JP5818195B2 - Probes and microarrays for detecting harmful or toxic dinoflagellates - Google Patents

Description

  The present invention relates to oligonucleotide probes used for detecting harmful or toxic dinoflagellates, a microarray on which they are arranged, a method for detecting harmful or toxic dinoflagellates using the probe or array, and a marine monitoring method. . Specifically, the present invention relates to an oligonucleotide probe, a microarray and a detection method that can quickly confirm the presence or absence of a predetermined harmful or toxic dinoflagellate, and a marine monitoring method that can quickly grasp the state of the marine environment.

In recent years, there are concerns about adverse effects on biological ecosystems caused by changes in offshore and coastal physical or chemical marine environments caused by rising water temperatures due to global warming. Until now, several Alexandrium species and Gymnodinium catenatum that cause paralytic shellfish poisoning, Heterocapsa circularisquama that specifically kills bivalves, and Cochlodinium polykrikoides that are harmful red tide organisms have been reported on the coast of Japan. The occurrence of tropical toxic plankton such as Gambierdiscus toxicus, a causal species of ciguatera, has been reported in the Seto Inland Sea and Kyushu coastal areas.
In the future, the emergence of harmful or toxic plankton distributed in the tropics or subtropics, expansion of the distribution area, or migration from other sea areas by ballast water, etc. are predicted, resulting in higher toxicity of edible fish and shellfish, There are concerns about the expansion of health damage.
For these reasons, particularly from the viewpoint of ensuring the safety of marine foods, it is necessary to urgently establish a rapid method for knowing the appearance of harmful or toxic dinoflagellates in the target sea area where marine foods are produced.

By the way, conventionally, the classification of the above-mentioned harmful or toxic dinoflagellates has been detected and identified by visual observation under a microscope, and the number and the like have been investigated.
However, the forms of harmful or toxic dinoflagellates are very similar between species, and the morphological traits to be emphasized differ depending on the identifier when they are identified by differences in morphological features such as armor arrangements or swimming methods. Sometimes, subjective judgments were made. In addition, there is a problem that objective classification is not clear, for example, morphological characteristics are likely to change depending on environmental conditions, and classification criteria based on morphological features are not sufficiently unified. Furthermore, in the actual seawater sample, multiple species appear at the same time, and the conventional method that relies on visual observation is difficult to accurately identify the species and calculate the cell density.

In recent years, in order to improve such problems, the development of objective methods by molecular biological methods, such as PCR-RFLP (Restricted Enzyme Length Polymorphism) method (see Non-Patent Documents 1 and 2), RNA Targeted FISH (Fluorescence In Situ Hybridization) method (see Non-Patent Documents 3 to 5), SHA (RNA-DNA Sandwich Hybridization) method (See Non-Patent Documents 6 and 7), Direct sequence of target gene using 1 cell The development of techniques using techniques such as sequencing (see Non-Patent Document 8) and real-time PCR (see Non-Patent Documents 9 to 11) has been actively conducted.
However, these molecular biology techniques have improved objectivity compared to conventional visual inspection under a microscope, but there is a need for further improvement in terms of simplicity, rapidity, and reproducibility. .

On the other hand, a DNA chip (microarray) has been developed as one of molecular biological techniques for determining a large number of nucleic acids at once, and results can be obtained quickly.
There have been only a few reports on studies on harmful or toxic plankton using the DNA chip method (see Non-Patent Documents 12 to 14), all of which are DNA chips specialized for the detection of the genus Alexandrium. Yes, many types of toxic dinoflagellates cannot be distinguished. In addition, since these DNA chips are not chips equipped with both tropical or subtropical harmful or toxic plankton detection probes and temperate toxic or harmful plankton detection probes, these cannot be detected simultaneously, It was impossible to monitor tropical plankton, which is an indicator of global warming in ocean conditions.

