JP6737592B2 - Anti-active GIP antibody - Google Patents

Description

The present invention relates to the use of an antibody that specifically reacts with activated GIP.

GIP (Gastric inhibitory polypeptide or glucose-dependent insulinotropic polypeptide) is one of the gut hormones belonging to the glucagon/secretin family. GIP is called incretin together with GLP-1 (glucagon-like peptide 1), and is secreted by K cells present in the small intestine during feeding of lipids and carbohydrates.
GIP is known to promote insulin secretion from pancreatic β cells and enhance glucose uptake into adipocytes in the presence of insulin. Therefore, it is considered that the action of GIP is one of the causes of obesity, and in fact, it is reported that obstruction of GIP function suppresses obesity (Non-patent Document 1).

Furthermore, GIP has been reported to contribute to insulin resistance (see Non-Patent Document 1). When insulin resistance develops, the absorption of sugar by insulin decreases, resulting in hyperinsulinemia. It is said that hyperinsulinemia is a fundamental cause of the development of various lifestyle-related diseases such as obesity, and prevention and improvement of insulin resistance also reduces the risk of lifestyle-related diseases. is important.

In addition, GIP is known to have a gastric acid secretion inhibitory action and a gastric motility inhibitory action (Patent Documents 1 to 3), and inhibition of GIP elevation is effective in promoting postprandial digestion and improving gastric lean. Conceivable.

Therefore, measuring the concentration of GIP in blood is important in the evaluation of such diseases and their therapeutic agents.
By the way, GIP is known to exist in an active form having physiological activity and an inactive form having no physiological activity. That is, in humans, prepro-GIP is processed by K cells distributed in the stomach, duodenum, and upper small intestine to become active GIP (also referred to as "GIP(1-42)"), and then DPP-4 induces N It is said that the last two amino acids are cleaved to form an inactive GIP (also referred to as “GIP(3-42)”). Therefore, in the quantification of GIP in vivo, the effect of the therapeutic drug, the risk of lifestyle-related diseases, and the like cannot be accurately known by measuring the total amount of active and inactive forms.

Conventionally, as a means for measuring active GIP, an active GIP quantification kit (IBL) is commercially available, but 1) the blood active GIP concentration after meal is higher than the quantification limit of the kit, 2) dilution rate However, there is a problem that the coefficient of variation exceeds 10%, and 3) the higher the dilution rate, the higher the measured value. In addition, recently, an anti-active GIP monoclonal antibody prepared by using a peptide consisting of 6 amino acid residues on the N-terminal side of GIP(1-42) as an immunogen, activated GIP at a concentration of 5-4000 pg/mL by ELISA method. It has been reported that it can be quantified (Non-Patent Document 2). In addition, an anti-active GIP monoclonal antibody prepared by using a peptide consisting of 7 amino acid residues on the N-terminal side of GIP(1-42) as an immunogen quantifies active GIP at a concentration of 7 to 500 pg/mL by ELISA. It has been reported (Patent Document 4).

International Publication No. 01/87341 Special table 2006-213598 gazette JP-A-5-95767 JP, 2013-138638, A

Miyawaki K et al., Nat Med. 8(7): 738-42, 2002 Jason S. Troutt et al., Clinical Chemistry, 57(6):849-855 (2011).

The present invention relates to providing an anti-active GIP antibody capable of detecting active GIP with high accuracy.

The present inventors have conducted various studies on the acquisition of an antibody that specifically recognizes active GIP, and have found a novel anti-active GIP antibody that recognizes an epitope different from conventional antibodies and has high specificity. Successfully acquired.

That is, the present invention relates to the following 1) to 3).
1) An anti-active GIP antibody that binds to active GIP and does not substantially bind to inactive GIP, and is one or more selected from the 8th to 10th amino acids of the amino acid sequence represented by SEQ ID NO: 5. An antibody which recognizes at least and which contains in the H chain a region consisting of the amino acid sequence represented by the following (1) or a conservative sequence modification thereof.
EMNPSDGRTHFNE (1)
2) A method for detecting or measuring active GIP using the antibody according to 1) above.
3) A reagent for detecting or measuring active GIP, which comprises the antibody according to 1) above.

By using the antibody of the present invention, active GIP can be detected with high accuracy in distinction from inactive GIP. Therefore, according to the present invention, it becomes possible to measure active GIP in a biological sample, detect abnormalities in the active GIP value, and further evaluate the efficacy of therapeutic agents using the active GIP as an index. Further, by calculating the ratio of active GIP to total GIP, it becomes possible to estimate the DPP-4 activity.

