JP6292654B2 - Frozen foods using wheat flour prepared from wheat lacking two GBSSI and two SSIIa enzyme activities - Google Patents

Description

  The present invention is non-heated produced using wheat flour or starch prepared from wheat lacking enzyme activity of two granule-binding starch synthase I (GBSSI) and two starch synthase type IIa (SSIIa) It relates to frozen food for thawing.

  Starch is a mixture of two components: linear amylose in which glucose is linked by α-1,4 bonds and amylopectin having a branched structure via α-1,6 bonds. These components are synthesized by the action of various enzymes and accumulate in the endosperm portion of seeds in cereals.

  Amylose is synthesized mainly by granule-bound starch synthase (GBSS) encoded by the granule-bound starch synthase gene, and in wheat it is synthesized by granule-bound starch synthase I (GBSSI). Has been. There are three genomes of homologous chromosomes A, B, and D in the main common wheat chromosomes that are allogeneic hexaploids. In normal wheat, there are three GBSSI genes (Wx-A1 gene, Wx-B1 gene, Wx-D1 gene; GBSSI-A1 gene, GBSSI-B1 gene, GBSSI-D1 gene, respectively) ), Present on the 7A, 4A and 7D chromosomes, respectively. Granule-bound starch synthase (GBSSI-A1, GBSSI-B1, GBSSI-D1) is expressed from these genes. Some strains lack GBSSI enzyme activity due to mutations in genomic DNA. For example, in the known wheat varieties, “Hokushin” is GBSSI-B1 deficient (amylose content is slightly low), “Chikugoizumi” is GBSSI-A1, B1 deficient (low amylose content), “Hatsumochi” and “Hatsumochi” "Mochi Maiden" is a GBSSI all-deficient type (mochi and extremely low amylose content). As a method for easily identifying a GBSSI deletion pattern, a method for directly analyzing the presence or absence of each GBSSI protein in endosperm, a method for examining based on a genomic DNA sequence, and the like have been established (for example, Patent Document 1, Non-patent Document 1). (See Patent Document 2 and Non-Patent Document 3).

  On the other hand, amylopectin is synthesized by the action of a plurality of enzymes. These multiple enzymes are (soluble) starch synthase I (SSI), (soluble) starch synthase II (SSII), (soluble) starch synthase III (Starch Synthase) III; SSIII), branching enzyme (BE), debranching enzyme (DBE) and the like.

  In wheat, starch synthase type IIa (SSIIa) (SSIIa-A1, SSIIa-B1, SSIIa-D1), known as one of the enzymes involved in branched chain synthesis of amylopectin, is present on chromosomes 7A, 7B, and 7D It is encoded by three types of SSIIa genes (SSIIa-A1 gene, SSIIa-B1 gene, SSIIa-D1 gene). Regarding these SSIIa as well, there are strains that lack enzyme activity due to mutations that occurred on genomic DNA. For example, with known wheat varieties, `` Chosen57 '' is SSIIa-A1 deficient, `` Kanto 79 '' is SSIIa-B1 The deficient type “Turkey116” is the SSIIa-D1 deficient type. Regarding SSIIa, a method for identifying a defect pattern is known (Patent Document 2, Non-Patent Document 4).

  Starch is stored in plants in the form of highly crystallized granules. By adding moisture to this and heating, the starch granules gradually swell, and at a certain temperature, the crystal structure collapses and becomes a paste (gelatinization). Then, by cooling, the gelatinized starch gradually increases in viscosity and gels. It is known that the characteristics of such starch and the content ratio of amylose and amylopectin may vary greatly depending on the plant species from which they are derived.

  Starch is an important energy source for plants as well as an important energy source for humans. When starch is ingested, not only are the grains containing this processed but also used in foods, and the above-mentioned swelling and gelatinization characteristics are used to add foods such as thickeners, water retention agents, and gel formers. Used as an agent. On the other hand, it has been used for a long time as a raw material for pastes and films in fields other than food. In addition, there is a great demand for processed starches that have been chemically or physically modified. Starch occupies most of the weight of stored organs (seed and tubers), and if the starch characteristics change, the texture of the above foods using these organs as raw materials, or food addition using such starches Since the effect on the processability of foods with additives is great, there is a great demand for the development of starch with various characteristics.

  As described above, the characteristics of starch may vary greatly depending on the plant species. However, the diversity of starch within the same plant species is largely dependent on changes in physical properties due to differences in amylose content. For example, the amylose content of Hokushin and Chikugoizumi is significantly lower than the amylose content of wheat in which GBSSI is all wild type, and it is said that it is excellent for use as noodle flour such as udon. Has been. In addition, rice and corn have been known to accumulate glutinous starch with extremely low amylose content, but wheat is first bred by Nakamura et al. (Patent Document 1) to produce foods using ordinary wheat. It is known that it has unique processability and texture.

  In wheat starch, amylose content is often discussed as one of the indicators of starch characteristics, but the structure of amylopectin is relatively rarely discussed. Therefore, the difference in starch characteristics of wheat generally used in food is limited mainly to the difference in amylose content, and the variety in wheat starch characteristics is very limited. For this reason, if it is possible to develop wheat that accumulates starch with new characteristics, it will be possible to develop improved products with different characteristics from the conventional ones, or development of new applications. Development is highly desired.

  As an example of producing wheat having novel starch characteristics, Yamamori et al. Have reported that a wheat line completely lacking three SSIIa has been developed (see Non-Patent Document 1). It has been reported that amylose is accumulated in this wheat in a high content (hereinafter referred to as “high amylose wheat”), but the ratio of starch per seed weight is low, so that the yield of wheat flour obtained is low and the production in milling is low. Issues remain in terms of sex. Moreover, when wheat flour derived from high amylose wheat is used in the manufacture of processed foods such as bread, there is a problem that the product volume becomes extremely small, and it has not yet been put into practical use.