Adachi M. et al. J. Phycol. 30: 857-863 (1994). Scholin CA and Anderson DM. J. Phycol. 30: 744-754 (1994). Scholin CA. et al. J. Phycol. 35: 1356-1367 (1999). Hosoi-Tanabe S and Sako Y. Harmful Algae 4: 319-328 (2005). Anderson DM. Et al. Deep Sea Research II 52: 2467-2490 (2005). Tyrrell JV. Et al. Harmful Algae 1: 205-214 (2002). Greenfield DL. Et al. Limnol Oceanogr Methods: 426-435 (2006). Bolch CJS. Phycologia 40: 162-167 (2001). Hosoi-Tanabe S, Nagai S. and Sako Y. Mar Biotechnol 6: 30-34. Kamikawa R, Hosoi-Tanabe S, Nagai S. et al. Fish Sci 71: 985-989 (2005). Kamikawa R, Nagai S. et al. Harmful Algae 6: 413-420 (2007). Ki JS and Han MS. Biosens Bioelectron 21: 1812-1821 (2006). Ahn SA. Et al. Appl Environ Microbiol 72: 5742-5749 (2006). Gescher C. et al. Harmful Algae 7: 485-494 (2008).

  Under such circumstances, it has been desired to develop oligonucleotide probes, microarrays, and the like that can rapidly detect various types of harmful or toxic dinoflagellates and monitor marine conditions.

  The present invention has been made in view of the above situation, and provides the following oligonucleotide probes and microarrays for detecting harmful or toxic dinoflagellates, a method for detecting harmful or toxic dinoflagellates, a marine monitoring method, and the like. To do.

(1) An oligonucleotide probe for detecting harmful or toxic dinoflagellates, comprising a base sequence capable of hybridizing to at least a part of the base sequences of nucleic acids derived from harmful or toxic dinoflagellates.
In the probe of the present invention, the at least part of the base sequence includes, for example, the base sequence of the large subunit ribosomal RNA gene in the algal chromosomal DNA and the large subunit ribosomal RNA gene in the algal chromosomal DNA. Examples include the base sequence of the D1 region or D2 region.
In the probe of the present invention, harmful or toxic dinoflagellates include, for example, from the genus Alexandrium, Dinophysis, Gambierdiscus, Gymnodinium, Karenia, Ostreopsis, Pfiesteria, Prorocentrum, Protoceratium, Protoperidinium and Pyrodinium At least one selected from the group consisting of:

Examples of the probe of the present invention include those containing the following DNA base sequence (a) or (b).
(a) DNA consisting of the nucleotide sequence shown in SEQ ID NOs: 4, 7, 8, 10-16, 20, 22, 27, 29, 31-35, 39-47 and 50-58
(b) at least a part of the base sequence of a nucleic acid that hybridizes with a DNA comprising a base sequence complementary to the DNA of (a) above under stringent conditions and is derived from a harmful or toxic dinoflagellate DNA having a function capable of detecting the nucleotide sequence of

(2) A microarray for detecting harmful or toxic dinoflagellates, wherein the oligonucleotide probe according to (1) is arranged on a base.
(3) A harmful or toxic dinoflagellate having a plurality of through-holes, wherein a gel is held in the through-holes, wherein the oligonucleotide probe according to (1) is held in the gel Algae detection microarray.

(4) A method for detecting harmful or toxic dinoflagellates,
Collecting seawater from a predetermined sea area as a specimen, extracting a nucleic acid derived from an organism in the specimen, and extracting the nucleic acid from the oligonucleotide probe according to (1) above or (2) or (3) The method comprising the step of contacting the microarray according to the above.
In the detection method of the present invention, examples of the subject include a plurality of subjects obtained by collecting seawater from a plurality of predetermined sea areas.

(5) A marine monitoring method characterized by analyzing a detection result obtained by the detection method according to (4) and estimating a marine situation using the analysis result as an index.
(6) The detection results of the plurality of subjects obtained by the detection method described in (4) above are compared and analyzed, and the influence of global warming on the marine situation is estimated using the analysis results as an index. And ocean monitoring method.
Examples of the monitoring method of (6) above include a method including comparing whether or not a predetermined harmful or toxic dinoflagellate is detected for each of the plurality of subjects. Here, examples of the predetermined harmful or toxic dinoflagellate include Pyrodinium genus and / or Gambierdiscus genus.

According to the present invention, a plurality of harmful or toxic dinoflagellates can be easily, quickly and comprehensively detected in the seawater area of the site, and further, the occurrence and occurrence of these can be traced. Oligonucleotide probes and microarrays for detection and methods for detecting harmful or toxic dinoflagellates can be provided. INDUSTRIAL APPLICABILITY The present invention is extremely useful in that it is possible to grasp the emergence of new harmful or toxic species of tropical or subtropical nature, to strengthen countermeasures against red tides and shellfish poisons, and to establish a rapid prediction system for them. .
In addition, by using the microarray or the like of the present invention, it is possible to quickly and accurately monitor tropical plankton, which is an indicator of warming in the marine situation, by including detection probes for harmful or toxic species distributed in the tropics or subtropics. Therefore, it is possible to easily grasp the influence of warming on the marine environment, and the present invention is extremely practical.

