JP6632116B2 - Agent for suppressing osteoclast formation and / or function, agent for promoting osteoclast formation and / or function, and method for screening for agent for suppressing or promoting osteoclast formation and / or function - Google Patents

Description

  The present invention relates to a method for screening an osteoclast formation inhibitor and / or an osteoclast function inhibitor, an osteoclast formation promoter and / or an osteoclast function promoter, and a drug based on a novel control mechanism of bone remodeling. I will provide a.

Osteoclasts, osteoblasts, and osteocytes, the cells that make up bone, control bone remodeling by intercellular communication. An imbalance in bone remodeling causes abnormal bone metabolism such as rheumatoid arthritis and osteoporosis, bone sclerosis, and osteopetrosis. Therefore, elucidation of the control mechanism of bone remodeling is an important key in understanding various bone diseases. To date, RANKL (receptor activation of nuclear factor-κB (RANK) ligand) expressed in osteoblasts and osteocytes binds to the receptor RANK on osteoclast precursor cells to promote osteoclast differentiation. It has been reported that osteoprotegerin produced from osteoblasts negatively regulates osteoclast differentiation as a soluble decoy receptor for RANKL (see Non-Patent Document 1). . Further, semaphorin 4D produced by osteoclasts binds to plexin B1, a receptor expressed in osteoblasts, and inhibits differentiation by inhibiting IGF-1 signal required for osteoblast differentiation. Has been reported (see Non-Patent Document 3). However, the full control mechanism of bone remodeling has not yet been elucidated.
Substrate vesicles are extracellular vesicles secreted budding from osteoblasts and chondrocytes. Matrix vesicles are mainly secreted into hard tissue and cartilage matrix, and promote the onset of calcification. Therefore, vesicles are rich in regulatory molecules for crystal growth of hydroxyapatite, such as ALP (alkaline phosphatase) and annexin. Furthermore, IGF-1 and TGF-beta ₁ is secreted been incorporated into matrix vesicles, but are accumulated in bone matrix in the inactive form, it is activated is released during bone resorption by osteoclasts. IGF-1 that is activated to promote the migration of mesenchymal stem cells and osteoblasts progenitor cells, the precursors recruited under control of TGF-beta ₁ to differentiate into osteoblasts (Non-patent Document 4 5). Thus, matrix vesicles play an important role not only in calcification but also in osteoblast formation.
MicroRNAs are small, untranslated RNAs of 20-25 nucleotides that bind to the target mRNA and inhibit its translation into protein. MicroRNAs are expressed in various cells and are known to be involved in various diseases and conditions. In bone, for example, it has been reported that forced expression of miR-34a suppresses osteoclast formation (see Non-Patent Document 6). In addition, it has been reported that forcibly expressing miR-125b in the stromal cell line ST2 suppresses cell growth, and as a result, suppresses BMP-4 (bone morphogenetic protein 4) -dependent osteoblast differentiation. (See Non-Patent Document 7). On the other hand, there is a report that miR-125b has no effect on osteoblast differentiation (see Non-Patent Document 8). It has been reported that microRNAs not only function in expressed cells but also are secreted extracellularly by extracellular vesicles such as exosomes, are taken up by other cells, and act on target genes (eg: Non-Patent Document 9). Substrate vesicles, a type of extracellular vesicles, are produced by osteoblast-like cells during transdifferentiation of vascular smooth muscle cells to osteoblast-like cells, which is considered to be an important process in vascular calcification pathology. It has been speculated that microRNAs may be contained in the substrate vesicles that generate (see Non-Patent Document 10).

Nature Medicine, 2011, Vol. 17, No. 10, 1231-1234. Cell, 1998, Vol. 93, No. 2, pp. 165-176. Nature Medicine, 2011, Vol. 17, No. 11, pp. 1473-1480. Nature Medicine, 2009, Vol. 15, No. 7, pp. 757-765. Nature Medicine, 2012, 18, 7, 7, 955-1101. Nature, 2014, 512, 431-435 Biochemical and Biophysical Research Communications, 2008, 368, 267-272. Brazilian Journal of Medical and Biological Research, 2013, Vol. 46, No. 8, pp. 676-680. Brazilian Journal of Medical and Biological Research. Nature Cell Biology, 2007, Vol. 9, No. 6, pp. 654-659. Cells, 2014, 3: 963-980.

  An object of the present invention is to provide an osteoclast formation inhibitor and / or an osteoclast function inhibitor, and an osteoclast formation promoter and / or an osteoclast function promoter. Another object of the present invention is to provide a method for screening a drug that controls bone remodeling.

  We believe that miR-125b is present in high concentrations in matrix vesicles and is transported from osteoblasts to bone matrix by matrix vesicles or directly into osteoclast precursor cells or osteoclasts. It was found to be transported to cells and suppress the formation and function of osteoclasts. Until now, it has not been known that matrix vesicles secreted from osteoblasts are taken up by osteoclast precursor cells or osteoclasts and suppress differentiation and function. In addition, there is no report on osteoclasts of miR-125b, much less miR-125b is present in a high concentration in matrix vesicles, and is taken into osteoclast precursor cells or osteoclasts via matrix vesicles to act. It is not known at all.

The present invention has been made based on the above findings, and provides the following.
[1] An osteoclast formation inhibitor and / or an osteoclast function inhibitor containing osteoblast-derived matrix vesicles.
[2] An osteoclast formation inhibitor and / or an osteoclast function inhibitor comprising miR-125b, a precursor thereof, or a mutant thereof.
[3] Osteoblasts transfected with miR-125b, or a precursor thereof, or a mutant thereof, and containing miR-125b, a precursor thereof, or a mutant thereof in a larger amount than before transfection. An osteoclast formation inhibitor and / or an osteoclast function inhibitor containing a cell-derived matrix vesicle.
[4] An osteoclast formation promoter and / or an osteoclast function promoter comprising a miR-125b antisense inhibitor.
[5] The agent for suppressing osteoclast formation and / or the agent for suppressing osteoclast function, or the agent for promoting osteoclast formation and / or promoting osteoclast function according to any one of [1] to [4]. A pharmaceutical composition for preventing and / or treating a bone disease, comprising an agent.
[6] preventing and / or preventing a disorder characterized by a decrease in bone mass, comprising the osteoclast formation inhibitor and / or the osteoclast function inhibitor according to any one of [1] to [3]. Or a pharmaceutical composition for treating.
[7] A pharmaceutical composition for preventing and / or treating a disease caused by a decrease in osteoclast function, comprising the osteoclast formation promoter and / or the osteoclast function promoter according to [4]. .
[8] culturing osteoblasts, osteoclast precursor cells or osteoclasts in the presence and absence of a test substance, and measuring the miR-125b amount of the cells under both conditions The formation or formation of osteoclasts, wherein the increase or decrease in the amount of miR-125b is used as an indicator of the effect of the test substance on suppressing or promoting osteoclast formation and / or the effect of suppressing or promoting osteoclast function. And / or a method for screening a substance that suppresses or promotes a function.
[9] culturing osteoblasts in the presence and absence of a test substance, and measuring the amount of miR-125b incorporated into matrix vesicles under both conditions, wherein the miR-125b The formation and / or function of osteoclasts, wherein the increase or decrease in the amount of uptake is used as an indicator of the action of the test substance to suppress or promote osteoclast formation and / or the action to suppress or promote osteoclast function, A method for screening a substance to be suppressed or promoted.
[10] culturing osteoclast precursor cells or osteoclasts in the presence and absence of a test substance, treating the osteoclast precursor cells or osteoclasts with matrix vesicles, and both conditions Measuring the incorporation of matrix vesicles into the osteoclast precursor cells or osteoclasts underneath to increase or decrease the uptake of matrix vesicles into the osteoclast precursor cells or osteoclasts. A substance that suppresses or promotes the formation and / or function of osteoclasts, which is used as an indicator of the effect of the test substance on suppressing or promoting osteoclast formation and / or the effect of suppressing or promoting osteoclast function. Screening method.
[11] Osteoclasts containing the matrix vesicles, comprising transfecting osteoblasts with miR-125b, or a precursor thereof, or a mutant thereof, and isolating matrix vesicles from the osteoblasts A method for producing a cell formation inhibitor and / or an osteoclast function inhibitor.
[12] an osteoclast formation inhibitor and / or osteoclast function containing the artificial matrix vesicle, which comprises inserting miR-125b, a precursor thereof, or a mutant thereof into the artificial matrix vesicle Method for producing inhibitors.
[13] (i) an osteoblast-derived matrix vesicle, or (ii) miR-125b, or a precursor thereof, for the production of an osteoclast formation inhibitor and / or an osteoclast function inhibitor. Use of those mutants.
[14] Use of a miR-125b antisense inhibitor for the production of an osteoclast formation inhibitor and / or an osteoclast function promoter.