  On the other hand, when wheat flour derived from waxy wheat with all three GBSSI deficiencies is used in the manufacture of processed foods such as bread, the shape does not retain its shape after baking, the mouth melts poorly, the crispness becomes poor, etc. The problem remains in terms of. Therefore, it has not reached wide spread.

  Although wheat with novel starch properties as described above has been created, wheat with all GBSSI and SSIIa deficient still has many problems remaining for use in food processing. It is desired to produce wheat having practicality and novel starch characteristics.

  The inventors of the present application have provided GBSSI-A1, GBSSI-B1, GBSSI-D1, and SSIIa-A1, SSIIa-B1 for the purpose of providing wheat that accumulates starch with new characteristics by controlling the enzyme activity of GBSSI and SSIIa. , SSIIa-D1 6 types of enzyme deficient combinations of 63 combinations (excluding wild type) were used to produce wheat lines lacking enzyme activity and to analyze the characteristics of starch (Patent Document 3) . Patent Document 3 includes GBSSI-A (-) B (+) D (-) / SSIIa-A (+) B (-) D (-) and GBSSI-A (-) B (-) D (+) It is also described that two types of wheat strains lacking two GBSSI and two SSIIa were created, / SSIIa-A (+) B (-) D (-). However, the properties of these strains of starch have not been fully studied. In addition, wheat lines other than those described in Patent Document 3 lacking two of the three GBSSI and two of the three SSIIa have not been reported. . Of course, no effective use of these wheat lines has been developed, and frozen foods made from wheat lines lacking two GBSSI and two SSIIa are very good after thawing. That is not specifically disclosed.

JP-A-6-125669 Japanese Patent Laid-Open No. 2005-333832 International Publication WO2006 / 118300

Yamamori et. Al., Theor. Appl. Genet (2000) 101: 21-29 Nakamura et.al., Genome (2002) 45: 1150-1156 Saito et.al., Mol. Breed. (2009) 23: 209-217 Shimbata et. Al., Theor. Appl. Genet (2005) 111: 1072-1079

  An object of the present invention is to provide a novel means for improving the texture after freezing and thawing in a frozen food using wheat flour or starch as a raw material, compared to conventional products.

  The inventors of the present application newly created seven wheat lines lacking two of the three GBSSIs and two of the three SSIIa, preparing flour and starch and characterizing them. As a result of intensive research, wheat and starch derived from wheat lacking the enzyme activities of two GBSSI and two SSIIa are very suitable as raw materials for frozen foods. By using the wheat or starch derived from wheat as raw materials, Frozen food with excellent texture after freezing and thawing can be provided, especially when the food is thawed while avoiding heating at high temperatures, the texture after thawing is much superior to foods using conventional flour or starch. The present invention was completed.

That is, the present invention was produced by using, as a raw material, wheat flour obtained by milling a harvest of at least one wheat selected from the following wheat or the starch isolated from the harvest or the wheat flour, Provide frozen food for non-heated thawing.
(1) The enzyme activity of GBSSI-A1 is not deficient, the enzyme activity of GBSSI-B1 and GBSSI-D1 is deficient, and any two of SSIIa-A1, SSIIa-B1 and SSIIa-D1 Wheat lacking enzyme activity
(2) GBSSI-D1 enzyme activity is not deficient, GBSSI-A1 and GBSSI-B1 enzyme activity is deficient, and any two of SSIIa-A1, SSIIa-B1 and SSIIa-D1 Wheat Deficient in Enzyme Activity The present invention also provides flour for the production of frozen food for unheated thawing, comprising wheat flour obtained by milling at least one wheat crop selected from the above wheat To do. Furthermore, the present invention is separated from wheat flour obtained by milling a harvest of at least one wheat selected from the above wheat, and wheat flour obtained by milling the harvest or the harvest. Provided is a raw material for producing a non-heated and thawed frozen food containing at least one of starches.

  According to the present invention, the enzyme activity of any two of GBSSI-A1, GBSSI-B1, and GBSSI-D1 is lost, and any two of SSIIa-A1, SSIIa-B1, and SSIIa-D1 By using wheat flour or starch derived from wheat lacking enzyme activity as a raw material, the texture after thawing of frozen foods including processed wheat foods can be improved over conventional products. In the manufacturing process of frozen food, instead of conventional wheat flour or in combination with conventional wheat flour, only using the above-mentioned specific enzyme-deficient strain-derived flour or starch provides frozen food with excellent texture can do. Since it does not need to go through a special manufacturing process, it is very advantageous in large-scale production of frozen foods containing wheat. Moreover, in a general household, it is not necessary to thaw with a heating device and can be eaten easily.

It is the result of having evaluated the food texture (hardness) of the starch gel after freeze-thaw about the starch derived from the wheat system | strain used in the Example. It is the result of having evaluated the food texture (stickiness) of the starch gel after freeze-thawing about the starch derived from the wheat system | strain used in the Example. It is the result of having evaluated the food texture (sponge feeling) of the starch gel after freeze-thaw about the starch derived from the wheat system | strain used in the Example. It is the result of having evaluated the food texture (mouth melt) of the starch gel after freeze-thaw about the starch derived from the wheat system | strain used in the Example. It is the result of having evaluated the food texture (smoothness) of the starch gel after freeze-thawing about the starch derived from the wheat system | strain used in the Example. It is the result of having evaluated the food texture (roughness) of the starch gel after freeze-thawing about the starch derived from the wheat system | strain used in the Example. It is the result of having evaluated the texture (free feeling) of the starch gel after freeze-thaw about the starch derived from the wheat system | strain used in the Example. It is the result of having evaluated the food texture (freshness) of the starch gel after freeze-thawing about the starch derived from the wheat system | strain used in the Example. It is the result of having evaluated the food texture (moist feeling) of the starch gel after freeze-thaw about the starch derived from the wheat system | strain used in the Example. It is the result of having evaluated the texture (easiness of swallowing) of the starch gel after freeze-thaw about the starch derived from the wheat system | strain used in the Example. It is a graph which shows the result of having measured the water separation rate of the starch gel after freeze-thaw about the starch derived from the wheat system | strain used in the Example. It is the result of having evaluated the food texture of each udon after thawing | decompressing the udon produced using wheat origin (i), (x) and the wheat flour derived from (xviii) in frozen water after freezing. (A) Elasticity, (B) Stickiness, (C) Softness, (D) Slippery, (E) Slimy, (F) Feeling loose. It is the result of having evaluated the food texture of each bread after thawing | decompressing naturally at room temperature after freezing each bread produced using the wheat flour derived from wheat system | strain (i), (x) and (xviii). (A) Elasticity, (B) Stickiness, (C) Stickiness, (D) Softness, (E) Melting in the mouth, (F) Moist feeling, (G) Sweetness, (H) Puffy, (I) Fragrance.