It is a figure which shows the sequence diagram of the DNA chip (DNA microarray) manufactured in the present Example. The numbers in the figure (excluding the numbers in the outer frame portion) represent probe numbers, and B represents that no probe is arranged. The numerals and alphabets in the outer frame portion are for specifying the position of the probe. It is a figure which shows the sequence diagram of the DNA chip (DNA microarray) manufactured in the present Example. The numbers in the figure (excluding the numbers in the outer frame portion) represent probe numbers, and B represents that no probe is arranged. The numerals and alphabets in the outer frame portion are for specifying the position of the probe. It is the schematic which shows the arrangement | sequence fixing jig for manufacture of a hollow fiber bundle (hollow fiber array body).

11 hole 21 perforated plate 31 hollow fiber 41 plate

  Hereinafter, the present invention will be described in detail. The scope of the present invention is not limited to these descriptions, and other than the following examples, the scope of the present invention can be appropriately changed and implemented without departing from the spirit of the present invention. It should be noted that all publications cited in the present specification, for example, prior art documents, publications, patent publications and other patent documents are incorporated herein by reference.

1. Summary of the Invention The inventor of the present invention, such as oligonucleotide probes and microarrays, which can detect a variety of harmful or toxic dinoflagellates rapidly and can monitor the marine situation, can be quickly detected. As a result of diligent research, we focused on the large subunit ribosomal RNA genes (LSU rRNA, 28S rRNA) in the chromosomal DNA of harmful or toxic dinoflagellates, especially the D1 and D2 regions in the gene. As a result of comparison between the species of the dinoflagellate, it was found that a specific base sequence exists for each species. Therefore, by using a nucleic acid fragment (oligonucleotide probe) containing this specific sequence and a DNA microarray in which they are arranged, it is possible to rapidly and specifically detect various types of harmful or toxic dinoflagellates. The headline and the present invention were completed.
As described above, the present invention has been completed by paying attention to the chromosomal DNA of various harmful or toxic dinoflagellates, specifically the base sequences of the D1 and D2 regions of LSU rRNA. The present invention relates to a microarray in which oligonucleotide probes having a base sequence that hybridizes to a part thereof are arranged. That is, the present invention is a microarray on which oligonucleotide probes capable of rapidly and specifically detecting various harmful or toxic dinoflagellates are arranged.

2. Oligonucleotide probe for detecting harmful or toxic dinoflagellate Oligonucleotide used as a probe in the present invention hybridizes with at least a part of the nucleotide sequence of nucleic acid derived from harmful or toxic dinoflagellate It is something that can be done. Here, the nucleic acid may be any of DNA (chromosomal DNA, plasmid DNA, etc.) and RNA (mRNA, etc.), but it is preferably chromosomal DNA. Specifically, the oligonucleotide used as a probe in the present invention can hybridize with the base sequence of the large subunit ribosomal RNA gene (LSU rRNA, 28S rRNA) in the chromosomal DNA of the dinoflagellate. More preferably, it can hybridize with the base sequence of the D1 region or D2 region of the LSU rRNA. That is, the probe of the present invention is designed to be complementary to at least a part of the base sequence in the specific region in expression analysis such as Northern blotting and microarray, and hybridizes when hybridized. It means what can be soyed.
In the probe of the present invention (particularly, a probe for microarray), it is preferable to select a region that has a specific base sequence for the various dinoflagellates to be detected and design the base sequence of the region. In general, when designing a probe, in addition to selecting a specific region, it is necessary to have a Tm and difficult to form a secondary structure. In some cases, the distance from the 3 'end of the mRNA should be relatively close.