Calibration curve by sandwich ELISA using the anti-active GIP antibody of the present invention. Quantification of active GIP in human normal human blood using the anti-active GIP antibody of the present invention. (A) Blood GIP(1-42) and (B) blood Total GIP value (N=5, crossover test of the same subject) after ingesting a control diet and a test diet. (C) Percentage of post-meal GIP(1-42) to total GIP (%) Epitope analysis of the anti-active GIP antibody of the present invention.

In the present invention, “active GIP” means a mammalian active GIP, preferably a human active GIP. Human active GIP is a peptide consisting of 42 amino acids ("GIP(1-42)") (SEQ ID NO: 5). On the other hand, “inactive GIP” means a peptide (“GIP(3-42)”) in which two N-terminal amino acids (YA) of active GIP are cleaved.

The anti-active GIP antibody in the present invention is an antibody that binds to active GIP and does not substantially bind to inactive GIP.
Substantially no binding to inactive GIP is judged by measuring the binding between the test antibody and inactive GIP using a method such as Western blotting, immunoprecipitation, immunohistochemical staining, and ELISA. can do. Specifically, the binding amount of the test antibody to inactive GIP is at most 10% or less, preferably 5% or less, more preferably 1% or less, when the binding amount to active GIP is 100%. More preferably, it is 0.1% to be “substantially not bound to non-activated GIP”.
In addition, the measurement by the sandwich ELISA can be performed using, for example, an anti-total GIP antibody as a capture antibody and a biotinylated anti-active GIP monoclonal antibody as a detection antibody for an inactive GIP solution.

Further, the antibody of the present invention is an antibody that recognizes the 8th and subsequent amino acids from the N terminus of activated GIP (SEQ ID NO: 5), and recognizes at least one amino acid selected from the 8th to 10th (SDY). It is an antibody that does.

Furthermore, the antibody of the present invention contains in the H chain a region consisting of the amino acid sequence represented by the following (1) or a conservative sequence modification thereof.
EMNPSDGRTHFNE (1)
The alphabetic characters in (1) mean the one-letter code of amino acids, and the sequences are listed in order from the N-terminus to the C-terminus. Here, I is isoleucine, L is leucine, F is phenylalanine, V is valine, A is alanine, T is threonine, D is aspartic acid, Q is glutamine, E is glutamic acid, M is methionine, N is asparagine, and P is Proline, S is serine, G is glycine, R is arginine, and H is histidine.

In the present invention, "conservative sequence modification" means amino acid modification that does not significantly affect or change the reactivity of the antibody consisting of the amino acid sequence before modification. Such conservative sequence modifications include substitutions, additions and deletions of 1 to several, preferably 1 to 3, more preferably 1 amino acid. Examples of the conservatively modified amino acid sequence include amino acid sequences having 90% or more, preferably 95% or more, and more preferably 98% or more sequence identity with the amino acid sequence before modification. Such modifications can be introduced into the antibody of the invention by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions include substitution of amino acid residues with amino acid residues having a similar side chain (family of amino acid residues). Such families of amino acid residues are defined in the art and include basic side chains (eg lysine, arginine, histidine), acidic side chains (eg aspartic acid, glutamic acid), uncharged polar side chains ( For example, glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (for example, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), β-branched side chains (for example, threonine). , Valine, isoleucine), and amino acids with aromatic side chains (eg tyrosine, phenylalanine, tryptophan, histidine).

The amino acid sequence represented by (1) above encodes a region consisting of 13 amino acid residues at the 50th to 62nd positions of the amino acid sequence represented by SEQ ID NO: 2 showing the H chain variable region.

As long as the antibody of the present invention has the above-mentioned reactivity, it can be attached to a cysteine residue in a fragment of the antibody, for example, F(ab′) ₂ , F(ab′), single-chain Fv (scFv), VH and VL. It may be a disulfide bond Fv (dsFv) in which a substituted amino acid residue is bound via a disulfide bond or a polymer thereof, or a dimerization V region (Diabody) in which scFv is dimerized. .. Furthermore, as long as it has the above-mentioned reactivity, a peptide containing a part of the anti-active GIP antibody, that is, a peptide having a part of the amino acid sequence constituting the antibody and having the above-mentioned reactivity is also included in the fragment of the antibody. Be done.

The immunoglobulin class of the antibody of the present invention is not particularly limited, and may be any immunoglobulin class of IgG, IgM, IgA, IgE, IgD, and IgY, and is preferably IgG. Further, the antibody of the present invention includes antibodies of any isotype.