  The wheat line used in the present invention lacks the enzyme activity of any two of the enzymes GBSSI-A1, B1, and D1 that synthesize amylose, and the enzymes SSIIa-A1, B1, and D1 that extend the branch chain of amylopectin. It is a strain lacking any two enzyme activities. In this specification, this strain is sometimes referred to as “2/2 deficient” for convenience. The 2/2 deficient is a wheat line created by the present inventors for the purpose of providing wheat that accumulates starch with new characteristics by controlling the enzyme activity of GBSSI and SSIIa. Of the 9 lines, GBSSI-A (-) B (+) D (-) / SSIIa-A (+) B (-) D (-) and GBSSI-A (-) B (-) D (+) / Specific examples of SSIIa-A (+) B (-) D (-) are described in International Publication No. WO2006 / 118300. The remaining seven lines described in the examples below are newly created lines.

  Regarding GBSSI, it is known that there is a significant difference in amylose content depending on the deletion pattern of three GBSSI. Wheat lines lacking the enzyme activity of one of the three GBSSIs have a slightly lower amylose content (somewhat called low amylose wheat) compared to wheat expressing all three, and lack two enzyme activities. If all three are missing, the wheat will not contain amylose. As for SSIIa, it is known that the chain length structure of amylopectin differs depending on the activity of the expressed enzyme. Wild type, strain lacking one of three SSIIa, two of three SSIIa There are differences between strains lacking the 3 and strains lacking all three SSIIa. In other words, both GBSSI and SSIIa have differences in characteristics between the lines lacking the two enzyme activities and the other lines, and the 2/2 deficients have common characteristics. Foods produced using 2 / 2-deficient wheat flour or starch as raw materials have a very good taste after freezing and thawing, and if 2 / 2-deficient wheat flour or starch is used, the food taste is excellent. These advantageous features are deficient in any two enzyme activities of the three GBSSI and any two enzyme activities of the three SSIIa. It is the feature brought about by.

  Among 2 / 2-deficients, wheat that lacks GBSSI-B1 and GBSSI-D1 enzyme activities and wheat that lacks GBSSI-A1 and GBSSI-B1 enzyme activities have an excellent taste after freezing and thawing Special features tend to be particularly strong. In particular, wheat-derived wheat flour and starch lacking GBSSI-B1 and GBSSI-D1 enzyme activities can be particularly preferably used as raw materials for frozen foods.

  In the process of heating and thawing frozen food, starch re-gelatinization occurs. If the food is thawed by non-heated thawing such as natural thawing or flowing water thawing without adding heat treatment such as microwave oven, boiling, baking, steaming, etc., the food being thawed is exposed to a temperature exceeding 30 ° C or 40 ° C. And re-gelatinization can be avoided. That is, the term “non-heated thawing” in the present invention typically means thawing without adding a heat treatment at a temperature at which re-gelatinization of starch may occur (for example, a temperature exceeding 30 ° C. or 40 ° C.). To do. Frozen foods produced using 2 / 2-deficient wheat flour or starch are superior to conventional frozen foods that use wheat or starch derived from wheat other than 2 / 2-deficient, whether heated or unheated. However, the difference from conventional frozen foods using wheat flour or starch is particularly remarkable in non-heated thawing.

  The kind of frozen food is not specifically limited, The food which contains the wheat processed food at least in part is included. Also included are foods that undergo freezing during manufacture or transportation, as well as those that are provided to the end consumer in a frozen state.

  Various types of frozen foods using flour or starch are known, and frozen foods obtained by freezing cooked foods and frozen foods (mainly used as cooking materials) that are frozen in the state before cooking. Any of them may be used in the present invention. For example, noodles such as udon and fried noodles (raw noodles or cooked noodles), bakery foods including breads, cakes and pizzas, fried foods such as tempura and fries (including flour or starch in clothes), dumplings and spring rolls -Frozen foods such as Chinese foods (including wheat flour or starch in the skin), buns (including wheat flour or starch in the skin), pie dough, bread dough, cookie dough, etc.

  The sequences of wheat GBSSI-A1, B1, D1 and SSIIa-A1, B1, D1 (genomic DNA, protein) are known and are registered in GenBank with the following accession numbers. Each of these sequences is shown in the Sequence Listing as shown in Table 1 below.

  Of course, the sequences shown in the sequence listing are examples of wild-type sequences. In naturally occurring wheat (including commonly distributed wheat varieties), each enzyme protein has a normal activity, but its nucleotide sequence or amino acid sequence. There may also be some differences in sequence. In the present invention, in the case of “GBSSI-A1 gene” and “GBSSI-A1 protein”, not only those having completely the same sequence as the base sequence or amino acid sequence shown in the sequence listing, but also natural proteins that do not impair the enzyme activity. Those having sequences containing mutations are also included. The same applies to other enzymes. Such natural mutant sequences usually have 90% or more, eg, 95% or more, or 98% or more identity with each base sequence or amino acid sequence shown in the sequence listing.