Specific base sequences corresponding to each species of harmful or toxic dinoflagellates can be found, for example, by means of multiple alignment and designing probes in different regions between species. The algorithm for taking the alignment is not particularly limited, but as a more specific analysis program, for example, a program such as ClustalX1.8 can be used. The parameters for the alignment may be executed in the default state of each program, but can be adjusted as appropriate according to the type of program.
In the present invention, harmful or toxic dinoflagellates to be detected are not limited, but include Alexandrium, Dinophysis, Gambierdiscus, Gymnodinium, Karenia, Ostreopsis, Pfiesteria, Prorocentrum, Protoceratium, Protoperidinium Examples include dinoflagellates such as the genus and Pyrodinium genus, and it is preferable that at least one of these, preferably two or more, be the detection target. In addition, for example, when estimating the influence of global warming on the marine situation, it is preferable to use the genus Pyrodinium and the genus Gambierdiscus as detection targets.

  When designing the probe of the present invention, it is necessary to consider stringency in hybridization. By making stringency close to a certain extent, even if there are similar base sequence regions between specific regions in each nucleic acid in the various dinoflagellates, they can distinguish and hybridize with other different regions. it can. In addition, when the base sequences between the specific regions are almost different, stringency can be set gently.

  Examples of such stringency conditions include hybridization under conditions of 50 to 60 ° C. in the case of tight conditions, and hybridization under conditions of 30 to 40 ° C. in the case of mild conditions. The hybridization conditions include, for example, “0.12M Tris · HCl / 0.12M NaCl / 0.05% Tween-20, 40 ° C.”, “0.12M Tris · HCl / 0.12M NaCl / 0.05% Tween. -20, 37 ° C. ”,“ 0.12M Tris · HCl / 0.12M NaCl / 0.05% Tween-20, 30 ° C. ”, more stringent conditions include, for example,“ 0.12M Tris · HCl / 0.12M NaCl / 0.05% “Tween-20, 50 ° C.”, “0.12M Tris · HCl / 0.12M NaCl / 0.05% Tween-20, 55 ° C.”, “0.06M Tris · HCl / 0.06M NaCl / 0.05% Tween-20, 60 ° C.”, etc. The conditions can be mentioned. More specifically, the probe was added and kept at 50 ° C. for 1 hour or longer to hybridize, and then washed for 20 minutes at 50 ° C. in 0.12M Tris · HCl / 0.12M NaCl / 0.05% Tween-20. There is also a method in which 0.12M Tris · HCl / 0.12M NaCl at 10 ° C. for 10 minutes is washed once. More stringent conditions can be set by raising the temperature during hybridization or washing. A person skilled in the art can set conditions in consideration of other conditions such as probe concentration, probe length, and reaction time in addition to conditions such as the buffer salt concentration and temperature. For details on the hybridization procedure, see `` Molecular Cloning, A Laboratory Manual 2nd ed. '' (Cold Spring Harbor Press (1989), `` Current Protocols in Molecular Biology '' (John Wiley & Sons (1987-1997)), etc. You can refer to it.

Although the length of the probe of the present invention is not limited, for example, it is preferably 10 bases or more, more preferably 16 to 50 bases, and further preferably 18 to 35 bases. If the probe length is appropriate (within the above range), non-specific hybridization (mismatch) can be suppressed and used for specific detection.
When designing the probe of the present invention, it is preferable to check the melting temperature (Tm) of the probe. Tm means the temperature at which 50% of any nucleic acid strand hybridizes with its complementary strand, and in order to hybridize the template DNA or RNA and probe to form a double strand, the hybridization temperature Need to be optimized. On the other hand, if this temperature is lowered too much, non-specific reactions are likely to occur, so the temperature is preferably as high as possible. Therefore, the Tm of the nucleic acid fragment to be designed is an important factor in performing hybridization. For confirmation of Tm, known probe design software can be used. Examples of software that can be used in the present invention include Probe Quest (registered trademark; Dynacom). Tm can also be checked by calculating it without using software. In that case, a calculation formula based on the nearest neighbor method, wallance method, GC% method, or the like can be used. In the probe of the present invention, although not limited, the average Tm is preferably about 35 to 70 ° C or 45 to 60 ° C. Other conditions that allow specific hybridization as a probe include GC content and the like, which are well known to those skilled in the art.