  According to the present invention, a novel agent for inhibiting osteoclast formation and / or function and an agent for promoting osteoclast formation and / or function are provided. Further, according to the present invention, bone remodeling using the amount of miR-125b, the amount of miR-125b incorporated into matrix vesicles, or the amount of matrix vesicle incorporated into osteoclast precursor cells or osteoclasts as an index is performed. Methods for screening for agents to control are provided.

3 shows the effect of matrix vesicles on osteoclast formation of mouse bone marrow-derived macrophages (BMMs). In the figure, the vertical axis indicates the number of cells in each well determined to be osteoclasts, and MVs indicates matrix vesicles. Substrate vesicle concentration is 0.8 μg / ml protein. The RANKL / M-CSF treatment group (-) was significant at the 1% level relative to the control (-). In the RANKL / M-CSF treatment group, MVs + was significant at the 5% level relative to MVs-. The significance test was performed by analysis of variance and Turkey's multiple comparison test (the same applies hereinafter). Fig. 3 shows the effect of matrix vesicles on osteoclastic formation of RAW-D cells. In the figure, the vertical axis indicates the number of cells in each well determined to be osteoclasts, and MVs indicates matrix vesicles. The numerical value on the horizontal axis indicates the concentration of the substrate vesicle, and the unit is μg / ml protein. The RANKL-treated group (-) was significant at the 1% level relative to the control (-). In the RANKL-treated group, MVs0.4 was significantly different from MVs- at the 5% level, and MVs0.8 and MVs1.6 were significantly different at the 1% level. 4 shows the effect of matrix vesicles on bone resorption. In the figure, the vertical axis indicates the area of the bone resorption pit (pit), and MVs indicates the matrix vesicle. Substrate vesicle concentration is 0.8 μg / ml protein. The RANKL / M-CSF treatment group (-) was significant at the 1% level relative to the control (-). In the RANKL / M-CSF treatment group, MVs + was significant at the 5% level relative to MVs-. Figure 4 shows the uptake of matrix vesicles in osteoclast precursor cells and osteoclasts. FIG. 4A is image data obtained by time-lapse imaging. The upper panel shows the results for osteoclast precursor cells. RAW-D cells were inoculated, the next day, labeled substrate vesicles were added at a concentration of 0.8 μg / ml, and the uptake of the substrate vesicles was evaluated by time-lapse imaging. The lower figure shows the results for osteoclasts. 3 to 4 days after RAW-D was seeded and RANKL was added, and after osteoclasts (multinucleated) were recognized, matrix vesicles labeled in the same manner as above were added, and the uptake of matrix vesicles was evaluated by time-lapse imaging. . FIG. 4B shows the results obtained by repeating the above test twice. The number of labeled cells relative to the total cells after 24 hours in the test using RAW-D cells, represented by RANKL (−) on the horizontal axis. In a test using RAW-D cells differentiated into osteoclasts by the addition of RANKL, and expressed as RANKL (+), the ratio of labeled multinucleated cells to the total number of multinucleated cells after 24 hours was calculated. Show. The relative amounts of each miRNA in MC3T3-E1 cells in cells and substrate vesicles are shown. In the figure, the vertical axis indicates the relative amount of each miRNA, 21 on the horizontal axis indicates miR-21, 125b indicates miR-125b, and 199a indicates miR-199a. Cells represent whole cells, and MVs represent substrate vesicles. For 125b and Let7-c, MVs was significantly different from Cells at the 5% level. FIG. 9 shows the results of RANKL-induced osteoclast formation in RAW-D cells transfected with miR-125b. In the figure, the vertical axis indicates the number of cells in each well determined to be osteoclasts, and 125b indicates cells transfected with miR-125b. The RANKL-treated group (-) was significant at the 0.1% level relative to the control (-). In the RANKL-treated group, 125b + was significant at the 1% level relative to 125b-. FIG. 4 shows the effect of miR-125b inhibitor on RANKL-induced osteoclastogenesis in RAW-D cells of matrix vesicles collected from MC3T3-E1 cells infected with recombinant lentivirus. In the figure, the vertical axis indicates the number of cells in each well determined to be osteoclasts. In addition, NC on the horizontal axis indicates a control, inhibitor indicates a substrate vesicle obtained from a cell in which miR-125b function was suppressed, and MVs indicates a substrate vesicle. RANKL-treated NCs were significant at the 1% level relative to NCs. In the RANKL-treated group, the inhibitor was significantly different from NC at the 5% level. 3 shows the inhibitory effect of miR-125b on osteoclast formation in a mouse LPS-induced osteolysis model. In the figure, the vertical axis indicates TRAP-positive cells. 125b on the horizontal axis indicates miR-125b. LPS was significant at the 1% level relative to the control (-). In the LPS treated group, 125b + was significant at the 5% level relative to 125b-.

Hereinafter, the present invention will be described in detail.
1. Osteoclast formation inhibitor and / or osteoclast function inhibitor containing osteoblast-derived matrix vesicles The first aspect of the present invention provides osteoclast formation and osteoblast-derived matrix vesicle-derived And / or function inhibitors.
In this specification, the osteoclast formation inhibitor and / or the osteoclast function inhibitor will also be described as an osteoclast formation and / or function inhibitor.
An osteoblast “derived” matrix vesicle means a matrix vesicle secreted or produced by osteoblasts. Substrate vesicles are extracellular vesicles secreted budding from osteoblasts and are characterized as starting points for bone matrix calcification. Osteoblasts are preferably mammalian, and more preferably human or mouse. Osteoblasts described below for the screening method can also be used.
When a substrate vesicle is used in an agent for inhibiting osteoclast formation and / or function, a substrate vesicle containing miR-125b is particularly preferred.
The naturally occurring matrix vesicles can be obtained by, for example, extracting from a culture of osteoblasts.

2. Osteoclast formation and / or function inhibitor comprising miR-125b, or a precursor thereof, or a mutant thereof. The second aspect of the present invention relates to miR-125b, a precursor thereof, or a mutant thereof. And an inhibitor of osteoclast formation and / or function.
MicroRNAs (also referred to as miRNAs) are generated from genes present on the genome that are transcribed into miRNA precursors. First, the primary transcript pri-miRNA is transcribed from the gene, and then the pri-miRNA is processed in the nucleus by RNase III called Drosha to produce a pre-miRNA having a hairpin structure of about 70 bases. . Thereafter, the pre-miRNA is transported to the cytoplasm and processed by RNase III called Dicer to produce a mature miRNA of about 20 to 25 bases.

  In the present specification, the “precursor” of the miRNA means both the pri-miRNA and the pre-miRNA. Thus, "precursor of miR-125b" refers to both pri-miR-125b and pre-miR-125b, and is also described as mir-125b. When administered to a living body, the precursor of miR-125b is processed in vivo as described above to produce miR-125b, and exerts the same function as miR-125b.

  Examples of the sequences of miR-125b and precursors of miR-125b are shown below, but are not limited thereto. In addition, pre-miR-125b may be a sequence containing miR-125b, and pri-miR-125b may be a sequence containing pre-miR-125b.