  “Deficient in enzyme activity” means that the protein having normal enzyme activity is not functioning in the plant body, for example, a protein having normal enzyme activity is not expressed. More specifically, mutations in gene sequences (mutations such as substitution, deletion, insertion, inversion, translocation, etc. of one or more bases, including deletion of the entire gene region), mRNA transcription defects , Protein translation defects, inhibition of enzyme activity in wheat plants, and the like. In the present invention, as long as the enzyme activity is reduced or deleted to less than 10%, preferably less than 5%, more preferably less than 1% of the activity of each wild-type enzyme, Good. Most preferably, the 2/2 deficient does not accumulate in the cell any two of the three GBSSI and any two of the three SSIIa, and the activity of each enzyme Wheat that has been completely lost, more specifically wheat that does not express two GBSSI and two SSIIa.

  SSIIa is generally used for the synthesis of amylopectin branched chains (glucose polymers branched by α-1,6 bonds), especially for the synthesis of medium-degree-of-polymerization chains (chains with a degree of polymerization of about 11 to 25). It is thought to be involved. Therefore, the enzyme activity of SSIIa can be considered as the activity of recognizing ADP-glucose and amylopectin as substrates and binding glucose from ADP-glucose to the end of the amylopectin branch chain. On the other hand, GBSSI is basically considered to be involved in amylose synthesis. Therefore, the enzyme activity of GBSSI can be considered to be a function of recognizing ADP-glucose and amylose as substrates and adding glucose from ADP-glucose to the end of amylose during elongation.

  Therefore, the enzyme activity of GBSSI-A1, B1, D1 and SSIIa-A1, B1, D1 can be confirmed by examining the above-mentioned activity by a conventional method. For example, the enzyme is purified from seeds, and the reaction is performed by adding ADP- [U-14C] glucose, amylose or amylopectin as a substrate, and further components for adjusting reaction conditions. After the reaction for a certain period of time, the enzyme is inactivated by heating to 100 ° C, and unreacted ADP- [U-14C] glucose is removed using an anion exchange column, which is then incorporated into amylose or amylopectin. The amount of [U-14C] glucose is measured using a liquid scintillation counter. As another method, the protein fraction roughly purified from the seed or the starch fraction (5-10 μg in protein content) is unmodified {from normal SDS-polyacrylamide gel electrophoresis (SDS-PAGE) to SDS Perform polyacrylamide gel electrophoresis under conditions excluding β-mercaptoethanol}. The gel after separation is dipped in a solution consisting of 50 mM glycine, 100 mM ammonium sulfate, 5 nM β-mercaptoethanol, 5 mM MgCl2, 0.5 mg / ml bovine serum albumin, 0.01 mg / ml amylose or amylopectin, 4 mM ADP-glucose, and 4 Leave for 12 hours from time. Thereafter, a method may be used in which staining is performed by adding a solution comprising 0.2% iodine and 0.02% potassium iodide to determine enzyme activity.

  Whether or not the enzyme activity is deficient can be confirmed, for example, by measuring enzyme activity, measuring the amount of enzyme protein accumulated, measuring the amount of mRNA expression, confirming the base sequence of genomic DNA, and the like.

  The method for confirming whether the enzyme activity is strong or weak is the same as the above-described method for carrying out the reaction by adding ADP- [U-14C] glucose, amylose or amylopectin serving as a substrate, and further components for adjusting reaction conditions.

  Confirmation that enzyme protein is not accumulated in wheat plant cells (more specifically, enzyme protein is not expressed) is performed by SDS-PAGE or two-dimensional electrophoresis of wheat seed or purified starch. be able to. The size of the band confirmed by SDS-PAGE is 115 kDa for SSIIa-A1, 100 kDa for SSIIa-B1, and 108 kDa for SSIIa-D1, and Non-Patent Document 1 describes a method for confirming the presence or absence of expression. ing. In addition, for GBSSI, the size of the band confirmed by SDS-PAGE for all GBSSI-A1, B1, and D1 is approximately 61 kDa, and in particular, it may be difficult to distinguish between the GBSSI-B1 and GBSSI-D1 bands. Rather than determining the presence or absence of expression by SDS-PAGE, the method of confirming by two-dimensional electrophoresis of starch-binding protein described in Patent Document 1 is suitable. The detailed method is as described in Patent Document 1, and it is only necessary to confirm whether or not there is a spot in the region that appears in the wild type.

  The deficiency in enzyme activity can also be confirmed by examining whether there is a mutation on the genomic DNA that causes loss of enzyme activity. In particular, when an enzyme deletion mutation is caused by mutagenesis treatment such as irradiation or exposure to a mutagenic chemical substance, a mutation involving amino acid substitution of only one residue may occur. In such a case, it is often difficult to identify by a method such as SDS-PAGE for examining the presence or absence of an enzyme protein. Therefore, a method for confirming a mutation on DNA is suitable. In the case of SSIIa, mutations in genomic DNA that cause loss of enzyme activity are mutations in the recognition / binding sites of ADP-glucose and amylopectin, which are enzyme substrates, or active centers that transfer glucose to the non-reducing end of amylopectin Examples include mutation at a site, or mutation at a signal sequence site at the N-terminus. In GBSSI, mutations in genomic DNA that cause loss of enzyme activity are mutations in the recognition / binding sites of ADP-glucose and amylose, which are enzyme substrates, or active centers that transfer glucose to the non-reducing end of amylose. Examples include mutation at the site.