The antibody of the present invention may be a non-human animal antibody, a human chimeric antibody, a humanized antibody or a human antibody. Examples of the non-human animal antibody include antibodies of mouse, rat, hamster, guinea pig, and the like, and mouse antibody is preferable.
Here, the "human chimeric antibody" is genetically modified so that the constant region of an antibody that is derived from a non-human animal and that specifically binds to active GIP has the same constant region as a human antibody. An antibody, preferably a human/mouse chimeric antibody. In addition, "humanized antibody" corresponds to a human antibody that has a primary structure other than the complementary recognition regions (CDRs) of the H and L chains of an antibody that is derived from a non-human animal and that specifically binds to activated GIP. Is an antibody whose genetically modified primary structure has been modified. Further, the "human antibody" means a human antibody that is an expression product of an antibody gene of completely human origin.

The antibody of the present invention preferably further contains, as the H chain variable region, a region consisting of the amino acid sequence represented by SEQ ID NO: 2 or a conservative sequence modification thereof.
Further, the H chain variable region comprises an amino acid sequence represented by SEQ ID NO: 2 or a region comprising a conservative sequence modification thereof, and the L chain variable region comprises an amino acid sequence represented by SEQ ID NO: 4 or a conservative sequence modification thereof. Those containing regions are preferred.

In another aspect, the present invention provides the antibody constituents and genes thereof shown in 1) and 2) below. In particular, the amino acid sequence represented by SEQ ID NO: 2 or a polypeptide (H chain variable region) comprising a conservative sequence modification thereof contains the amino acid sequence represented by (1) above, and thus functions as an antibody of the present invention. Preferred as the carrying antibody fragment.
1) The following polypeptide and gene encoding the same: (a) A polypeptide comprising the amino acid sequence shown by SEQ ID NO: 2, or 90% or more, more preferably 95% or more, further preferably 98% or more with the amino acid sequence. A polypeptide having an amino acid sequence having the same identity, which has a function as an antibody that binds to active GIP and does not substantially bind to inactive GIP.
(B) a DNA comprising the nucleotide sequence represented by SEQ ID NO: 1, or a DNA comprising the nucleotide sequence having 90% or more, more preferably 95% or more, and even more preferably 98% or more identity to the nucleotide sequence. A DNA encoding a polypeptide having a function as an antibody which binds to active GIP and does not substantially bind to inactive GIP.
2) The following polypeptide and gene encoding the same (c) A polypeptide comprising the amino acid sequence shown by SEQ ID NO: 4, or 90% or more, more preferably 95% or more, and further preferably 98% or more with the amino acid sequence. A polypeptide having an amino acid sequence having the same identity, which has a function as an antibody that binds to active GIP and does not substantially bind to inactive GIP.
(D) a DNA comprising the nucleotide sequence represented by SEQ ID NO: 3, or a DNA comprising the nucleotide sequence having 90% or more, more preferably 95% or more, and even more preferably 98% or more identity to the nucleotide sequence. A DNA encoding a polypeptide having a function as an antibody which binds to active GIP and does not substantially bind to inactive GIP.

The DNA consisting of the nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 1 or 3 is, for example, hybridized with the nucleotide sequence represented by SEQ ID NO: 1 or 3 under stringent conditions. DNA to be used. The hybridization conditions in this case are, for example, 6×SSC (0.9M NaCl, 0.09M trisodium citrate) or 6×SSPE (3M NaCl, 0,2M NaH ₂ PO ₄ , 20 mM EDTA·2Na, pH 7. 4) Hybridization at 42° C. in medium, and then washing with 0.5×SSC at 42° C.

In the present invention, the identity between amino acid sequences or base sequences means that when two amino acid sequences or base sequences are aligned, the number of full-length amino acids at the positions where the same amino acid residues or bases are present in both sequences. The ratio (%) to the number of residues or the number of bases. Specifically, for example, it is calculated by the Lippman-Pearson method (Lipman-Pearson method; Science, 227, 1435, (1985)), and the genetic information processing software Genetyx-Win (Ver. 5.1.1; software development) is used. Using the homology analysis (Search homology) program, Unit size
It can be calculated by performing an analysis with to compare (ktup) being 2.

The anti-active GIP antibody containing the region consisting of the amino acid sequence represented by SEQ ID NO: 2 as the H chain variable region and the region consisting of the amino acid sequence represented by SEQ ID NO: 4 as the L chain variable region is described in Example 1 below. The monoclonal antibody produced from the hybridoma 9B9H5-B9 strain shown in 1) can be mentioned.

