JP5937029B2 - TRAIL expression enhancer - Google Patents

Description

  The present invention relates to an agent for enhancing the expression of TRAIL (tumor necrosis factor-related apoptosis-inducing ligand), which is a cytokine involved in autoimmune inflammation.

  TRAIL is a cytokine that belongs to the TNF (tumor necrosis factor) superfamily and is a ligand recognized by the death receptor that induces apoptosis in cells. Other typical molecules classified as death ligands include TNF-α (tumor necrosis factor-α) and FasL (Fas ligand). In addition to apoptosis-inducing action, TRAIL has an action of suppressing the proliferation of autoimmune inflammatory cells. For example, Non-Patent Document 1 discloses the administration of recombinant TRAIL in experimental autoimmune thyroiditis. It has been reported that its symptoms improve. Non-patent document 2 reports that the symptoms of experimental autoimmune encephalomyelitis are improved by administration of recombinant TRAIL.

Wang SH, Cao Z, Wolf JM, Van Antwerp M, Baker JR Jr. Death ligand tumor necrosis factor-related apoptosis-inducing ligand inhibits experimental autoimmune thyroiditis. Endocrinology. 2005 Nov; 146 (11): 4721-6. Epub 2005 Aug twenty five. Cretney E, McQualter JL, Kayagaki N, Yagita H, Bernard CC, Grewal IS, Ashkenazi A, Smyth MJ. TNF-related apoptosis-inducing ligand (TRAIL) / Apo2L suppresses experimental autoimmune encephalomyelitis in mice.Immunol Cell Biol. 2005 Oct; 83 (5): 511-9.

  However, the method of administering recombinant TRAIL has not always been able to fully exert the original action of TRAIL. Accordingly, an object of the present invention is to provide a TRAIL expression enhancer capable of enhancing the TRAIL expression ability inherent in cells safely and without side effects.

  The inventors of the present invention have intensively studied to achieve the above object and have completed the present invention. That is, the present invention is as follows.

[1] A TRAIL expression enhancer comprising a culture composition obtained from a culture of Aureobasidium pullulans as an active ingredient.
[2] The TRAIL expression enhancer according to [1], which is used for prevention or improvement of autoimmune inflammation.

  According to the present invention, since the culture composition obtained from the culture of Aureobasidium pullulans is used as an active ingredient for enhancing TRAIL expression, the TRAIL expression ability inherent in the cells is enhanced safely and without side effects. can do. Therefore, it is useful for preventing or improving autoimmune inflammation.

FIG. 1A shows the results of analysis of TRA26, TNF-α, and FasL mRNA-inducing ability of β-glucan produced by Aureobasidium pullulans in RAW264.7 cells, and FIG. 1B shows TRAIL, TNF-α, FIG. 1C shows the results of analysis of TRAIL, TNF-α, and FasL mRNA induction ability of Lipopolysaccharide (LPS) in RAW264.7 cells. is there. It is the result of having analyzed the ability to induce TRAIL protein expression by β-glucan produced by Aureobasidium pullulans in RAW264.7 cells. FIG. 3A shows the results of analysis of TRAIL mRNA-inducing ability in β-glucan, barley-derived β-glucan or baker's yeast-derived β-glucan produced by Aureobasidium pullulans in RAW264.7 cells, and FIG. It is the result of analyzing the mRNA inducing ability of TRAIL by β-glucan, β-glucan derived from barley, or β-glucan derived from baker's yeast in THP-1 macrophage-like cells.

  In the present invention, a culture composition obtained from a culture of Aureobasidium pullulans is used as an active ingredient of a TRAIL expression enhancer. This culture composition is rich in β-glucan produced by Aureobasidium pullulans during its growth. As shown in Examples described later, β-glucan produced by Aureobasidium pullulans is excellent in the effect of enhancing the expression of TRAIL.