  As a primer for investigating whether there exists a variation | mutation on genomic DNA which loses GBSSI enzyme activity, the primer (sequence number 13-19) used in the following Example can be mentioned, for example. This is also described in Non-Patent Document 2 and Non-Patent Document 3. The criteria for determining whether there is a mutation on the genomic DNA that causes the loss of enzyme activity is as described in Table 2 in the Examples below. When nucleic acid amplification methods such as PCR are performed using these primers, enzyme-deficient mutations in the known wheat variety “Moto Otome” (deficient in three GBSSIs) can be detected. Therefore, when the GBSSI-deficient mutation of the 2/2 deficient used in the practice of the present invention is derived from `` Mochi Otome '' or from other varieties having the same GBSSI deficiency as `` Mochi Otome '', the sequence Defects can be confirmed using primers numbered 13-19.

  Moreover, as a primer for investigating whether there exists a variation | mutation on genomic DNA which loses SSIIa enzyme activity, the primer (sequence number 20-25) used in the following Example can be mentioned, for example. . This is also described in Non-Patent Document 4. The criteria for determining whether or not there is a mutation on the genomic DNA that causes loss of enzyme activity is as described in Table 2 in the Examples below. When nucleic acid amplification methods such as PCR are performed using these primers, the known wheat varieties “Chosen57” (SSIIa-A1 deficient type), “Kanto 79” (SSIIa-B1 deficient type) and “Turkey116” (SSIIa- The enzyme-deficient mutation of (D1-deficient type) can be detected. Therefore, when the SSIIa-deficient mutation of the 2/2 deficient used in the practice of the present invention is derived from the above cultivar, or from other varieties having the same SSIIa deficiency as the above cultivar, SEQ ID NOs: 20 to 25 The deficiency can be confirmed using these primers.

  The 2/2 deficient used in the present invention can be produced by crossing known wheat varieties lacking any combination of the six enzymes as described in the Examples below. Radiation treatment (γ rays, β rays, X-rays, neutron rays, etc.), chemical substance treatment (ethyl methanesulfonic acid, etc.) and other mutagenesis treatments may be performed, and the desired enzyme deficient may be selected and used for mating . In addition, various methods for producing monocotyledonous transformants are known, and genetic engineering techniques for deleting the function of the target gene are also known. For example, there is a method of inhibiting the expression of a target gene by RNAi or an antisense method, and a gene disruption method for destroying only a target gene in a plant is also known (Proc. Natl. Acad. Sci. USA ( 2010) June 29, 107 (26): 12034-12039). Therefore, the wheat line used in the present invention can also be produced by genetic engineering techniques.

  In the 2/2 deficient used in the present invention, the genetic traits other than the deficiency in GBSSI and SSIIa enzyme activities are not particularly limited, and those having other traits introduced therein are also included. For example, useful traits such as disease resistance, gluten suitability, lodging resistance, autumn sowing ability, spring sowing ability, high yield, low temperature tolerance, ear germination tolerance, milling suitability, and two GBSSI and two SSIIa enzyme activities It may be a wheat having a combination of defects.

  The wheat flour used in the production of the frozen food of the present invention can be obtained by milling a 2 / 2-deficient harvest (fruit or seed). The milling method is not particularly limited, and a general milling method used when producing wheat flour from a harvest of a conventional wheat variety can be used. The form of the wheat flour is not particularly limited, and may be, for example, wheat flour obtained by removing components such as “Bran” through a normal milling process, or whole wheat flour that is not fractionated.

  The starch can be obtained by extraction and separation by a conventional method from a 2 / 2-deficient harvest or wheat flour obtained by milling the harvest. Starch derived from 2/2 deficient has very good physical properties after freezing and thawing, and excellent texture compared to those derived from other strains with different combinations of GBSSI and SSIIa deficiency patterns. Yes. Therefore, like 2 / 2-deficient wheat flour, 2 / 2-deficient starch is very good as a raw material for frozen foods.

  For the production of frozen foods, only the 2 / 2-deficient wheat flour may be used as the flour raw material, or other flours may be mixed with the 2 / 2-deficient wheat flour. “Other flours” include flours derived from other wheat lines (including those not defective in GBSSI and SSIIa) with different GBSSI and SSIIa defect patterns, and flours prepared from grains other than wheat ( For example, rye flour, rice flour, etc.) are included. In addition, the 2 / 2-deficient wheat flour itself may be a single type of 2 / 2-deficient wheat flour or a mixture of two or more 2 / 2-deficient wheat flours. Also good. The blending ratio of flour can be selected as appropriate. Therefore, flour for producing frozen food for non-heated thawing containing flour obtained by milling a 2 / 2-deficient harvest is only from one or more 2 / 2-deficient wheat flours. Or a mixture of one or two or more 2 / 2-deficient wheat flours and at least one other flour.

  In addition, when starch is used as a raw material for frozen foods, only starch derived from 2/2 deficients may be used as a starch raw material, or starch derived from other wheat having different GBSSI and SSIIa deficiency patterns, It may be used by mixing with starch derived from plants other than wheat. As the starch derived from the 2/2 deficient, only one type of 2/2 deficient derived starch may be used, or two or more types of 2/2 deficient derived starch may be mixed and used. Accordingly, one or two or more kinds of starch for producing a non-heat-frozen frozen food containing a 2 / 2-deficient crop or starch isolated from the flour obtained by milling the crop is used. / 2 deficient derived starch only, or one or more 2/2 deficient derived starches and other wheat derived starches and starches derived from plants other than wheat It may be a mixture with at least one selected starch.

  The raw material for producing the non-heated and thawed frozen food contains the above-mentioned flour for producing the non-heated and thawed frozen food or starch for producing the non-heated and thawed frozen food. For example, the raw material is a raw material containing both a 2 / 2-deficient wheat flour and a 2 / 2-deficient starch; a wheat flour other than a 2 / 2-deficient material or a flour other than a wheat flour, and a 2 / 2-deficient material A raw material containing starch derived from the body; or a raw material containing wheat flour derived from 2/2 deficient and wheat derived starch other than 2/2 deficient or starch derived from plants other than wheat.