The anti-active GIP antibody of the present invention can be obtained as a monoclonal antibody using known means. Mammal-derived monoclonal antibodies include those produced from hybridomas and those produced by designing antibody genes or antibody fragment genes and using well-known genetic engineering techniques.
As a genetic engineering method, a DNA encoding the H chain variable region (eg, a DNA consisting of the base sequence shown in SEQ ID NO: 1) and a DNA encoding the L chain variable region (eg, the base shown in SEQ ID NO: 3) DNA comprising the sequence) is inserted into the downstream of the promoter of an appropriate vector to prepare a recombinant vector, and the H chain and L chain are produced from the transformant in which the recombinant vector is introduced into a host cell. DNA linked to a peptide or coding for H chain variable region (for example, DNA consisting of the base sequence shown in SEQ ID NO: 1) and DNA coding for L chain variable region (for example, base sequence shown in SEQ ID NO: 3) DNA) consisting of DNA containing a known linker is ligated with the DNA encoding a known linker and inserted into the downstream of the promoter of an appropriate vector to construct a recombinant vector, which is expressed in a host cell, and the like, thereby having an antigen-binding ability. Producing a single chain recombinant antibody protein (scFv). (See MacCfferty, J. et al., Nature, 348, 552-554, 1990, Tim Clackson et al, Nature, 352, 642-628, 1991 etc.). Further, it may be produced by binding and expressing the DNA encoding the variable region and the DNA encoding the constant region. In this case, the constant region may be the same as the antibody from which the variable region is derived or may be from a different antibody.
Introduction of amino acid mutations to prepare functionally equivalent polypeptides as described above can be performed using, for example, the site-directed mutagenesis method.

The anti-active GIP antibody-producing hybridoma can be basically prepared by a known technique as follows.
For example, an active GIP or a peptide having an amino acid sequence at the N-terminal thereof (a peptide consisting of the 1st to 15th amino acid sequences of SEQ ID NO: 5) is used, if necessary, in a suitable carrier protein such as keyhole limpet hemocyanin ( It can be produced by immunizing a non-human mammal by further enhancing the immunogenicity by binding with KLH) or bovine serum albumin. The activated GIP or the above-mentioned peptide used as a sensitizing antigen (immunogen) can be prepared by a genetic engineering method or chemical synthesis.

The mammal to be immunized with the sensitizing antigen is not particularly limited, but is preferably selected in consideration of compatibility with the mammalian myeloma cell that is a parent cell used for cell fusion, and is generally Specifically, rodent animals such as mouse, rat, hamster and the like are used.

Animals are immunized with the sensitizing antigen according to known methods. For example, it is performed by injecting the sensitizing antigen intraperitoneally or subcutaneously into a mammal. Specifically, the sensitizing antigen is diluted and suspended in an appropriate amount with PBS (Phosphate-Buffered Saline), physiological saline, etc., and if desired, an ordinary adjuvant, for example, Freund's complete adjuvant is mixed in an appropriate amount, and after emulsification. , Subcutaneously, intradermally, or intraperitoneally administered to an animal, and after temporary stimulation, the same operation is repeated if necessary. The dose of the antigen is appropriately determined depending on the route of administration and animal species, but the usual dose is preferably about 10 μg to 1 mg per dose. Immunization is performed in this manner, and after confirming that the desired antibody level is increased in the serum, immune cells are taken out from the mammal with the increased antibody level and cell fusion is performed. Preferred immune cells for cell fusion include splenocytes in particular.
As the mammalian myeloma cell as the other parent cell to be fused with the immune cell, various known cell lines such as P3X63, NS-1, MPC-11, SP2/0 and the like are appropriately used.

The fusion of the immune cells and the myeloma cells can be performed according to a known method, for example, the method of Keller et al. (Kohler et al., Nature, vol, 256, p495-497 (1975)). That is, in the presence of a cell fusion promoter such as polyethylene glycol (PEG having an average molecular weight of 1000 to 6000, 30 to 60% concentration) and Sendai virus (HVJ), an auxiliary agent such as dimethyl sulfoxide is added, if desired, and RPMI1640 culture solution. Fusion cells (hybridomas) are formed by mixing immune cells and myeloma cells in a nutrient medium such as MEM medium.

The hybridoma formed by the fusion is cultured in a selective medium such as a medium containing hypoxanthine, thymidine and aminopterin (HAT medium) for 1 to 7 days to separate from the unfused cells. The resulting hybridomas are further selected by the antibody produced by them (the antibody that binds to active GIP but does not substantially bind to inactive GIP).
The selected hybridoma is monocloned according to a known limiting dilution method, and established as a monoclonal antibody-producing hybridoma.
As a method for detecting the activity of the antibody produced by the hybridoma, a known method can be used. Examples thereof include an ELISA method, an agglutination reaction method, and a radioimmunoassay method.