  The culture composition obtained from the culture of Aureobasidium pullulans (hereinafter referred to as “Aureobasidium-derived culture composition”) used as an active ingredient of the present invention includes Aureobasidium pullulans (Aureobasidium pullulans). ), A culture solution obtained by separating and removing cells by centrifugation, a concentrated solution of the culture solution, a diluted solution of the culture solution, or a solid product obtained by removing moisture from the culture solution. . In addition to these, a culture composition in which the content of β-glucan is increased by removing low-molecular impurities by ultrafiltration or hydrous ethanol precipitation or by other known fractionation means is also included. It is. The culture of Aureobasidium pullulans is used as a food additive such as a thickening stabilizer and has high safety.

  When purified β-glucan is used as the above-mentioned aureobasidium-derived culture composition, for example, after removing insoluble matter by filtering the culture of Aureobasidium pullulans through diatomaceous earth or the like, powdered activated carbon Etc. are used to adsorb and remove low molecular weight compounds, which are ultrafiltered through an ultrafiltration membrane with a molecular weight cut off of 5,000 to 5,000,000, more preferably a molecular weight cut off of 500,000 to 2,000,000. A product obtained by precipitating β-glucan collected in the fraction with water-containing ethanol can be used as purified β-glucan.

  The aureobasidium-derived culture composition used in the present invention is a β-glucan produced by culturing Aureobasidium pullulans, converted to a content of 100 g of the culture, The content is preferably 50 to 3,000 mg, more preferably 100 to 2,000 mg. Moreover, when using purified β-glucan as the aureobasidium-derived culture composition, the β-glucan purity is preferably 80 to 100% by mass, and more preferably 95 to 100% by mass.

In addition, determination of content of (beta) -glucan can be performed by the following methods, for example. That is, the culture solution is subjected to an enzyme treatment using amylase, amyloglucosidase, protease, or the like, and an α-glucan such as protein or pullulan is removed, followed by ethanol precipitation. Further, it is filtered through a glass filter to obtain a polymer sample. At this time, in order to remove low-molecular substances containing monosaccharides, the cells are thoroughly washed with 80% ethanol. The washed polymer sample is further washed with acetone, and sulfuric acid is added for hydrolysis. After hydrolysis, the solution is neutralized, the filtrate is collected, glucose is quantified by the glucose oxidase method, and the value calculated based on the following Equation 1 is defined as the amount of β-glucan.
Formula 1: β-glucan (g / 100 g) = glucose (g / 100 g) × 0.9

  The content of β-glucan can also be determined as the so-called sugar chain-containing polymer substance (polysaccharide) content. In this case, the culture solution is subjected to enzyme treatment using amylase, amyloglucosidase, protease, etc., and α-glucan such as protein and pullulan is removed, followed by ethanol precipitation. Further, it is filtered through a glass filter to obtain a polymer sample. At this time, in order to remove low-molecular substances containing monosaccharides, the cells are thoroughly washed with 80% ethanol. The washed polymer sample is further washed with acetone, and the weight of the washed polymer sample is measured to determine the amount of the sugar chain-containing polymer substance (polysaccharide).

  The β-glucan quantified in this way is quantified as having a functional group such as a sulfate group or a phosphate group. Therefore, when β-glucan is quantified as a broad-chain sugar chain-containing polymer (polysaccharide) in this way, the content of β-glucan produced by culturing Aureobasidium pullulans is In terms of the content with respect to 100 g of the culture, the content is preferably 70 to 5,000 mg, more preferably 140 to 3,000 mg.

  Examples of the Aureobasidium pullulans used in the present invention include, for example, Aureobasidium pullulans M-1, AIST (National Institute of Advanced Industrial Science and Technology, Patent Biological Depositary Accession No. FERM BP-08615). Aureobasidium pullulans M-2 (Independent Administrative Institution, National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center Accession Number FERM BP-10014) and the like are preferably used. In addition, β-glucan produced by these strains is obtained from the main chain in which glucose is β-1,3 linked by structural analysis by NMR measurement (13C NMR: Varian's UNITY INOVA500 type, 1HNMR: Varian's UNITY INOVA600 type). It has been clarified that it is β-1,3-1,6-glucan having a structure in which glucose is branched by -1,6 bonds.