The nucleotide (nucleic acid) constituting the probe of the present invention may be any of DNA and RNA or PNA, and may be a hybrid of two or more of DNA, RNA and PNA.
Specific examples of the probe of the present invention preferably include the following DNA sequences (a) or (b).
(a) DNA consisting of the nucleotide sequence shown in SEQ ID NOs: 4, 7, 8, 10-16, 20, 22, 27, 29, 31-35, 39-47 and 50-58
(b) at least a part of the base sequence of a nucleic acid that hybridizes with a DNA comprising a base sequence complementary to the DNA of (a) above under stringent conditions and is derived from a harmful or toxic dinoflagellate DNA having a function capable of detecting the nucleotide sequence of

Regarding the various DNAs of (a) above, the specific base sequences, probe numbers, probe names, and dinoflagellates to be detected can be referred to the description in Examples and Table 5 below.
The DNA of (b) is a DNA comprising the various DNAs of (a) or a complementary base sequence thereof, or a fragment thereof, which is used as a probe, colony hybridization, plaque hybridization, and Southern. It can be obtained from a cDNA library or a genomic library by performing a known hybridization method such as blotting. A library prepared by a known method may be used, or a commercially available cDNA library or genomic library may be used, and is not limited. For the detailed procedure of the hybridization method, the same one as described above can be referred to. Regarding the DNA of (b) above, “stringent conditions” are conditions at the time of washing after hybridization, wherein the buffer salt concentration is 24-390 mM, the temperature is 40-65 ° C., preferably the salt concentration is It means the condition of 48.8-195mM and temperature of 45-60 ° C. Specifically, for example, conditions such as 97.5 mM and 50 ° C. can be mentioned. In addition to conditions such as salt concentration and temperature, various conditions such as probe concentration, probe length, and reaction time are taken into consideration, and conditions for obtaining the DNA of (b) above are set as appropriate. Can do. The hybridizing DNA is preferably a base sequence having at least 60% homology with the DNA base sequence of (a) above, more preferably 80% or more, still more preferably 90% or more, More preferably, it is 95% or more, particularly preferably 98% or more, and most preferably 99% or more.

The probe of the present invention can be prepared by, for example, chemical synthesis using a normal oligonucleotide synthesis method (purification is performed by HPLC or the like). Such a probe can be designed by, for example, Probe Quest (registered trademark: manufactured by Dynacom). Moreover, the probe of the present invention may contain an additional sequence such as a tag sequence, for example.
In the present invention, the nucleic acid base sequence of the various dinoflagellates to be detected does not have to be the base sequence itself, and a part of the base sequence is mutated by deletion, substitution, insertion, etc. It may be. Therefore, the base sequence of the nucleic acid to be detected (for example, the base sequence of the D1 and D2 regions) hybridizes with a sequence complementary to the base sequence under stringent conditions and is derived from each base sequence. Mutant genes having functions and activities can also be targeted, and probes can also be designed based on the base sequence of such mutant genes. Here, the “stringent conditions” may be the same conditions as described above.

3. Microarray for detecting harmful or toxic dinoflagellate algae A plurality of the probes of the present invention described above are arranged on a substrate serving as a support. The substrate on which the probes are arranged is generally called a DNA chip or a DNA microarray. As the form of the substrate serving as the support, any form such as a flat plate (glass plate, resin plate, silicon plate, etc.), rod shape, or bead can be used. When a flat plate is used as the support, a predetermined probe can be fixed on the flat plate with a predetermined interval for each type (spotting method, etc .; see Science 270, 467-470 (1995), etc.) . It is also possible to sequentially synthesize a predetermined probe for each type at a specific position on the flat plate (see, for example, photolithography method; Science 251, 767-773 (1991)). Other preferred support forms include those using hollow fibers. When hollow fibers are used as the support, a microarray obtained by fixing a predetermined probe to each hollow fiber for each type, converging and fixing all hollow fibers, and then repeating cutting in the longitudinal direction of the fibers ( The “fiber type microarray” is preferably exemplified below. This macroarray can also be described as a type in which a nucleic acid is immobilized on a through-hole substrate, and is also referred to as a so-called “through-hole type microarray” (see Japanese Patent No. 3510882).