Human and mouse miR-125b-5p: ucccugagacccuaacuuguga (SEQ ID NO: 1)
Human miR-125b-1-3p: acggguuaggcucuugggagcu (SEQ ID NO: 2)
Human miR-125b-2-3p: ucacaagucaggcucuugggac (SEQ ID NO: 3)
Mouse miR-125b-1-3p: acggguuaggcucuugggagcu (SEQ ID NO: 4)
Mouse miR-125b-2-3p: acaagucagguucuugggaccu (SEQ ID NO: 5)
Mouse mir-125b-1; ugcgcuccccucagucccugagacccuaacuugugauguuuaccguuuaaauccacggguuaggcucuugggagcug (SEQ ID NO: 6)
Mouse mir-125b-2; gccuagucccugagacccuaacuugugagguauuuuaguaacaucacaagucagguucuugggaccuaggc (SEQ ID NO: 7)
Human mir-125b-1; ugcgcuccucucagagucccugagacccuaacuugugauguuuaccguuuaaauccacggguuaggcucuugggagcugcgagucgugcu (SEQ ID NO: 8)
Human mir-125b-2; accagacuuuuccuagucccugagacccuaacuugugagguauuuuaguaacaucacaagucaggcucuugggaccuaggcggagggga (SEQ ID NO: 9)

In the present specification, the “mutant” of miR-125b or a precursor thereof includes 80% or more, preferably 85% or more, more preferably 90% or more, and still more preferably the sequence of miR-125b or a precursor thereof. Include RNA molecules having 95% or more sequence identity and retaining the function of miR-125b. Also included are those analogs synthesized to mimic miR-125b or a precursor thereof. For example, the miR-125b analog can be obtained from Ambion.
"Sequence identity" is determined by comparing two optimally aligned sequences over the entire region of the sequence to be compared. Here, the sequence to be compared may have an addition or deletion (for example, a gap or the like) in the optimal alignment of the two sequences. Sequence identity can be calculated using a program such as FASTA, BLAST, CLUSTAL W, etc. provided in a public database (for example, DDBJ (http://www.ddbj.nig.ac.jp)). Alternatively, it can be determined using commercially available sequence analysis software (for example, Vector NTI (registered trademark) software, GENETYX (registered trademark) ver. 12). In addition, the “mutant” of miR-125b or a precursor thereof includes one to several, preferably one to three in the miR-125b, pri-miR-125b, or pre-miR-125b sequence. An RNA molecule having a sequence in which a base is deleted, substituted, inserted or added and which retains the function of miR-125b is included.

In the present specification, “miR-125b or a precursor thereof, or a mutant thereof” is also described as “miRNA of the present invention”.
The miRNA of the present invention can be synthesized using a known method. The nucleic acid constituting the miRNA of the present invention may be a natural nucleic acid or a non-natural nucleic acid such as a nucleic acid derivative with improved stability. Examples of the nucleic acid derivative include methylphosphonate, phosphorothioate, phosphorodithioate, phosphoramidate, phosphotriester, sulfone, siloxane, carbonate, carboxymethylester, acetamidodate, carbamate, thioether, cross-linked phosphoramidate, and cross-linked Nucleic acids containing internucleoside linkages of methylene phosphonate, bridged phosphorothioate, dimethylene-sulfide, dimethylene-sulfoxide, dimethylene-sulfone, 2′-O-alkyl, or 2′-deoxy-2′-fluorophosphorothioate, LNA (Locked Nucleic Acid) ), ENA (2′-O, 4′-C-Ethylene-bridged Nucleic Acid) and the like. In addition, the nucleic acid derivative includes a nucleic acid containing a 2 ′ or 3 ′ sugar modification, for example, a 2′-O-methyl (2′-O-Me) -modified nucleotide or 2′-deoxynucleotide, or 2′-fluoro, difluorotoluyl , 5-Me-2'-pyrimidine, 5-allylamino-pyrimidine, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl (2'-O-AP), 2 ' —ON-methylacetamide (2′-O-NMA), 2′-O-dimethylaminoethyloxyethyl (2′-DMAEOE), 2′-O-dimethylaminoethyl (2′-O-DMAOE), '-O-dimethylaminopropyl (2'-O-AP), 2'-hydroxy nucleotide, phosphorothioate, 4'-thio nucleotide, 2'-O-trifluoromethyl nucleotide, 2'-O-ethyl-tri Le Oro methoxy nucleotides, 2'-O-difluoromethoxy - include nucleic acids, including fluoro nucleotides - ethoxy nucleotide or 2'-Ara.

  The miRNA of the present invention may form a salt with an inorganic base, an organic base, an inorganic acid, an organic acid, or the like, and the salt form is one of the preferable embodiments of the miRNA of the present invention. As the salt, a pharmacologically acceptable salt is preferable. Examples of the salt with the inorganic base include, for example, alkali metal salts such as sodium salt and potassium salt; alkaline earth metal salts such as calcium salt and magnesium salt; and aluminum salt and ammonium salt. Examples of the salt with the organic base include, for example, salts with trimethylamine, triethylamine, pyridine, picoline, ethanolamine, diethanolamine, triethanolamine, dicyclohexylamine, N, N'-dibenzylethylenediamine. Examples of salts with the above-mentioned inorganic acids include salts with hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, and phosphoric acid. Examples of salts with the above organic acids include, for example, formic acid, acetic acid, trifluoroacetic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, p- And salts with toluenesulfonic acid.

  Further, the expression vector that expresses the miRNA of the present invention (hereinafter, also referred to as “expression vector of the present invention”) is also one of the preferable embodiments of the miRNA of the present invention. The expression vector of the present invention may be a viral vector or a non-viral vector. Examples of the virus vector include vectors derived from adenovirus, adeno-associated virus (AAV), retrovirus, Sendai virus, lentivirus, vaccinia virus, chicken pox virus, Papova virus represented by SV40, and the like. Preferably, the vector is a virus derived from an adenovirus or an adeno-associated virus. Examples of the non-viral vector include a vector having a Pol I promoter, a Pol II promoter, a Pol III promoter, a bacteriophage (T4 phage or T7 phage RNA polymerase recognition sequence) promoter, or the like. Examples of the Pol II promoter include a CMV promoter and a β-globulin promoter, and examples of the Pol III promoter include a U6 promoter, an H1 promoter, a tRNA promoter, a 7SK promoter, a 7SL promoter, a Y3 promoter, a 5S rRNA promoter, an Ad2 VAI and a VAII promoter. Is exemplified. Vectors having these promoters are commercially available and readily available.

  The miRNA of the present invention may be administered to a patient as it is, or may be administered as a carrier using liposomes, atelocollagen, self-assembling peptides, nanoparticles, cationic polymers, dendrimers, and the like. Further, it may be administered while being contained in a substrate vesicle. Substrate vesicles may be of natural origin or synthetic. The synthesized artificial substrate vesicles are composed of, for example, liposomes, block copolymer micelles, and the like. The size of the artificial substrate vesicle is preferably 100 nm to 300 nm in diameter. Examples of the liposome include N- [2,3- (dioleyloxy) propyl] -N, N, N-trimethylammonium chloride (DOTMA) and dioleoylphosphatidylethanolamine (DOPE).

3. An osteoblast derived from osteoblasts transfected with miR-125b, or a precursor thereof, or a mutant thereof, and containing miR-125b, a precursor thereof, or a mutant thereof in a greater amount than before transfection. Osteoclastogenesis and / or function inhibitor comprising matrix vesicles and method for producing the same A third aspect of the present invention provides a method for disrupting osteoclasts derived from osteoblasts transfected with the miRNA of the present invention. It is a bone cell formation and / or function inhibitor. The substrate vesicle contains the miRNA of the present invention in a larger amount than before transfection.
Further, a fourth aspect of the present invention provides a method of forming osteoclasts containing the matrix vesicles, which comprises transfecting the miRNA of the present invention into osteoblasts and isolating matrix vesicles from the osteoblasts. And / or a method for producing a function inhibitor.
As the transfection method, a conventionally known method, for example, a lipofection method, a liposome method, a polyamine method, an electroporation method, a bead method, or the like can be used. Examples of transfection reagents include TransFectin (Bio-Rad), Lipofectamine RNAiMAX (Life Technologies), HiPerFect Transfection Kit (Qiagen), and DharmaFECT reagent kit (Thermo Fisher Scientific, etc.). By isolating the substrate vesicles from the osteoblasts transfected with the miRNA of the present invention, substrate vesicles containing the miRNA of the present invention in a larger amount than before transfection can be obtained. Using this matrix vesicle, an agent for inhibiting osteoclast formation and / or function can be produced.