  Cultivation of Aureobasidium pullulans can be performed according to a known method (see JP-A-57-149301, etc.). That is, a medium (pH 5.2 to 2) containing 0.5 to 5.0% by mass of a carbon source (sucrose), 0.1 to 5.0% by mass of an N source, and other trace substances (for example, vitamins and inorganic substances). 6.0) is inoculated with bacteria and aerated culture at a temperature of 20 to 30 ° C. for 2 to 14 days, preferably aerated and stirred culture. As β-glucan is produced, the viscosity of the culture solution increases and becomes a highly viscous gel. The culture solution thus obtained usually contains 0.6 to 10% by mass of solid content, and the solid content contains 5 to 80% by mass of β-glucan. In addition to β-glucan, other useful components such as phosphorus, potassium, magnesium, and vitamin C are also included.

  Aureobasidium pullulans may also be cultured by adding killed microorganisms to the culture medium in which it is cultured to assimilate them as nutrient components. In this case, the blending amount of the dead cells in the culture solution is usually about 100 cells / mL (culture solution) to 100 trillion cells / mL (culture solution), although it varies depending on the type of cells used. It is preferable. Microbial killing can be performed by heat sterilization or the like.

  The microorganism used as the killed microorganism is not particularly limited as long as it contains an aureobasidium microorganism nutrient source such as a nitrogen source, and examples thereof include lactic acid bacteria and yeast. Examples of lactic acid bacteria include Enterococcus faecalis, Enterococcus faecalis, Lactobacillus acidphilus, L. gasseri, L. mali, Lactobacillus. Bacillus plantarum (L.plantarum), Lactobacillus buchneri (L.buchneri), Lactobacillus casei (L.casei), Lactobacillus johnsonii (L.johnsonii), Lactobacillus gallinarum (L.gallinarum) , Lactobacillus amylovorus (L.amylovorus), Lactobacillus brevis (L.brevis), Lactobacillus rhamnosus (L.rhamnosus), Lactobacillus kefir (L.kefir), Lactobacillus paracasei (L.paracasei) , Lactobacillus subtypes such as L. crispatus Streptococcus bacteria such as Streptococcus thermophilus, Lactococcus lactis bacteria such as Lactococcus lactis, Bifidobacterium bifidum, Bifidobacterium longum (B. longum), Bifidobacterium addresscentis (B.adolescentis), Bifidobacterium infantis (B.infantis), Bifidobacterium breve (B.breve), Bifidobacterium catenuratum (B Bacteria belonging to the genus Bifidobacterium such as .catenulatum, Bacillus subtilis, Bacillus coagulans such as B. coagulans, Clostridium butilicum such as Clostridium butilicum, etc. be able to.

  Yeasts include imperfect fungi, including Aureobasidium pullans, Saccharomyces cerevisiae, Saccharomyces intemedius, Saccharomyces intemedius, Saccharomyces validus, Saccharomyces validus Saccharomyces ellipsoideus), Saccharomyces mali risler, Saccharomyces mandschuricus, Saccharomyces Vordermannii, Saccharomyces charisom Som (Saccharomyces piriformis), Saccharomyces anamen sis), Saccharomyces cartilaginosus, Saccharomyces Awamori, Saccharomyces Batatae, Saccharomyces Coreanus, robust Saccharomyces Coreanus, Somcharosus Cis (Saccharomyces Carlsbergensis), Saccharomyces Monacensis (Saccharomyces Monacensis), Saccharomyces Marxianus, Zygosaccharomyces (Saccharomyces) Roc Hansenula anomala, etc. can be used.