In order to obtain a monoclonal antibody from the obtained hybridoma, the hybridoma is cultured according to a usual method, and a method of obtaining the culture supernatant thereof, or the hybridoma is administered to a mammal compatible therewith and propagated, The method of obtaining ascites is adopted.

The antibody can be purified using a known purification means such as a salting-out method, a gel filtration method, an ion exchange chromatography method or an affinity chromatography method.

By using the anti-active GIP antibody of the present invention in any immunological measurement method, active GIP in a sample can be specifically detected or measured. That is, by contacting a sample with the anti-active GIP antibody of the present invention and detecting the binding to the antibody to immunologically measure the level of active GIP, the active GIP in a biological sample or in vivo can be detected. It can be detected or measured.
This makes it possible to measure active GIP in a biological sample, detect abnormalities in the active GIP value, and further evaluate the efficacy of therapeutic agents using the active GIP as an index.

Here, the immunological measurement method is not particularly limited, but as the qualitative analysis, an immunohistological staining method, a fluorescent antibody method, an adsorption method, and a neutralization method can be mentioned.As the quantitative analysis, The ELISA method, the radioimmunoassay method, the Western blotting method, etc. can be mentioned. Among them, the ELISA method is preferably used from the viewpoint of simplicity. The ELISA method and the radioimmunoassay method include a competitive method, a sandwich method, and a direct adsorption method.

In the competitive method, an anti-active GIP antibody is bound to an assay plate, and a fixed concentration of active GIP labeled with an enzyme such as calf small intestine-derived alkaline phosphatase (CIAP) or horseradish peroxidase or a radioisotope is used. , To add a sample. The active GIP labeled with the active GIP in the sample competes for binding to the anti-active GIP antibody, and the labeled active GIP binds to the anti-active GIP antibody according to the concentration of the active GIP in the sample. Therefore, the concentration of the active GIP in the sample can be estimated from the amount of the labeled active GIP bound to the antibody.

The sandwich method uses an anti-GIP antibody and a labeled anti-active GIP antibody. The anti-GIP antibody is preferably an antibody having an epitope different from that of the anti-active GIP antibody, and such an antibody is an anti-total GIP antibody. Are listed. Further, a method using an immobilized anti-GIP antibody and a labeled anti-active GIP antibody is preferable.
The immobilized anti-GIP antibody is preferably one in which the antibody is immobilized on an insoluble support such as a polystyrene plate, latex particles, magnetic particles, glass fiber membrane, nylon membrane, nitrocellulose membrane, or cellulose acetate membrane.
Examples of the label of the labeled anti-active GIP antibody include radioisotopes (eg, ³² P, ³⁵ S, ³ H), enzymes (eg, peroxidase, alkaline phosphatase, luciferase), proteins (eg, avidin), Low molecular weight compounds (eg biotin), fluorescent substances (eg FITC), chemiluminescent substances (eg acridinium), latex particles (eg colored latex particles, fluorescent latex particles), metals (eg gold, silver, platinum etc.) Noble metal) colloidal particles, carbon atoms and the like can be used.

The direct adsorption method (direct method) is a method in which an antigen is adsorbed on a solid phase and reacted with a labeled anti-active GIP antibody.

The active GIP in the sample (biological sample) is detected by reacting the active GIP in the sample with the immobilized anti-GIP antibody. For example, in the case of the sandwich method, the sample-containing solution and the immobilized anti-GIP antibody are immobilized. It can be carried out by reacting the GIP antibody and then the labeled antibody, or by reacting the immobilized anti-GIP antibody and the labeled antibody simultaneously. After completion of the reaction, the amount of active GIP in the sample can be measured by measuring the amount of label in the complex formed by the active GIP, the immobilized anti-GIP antibody and the labeled antibody in the sample. The amount of label can be measured by a means suitable for the type of label. For example, when an enzyme is used as a label, a substrate is added after the reaction and the enzyme activity is measured. When fluorescence (including fluorescent latex particles) or chemiluminescent substance is used as the label, the signal is measured under the condition that quenching does not occur. For colored latex particles, metal colloid particles, carbon particles and the like, signals are measured visually or by reflected light.