A fifth aspect of the present invention is a method for producing an inhibitor of osteoclast formation and / or function comprising artificial matrix vesicles, comprising inserting the miRNA of the present invention into artificial matrix vesicles.
For example, it can be produced by inserting the miRNA of the present invention into artificial substrate vesicles composed of liposomes, block copolymer micelles and the like.

4. Osteoclastogenesis Promoter and / or Osteoclast Function Promoter Containing miR-125b Antisense Inhibitor A sixth aspect of the present invention provides a method for promoting osteoclastogenesis and / or osteoclast formation comprising a miR-125b antisense inhibitor. Or a function promoter.
In the present specification, the osteoclast formation promoting agent and / or the osteoclast function promoting agent is also referred to as an osteoclast formation and / or function promoting agent.
In the present invention, the miR-125b antisense inhibitor is an inhibitor having a sequence complementary to miR-125b and having an action of inhibiting the activity and / or expression of miR-125b. For example, LNA ^™ microRNA Inhibitor (Takara Bio), Tough Decay RNA (Lenti miRNA inhibitor (Sigma-Aldrich)) and the like can be mentioned. For example, the miR-125b antisense inhibitor reduces the function or expression of miR-125b in the osteoblast, thereby causing a decrease or dysfunction of miR-125b contained in the matrix vesicle, and causing osteoclasts. Promotes the formation and / or function of

5. Pharmaceutical composition for preventing and / or treating bone disease, comprising an agent for suppressing osteoclast formation and / or function, or an agent for promoting osteoclast formation and / or function, The seventh aspect of the present invention is described above. A pharmaceutical composition for preventing and / or treating a bone disease, comprising an agent for suppressing osteoclast formation and / or function, or an agent for promoting osteoclast formation and / or function (also referred to as the pharmaceutical composition of the present invention) It is.
The pharmaceutical composition of the present invention comprises, in addition to the miRNA of the present invention, a pharmaceutically acceptable carrier (eg, sterilized water, physiological saline and the like), a stabilizer (eg, a nuclease inhibitor and the like), a chelating agent (eg, EDTA, etc.), and other auxiliaries.
The administration method of the pharmaceutical composition of the present invention includes oral administration and parenteral administration, but parenteral administration is preferred. Examples of parenteral administration include intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, and mucosal administration.

The dose and frequency of administration of the pharmaceutical composition of the present invention can be appropriately determined in consideration of the purpose of use, the age, weight, sex, history of the patient, the severity of the disease, the type of active ingredient, and the like of the patient. . The dose is, for example, 1.0 μg / kg to 1.0 g / kg, preferably 10 μg / kg to 100 mg / kg per adult for miRNA, and the final titer of virus for viral vectors. 10 ⁷ to 10 ¹³ pfu / mL, and preferably 10 ⁹ to 10 ¹² pfu / mL. The administration frequency is, for example, once a day to once every several months.

In the present invention, a bone disease is an abnormal bone metabolism caused by abnormal differentiation and / or maturation of osteoclasts, and a disorder characterized by a decrease in bone mass (for example, osteoporosis (postmenopausal osteoporosis, senile osteoporosis, Osteoporosis due to the use of therapeutic drugs such as steroids and immunosuppressants, osteoporosis associated with rheumatoid arthritis), bone destruction associated with rheumatoid arthritis, cancerous hypercalcemia, bone associated with multiple myeloma and cancer bone metastasis Destruction, giant cell tumor, osteopenia, tooth loss due to periodontitis, osteolysis around artificial joints, bone destruction in chronic osteomyelitis, Paget disease of bone, renal osteodystrophy, osteogenesis imperfecta, etc.) And diseases caused by reduced osteoclast function (eg, osteopetrosis, sclerosis, ectopic ossification, ossifying myositis, etc.).
The medicament containing the osteoclast formation and / or function inhibitor of the present invention can be used as a preventive and / or therapeutic agent for a disorder characterized by bone loss. That is, the present invention provides a pharmaceutical composition for preventing and / or treating a disorder characterized by bone loss, comprising the above-mentioned inhibitor of osteoclast formation and / or function.
The medicament containing the agent for promoting osteoclast formation and / or function of the present invention can be used as a prophylactic and / or therapeutic agent for diseases caused by a decrease in osteoclast function. That is, the present invention provides a pharmaceutical composition comprising the above-mentioned agent for promoting osteoclast formation and / or function, for preventing and / or treating a disease caused by reduced osteoclast function.
In the present invention, differentiation and formation are synonymous. For example, osteoclast differentiation and osteoclastogenesis are used interchangeably.

  The preventive and / or therapeutic agent for a bone disease containing the agent for suppressing or promoting osteoclast formation and / or function of the present invention can be used as a medicine for an individual to be administered. Specific individuals to be administered are preferably individuals with the above-mentioned bone disease, individuals who may develop the bone disease, and the like. In addition, mammals (humans, mice, rats, rabbits, dogs, cats, cows, horses, pigs, monkeys, and the like) are preferred as individuals, and humans are preferred among them, and patients with bone diseases (humans) are particularly preferred.

  The pharmaceutical composition of the present invention can be used in combination with a therapeutically and / or prophylactically effective amount of at least one therapeutic agent for bone disease. For example, bisphosphonates (eg, alendronate, etidronate, ibandronate, incadronate, pamidronate, risedronate, or zoledronate) include bisphosphonates (eg, alendronate, etidronate, ibandronate, indronate, pamidronate, risedronate) as therapeutic agents for bone diseases that can be used in combination with the pharmaceutical composition containing the osteoclast formation and / or function inhibitor of the present invention. Activated vitamin D3, calcitonin and derivatives thereof, hormones such as estradiol, SERMs (selective estrogen receptor modulators), ipriflavone, vitamin K2 (menatetrenone), calcium preparations, PTH (parathyroid hormones), non-steroidal agents, celecoxib or rofecoxib), Soluble TNF receptor (eg, etanercept), anti-TNFα antibody or antigen-binding fragment of the antibody (eg, infliximab), anti-PTHrP (parathyroid hormone-related protein) antibody or antigen-binding fragment of the antibody, IL-1 receptor antagonist (eg, anakinra), an anti-IL-6 receptor antibody or an antigen-binding fragment of the antibody (e.g., tocilizumab), an anti-RANKL antibody or an antigen-binding fragment of the antibody (e.g., denosumab), and OCIF (osteoblastogenesis inhibitory factor). It is possible, but not limited to these. The pharmaceutical composition of the present invention and another therapeutic agent for bone disease may be contained in a single preparation or may be contained in separate preparations.

6. Screening method In the present invention, the present inventors have found a novel control mechanism of bone remodeling consisting of the following (1) to (3).
(1) In osteoblasts, miR-125b is selectively incorporated into matrix vesicles.
(2) Substrate vesicles containing miR-125b are secreted from osteoblasts and selectively taken up by osteoclast precursor cells or osteoclasts.
(3) miR-125b incorporated into osteoclast precursor cells or osteoclasts as a substrate vesicle molecule suppresses differentiation (osteoclast formation) and / or function.
A novel screening method is provided based on the present control mechanism.

6-1. First Screening Method As one embodiment of the present invention, the regulation of osteoclast formation and / or function using the change in the amount of miR-125b in osteoblasts, osteoclast precursor cells or osteoclasts as an index ( The present invention provides a method for screening a substance that suppresses or promotes) or a preventive and / or therapeutic agent for a bone disease.
More specifically, the present invention provides a method of culturing osteoblasts, osteoclast precursor cells or osteoclasts in the presence and absence of a test substance, and measuring the amount of miR-125b in the cells under both conditions. A method for screening a substance that regulates osteoclast formation and / or function or a preventive and / or therapeutic agent for a bone disease, characterized by measuring and comparing. When using osteoclast precursor cells or osteoclasts, preferably, in addition to the above conditions, substrate vesicles are further added to the medium. That is, the present invention treats substrate vesicles on osteoclast precursor cells or osteoclasts cultured in the presence or absence of a test substance with osteoclast precursor cells or osteoclasts, under both conditions. Provided is a method for screening a substance that regulates osteoclast formation and / or function, or a preventive and / or therapeutic agent for a bone disease, which comprises measuring and comparing the amount of miR-125b in a cell. As a result of the comparison, when the amount of miR-125b in the osteoblasts, osteoclast precursor cells or osteoclasts is increased or decreased, the test substance is used as an indicator for the formation of osteoclasts and It can be determined that the compound has an effect of suppressing or promoting a function.