  As described above, TRAIL has an action of suppressing the proliferation of autoimmune inflammatory cells in addition to the apoptosis-inducing action. For example, in Non-Patent Document 1 described above, experimental administration of recombinant TRAIL results in an experiment. It has been reported that symptoms of autoimmune thyroiditis improve. Non-Patent Document 2 reports that administration of recombinant TRAIL improves the symptoms of experimental autoimmune encephalomyelitis. Thus, the TRAIL expression enhancer according to the present invention is useful for preventing or improving autoimmune inflammation. That is, for example, it is useful for preventing or improving autoimmune inflammation in which self-killing T cells are involved in the onset. Specific examples include chronic thyroiditis (Hashimoto's disease) classified as autoimmune thyroiditis, Graves' disease, and multiple sclerosis classified as autoimmune encephalomyelitis.

  The dose of the aureobasidium-derived culture composition can be appropriately determined depending on the intensity of symptoms, physical condition, age, administration method, number of administrations, and administration timing. For example, a typical dose is approximately 0.02 to 200 mg / kg (body weight) per day in terms of the amount of β-glucan, which is one of the contents of the aureobasidium-derived culture composition. Take in the amount of. Moreover, it is preferable to make it ingest for a long time and to exhibit an effect continuously. In addition, TNF-α inhibitors (anti-human TNF-α antibody: infliximab (trade name “Remicade”), adalimumab (trade name “Humila”), etc .; TNFα receptor and immunoglobulin fusion protein: etanercept (trade name “Embrel”) )), IL-1β inhibitor (anti-IL-1β antibody: canakinumab (trade name “Ilaris”), etc .; anti-IL-1 receptor antibody: anakinra (trade name “Kinelet”), etc.), IL-6 inhibitor (Anti-IL-6 receptor antibody: tocilizumab (trade name “ACTEMURA”) and the like) can also be used in combination with conventionally known treatments for autoimmune inflammation.

  EXAMPLES Hereinafter, the present invention will be specifically described with reference to examples, but these examples do not limit the scope of the present invention.

[Experimental materials and methods]
-Preparation of culture A culture solution of Aureobasidium pullulans M-2 (FERM BP-10014) was prepared as follows.
Pre-prepared pre-culture solution is inoculated in an appropriate amount into a liquid medium (pH 5.3) containing 1% sucrose, 0.1% ascorbic acid, 0.1% rice bran, and 25 to 72 ° C for 72 to 96 hours (depending on the production batch) Aeration stirring culture was performed. After completion of the culture, this culture solution was sterilized at 121 ° C. for 15 minutes. The obtained sterilized culture solution contains approximately 1.2% by mass of solid content.

・ Preparation of purified β-glucan After removing insoluble matter by filtering the above aureobasidium culture solution through diatomaceous earth, adsorb and remove low molecular weight compounds using powdered activated carbon (Wako Pure Chemical Industries, Ltd.). And subjected to ultrafiltration with an ultrafiltration membrane having a molecular weight cut off of 20,000. Thereafter, β-glucan recovered in the non-passed fraction of ultrafiltration was precipitated with 80% ethanol, the obtained precipitate was redissolved with purified water, and ethanol was removed by heating as purified β-glucan. Using.

・ Cells Macrophage-like cultured cell line RAW264.7 cells (ATCC TIB-71) and cultured cell lines derived from human monocytes, THP-1 cells (ATCC TIB-202) are RPMI-1640 ( (Sigma-Aldrich) in medium supplemented with 10% fetal bovine serum (FBS) and 100 units / ml penicillin and 100 μg / ml streptomycin under conditions of 37 ° C and 5% CO ₂ Was cultured.
Differentiation of THP-1 cells into macrophages is performed by adding a final concentration of 100 nM PMA (Phorbol 12-Myristate 13-Acetate) to the medium and culturing at 37 ° C and 5% CO ₂ for 3 days. It was. THP-1 cells induced to differentiate into macrophages were further cultured for 24 hours in a medium not containing PMA, and then subjected to experiments.