  Hereinafter, the present invention will be described more specifically based on examples. However, the present invention is not limited to the following examples.

[Creation of wheat line]
Wheat lines lacking two GBSSI and two SSIIa were created using the following two lines as parent lines.
Parent line 1:
“Kanto 79” (SSIIa-B1 deficient type) and foreign varieties “Turkey116” (SSIIa-D1 deficient type) and “Chosen57” (SSIIa-A1 deficient type) were crossed and selected in sequence. A strain completely deficient in SSIIa.
Parent line 2:
Mice Otome (all GBSSI-deficient type, SSIIa protein is wild-type) and Kestrel were crossed and selected from the seeds of the F5 generation, GBSSI-deficient line.

  Wheat cultivation and mating followed the standard method. The above parent lines 1 and 2 were crossed to obtain the F1 generation. This was self-fertilized to obtain F2 or later generations. From these progenies, genotypes of GBSSI and SSIIa genes were determined by PCR, and a desired wheat line was selected. The specific method of genotype confirmation by PCR is as follows.

  Wheat seeds were germinated, and genomic DNA from young leaves was purified using a DNeasy plant mini kit manufactured by Qiagen. 100 mg of germinated seed young leaves were ground in liquid nitrogen until powdered. The ground sample was transferred to a 1.5 ml tube, and then buffer AP1 and RNase solution attached to the kit were added and heated at 65 ° C. for 10 minutes. Next, buffer AP2 was added and allowed to stand on ice for 5 minutes, and then the deposited precipitate was removed by centrifugation. After adding buffer AP3 to the supernatant and mixing, the entire amount was applied to a mini spin column, and centrifuged to adsorb the DNA to the membrane. After washing with buffer AW twice, buffer AE was added and allowed to stand for 5 minutes, and the DNA solution was collected by centrifugation.

The following primers were used for PCR.
GBSSI-A1 gene confirmation primer:
AFC: TCGTGTTCGTCGGCGCCGAGATGG (SEQ ID NO: 13)
AR2: CCGCGCTTGTAGCAGTGGAAGTACC (SEQ ID NO: 14)
GBSSI-B1 gene confirmation primer:
BDFL: CTGGCCTGCTACCTCAAGAGCAACT (SEQ ID NO: 15)
BRC1: GGTTGCGGTTGGGGTCGATGAC (SEQ ID NO: 16)
BFC: CGTAGTAAGGTGCAAAAAAGTGCCACG (SEQ ID NO: 17)
BRC2: ACAGCCTTATTGTACCAAGACCCATGTGTG (SEQ ID NO: 18)
GBSSI-D1 gene confirmation primer:
BDFL: CTGGCCTGCTACCTCAAGAGCAACT (SEQ ID NO: 15)
DRSL: CTGTTTCACCATGATCGCTCCCCTT (SEQ ID NO: 19)
SSIIa-A1 gene confirmation primer:
SSIIAF1: GCGTTTACCCCACAGAGC (SEQ ID NO: 20)
SSIIAR1: ACGCGCCATACAGCAAGTCATA (SEQ ID NO: 21)
SSIIa-B1 gene confirmation primer:
SSIIBF1: ATTTCTTCGGTACACCATTGGCTA (SEQ ID NO: 22)
SSIIBR1: TGCCGCAGCATGCC (SEQ ID NO: 23)
SSIIa-D1 gene confirmation primer:
SSIIDF1: GGGAGCTGAAATTTTATTGCTTATTG (SEQ ID NO: 24)
SSIIDR1: TCGCGGTGAAGAGAACATGG (SEQ ID NO: 25)

For PCR reaction for GBSSI gene confirmation, 10 × Taq buffer 5 μL, dNTP final concentration 0.2 mM, Mg (Cl) ₂ final concentration 1.5 mM, each primer final concentration 0.2 μM, genomic DNA final concentration 2 ng / μL, Taq polymerase (Takara Bio Inc.) was used at a final concentration of 0.05 U / μL in a total volume of 50 μL. GeneAmp PCR System 9700 (Applied Biosystems) was used, and the reaction conditions were 95 ° C for 5 minutes-[95 ° C for 30 seconds-65 ° C for 30 seconds-72 ° C for 2 minutes] x 32 cycles-72 ° C for 7 minutes.

PCR reaction for SSIIa gene confirmation: 10 μL LA Taq buffer 2 μL, dNTP final concentration 0.2 mM, Mg (Cl) ₂ final concentration 2.25 mM, each primer final concentration 0.25 μM, genomic DNA final concentration 1 ng / μL LA Taq (Takara Bio Inc.) was performed at a final concentration of 0.025 U / μL in a total volume of 20 μL. GeneAmp PCR System 9700 (Applied Biosystems) was used, and the reaction conditions were 98 ° C for 5 minutes-[98 ° C for 30 seconds-65 ° C for 30 seconds-74 ° C for 1 minute] x 40 cycles-74 ° C for 5 minutes.

  The PCR amplification reaction solution was subjected to electrophoresis on a 3% agarose gel, followed by ethidium bromide staining, and the genotype was determined as follows based on the size of the amplification band.

  After confirming the above, wheat lines having various genotypes were selected. In the following experiments, wheat lines selected as described above and commercially available wheat varieties (Table 3) were used.

[Preparation of wheat flour and whole grains]
The harvested wheat was added with water to 14% and left overnight, and then ground in a test mill manufactured by Buehler or Brabender. In the case of grinding with a tester manufactured by Buehler, flour obtained from 1B, 2B, 3B, 1M, 2M, and 3M ports was mixed to obtain flour. When ground with a Brabender test mill, the first and second flours were combined to obtain flour. The harvested wheat was prepared into whole grains using an ultracentrifugal mill ZM 200 (Retsch). The rotor speed was 14,000 rpm and the screen was 0.75 mm with a trapezoidal hole.