  As the osteoblast, any cell that can be differentiated into an osteoblast can be used regardless of species or cell line. In addition, tissues containing osteoblasts (such as bone tissues) can be used. For example, primary cultured cells prepared from an individual or established cell lines can be used. Specifically, primary cultured osteoblasts (preferably, from tissues of humans (for example, Lonza Japan, catalog number CC-2538, DV Biologics, catalog number AM005-f), monkeys, dogs, rabbits, rats, mice, etc.) Preparation), MC3T3-E1 cells, ROS 17 / 2.8, UMR-106, RCJ3.1, C3H10T1 / 2, ROB-C26, C2C12, ST-2, SV-HFO, hFOBs, MG-63, Saos-2 , U2-OS, HOS TE85, HBDC (Trabecular Human Bone Derived Cell), hMS (OB), SaM-1 and the like. Cells that can be transformed into osteoblast-like cells (eg, vascular smooth muscle cells) and chondrocytes that secrete matrix vesicles can also be used.

The above-mentioned osteoclast precursor cells include monocyte / macrophage cells that can be differentiated into osteoclasts, and any kind of osteoclast precursor cells that can be differentiated into osteoclasts can be used regardless of species or cell line. it can. In addition, tissues containing osteoclast precursor cells (eg, bone tissue) can also be used. For example, primary cultured cells prepared from an individual or established cell lines can be used. More specifically, primary culture cells (preferably, prepared from tissues of humans (for example, Lonza Japan, Catalog No. 2T-110), monkeys, dogs, rabbits, rats, mice, etc.), RAW 264.7 cells or RAW 264.7 Macrophage-like cells (RAW-D cells and the like) established from cells, MOCP-5 cells, and the like.
Examples of the osteoclast include cells obtained by inducing differentiation from the osteoclast precursor cells, osteoclasts isolated from tissues, and the like.
Test substances include, for example, proteins, peptides, non-peptide compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, and the like. Or a known one. In addition, a compound library prepared using a combinatorial chemistry technique, a random peptide library prepared by a solid phase synthesis or a phage display method, and the like are also examples of the test substance.

The measurement of the miR-125b amount of osteoblasts, osteoclast precursor cells or osteoclasts can be performed, for example, as follows.
When osteoblasts, osteoclast precursor cells or osteoclasts are cultured in vitro according to a conventional method, a test substance is added to a medium, and after culturing for a certain time, the amount of miR-125b of the cells is determined by a known method, for example, , RT-PCR, nucleic acid array, Northern blot analysis and the like.
When using osteoclast precursor cells or osteoclasts, matrix vesicles may be added to the medium in addition to the test substance. The timing of adding the test substance and the substrate vesicle may be the same or different.

-Selection of a substance that inhibits osteoclast formation and / or function, or a prophylactic and / or therapeutic agent for disorders characterized by reduced bone mass. MiR in osteoblasts, osteoclast precursor cells or osteoclasts As a result of measuring the amount of -125b, the increase in the amount of miR-125b caused by the test substance and the effect of suppressing the formation and / or function of osteoclasts, or preventing and / or preventing a disorder characterized by a decrease in bone mass. The activity to be treated is correlated. Then, the test substance having an increased miR-125b level in osteoblasts, osteoclast precursor cells or osteoclasts is characterized by a substance that suppresses osteoclast formation and / or function or a decrease in bone mass. As a prophylactic and / or therapeutic agent (or candidate thereof) for the disorder to be treated. That is, as one embodiment of the present invention, a substance that suppresses osteoclast formation and / or function, using an increase in the amount of miR-125b in osteoblasts, osteoclast precursor cells, or osteoclasts as an index, Alternatively, a method for screening for a prophylactic and / or therapeutic agent (or a candidate thereof) for a disorder characterized by bone loss is provided.

-Selection of a substance that promotes the formation and / or function of osteoclasts, or the selection of a preventive and / or therapeutic agent for a disease caused by a decrease in the function of osteoclasts. As a result of the measurement of the amount of miR-125b, a change in the decrease of the amount of miR-125b by the test substance and an effect of promoting the formation and / or function of osteoclasts, or preventing a disease caused by a decrease in the function of osteoclasts, And / or correlate with the activity to be treated. Then, the test substance having a reduced miR-125b amount is replaced with a substance that promotes osteoclast formation and / or function, or a preventive and / or therapeutic agent for a disease caused by a decrease in osteoclast function (or a therapeutic agent thereof). Candidate substance). That is, as one embodiment of the present invention, a substance that promotes osteoclast formation and / or function, which is based on a decrease in the amount of miR-125b in osteoblasts, osteoclast precursor cells, or osteoclasts, Alternatively, there is provided a method for screening for a preventive and / or therapeutic agent (or a candidate thereof) for a disease caused by reduced osteoclast function.

6-2. Second Screening Method As one embodiment of the present invention, a substance that regulates osteoclast formation and / or function, based on a change in miR-125b uptake (transport) into matrix vesicles, or a bone disease Methods for screening for prophylactic and / or therapeutic agents are provided.
More specifically, the present invention relates to culturing osteoblasts in the presence or absence of a test substance, and measuring and comparing the uptake of miR-125b into matrix vesicles under both conditions. Disclosed is a method for screening a substance that regulates formation and / or function of osteoclasts, or a preventive and / or therapeutic agent for a bone disease. As a result of the comparison, when there is an increase or decrease in the amount of miR-125b incorporated into the substrate vesicles, the test substance is used as an index to suppress or promote the formation and / or function of osteoclasts. Can be determined.

  As the osteoblast, any cell that can be differentiated into an osteoblast can be used regardless of species or cell line. In addition, tissues containing osteoblasts (such as bone tissues) can also be used. For example, primary cultured cells prepared from an individual or established cell lines can be used. Specifically, primary cultured osteoblasts (preferably, from tissues of humans (for example, Lonza Japan, catalog number CC-2538, DV Biologics, catalog number AM005-f), monkeys, dogs, rabbits, rats, mice, etc.) Preparation), MC3T3-E1 cells, ROS 17 / 2.8, UMR-106, RCJ3.1, C3H10T1 / 2, ROB-C26, C2C12, ST-2, SV-HFO, hFOBs, MG-63, Saos-2 , U2-OS, HOS TE85, HBDC (Trabecular Human Bone Derived Cell), hMS (OB), SaM-1 and the like. Cells that can be transformed into osteoblast-like cells (eg, vascular smooth muscle cells) and chondrocytes that secrete matrix vesicles can also be used.

Test substances include, for example, proteins, peptides, non-peptide compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, and the like. Or a known one. In addition, a compound library prepared using a combinatorial chemistry technique, a random peptide library prepared by a solid phase synthesis or a phage display method, and the like are also examples of the test substance.
Measurement of uptake (transport) of miR-125b into substrate vesicles can be performed, for example, as follows.
When osteoblasts are cultured in vitro according to a conventional method, a test substance is added to a medium, and after culturing for a certain period of time, matrix vesicles of the cells are isolated by a known method (Examples or Methods Mol Biol, vol. 1053). , 115-124). The amount of miR-125b in the isolated substrate vesicles is quantified and analyzed using techniques such as RT-PCR, nucleic acid array, and Northern blot analysis.

-Selection of a substance that inhibits osteoclast formation and / or function, or a prophylactic and / or therapeutic agent for a disorder characterized by a decrease in bone mass. As a result of measuring the amount of miR-125b incorporated into matrix vesicles, Prevention and / or treatment of disorders characterized by altered uptake of miR-125b into matrix vesicles by test substances, and inhibitory effects on osteoclast formation and / or function, or bone loss Activity is correlated. Then, the test substance (a substance having an action of promoting the transport of miR-125b to the substrate vesicles) having an increased amount of miR-125b incorporated into the substrate vesicles is subjected to osteoclast formation and / or function. Or a preventive and / or therapeutic agent (or a candidate thereof) for a disorder characterized by bone loss. That is, one embodiment of the present invention is characterized by a substance that suppresses osteoclast formation and / or function, or a decrease in bone mass, based on an increase in the uptake of miR-125b into matrix vesicles. A method for screening for a prophylactic and / or therapeutic agent (or a candidate thereof) for a given disorder is provided.