A detection or measurement reagent (kit) containing the anti-active GIP antibody of the present invention is used in a method of measuring or detecting active GIP in a sample using the anti-active GIP antibody of the present invention, It is a reagent for qualitatively, quantitatively or semi-quantitatively detecting or measuring a biological sample (eg, tissue, blood, plasma, serum, lymph, etc.) collected from a subject or in vivo active GIP.
The detection or measurement reagent containing the anti-active GIP antibody may be, for example, a labeled anti-active GIP antibody of the present invention, a diluent for a sample, an immobilized anti-GIP antibody, a reaction substrate, and a coloring reagent if necessary. , A reaction stopping reagent, a standard antigen reagent, a sample pretreatment reagent, a blocking reagent and the like. Moreover, the anti-active GIP antibody may be contained or fixed in a resin, a film, a film, a container, or the like, or may be dissolved in a solvent.

Regarding the above-described embodiment, the following aspects are disclosed in the present invention.
<1> An anti-active GIP antibody that binds to active GIP and does not substantially bind to inactive GIP, and is one or more selected from the 8th to 10th amino acids of the amino acid sequence of SEQ ID NO: 5. An antibody which recognizes at least and which contains in the H chain a region consisting of the amino acid sequence represented by the following (1) or a conservative sequence modification thereof.
EMNPSDGRTHFNE (1)
<2> The antibody of <1>, which comprises a region consisting of the amino acid sequence shown by SEQ ID NO: 2 or a conservative sequence modification thereof as the H chain variable region.
<3> The antibody according to <2>, wherein the conservative sequence-modified amino acid sequence has 90% or more identity with the amino acid sequence represented by SEQ ID NO: 2.
<4> The H chain variable region comprises the amino acid sequence represented by SEQ ID NO: 2 or a region comprising conservative sequence modifications thereof, and the L chain variable region comprises the amino acid sequence represented by SEQ ID NO: 4 or conservative sequence alterations thereof. <1> or <2> antibody containing a region.
<5> A conservative sequence-modified amino acid sequence with respect to the amino acid sequence represented by SEQ ID NO: 2 has 90% or more identity with the amino acid sequence represented by SEQ ID NO: 2, and the amino acid represented by SEQ ID NO: 4 The antibody of <4>, wherein the conservative sequence-modified amino acid sequence with respect to the sequence has 90% or more identity with the amino acid sequence represented by SEQ ID NO: 4.
<6> A method for detecting or measuring active GIP using the antibody according to any one of <1> to <5>.
<7> A method for detecting or measuring active GIP in a sample, which comprises the following steps 1) and 2).
1) A step of bringing the immobilized anti-GIP antibody and any of the labeled antibodies <1> to <5> into contact with a sample-containing solution together or separately 2) Activated GIP in a sample and the immobilized anti-GIP antibody Step of measuring the amount of labeling in the complex formed by the GIP antibody and the labeled antibody <8> A reagent for detecting or measuring active GIP containing the antibody according to any one of <1> to <5>.

<9> Polypeptide below and gene encoding the same (a) A polypeptide comprising the amino acid sequence shown by SEQ ID NO: 2, or 90% or more, more preferably 95% or more, and further preferably 98% with the amino acid sequence. A polypeptide having an amino acid sequence having the above-mentioned identity, which has a function as an antibody that binds to active GIP and does not substantially bind to inactive GIP.
(B) a DNA comprising the nucleotide sequence represented by SEQ ID NO: 1, or a DNA comprising the nucleotide sequence having 90% or more, more preferably 95% or more, and even more preferably 98% or more identity to the nucleotide sequence. A DNA encoding a polypeptide having a function as an antibody which binds to active GIP and does not substantially bind to inactive GIP.
<10> Polypeptide below and gene encoding the same (c) A polypeptide comprising the amino acid sequence shown by SEQ ID NO: 4, or 90% or more, more preferably 95% or more, and further preferably 98% with the amino acid sequence. A polypeptide having an amino acid sequence having the above-mentioned identity, which has a function as an antibody that binds to active GIP and does not substantially bind to inactive GIP.
(D) a DNA comprising the nucleotide sequence represented by SEQ ID NO: 3, or a DNA comprising the nucleotide sequence having 90% or more, more preferably 95% or more, and even more preferably 98% or more identity to the nucleotide sequence. A DNA encoding a polypeptide having a function as an antibody which binds to active GIP and does not substantially bind to inactive GIP.

Example 1 Preparation of antibody 1) Synthesis of peptide for immunization After PEGylation of N-terminal 15 amino acids (GIP(1-15)) of activated GIP, KLH was chemically bound to KLH-conjugated PEGylated GIP(1). -15) was prepared and used as an immunogen. The N-terminal 15 amino acids of activated GIP (GIP(1-15)) were PEGylated, and the antigen for measurement (1), and the N-terminal 13 amino acids of inactive GIP (GIP(3-15)) were PEGylated. This was used as the measurement antigen (2).