The method for fixing the probe to the support is not limited, and any binding mode may be used. Moreover, it is not limited to fix | immobilize directly to a support body, For example, a support body can be previously coated with polymers, such as a polylysine, and a probe can also be fixed to the support body after a process. Furthermore, when a tubular body such as a hollow fiber is used as the support, the tubular body can hold a gel-like material, and the probe can be fixed to the gel-like material.
Hereinafter, a fiber microarray which is one form of the “through-hole microarray” will be described in detail. This microarray can be manufactured through the following steps (i) to (iv), for example.
(i) A step of producing an array by arranging a plurality of hollow fibers in three dimensions so that the longitudinal directions of the hollow fibers are the same direction
(ii) a step of embedding the array and producing a block
(iii) A step of introducing a gel precursor polymerizable solution containing an oligonucleotide probe into the hollow part of each hollow fiber of the block body to carry out a polymerization reaction and holding the gel-like substance containing the probe in the hollow part
(iv) A step of cutting the block body into pieces by cutting in a direction crossing the longitudinal direction of the hollow fiber

The material used for the hollow fiber is not limited, but for example, materials described in JP-A No. 2004-163211 and the like are preferable.
The hollow fibers are arranged three-dimensionally so that the lengths in the longitudinal direction are the same (step (i)). As an arrangement method, for example, a method of arranging a plurality of hollow fibers in parallel with a predetermined interval on a sheet-like material such as an adhesive sheet, forming a sheet, and then winding the sheet in a spiral manner (Japanese Patent Laid-Open No. 11-1990). No. 108928), or two perforated plates in which a plurality of holes are provided at a predetermined interval are overlapped so that the holes coincide with each other, and hollow fibers are passed through these holes, and then the two perforated plates And a method of temporarily fixing the gap between the two perforated plates and filling the periphery of the hollow fiber with a curable resin raw material to cure (see JP 2001-133453 A). For the arrangement fixing jig used in the latter method, reference is made to the schematic diagram shown in FIG.
The manufactured array is embedded so that the array is not disturbed (step (ii)). Examples of the embedding method include a method in which a polyurethane resin, an epoxy resin, or the like is poured into a gap between fibers, and a method in which fibers are bonded together by heat fusion.

The embedded array is filled with a gel precursor polymerizable solution (gel forming solution) containing an oligonucleotide probe in the hollow part of each hollow fiber, and a polymerization reaction is performed in the hollow part (step (iii)). . Thereby, the gel-like thing with which the probe was fixed can be hold | maintained in the hollow part of each hollow fiber.
The gel precursor polymerizable solution is a solution containing a reactive substance such as a gel-forming polymerizable monomer, and the solution can be converted into a gel by polymerizing and crosslinking the monomer. Say. Examples of such monomers include acrylamide, dimethylacrylamide, vinyl pyrrolidone, methylene bisacrylamide and the like. In this case, the solution may contain a polymerization initiator and the like.
After fixing the probe in the hollow fiber, the block body is cut in a direction intersecting with the longitudinal direction of the hollow fiber (preferably in a direction perpendicular to the hollow fiber) to make a thin piece (step (iv)). The flakes thus obtained can be used as a DNA microarray. The thickness of the array is preferably about 0.01 mm to 1 mm. The block body can be cut by, for example, a microtome and a laser.
Preferred examples of the fiber microarray described above include a DNA chip (Genopal ^™ ) manufactured by Mitsubishi Rayon Co., Ltd.

In the fiber type microarray, as described above, the probes are three-dimensionally arranged in the gel, and the three-dimensional structure can be maintained. Therefore, the detection efficiency is increased compared to a planar microarray in which a probe is bonded to a slide glass whose surface is coated, and it is possible to perform a highly sensitive and highly reproducible inspection.
Further, the number of types of probes arranged on the microarray is preferably 1000 or less, preferably 500 or less, more preferably 250 or less on one (middle) microarray. By limiting the number (type) of probes arranged in this way to some extent, it becomes possible to detect the target dinoflagellate with higher sensitivity. The type of probe is distinguished by the base sequence. Therefore, even if the probes are derived from the same gene, even if one base sequence is different, it is specified as a different type.
In the present specification, the names of the DNA microarray and the DNA chip are not distinguished from each other but are synonymous.