-Selection of a substance that promotes osteoclast formation and / or function, or a prophylactic and / or therapeutic agent for a disease caused by a decrease in osteoclast function Result of measurement of miR-125b uptake into matrix vesicles Changes in the uptake of miR-125b into matrix vesicles by test substances, and effects of promoting the formation and / or function of osteoclasts, or preventing diseases caused by reduced osteoclast function and / or Alternatively, it is correlated with the activity to be treated. Then, the test substance (a substance having an action of suppressing the transport of miR-125b to the substrate vesicles) in which the amount of miR-125b incorporated into the substrate vesicles is reduced is converted into osteoclast formation and / or It can be selected as a substance that promotes function or as a preventive and / or therapeutic agent (or a candidate substance thereof) for a disease caused by reduced osteoclast function. That is, as one embodiment of the present invention, a substance that promotes osteoclast formation and / or function, or a decrease in osteoclast function, which is based on a decrease in the uptake of miR-125b into matrix vesicles, is used as an index. A method for screening a preventive and / or therapeutic agent (or a candidate substance thereof) for a disease caused by the disease is provided.

6-3. Third Screening Method As one embodiment of the present invention, a substance that regulates osteoclast formation and / or function, based on changes in the uptake of matrix vesicles by osteoclast precursor cells or osteoclasts, or bone A method for screening for a prophylactic and / or therapeutic agent for a disease is provided.
More specifically, the present invention treats osteoclast precursor cells or osteoclasts cultured in the presence or absence of a test substance with matrix vesicles, A method for screening a substance that regulates osteoclast formation and / or function, or a method for preventing and / or treating a bone disease, comprising measuring and comparing the uptake of matrix vesicles by osteoclasts. I do. As a result of the comparison, when there is an increase or decrease in the uptake of matrix vesicles into osteoclast precursor cells or osteoclasts, the test substance is used as an indicator to form osteoclasts and / or It can be determined that the compound has an effect of suppressing or promoting the function.

The above-mentioned osteoclast precursor cells include monocyte / macrophage cells that can be differentiated into osteoclasts, and any kind of osteoclast precursor cells that can be differentiated into osteoclasts can be used regardless of species or cell line. it can. In addition, tissues containing osteoclast precursor cells (eg, bone tissue) can also be used. For example, primary cultured cells prepared from an individual or established cell lines can be used. More specifically, primary culture cells (preferably, prepared from tissues of humans (for example, Lonza Japan, Catalog No. 2T-110), monkeys, dogs, rabbits, rats, mice, etc.), RAW 264.7 cells or RAW 264.7 Macrophage-like cells (RAW-D cells and the like) established from cells, MOCP-5 cells, and the like.
Examples of the osteoclast include cells obtained by inducing differentiation from the osteoclast precursor cells, osteoclasts isolated from tissues, and the like.

  Test substances include, for example, proteins, peptides, non-peptide compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, and the like. Or a known one. In addition, a compound library prepared using a combinatorial chemistry technique, a random peptide library prepared by solid phase synthesis or a phage display method, and the like are also examples of the test substance.

Measurement of the uptake of matrix vesicles by osteoclast precursor cells or osteoclasts can be performed, for example, as follows.
When culturing osteoclast precursor cells or osteoclasts in vitro according to a conventional method, a test substance and labeled substrate vesicles are added to the medium, and the dynamics (uptake) of the substrate vesicles are measured by a method using real-time imaging. Quantitative analysis. The timing of adding the test substance and the substrate vesicle may be the same or different.

・ Selection of a substance that inhibits osteoclast formation and / or function, or a prophylactic and / or therapeutic agent for a disorder characterized by a decrease in bone mass. Incorporation of matrix vesicles into osteoclast precursor cells or osteoclasts. As a result of the measurement of the amount, a change in the increase in the uptake of matrix vesicles into osteoclast precursor cells or osteoclasts by the test substance and an effect of suppressing the formation and / or function of osteoclasts, or Correlates with prophylactic and / or therapeutic activity against a disorder characterized by reduction. The test substance having an increased uptake of matrix vesicles into osteoclast precursor cells or osteoclasts is characterized by a substance that suppresses osteoclast formation and / or function, or a decrease in bone mass. As a prophylactic and / or therapeutic agent (or candidate thereof) for the disorder to be treated. That is, as one embodiment of the present invention, a substance which suppresses the formation and / or function of osteoclasts, which is based on an increase in the amount of matrix vesicles taken up into osteoclast precursor cells or osteoclasts, or Methods are provided for screening for prophylactic and / or therapeutic agents (or their candidates) for disorders characterized by reduced amounts.

・ Selection of a substance that promotes osteoclast formation and / or function, or a prophylactic and / or therapeutic agent for a disease caused by reduced osteoclast function. As a result of the measurement of the uptake, a change in decrease in the uptake of matrix vesicles into the osteoclast precursor cells or osteoclasts by the test substance and an effect of promoting the formation and / or function of osteoclasts, or osteoclasts It is correlated with the activity of preventing and / or treating a disease caused by reduced cell function. Then, the test substance, which has reduced the amount of matrix vesicles taken into osteoclast precursor cells or osteoclasts, is replaced with a substance that promotes osteoclast formation and / or function, or a decrease in osteoclast function. Can be selected as preventive and / or therapeutic agents (or candidate substances thereof) for diseases caused by That is, as one embodiment of the present invention, a substance or a substance which promotes osteoclast formation and / or function, based on a decrease in the amount of matrix vesicles taken up into osteoclast precursor cells or osteoclasts, is used as an index. A method for screening for a preventive and / or therapeutic agent (or a candidate thereof) for a disease caused by reduced bone cell function is provided.
In the screening method of the present invention, the change in the expression of miR-125b can also be evaluated by measuring the expression level of miR-125b instead of miR-125b or its precursor or a mutant of miR-125b. . Therefore, a screening method for evaluating the expression of miR-125b precursor or miR-125b or a mutant of miR-125b instead of miR-125b expression is also included in the present invention.

The bone disease in the screening method of the present invention is an abnormality in bone metabolism caused by abnormal differentiation and / or maturation of osteoclasts, a disorder characterized by a decrease in bone mass, and a disease caused by decreased osteoclast function. including.
Disorders characterized by a decrease in bone mass in the screening method of the present invention include, for example, osteoporosis (postmenopausal osteoporosis, senile osteoporosis, secondary osteoporosis due to use of therapeutic agents such as steroids and immunosuppressants, and rheumatoid arthritis) Osteoporosis), bone destruction associated with rheumatoid arthritis, cancerous hypercalcemia, bone destruction associated with multiple myeloma or cancer bone metastasis, giant cell tumor, osteopenia, tooth loss due to periodontitis, periprosthetic joint Osteolysis, bone destruction in chronic osteomyelitis, Paget's disease, renal osteodystrophy, osteogenesis imperfecta and the like.
In the screening method of the present invention, the disease caused by a decrease in the function of osteoclasts is, for example, osteopetrosis, sclerosis, ectopic ossification, ossifying myositis and the like.
The substance selected by the screening method of the present invention can be formulated as in the aforementioned pharmaceutical composition of the present invention. The preparations obtained in this way are safe and low toxic, and therefore, for example, mammals (eg, human, rat, mouse, hamster, rabbit, sheep, goat, pig, cow, horse, cat, dog, monkey, chimpanzee) ) Can be administered.

Hereinafter, the present invention will be described in detail with reference to examples, but the present invention is not limited thereto.
<Cell culture>
The mouse osteoblast cell line MC3T3-E1 was obtained from RIKEN cell bank, and human osteoblasts (derived from cancellous bone) were obtained from DV Biologics. Mouse macrophage cell line RAW-D (established from cell line RAW264.7) was provided by Professor Hisagida Kyushu University. Cells and tissues (other than human osteoblasts) used in the present invention are α-Mininum supplemented with 10% fetal bovine serum (FBS) and antibiotics unless otherwise specified. Maintained at 37 ° C. in a 5% CO ₂ humidified incubator using Essential Medium (αMEM). For culturing human osteoblasts, a medium for osteoblasts (DV Biologics) was used.