2) Immunization Three BALB/c mice were subcutaneously immunized on the back. In the first immunization, an emulsion prepared by mixing the antigen prepared above and complete Freund's adjuvant was administered. A booster immunization was carried out every 2 weeks from the initial immunization using an emulsion in which the antigen and incomplete Freund's adjuvant were mixed. The amount of antigen to be immunized at one time was in the range of 0.1 to 0.2 mg. Seven weeks after the first immunization, the antibody titer was measured using the serum collected from the mouse, and the increase in the antibody titer was confirmed.

3) Cell fusion The spleen was excised from the mouse with increased antibody titer to obtain splenocytes. The resulting spleen cells were fused with the mouse myeloma cell line P3U1 by the PEG method. After that, seeding was performed on 20 96-well plates (1×10 ⁵ cells/well).

4) Screening Antigens (1) and (2) for measurement were diluted with PBS (-) to 1 μg/mL and immobilized on a plate, and HRP-labeled anti-mouse Ig antibody was used as a secondary antibody. The reaction between the hybridoma culture supernatant and the antigens (1) and (2) was evaluated by the ELISA method, and the hybridomas positive for the antigen (1) and negative for the antigen (2) were produced as anti-active GIP monoclonal antibody. Selected as hybridoma.

5) Cloning By culturing the hybridoma obtained above by a limiting dilution method so that a single colony can be obtained, the antibody-producing hybridoma is cloned, and the single colony forming well is again measured by ELISA to determine the antigen (1). The 9B9H5-B9 strain producing an antibody that is positive for and the antigen (2) is established.
The obtained antibody-producing hybridomas are preserved by culturing the hybridomas and recovering them in the logarithmic growth phase, and then preparing them in a cell freezing solution containing FBS so that the cell concentration becomes 1×10 ⁶ cells/mL, and then 1 It was dispensed into a freezing tube so as to have ×10 ⁶ cells/tube, and stored at −80° C. in a bicell.

6) Antibody production A frozen vial of the obtained antibody-producing hybridoma was put to sleep and acclimated to Hybridoma-SFM without serum. After the expansion culture, the culture was performed in two roller bottles (500 mL×2 bottles, 1 L), and the culture supernatant was collected. The recovered culture supernatant was used to purify Protein A to purify the monoclonal antibody.

Example 2 Reactivity with activated GIP by ELISA The reactivity between the monoclonal antibody obtained in Example 1 and activated GIP was confirmed by ELISA. The amino group of the anti-active GIP monoclonal antibody was biotinylated with an NH ₂ group biotinylation kit (manufactured by Dojindo). Human (total) GIP
As an alternative to the detection antibody'GIP detection antibody' (biotinylated anti-total GIP monoclonal antibody) attached to the ELISA kit (manufactured by Millipore), 1 μg/mL of biotinylated anti-active GIP monoclonal antibody prepared was used for ELISA. It was A 4-fold dilution series was prepared up to 6 steps (8.2 to 2000 pg/mL) with 2000 pg/mL solution of GIP(1-42) or GIP(3-42) as the highest concentration, and anti-total as a capture antibody. GIP monoclonal antibody (supplied with Human GIP (total) ELISA kit manufactured by Millipore), biotinylated anti-active GIP monoclonal antibody as a detection antibody, and a sandwich ELISA system using a peroxidase-streptavidin-bound product for detection, and the GIP concentration was X. A calibration curve having an axis and an absorbance of 450 nm to 590 nm as the Y axis was prepared (FIG. 1).
As shown in FIG. 1, the absorbance of GIP(3-42) did not increase even in a high concentration range, and the absorbance increased only in GIP(1-42) in a concentration-dependent manner. It was confirmed that -42) has no cross-reactivity and that GIP(1-42) can be specifically detected.

Example 3 Measurement of human active GIP In order to evaluate whether the GIP(1-42) ELISA method constructed in Example 2 can be actually used for human blood GIP(1-42) measurement, The study was performed using a human plasma sample.
The blood GIP(1-42) value at each time after ingesting a control diet (standard diet) or a test diet (GIP-reduced diet) in healthy subjects was measured in FIG. 2A as a comparison in blood. Total GIP values are shown in Figure 2B. The blood GIP(1-42) value peaked at 30 minutes after meal (FIG. 2A), but was earlier than that of Total GIP (FIG. 2B), which remained high up to 120 minutes after meal. It was suggested that the blood concentration was decreased. In comparison of the control diet and the test diet, the test diet showed a significant reduction in blood GIP(1-42) value with respect to the control diet at the 30-minute value and the 60-minute value after the meal (FIG. 2A ), Total GIP. A tendency similar to the value (FIG. 2B) was observed. In addition, the ratio of GIP(1-42) to total GIP after meal was determined (FIG. 2C). The average value of each time at 30, 60, 120, and 180 minutes after meal was 43%, 28%, 27%, and 19%, and the ratio of active GIP was high early after meal and decreased with time thereafter. It was suggested.