・ Analysis by real-time RT-PCR method Cells after stimulation with a test substance were collected, and total RNA was extracted using an RNA extraction reagent “TRIzol” (trade name, Invitrogen). The extracted total RNA was treated with DNase I (trade name, Takara Bio Inc.) and then subjected to reverse transcription using a random primer and oligo dT primer and reverse transcriptase `` ReverTraAce '' (trade name, Toyobo Co., Ltd.). Then, cDNA was synthesized. Real-time PCR analysis of mRNA expression levels of TRAIL, TNF-α, and FasL uses PCR primers specific to each mRNA and Taq polymerase “SYBR Premix Ex Taq II” (trade name, Takara Bio Inc.) A real-time PCR analyzer “BioRad CFX96 real-time PCR detection system” (trade name, Bio-Rad) was used according to the manufacturer's recommended protocol.

・ PCR primer
The following primers were used as primers specifically detecting TRAIL, TNF-α, and FasL mRNA.
(1) For TRAIL mRNA
5'- CCAACGAGATGAAGCAGCTGCAGG -3 '
5'- CCTGCAAGCAGGGTCTGTTCAAGA -3
(2) For TNF-α mRNA
5'- GACCCTCACACTCAGATCATCTTCT -3 '
5'- CCACTTGGTGGTTTGCTACGA -3 '
(3) For FasL mRNA
5'- CCACCTGCAGAAGGAACTGGCA -3 '
5'- ATGGGCCACACTCCTCGGCT -3 '

・ Analysis by Western blotting After cells stimulated with test substance were washed with PBS (phosphate buffered saline), RIPA (25 mM Tris-HCl [pH 7.5], 150 mM NaCl, 1% NP- 40, 1% sodium deoxycholate, 0.1% SDS) was added with a protease inhibitor cocktail (Complete Mini; Roche) and dissolved, and cell debris was removed by centrifugation to obtain a total cell extract. 20 μg of protein was fractionated by 10% SDS polyacrylamide electrophoresis, and TRAIL protein and actin protein transferred to PVDF membrane (Immobilon-P Transfer Membrane, Millipore) were detected using each specific antibody. It was.

·antibody
Detection of TRAIL protein and actin (Actin) protein was performed using a commercially available anti-mouse TRAIL antibody (Oriental Yeast Co., Ltd.) and anti-β-actin antibody (Chemicon), respectively.

<Test Example 1>
2 x 10 ⁵ RAW264.7 cells cultured overnight at 37 ° C, 5% CO ₂ , purified β-glucan with a final concentration of 100 μg / ml, CpG DNA with a final concentration of 5 μM (CpG-A, Hycult Biotech), or lipopolysaccharide (derived from E. coli 055: B5, Sigma-Aldrich) at a final concentration of 100 μg / ml. Collect 6 hours of cells after stimulation, prepare total RNA from the cells, and detect these genes by real-time RT-PCR using primers that specifically detect TRAIL, TNF-α, and FasL mRNA. Expression was analyzed. The data were normalized by the expression level of GAPDH mRNA, and then expressed as a relative ratio to each expression level in control cells. Error bars represent the standard deviation in 3 independent trials (Figure 1).

  As shown in FIG. 1A, the expression level of TRAIL mRNA in RAW264.7 cells was increased by stimulation with purified β-glucan. In contrast, the mRNA expression levels of TNF-α and FasL, which are known to be death ligands that induce apoptosis in cells, similar to TRAIL, are relative to the respective expression levels in control cells. The ratio was low compared to that of TRAIL, and thus it was shown that stimulation with purified β-glucan has a high selectivity for the induction of TRAIL expression.

  In addition, as shown in FIG. 1B, stimulation with CpG DNA, which is known as a substance having an immunostimulatory action similar to β-glucan, showed high selectivity for TNF-α expression induction.

  In addition, as shown in FIG. 1C, stimulation with lipopolysaccharide (LPS), which is also known as a substance having an immunostimulatory action, induced TNF-α expression in addition to TRAIL expression.