[Purification of starch from wheat flour]
Starch was purified from the above flour as follows. Water of 0.5 times the weight of the flour was added, kneaded well to prepare a dough, and immersed in cold water for 1 hour. After that, the dough was kneaded in water to extract starch. The starch suspension was centrifuged at 2,070 × g for 10 minutes, and the supernatant was removed. Contaminants such as pentozan precipitated on the upper layer of the starch were removed. This operation was repeated to wash the starch. This starch was lyophilized to obtain purified starch. Moreover, the water content of the purified starch was measured and the dry matter weight was determined.

[Measurement of amylose content]
Amylose content was measured using purified starch. Using AMYLOSE / AMYLOPECTIN ASSAY KIT (Megazyme), the measurement was performed according to the procedure manual of the kit. The results are shown in Table 4 below.

[RVA measurement]
Viscosity characteristics were measured using a rapid visco analyzer (RVA) using the prepared whole grain powder. The model RVA-4 manufactured by NEWPORT SCIENTIFIC was used as the apparatus, and the measurement was performed with the STD3 program according to the official method (AACC method 76-21) for wheat flour determined by the American Grain Society. However, 1 mM silver nitrate aqueous solution was used instead of water. The results are shown in Table 4 below.

[Physical property evaluation of starch gel after freezing and thawing]
A starch gel was prepared using the purified starch, and physical properties after freeze-thawing were evaluated. A starch suspension was prepared by adding water to 10% (w / w) on a dry weight basis and sealed in a nylon pack. The nylon pack was placed in a 65 ° C. water bath for 15 minutes and then gelatinized by heating in boiling water for 20 minutes. After gelatinization, the starch gel was cooled at 25 ° C. for 1 hour, further cooled sufficiently at 4 ° C., and then frozen by placing it at −30 ° C. for 5 hours. Thereafter, it was allowed to stand at 4 ° C. for 3 hours and at 25 ° C. for 1 hour to completely thaw. This was again frozen at −30 ° C. for 12 hours, and thawed by leaving at 4 ° C. for 3 hours and at 25 ° C. for 1 hour.

  The texture of the starch gel that had been frozen and thawed under the above conditions was evaluated in five levels according to the following items and evaluation criteria by six panelists, and the average value for each item was calculated.

  The results of sensory evaluation are shown in FIGS. Compared to other strains, the 2 / 2-deficient starch gel has a smooth and moderate viscosity, and the starch is extremely deteriorated. I could hardly feel it. There was a tendency that the results of sensory evaluation were particularly excellent in starch gels of strains having genotypes of GBSSI gene A (+) B (-) D (-). Thus, the 2/2 deficient starch gel had significantly better overall properties than the other strains.

  Therefore, due to the characteristics of the texture after freezing and thawing, 2 / 2-deficient starch or wheat flour is one of the materials such as frozen foods that need to be frozen in production, distribution, sales, storage after purchase, etc. If it is used for the part, it is expected that a product with excellent texture after thawing can be developed.

  Furthermore, even when 2 / 2-deficient starch or flour is used as a part of a food material that does not need to be frozen in production, distribution, sales, etc., especially when frozen in storage after the purchase of food. It is expected that a product excellent in texture after thawing can be developed when stored frozen for a long period of time.

[Measurement of water separation rate of starch gel after freezing and thawing]
Using the purified starch, the water separation rate of the starch gel after freeze-thawing was measured. A starch suspension was prepared by adding water to 8% (w / w) on a dry matter basis and sealed in a nylon pack. The nylon pack was placed in a 65 ° C. water bath for 15 minutes, and then starch was gelatinized by heating in boiling water for 20 minutes. After gelatinization, the starch gel was cooled for 1 hour at 25 ° C and frozen by placing it at -30 ° C for 5 hours. Then, it was defrosted by placing it at 25 ° C. for 1 hour 30 minutes, frozen again by placing it at −30 ° C. for 14 hours, and then thawed by placing it at 25 ° C. for 1 hour 30 minutes.

The starch gel subjected to the above steps was wrapped in a nylon mesh. The nylon mesh was fixed to the upper end of a 50 ml plastic tube, so that the gel and water separated from the water by centrifugation were reliably separated. In this state, centrifugation was performed at 100 × g for 5 minutes. The separated water weight was measured, and the water separation rate was calculated from the weight ratio with respect to the starch gel used for centrifugation. The following formula was used to calculate the water separation rate (%).
Water separation rate (%) = Weight of separated water (g) ÷ Weight of starch gel used for centrifugation (g) x 100

  The results are shown in FIG. Generally, starch that is easily degraded by freezing and thawing has more water separated, so measurement of water separation rate is an indicator of the degree of degradation. The 2 / 2-deficient starch gel has an extremely low water separation rate compared to other types of starch, and it can be said that the state of the starch gel after freeze-thawing is very good.

  Therefore, from the characteristics of the water separation rate of such a freeze-thawed starch gel, frozen foods that require 2 / 2-deficient starch or flour to be frozen during production, distribution, sale, storage after purchase, etc. If it is used as a part of the material, it is expected that a product excellent in texture after thawing can be developed.

  Furthermore, even when 2 / 2-deficient starch or flour is used as a part of a food material that does not need to be frozen in production, distribution, sales, etc., especially when frozen in storage after the purchase of food. It is expected that a product excellent in texture after thawing can be developed when stored frozen for a long period of time.