Example 4 Epitope Analysis of Activated GIP Monoclonal Antibody In order to identify the epitope of the monoclonal antibody prepared in Example 1, the following synthetic peptide was prepared.
_{(1) GIP (1-10):} NH 2 -YAEGTFISDY-COOH
_{(2) GIP (1-9):} NH 2 -YAEGTFISD-COOH
_{(3) GIP (1-8):} NH 2 -YAEGTFIS-COOH
_{(4) GIP (1-7):} NH 2 -YAEGTFI-COOH
_{(5) GIP (1-6):} NH 2 -YAEGTF-COOH
(6) GIP (1-6) + GIP nonspecific 4aa (Random _4aa): NH 2 -YAEGTFVNLV-COOH

The synthesized 6 kinds of peptides were diluted with PBS(-) to 1 μg/mL and immobilized on a 96-well plate, and a biotinylated anti-active GIP monoclonal antibody was used for detection, and a peroxidase-streptavidin conjugate was used. ELISA was performed. Results are shown in FIG.
From FIG. 3, it was found that an active GIP peptide having a length of GIP(1-8) or more, that is, having a length of 8 amino acids or more from the N-terminus is necessary as a recognition site for the anti-active GIP monoclonal antibody.

Example 5 Analysis of amino acid sequences of H chain and L chain variable regions (1) Sequencing According to a conventional method, total RNA was extracted from 9B9H5-B9 hybridoma, and cDNA was prepared using this as a template. PCR was performed using the primers shown in Table 1 under the conditions shown in Table 2 to amplify a PCR product containing the variable regions of the H chain and L chain.
That is, using the obtained cDNA (synthesized by an H chain-specific primer) as a template, a mouse antibody (IgG) H chain-specific primer was used as a reverse primer, and a universal primer shown in Table 1 was used as a forward primer to perform a RACE PCR reaction. I did. Similarly, using the cDNA (synthesized by the L chain-specific primer) as a template, the RACE PCR reaction was performed using the L chain-specific primer. PrimeSTAR GXL was used as the PCR enzyme. The obtained PCR products were ligated to Cloning Plasmid pMD20-T, and 48 clones were obtained for each PCR product by transformation according to a conventional method.

The obtained Clone was analyzed from one side of the Plasmid region using the primer M13-47 (cgccagggttttcccagtcacgac; SEQ ID NO: 10). The sequencing was performed using a Big Dye Terminators v3.1 cycle sequencing kit (ABI) according to the attached protocol, and the sequence was determined. Among the determined sequences, the amino acid sequence deduced from the nucleotide sequence derived from the experimental sample was subjected to homology search by BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi) to determine H The nucleotide sequences presumed to encode the variable regions of the chain and the L chain (from the start codon) and the amino acid sequence were determined (SEQ ID NOS: 1 to 4). Here, SEQ ID NOs: 1 and 2: the nucleotide sequence and amino acid sequence encoding the H chain variable region of the monoclonal antibody, and SEQ ID NOs: 3 and 4: the nucleotide sequence and amino acid sequence encoding the L chain variable region of the monoclonal antibody are shown.

In addition, the amino acid sequence of the H chain variable region was searched for homology by BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi), and as a result, the 50th to 62nd positions from the N terminus No polypeptide having an amino acid sequence having 90% or more identity with the amino acid residue "EMNPSDGRTHFE" was found.

Claims (4)

An anti-active GIP antibody that binds to active GIP and does not substantially bind to inactive GIP, wherein at least one or more amino acids selected from the 8th to 10th amino acids of the amino acid sequence represented by SEQ ID NO: 5 is used. recognize, as the H chain variable region comprises an amino acid sequence represented by SEQ ID NO: 2, as L chain variable region, antibody comprising an amino acid sequence represented by SEQ ID NO: 4. A method for detecting or measuring active GIP using the antibody according to claim 1. A method for detecting or measuring active GIP in a sample, which comprises the following steps 1) and 2).
1) Contacting the immobilized anti-GIP antibody and the labeled antibody according to claim 1 together or separately with the sample-containing solution 2) Active GIP in the sample, the immobilized anti-GIP antibody and the labeled antibody Measuring the amount of label in the complex formed by A reagent for detecting or measuring active GIP, which comprises the antibody according to claim 1.

Images