<Test Example 2>
2 x 10 ⁵ RAW264.7 cells cultured overnight at 37 ° C, 5% CO ₂ , stimulated with purified β-glucan at a final concentration of 100 μg / ml, and 24 hours after stimulation A total cell extract was prepared. 20 μg of protein was fractionated by SDS-PAGE and analyzed by Western blotting using a TRAIL-specific antibody. The results are shown in FIG. In FIG. 2, the arrows indicate bands of membrane-bound TRAIL: TRAIL (M), soluble TRAIL: TRAIL (S), and actin (Actin) used as an internal standard.

  As shown in FIG. 2, it was clarified that when RAW264.7 cells were stimulated with purified β-glucan, the expression of both membrane-localized and soluble TRAIL proteins was enhanced.

  In humans, TRAIL signals to cells via its receptors TRAIL-R1 (also called TRAIL receptor 1; also called DR4 (death receptor 4)) and TRAIL-R2 (also called TRAIL receptor 2; also called DR5 (death receptor 5)). To communicate. TNF-α and FasL transmit signals that induce apoptosis to cells via TNFαR1 (TNFα receptor 1; also called DR1 (death receptor 1)) and Fas (also called DR2 (death receptor 2)), respectively.

  According to the results of Test Example 1 and Test Example 2, CpG DNA has the ability to induce TNF-α expression but does not induce TRAIL expression, whereas β--obtained from the above aureobasidium culture solution. Glucan has a high ability to induce TRAIL expression. In addition, lipopolysaccharide (LPS) induces TNF-α expression as well as TRAIL expression, whereas β-glucan obtained from the aureobasidium culture solution has high selectivity for TRAIL. For example, it is known that increased expression of TNF-α acts to exacerbate various inflammatory diseases. It was considered that β-glucan produced by Aureobasidium pullulans is useful as an inducer capable of enhancing the expression of TRAIL with little influence on such other signals.

<Test Example 3>
As a stimulant for RAW264.7 cells, purified β-glucan (derived from Aureobasidium culture broth) with a final concentration of 100 μg / ml and β-glucan derived from barley with a final concentration of 100 μg / ml (“barley β-glucan”). The above test example except that it was carried out in place of “granule”, manufactured by ADEKA Co., Ltd.) or β-glucan derived from baker's yeast having a final concentration of 100 μg / ml (“Ortas β glucan 85 powder”, manufactured by Altus Co. In the same manner as in Example 1, the expression level of TRAIL mRNA by these stimulating substances was analyzed. The data were normalized by the expression level of GAPDH mRNA, and then expressed as a relative ratio to each expression level in control cells. Error bars represent standard deviation in 3 independent trials (FIG. 3A).

  In addition, THP-1 macrophage-like cells that were induced to differentiate into macrophage-like cells by PMA (Phorbol 12-Myristate 13-Acetate) instead of RAW264.7 cells were subjected to the same test as above. It was. The data were normalized by the expression level of GAPDH mRNA, and then expressed as a relative ratio to each expression level in control cells. Error bars represent standard deviation in 3 independent trials (FIG. 3B).

  As shown in FIG. 3A, TRAIL mRNA expression was induced in RAW264.7 cells by stimulation of purified β-glucan derived from aureobasidium culture. In contrast, β-glucan derived from barley or β-glucan derived from baker's yeast did not induce any TRAIL mRNA expression in RAW264.7 cells. As shown in FIG. 3B, similar results were obtained in THP-1 macrophage-like cells. Therefore, it was revealed that TRAIL expression can be effectively induced by purifying β-glucan derived from aureobasidium culture medium.

Claims (2)

A TRAIL expression enhancer comprising a β-glucan-containing culture composition derived from a culture of Aureobasidium pullulans as an active ingredient.   The TRAIL expression enhancer according to claim 1, which is used for preventing or improving autoimmune inflammation.