISPR detection of Fusobacterium nucleatum by PCR primers on isolates and standard strains (1) DNA extraction from bacterial cells
The standard strain and isolate of F. nucleatum (Example 2) were cultured on EG medium under anaerobic conditions at 37 ° C. for 48 hours, and the grown colonies were collected and washed twice with PBS, and then 200 μl of PBS was used. Suspended in.

DNA extraction was performed by modifying a part of the method of Matsuki et al. (Matsuki, T. et al., Appl. Environ. Microbiol., Vol.70, No.1, pp.167-173 (2004)). The cells suspended in 200 μl of PBS consisted of 0.1 mm diameter beads (300 mg), lytic buffer (100 mM Tris-HCl, 50 mM EDTA pH8 (350 μl), 10% SDS (50 μl)) and TE saturated phenol (500 μl). After heat treatment (70 ° C., 10 minutes), the bacterial cells are physically crushed (4000 rpm, 1 minute) with Micro Smash MS-100 ((TOMY)), and at the same time, the bacterial cell protein is denatured. After centrifugation (4 ° C., 20000 × g, 5 minutes), phenol-chloroform-isoamyl alcohol (25: 24: 1) (500 μl) was added to 500 μl of the supernatant, and 350 μl of the supernatant after centrifugation was added to the eta-deposited mate. DNA was extracted with (Takara). After two centrifugations with cold 70% ethanol (1 ml), it was air dried and dissolved in 100 μl of nuclease free water.
(2) PCR
Using a primer set (Example 3) specific for amplification of four CRISPR regions of type IB (1), type IB (2), type II-A, and type III-A, the above (Example 3) PCR was performed using the DNAs of the isolates and standard strains extracted in 1) as templates. The PCR reaction was carried out in a reaction solution containing 1.0 μl of a template DNA solution, 1 × Ex Taq Buffer, 200 μM each dNTP, 200 nM primers, and 0.38 U Ex Taq Hot Start Version (TaKaRa) in a total solution volume of 15 μl. went. The PCR conditions for the type IB (1), type IB (2), and type III-A primer sets were 94 ° C. for 30 seconds, 55 ° C. for 30 seconds, and 72 ° C. after denaturation at 94 ° C. for 2 minutes. The three-tenth step was repeated 40 times, followed by stretching at 72 ° C. for 10 minutes. The PCR condition of type II-A was that after denaturation at 94 ° C. for 2 minutes, steps of 98 ° C. for 10 seconds, 55 ° C. for 15 seconds, and 72 ° C. for 7/7 were repeated 30 times. Four PCRs were performed on each strain.

The PCR results are shown in FIG. For each primer set, each isolate / standard strain was electrophoresed in the same order (that is, the same strain is vertically arranged in the four gel electrophoresis photographs of FIG. 5). a1 to a10 are F. nucleatum subsp. Animalis, p1 to p9 are F. nucleatum subsp. Polymorphum, v1 is F. nucleatum subsp. Vincentii, and n1 is F. nucleatum subsp. Nucleatum. The a3 and a4, a5 and a6, p2 and p3, p7 and p8 strains marked with an asterisk are strains isolated from the same subject and exhibiting the same AP-PCR band pattern. In FIG. 5, a (subspecies animalis), p (subspecies polymorpham), v (subspecies Vincenti), n (subspecies nucleotam), and f (subspecies fushiforme) are assigned to the Bioresource Center of the National Institute of Physical and Chemical Research. It is a registered standard strain. In addition, all or part of the genome sequence of these standard strains has already been registered in the International Nucleotide Sequence Database (INSD), and sequence information exists in all strains for regions that may have four CRISPRs. Therefore, it was used as a positive control or a negative control.

From 0 to 3 CRISPR amplified fragments were detected at different positions for each isolate / standard strain. In the standard strain, the presence or absence of CRISPR based on the genome sequence information and the presence or absence of the PCR amplified fragment matched. For strains (stars) isolated from different sites in the same subject and having the same AP-PCR band pattern, amplified fragments of the same length were confirmed in the two strains.

The method of the present invention can identify Fusobacterium nucleatum in a sample at the strain level. Since the involvement of Fusobacterium nucleatum in diseases is discussed at the strain level, it is also useful in that it is expected to be applied to a simple strain identification test that does not require culture of Fusobacterium nucleatum contained in clinical specimens. be.

Claims (6)