[Frozen food processing test 1]
Udon was produced using 2 / 2-deficient wheat flour, and the texture after freezing and thawing was evaluated. Line (i) was used as 2 / 2-deficient wheat flour, and lines (x) and (xviii) were used as control flour. The wheat flour was tested for moisture correction on a 13.5 mass% basis. The method of water correction when the water content of the flour is m% by mass is as follows.
Actual amount of flour used (unit: parts by mass) = 100 × (100-m) / (100-13.5)
Actual amount of water used (unit: parts by mass) = (100 + amount of water)-Actual amount of flour used

The process for producing udon is as follows.
1. 4 parts by mass of sodium chloride and 38 parts by mass of water were added to 100 parts by mass of wheat flour and mixed for 13 minutes under reduced pressure of 700 mHg to obtain a dough. 1. Actual amount of water used (unit: parts by mass) = (100 + 38) −actual amount of flour used The dough was shaped once with a noodle roll, twice combined, and rolled three times. The final noodle strip thickness was 2.5 mm, and the noodle strip was cut with No. 10 (corner) incisors. The length of the noodle strings was about 25 cm.
3. The noodle strings are boiled for about 15 times the mass of the noodle strings with water (pH adjusted to 5.5-6.0) for 13 minutes, fastened with cold water, and rapidly frozen at -40 ° C. to obtain frozen noodles. . Then, after storing at −20 ° C. for 20 hours, the frozen noodles were thawed in running water.

A taste test was performed on the udon after thawing. Various items such as hardness and stickiness were evaluated by 10 panelists, and the average value for each item was calculated.
Elasticity: Not elastic (1 point) to very elastic (5 points)
Stickiness: Not sticky (1 point)-Strongly sticky (5 points)
Soft: no soft (1 point) to very soft (5 points)
Tsurumi: No Tsurumi (1 point) ~ Very Tsurumi (5 points)
Slimy: No sliminess (1 point) ~ Very slimy (5 points)
Looseness: No sensation (1 point) ~ Very voluminous (5 points)

  The results of sensory evaluation are shown in FIGS. Udon made with the 2 / 2-deficient wheat of line (i) had almost no looseness even after freezing and thawing, and was excellent in elasticity, stickiness, sag, and the like.

[Frozen food processing test 2]
Using 2 / 2-deficient wheat flour, bread was produced and the texture after freezing and thawing was evaluated. Line (i) was used as 2 / 2-deficient wheat flour, and lines (x) and (xviii) were used as control flour. The bread was manufactured as follows. Each bread after production was stored at −30 ° C. for 20 hours and frozen, and then naturally thawed at room temperature to conduct a taste test. Ten panelists evaluated various items such as elasticity and stickiness in five levels, and calculated the average value for each item.

How to make bread:
Using an automatic home bakery (MK Seiko Co., Ltd.), bread was prepared using the “bread bread course” program. It was prepared with the formulation shown below.
190 ml of water
280g flour
20 g sugar
Salt 4 g
Shortening 20 g
Nonfat dry milk 6 g
Dry yeast 2.4 g

Sensory evaluation score criteria:
Elasticity: Not elastic (1 point) to very elastic (5 points)
Stickiness: Not sticky (1 point)-Strongly sticky (5 points)
Sticky feeling: No sticky feeling (1 point) ~ Very sticky (5 points)
Soft: no soft (1 point) to very soft (5 points)
Melting in the mouth: Melting in the mouth is very bad (1 point)-Melting in the mouth is very good (5 points)
Moist feeling: No moist feeling (1 point) ~ Very moist (5 points)
Sweetness: no sweetness (1 point) ~ very sweet (5 points)
Pasaki: No crispness (1 point) ~ Very crisp (5 points)
Fragrance: No fragrance (1 point) ~ Very fragrant (5 points)

  The results of sensory evaluation are shown in FIGS. The bread produced with the wheat flour of line (i), which is a 2/2 deficient, had almost no crust even after freezing and thawing, and was excellent in elasticity, stickiness, stickiness, moist feeling and the like.

Claims (4)

Non-heat-freezing refrigeration produced using wheat flour obtained by milling at least one wheat crop selected from the following wheat or the starch isolated from the crop or the wheat flour as a raw material Food.
(1) The enzyme activity of GBSSI-A1 is not deficient, the enzyme activity of GBSSI-B1 and GBSSI-D1 is deficient, and any two of SSIIa-A1, SSIIa-B1 and SSIIa-D1 Wheat lacking enzyme activity
(2) GBSSI-D1 enzyme activity is not deficient, GBSSI-A1 and GBSSI-B1 enzyme activity is deficient, and any two of SSIIa-A1, SSIIa-B1 and SSIIa-D1 Wheat lacking enzyme activity The wheat, the GBSSI-A1 and SSIIa-A1 enzyme activity not lacking, GBSSI-B1, GBSSI-D1 , SSIIa-B1 and SSIIa-D1 of claim 1 wherein the enzyme activity is deficient wheat Frozen food. Flour for producing frozen food for non-heated thawing, comprising wheat flour obtained by milling at least one wheat harvest selected from the following wheat .
(1) The enzyme activity of GBSSI-A1 is not deficient, the enzyme activity of GBSSI-B1 and GBSSI-D1 is deficient, and any two of SSIIa-A1, SSIIa-B1 and SSIIa-D1 Wheat lacking enzyme activity
(2) GBSSI-D1 enzyme activity is not deficient, GBSSI-A1 and GBSSI-B1 enzyme activity is deficient, and any two of SSIIa-A1, SSIIa-B1 and SSIIa-D1 Wheat lacking enzyme activity Wheat flour obtained by milling at least one wheat crop selected from the following wheat, and at least one of starch obtained from the crop or wheat flour obtained by milling the crop A raw material for producing frozen food for non-heated thawing, including one.
(1) The enzyme activity of GBSSI-A1 is not deficient, the enzyme activity of GBSSI-B1 and GBSSI-D1 is deficient, and any two of SSIIa-A1, SSIIa-B1 and SSIIa-D1 Wheat lacking enzyme activity
(2) GBSSI-D1 enzyme activity is not deficient, GBSSI-A1 and GBSSI-B1 enzyme activity is deficient, and any two of SSIIa-A1, SSIIa-B1 and SSIIa-D1 Wheat lacking enzyme activity