<Isolation of substrate vesicles>
MC3T3-E1 cells were seeded at a density of 3,000 cells / cm ^{2 in} the presence of 50 μg / ml ascorbic acid (also referred to as differentiation induction medium). Once osteoid nodules had formed (2-3 weeks), cells were washed with PBS (phosphate buffered saline) and treated with 500 units / ml collagenase (type 2, Sigma-Aldrich) for 1 hour at 37 ° C. The digest after the enzyme treatment was collected and centrifuged at 20,000 g for 20 minutes to remove cells and cell debris after centrifugation. Thereafter, the supernatant was ultracentrifuged at 100,000 g for 60 minutes. The precipitate was resuspended in 10 mM HEPES (pH 7.5) containing 100 mM mannitol and ultracentrifuged at 350,000 × g for 30 minutes. The precipitate containing the substrate vesicles was resuspended in PBS and stored at -80 <0> C until use.

Example 1: Osteoclast formation and function-suppressing action by matrix vesicles Example 1.1: In vitro osteoclast formation assay Mouse bone marrow-derived macrophages (BMMs) and RAW-D cells were used as osteoclast precursor cells. .
BMMs were prepared by the following method. Bone marrow was obtained by flushing out the tibia and femur of 4-6 week old male ddY mice, from which the monocyte / macrophage fraction was separated by density gradient centrifugation (Ficoll-Paque ^™ PREMIUM, GE Healthcare). Collected. After overnight culture in the presence of 20 ng / ml macrophage colony stimulating factor (M-CSF) (recombinant mouse, @Protech), the floating cells were collected and designated as BMMs. The recovered BMMs were seeded at a density of 125,000 cells / cm ² , and then cultured in the presence or absence of 100 ng / ml RANKL (recombinant human soluble, ぺ Protech) and 40 ng / ml M-CSF. .
RAW-D cells were collected using a non-enzymatic cell stripper solution (Mediatech), seeded at a density of 2,200 cells / cm ² , and cultured in the presence or absence of 50 ng / ml RANKL. .
When treating each cell with a substrate vesicle, the substrate vesicle isolated in the above [Isolation of substrate vesicle] was added to each cell every day.
Six days after seeding, each cell was fixed in PBS containing 4% paraformaldehyde, stained with tartaric acid-resistant acid phosphatase (TRAP), and five or more nuclei of TRAP-positive multinucleated cells were determined as osteoclasts. , And in the following experiments).

  Substrate vesicles (0.8 μg / mL protein) are dependent on RANKL and M-CSF (RAW-D cells do not require M-CSF) -dependent osteoclast differentiation in BMMs (FIG. 1) and RAW-D (FIG. 2) Was suppressed. Using RAW-D cells, the concentration dependence of substrate vesicles (0.4 to 1.6 μg / mL protein) was confirmed (FIG. 2).

Example 1.2: Functional analysis of osteoclasts by bone resorption pit formation assay BMMs were seeded at a density of 125,000 cells / cm ² on a 96-well plate on which ivory pieces (Wako Pure Chemical Industries) were set. For 20 days in the presence or absence of 100 ng / ml RANKL and 40 ng / ml M-CSF. When treating substrate vesicles, the substrate vesicles (0.8 μg / mL protein) isolated in the above [Isolation of substrate vesicles] were added to the cells daily. After culture, to evaluate the formation of bone resorption pits (pits), ivory pieces were stained with hematoxylin, and the area of the bone resorption pits was measured using Image J1.48 software (National Institutes of Health). . As a result, the matrix vesicles suppressed the formation of RANKL and M-CSF-dependent bone resorption pits (pits) (FIG. 3).

Example 1.3: Assay of matrix vesicle uptake in osteoclast precursor cells and osteoclasts <Isolation of labeled matrix vesicles>
MC3T3-E1 cells were cultured at 37 ° C. for 30 minutes in a medium to which Vybrant (registered trademark) Dil cell-labeling D-282 solution (final concentration: 5 μM, Life Technologies) was added. After the culture, labeled substrate vesicles were isolated according to the above [Isolation of substrate vesicles].
<Assay of substrate vesicle uptake in osteoclast precursor cells>
RAW-D cells were seeded on a 35 mm glass bottom dish at a density of 2200 cells / cm ² , cultured for 1 day, and then the labeled substrate vesicle (0.8 μg / mL protein) prepared above was added. Twenty-four hours after the addition, time-lapse imaging was performed using an IncuCyte ZOOM system (Essen Bioscience) to observe the dynamics of the substrate vesicles.
<Assay of matrix vesicle uptake in osteoclasts>
RAW-D cells were seeded on a 35 mm glass bottom dish at a density of 2200 cells / cm ² , cultured in the presence of RANKL for 3 to 4 days, and after observing osteoclasts (multinucleated), the labeling prepared above was performed. Substrate vesicles (0.8 μg / mL protein) were added. Twenty-four hours after the addition, time-lapse imaging was performed using an IncuCyte ZOOM system (Essen Bioscience) to observe the dynamics of the substrate vesicles.

As a result, time-dependent accumulation (uptake) of matrix vesicles was observed in both RAW-D cells (osteoclast precursor cells) and RAW-D cells in which osteoclasts were differentiated. (The data for 24 hours after each cell is shown in FIG. 4). On the other hand, a substrate vesicle uptake assay similar to that of RAW-D cells was performed using MC3T3-E1 cells, but no accumulation of substrate vesicles was observed in MC3T3-E1 cells (data not shown). These results suggest that the uptake of matrix vesicles is cell-selective, and that osteoclast precursor cells and osteoclasts may selectively take up matrix vesicles.
As described above, Example 1 shows that matrix vesicles are taken up by osteoclast precursor cells or osteoclasts, where they exhibit an osteoclast formation inhibitory action and an osteoclast function inhibitory action.

Example 2: Comprehensive analysis of miRNA contained in substrate vesicles The miRNA contained in substrate vesicles was profiled. The miRNA in the substrate vesicles derived from MC3T3-E1 cells was extracted using the mirVana miRNA isolation kit (Ambion) according to the instructions attached to the kit. The extracted miRNA was prepared using miRNA Complete Labeling and Hyb kit (Agilent Technology) and SurePrint G3 Mouse miRNA microarray kit 8 × 60K Rel. Labeling and hybridization were performed using 17.0 (Agilent Technology). miRNA profiling was analyzed with an Agilent G2539A microarray scanner and analysis software GeneSpringGX.
As a result, 174 miRNAs out of 1800 were present in the substrate vesicles. Among these, miR-21, miR-199a, miR-125b, and let-7c were selected as miRNAs having high relative amounts in substrate vesicles and common to humans and mice.

Example 3: Selective transport of miR-125b to substrate vesicles The relative amounts of osteoblasts and substrate vesicles were compared for the four selected miRNAs.
Total RNA was extracted from MC3T3-E1 cells and their substrate vesicles cultured for 14 days in a differentiation induction medium. TaqMan® miRNA assays were used for quantification of target microRNAs, with U6 and miR-16-5P as internal standards. Rat osteoblasts were prepared from embryonic 21-day Wistar rat calvaria and cultured for 14 days in a differentiation-inducing medium. Human osteoblasts used were cultured for 21 days in a differentiation induction medium. As a result, in MC3T3-E1 cells, the amount of miR-125b in substrate vesicles was higher than that in cells (FIG. 5). Similar results were obtained with rat osteoblasts and human osteoblasts.
These results indicated that in osteoblasts, miR-125b was selectively taken up by matrix vesicles and was present at high levels in matrix vesicles.

Example 4: miR-125b levels in osteoclast precursor cells after substrate vesicle treatment Total RNA was isolated from RAW-D cells treated with substrate vesicles (0.8 μg / mL protein) for 24 hours, and as described above. Was used to calculate the relative amount of miR-125b. As a result, the miR-125b level in the cells increased about 2.5-fold as compared to before the treatment.