A method for identifying Fusobacterium nucleatum in a sample at the strain level, and in the DNA derived from the sample, the following:
(1) 2,454,881 bp to 2,463,504 bp (SEQ ID NO: 22) of the genome of the Fusobacterium nucleatum subsp. Animalis strain, which is the international nucleotide sequence database (INSD) accession number CP012713, or the corresponding region. The CRISPR region located on the 3'side of the Cas gene group (type IB) present in
(2) Fusobacterium nucleatum subsp. Polymorphum ChDC F306 strain genome 1,070,083 bp to 1,078,752 bp (SEQ ID NO: 23) or Cas gene cluster existing in the corresponding region, which is INSD accession number CP013121. CRISPR region on the 3'side of (type IB);
(3) Present in the genome of the Fusobacterium nucleatum subsp. Vincentii ChDC F8 KCOM 1231 strain, which has INSD accession number CP012714, at 1,100,111 bp to 1,106,109 bp (SEQ ID NO: 24) or the corresponding region. CRISPR region located on the 3'side of the Cas gene group (type II-A); and (4) 279,908 bp to 289,159 bp of the genome of the Fusobacterium nucleatum subspecies polymorpham ChDC F306 strain with INSD accession number CP013121 (SEQ ID NO:) 25) The CRISPR region located on the 3'side of the Cas gene group (type III-A) located in or the corresponding region;
From made with at least one region selected from the group using a combination of amplification possible primer DNA containing the, the region performs PCR, the presence and the sequence of the CRISPR-Cas sequence comprising the region Including detecting the length,
Here, the combination of primers capable of amplifying DNA containing the region (1) is a part of a base sequence having at least 95% or more identity with respect to SEQ ID NO: 1, and has 15 to 30 bases. It is a combination of a forward primer having a length and a reverse primer having a length of 15 to 30 bases, which is complementary to a part of the base sequence having at least 95% or more identity with respect to SEQ ID NO: 2. ,
The combination of primers capable of amplifying DNA containing the region (2) is a part of a base sequence having at least 95% or more identity with respect to SEQ ID NO: 3, and has a length of 15 to 30 bases. It is a combination of a forward primer having a length of 15 to 30 bases and a reverse primer having a length of 15 to 30 bases, which is complementary to a part of the base sequence having at least 95% or more identity with respect to SEQ ID NO: 4.
The combination of primers capable of amplifying DNA containing the region (3) is a part of a base sequence having at least 95% or more identity with respect to SEQ ID NO: 5, and has a length of 15 to 30 bases. It is a combination of a forward primer having a length of 15 to 30 bases and a reverse primer having a length of 15 to 30 bases, which is complementary to a part of the base sequence having at least 95% or more identity with respect to SEQ ID NO: 6.
The combination of primers capable of amplifying DNA containing the region (4) is a part of a base sequence having at least 95% or more identity with respect to SEQ ID NO: 7, and has a length of 15 to 30 bases. It is a combination of a forward primer having a length of 15 to 30 bases and a reverse primer having a length of 15 to 30 bases, which is complementary to a part of the base sequence having at least 95% or more identity with respect to SEQ ID NO: 8.
The method . The combination of primers capable of amplifying DNA containing the region (1)
Primers containing 5'-TGAAAAATATAAAYTATAATTATGCTTGGG -3'(SEQ ID NO: 9) and
A combination of primers containing 5'-TTTAAAAGRGTWTCTGGATCTGCTAA -3'(SEQ ID NO: 10).
The combination of primers capable of amplifying DNA containing the region (2)
Primers containing 5'- AAATCTTTTCAAATGTGGTGGTGA -3'(SEQ ID NO: 11) and
A combination of primers containing 5'-TTTTTTCTTAACTTGYCCTAAAAAACTCA -3'(SEQ ID NO: 12).
The combination of primers capable of amplifying DNA containing the region (3)
Primers containing 5'-CAAATGATTTATCATTAGTGAGA -3'(SEQ ID NO: 13) and
A combination of primers containing 5'-ACTATTGGTATTTTTTATGCAACTC -3'(SEQ ID NO: 14) and a combination of primers capable of amplifying DNA containing the region (4)
Primers containing 5'-TTTGATGAAAAAAGTGGAGGAG -3'(SEQ ID NO: 15) and
A combination of primers containing 5'-GTAAAGGCAAATTTYCCATGTAAAG -3'(SEQ ID NO: 16),
The method according to claim 1. When the electrophoresis pattern of the PCR product for the DNA derived from the sample to be identified matches the electrophoresis pattern of the PCR product for the DNA derived from the sample to be compared, Fusobacterium nucleatum in the sample to be identified is compared. The method according to claim 1 or 2 , which identifies the strain as the same strain as Fusobacterium nucleatum in the sample. Less than:
A forward primer that is part of a sequence that has at least 95% or more identity to SEQ ID NO: 1 and has a length of 15 to 30 bases, and at least 95% or more identity to SEQ ID NO: 2. A combination of reverse primers with a length of 15-30 bases that is complementary to part of the sex sequence;
A forward primer that is part of a sequence that has at least 95% or more identity to SEQ ID NO: 3 and has a length of 15 to 30 bases, and at least 95% or more identity to SEQ ID NO: 4. A combination of reverse primers with a length of 15-30 bases that is complementary to part of the sex sequence;
A forward primer that is part of a sequence that has at least 95% or more identity to SEQ ID NO: 5 and has a length of 15 to 30 bases, and at least 95% or more identity to SEQ ID NO: 6. A combination of reverse primers having a length of 15 to 30 bases that is complementary to a portion of the sequence having sex; and a portion of the sequence having at least 95% or more identity to SEQ ID NO: 7. A forward primer with a length of 15-30 bases and a reverse primer with a length of 15-30 bases that is complementary to a portion of the sequence that has at least 95% or more identity to SEQ ID NO: 8. Combination;
A combination of at least one primer selected from the group consisting of. Less than:
Combination of Primer Containing SEQ ID NO: 9 and Primer Containing SEQ ID NO: 10;
Combination of Primer Containing SEQ ID NO: 11 and Primer Containing SEQ ID NO: 12;
A combination of a primer containing SEQ ID NO: 13 and a primer containing SEQ ID NO: 14; and a combination of a primer containing SEQ ID NO: 15 and a primer containing SEQ ID NO: 16;
A combination of at least one primer selected from the group consisting of. A kit for identifying Fusobacterium nucleatum at the strain level, which comprises the combination of primers according to claim 4 or 5.

Images