Example 5: Inhibition of osteoclast formation by miR-125b Example 5.1: Transfection of miR-125b Transformation of miR-125b into RAW-D cells and parietal bone in organ culture to form osteoclasts It was confirmed.
RAW-D cells were seeded at a density of 2,200 cells / cm ² and cultured overnight. Thereafter, the cells were transfected with 10 nM miR-125b mimic (Ambion) or control miRNA using RNAi Max reagent (Life Technologies). Eight hours later, the medium was replaced with a medium containing RANKL (50 ng / ml), and the cells were further cultured for 5 days. Then, it was subjected to TRAP staining.
Transfection to the parietal bone was performed by the following method. The parietal bone was collected from a 5-week-old male ddY mouse, and a bone fragment of ² × ² mm ² was cut out at a position 1 mm from the sagittal suture. Four randomly selected bone fragments were placed in each well of a 24-well plate, and cultured in the presence or absence of 500 ng / ml RANKL for 5 days. A mixture of miR-125b or control RNA (200 pmole each) and 5 μl of AteloGene® (Koken) was added to each bone fragment every other day. After culturing, each bone fragment was fixed with 4% paraformaldehyde-containing PBS at 4 ° C. for 1 hour, and a frozen section having a thickness of 8 μm was prepared and subjected to TRAP staining.

  As a result, in RAW-D cells transfected with miR-125b, suppression of RANKL-dependent osteoclast formation was observed (FIG. 6). Similar results were also obtained from experiments using parietal bone organ cultures.

Example 5.2: Effect of forced expression of miR-125b inhibitor MC3T3-E1 cells were seeded at a density of 2,000 cells / cm ^{2 in} a 48 well plate. When 50% confluent is reached, the miR-125b inhibitor (Tough Decay RNA) or the negative control 1 is multiplied with a multiplicity of infection (MOI) of 10 to 20 using MISSION® Lenti miRNA inhibitor (Sigma-Aldrich). For overnight. The medium was replaced with a medium containing 2.5 μg / ml puromycin, and a clone stably expressing the miR-125b inhibitor or control RNA was selected. In addition, clones determined to be positive by the quantitative PCR analysis were maintained in a differentiation-inducing medium, and matrix vesicles were collected after formation of bone-like nodules.

  No significant differences in proliferation and differentiation were found between the two stably expressing cells. On the other hand, forced expression of the miR-125b inhibitor reduced the detection level of miR-125b by real-time RT-PCR by about 70% without changing the levels of marker proteins such as ALP and annexin V in the substrate vesicles. Osteoclast formation assays were performed using matrix vesicles from both cells. Substrate vesicles derived from miR-125b inhibitor forced expression cells or control cells were respectively administered to RAW-D cells in the presence or absence of RANKL for 4 days and subjected to TRAP staining. As a result, in RAW-D cells to which substrate vesicles derived from miR-125b inhibitor forced expression cells were administered, the number of osteoclasts was larger than in cells to which substrate vesicles derived from control cells were administered ( (FIG. 7). From these results, it can be seen that miR-125b function deficiency reduces the ability of matrix vesicles to inhibit osteoclast formation, that is, the inhibitory effect of matrix vesicles on osteoclast formation is mediated by miR-125b in matrix vesicles. It was shown that it was exerted.

Example 5.3: In vivo osteoclast formation assay The inhibitory effect of miR-125b on osteoclast formation in vivo was verified using a mouse LPS (lipopolysaccharide) -induced osteolysis model. This model is an animal model in which LPS is administered to the mouse calvaria to induce osteoclast differentiation and bone destruction.
LPS (5 mg / kg body weight) was administered subcutaneously every other day on the calvaria of 8-week-old male ddY mice. On days 0 and 3, a mixture of miR-125b or control RNA (7 nmole each) and 70 μl of AteloGene® was injected subcutaneously near the LPS administration site. On the first and fifth days, calcein (100 μg / kg body weight) was intraperitoneally administered. One week after LPS administration, calvariae were subjected to whole mount TRAP staining.

FIG. 8 shows the result. The number of TRAP-positive osteoclasts was reduced in the mouse calvaria to which miR-125b was administered, compared to the mouse calvaria to which the control RNA had been introduced. From these results, the effect of miR-125b on osteoclast formation was also demonstrated in vivo.
From Example 5, it can be seen that miR-125b has an inhibitory effect on osteoclast formation, and that miR-125b is carried to osteoclast precursor cells or osteoclasts through matrix vesicles to exert its action. Indicated.

  According to the present invention, an agent for inhibiting osteoclast formation and / or function and an agent for promoting osteoclast formation and / or function are provided. Further, according to the present invention, there is provided a method for screening a drug that controls bone remodeling.

Claims (14)

  An osteoclast formation inhibitor and / or an osteoclast function inhibitor containing osteoblast-derived matrix vesicles. Inhibition of osteoclastogenesis, including a mutant having 90% or more sequence identity with miR-125b or a precursor thereof , or a sequence of miR-125b or a precursor thereof and retaining the function of miR-125b And / or an inhibitor of osteoclast function. transfected with miR-125b or a precursor thereof , or a mutant having 90% or more sequence identity with the sequence of miR-125b or a precursor thereof, and retaining the function of miR-125b, , or a precursor thereof, or the mutants containing a substrate vesicles derived osteoblasts was largely encompass than before transfection, osteoclastogenesis inhibitors and / or osteoclast function inhibitor.   An osteoclast formation promoting agent and / or an osteoclast function promoting agent comprising a miR-125b antisense inhibitor. A pharmaceutical composition for preventing and / or treating a bone disease, comprising the osteoclast formation inhibitor and / or the osteoclast function inhibitor according to any one of claims 1 to 3 .   A medicament for preventing and / or treating a disorder characterized by a decrease in bone mass, comprising the osteoclast formation inhibitor and / or the osteoclast function inhibitor according to any one of claims 1 to 3. Composition.   A pharmaceutical composition comprising the osteoclast formation promoter and / or the osteoclast function promoter according to claim 4, for preventing and / or treating a disease caused by a decrease in osteoclast function.   Culturing osteoblasts, osteoclast precursor cells or osteoclasts in the presence and absence of a test substance, and measuring the miR-125b amount of the cells under both conditions, wherein the miR Increasing or decreasing the amount of -125b as an indicator of the effect of the test substance on suppressing or promoting osteoclast formation and / or the effect of suppressing or promoting osteoclast function; and / or A method for screening a substance that suppresses or promotes a function.   Culturing osteoblasts in the presence and absence of a test substance, and measuring the uptake of miR-125b into matrix vesicles under both conditions; A substance that suppresses osteoclast formation and / or function, wherein the increase or decrease is used as an indicator of the action of the test substance to suppress or promote osteoclast formation and / or the action to suppress or promote osteoclast function. Or a method of screening a substance to promote.   Culturing osteoclast precursor cells or osteoclasts in the presence and absence of a test substance, treating the osteoclast precursor cells or osteoclasts with matrix vesicles, and Measuring the uptake of matrix vesicles into osteoclast precursor cells or osteoclasts, wherein the increase or decrease in uptake of matrix vesicles into the osteoclast precursor cells or osteoclasts is determined by the test. A method for screening a substance that suppresses or promotes osteoclast formation and / or function, which is used as an indicator of the action of suppressing or promoting the formation of osteoclasts and / or the action of suppressing or promoting osteoclast function. . An osteoblast is transfected with miR-125b or a precursor thereof, or a mutant having a sequence identity of 90% or more with the sequence of miR-125b or a precursor thereof and retaining the function of miR-125b. A method for producing an osteoclast formation inhibitor and / or an osteoclast function inhibitor containing the matrix vesicles, comprising isolating matrix vesicles from the osteoblasts. Insertion of miR-125b or a precursor thereof, or a mutant having 90% or more sequence identity with the sequence of miR-125b or a precursor thereof and retaining the function of miR-125b into the artificial substrate vesicle A method for producing an osteoclast formation inhibitor and / or an osteoclast function inhibitor containing the artificial matrix vesicles. For the manufacture of osteoclastogenesis inhibitory agent and / or osteoclast function inhibitor, (i) osteoblast-derived matrix vesicles or (ii) miR-125b,, or its precursor or miR-125b, Alternatively , use of a mutant having 90% or more sequence identity with the sequence of its precursor and retaining the function of miR-125b . Use of a miR-125b antisense inhibitor for the production of an osteoclast formation promoter and / or an osteoclast function promoter.