4). Method for detecting harmful or toxic dinoflagellate The method for detecting harmful or toxic dinoflagellate of the present invention is a method comprising the following steps.
(i) A step of extracting seawater from a predetermined sea area as a specimen and extracting nucleic acids derived from organisms in the specimen (extraction process)
(ii) A step of contacting the extracted nucleic acid with the above-described oligonucleotide probe of the present invention (section 2.) or the microarray of the present invention (section 3.) (detection step)

Below, the detail of the detection method of this invention is demonstrated for every process.
(1) About step (i) In this step (extraction step), seawater is collected from a predetermined sea area as a specimen, and nucleic acids derived from organisms in the specimen are extracted. Is not particularly limited. Examples of seawater to be collected include, but are not limited to, seawater in the marine development site, seawater in the farm, seawater in the farm, or seawater inhabited by diseased fish, For example, seawater in the sea area may be collected for the purpose of knowing the environmental conditions of the sea. Further, the subject may be a subject obtained by collecting from one sea area, or may be a plurality of subjects obtained by collecting from a plurality of sea areas. When collecting samples from the sea, for example, it is possible to monitor the ocean in a diversified manner, for example, by conducting a comparative study on a plurality of sea areas, or by grouping sea areas according to the situation of the sea area.

  Next, nucleic acids derived from organisms in the subject are extracted. For example, a seawater sample that has been passed through a plankton net is further passed through a filter having a pore size of about 0.22 μm, and what remains on the filter is collected. And a nucleic acid (polynucleotide) can be extracted from the sample. The nucleic acid is preferably recovered as a double-stranded polynucleotide. The nucleic acid extraction method can be performed according to a conventional method, and can be collected by, for example, filtration, culture, centrifugation, lysis and the like.

  The nucleic acid obtained from the sample may be directly contacted with a microarray or the like, or a desired site (base sequence region) may be amplified by PCR or the like, and the amplified fragment may be contacted with the microarray or the like. Not. The site to be amplified using the obtained nucleic acid as a template is a site that encodes a nucleic acid region containing the base sequence of an oligonucleotide placed (mounted or fixed) on the probe of the present invention or the microarray of the present invention. The desired site to be amplified is not limited, and can be obtained by amplifying many kinds of mixtures at once using the base sequence of a highly conserved region regardless of the species of the dinoflagellate. The sequence for such amplification may be experimentally isolated, purified, analyzed based on the base sequence of the isolated polynucleotide, and determined based on the sequence, It may be determined by In Silico by searching a known base sequence in various databases and taking an alignment. The database of nucleic acids or amino acids is not particularly limited. For example, DDBJ (DNA Data Bank of Japan), EMBL (European Molecular Biology Laboratory, EMBL nucleic acid sequence data library), GenBank (Genetic sequence data bank) , NCBI (National Center for Biotechnology Information) Taxonomy database can be used.

  Specifically, the desired site to be amplified is preferably the D1 or D2 region of the large subunit ribosomal RNA (LSU rRNA) gene in the chromosomal DNA of the dinoflagellate. Preferred examples of PCR primers that can be used for amplification of the region include the following. Amplification of nucleic acid by the PCR method can be performed according to a conventional method.

Forward primer D1R:
5'-ACCCGCTGAATTTAAGCATA-3 '(SEQ ID NO: 1)
Reverse primer D2C:
5'-CCTTGGTCCGTGTTTCAAGA-3 '(SEQ ID NO: 2)

  The nucleic acid extracted in this step and the amplified fragment thereof can be appropriately labeled and used in the detection process after hybridization. Specifically, a method of incorporating a reactive nucleotide analog during a reverse transcription reaction, a method of incorporating a biotin-labeled nucleotide, and the like can be considered. Furthermore, it can be labeled with a fluorescent labeling reagent after preparation. As the fluorescent reagent, for example, various reporter dyes (for example, Cy5, Cy3, VIC, FAM, HEX, TET, fluorescein, FITC, TAMRA, Texas red, Yakima Yellow, etc.) can be used.

(2) Step (ii) In this step (detection step), the nucleic acid obtained in step (i) or an amplified fragment thereof is brought into contact with the oligonucleotide probe of the present invention or the microarray of the present invention. Then, a hybridization solution containing the nucleic acid or the like is prepared, and the nucleic acid or the like in the solution is bound (hybridized) to the oligonucleotide probe mounted on the microarray. The hybridization solution can be appropriately prepared according to a conventional method using a buffer such as SDS or SSC.
In the hybridization reaction, the reaction conditions (type of buffer, pH, temperature, etc.) are appropriately set so that the nucleic acid in the hybridization solution can hybridize with the oligonucleotide probe mounted on the microarray under stringent conditions. Can be set and done. The term “stringent conditions” as used herein refers to conditions under which cross-hybridization due to similar sequences is unlikely to occur or nucleic acids cross-hybridized with similar sequences are dissociated. It means the washing conditions of the microarray after or after hybridization.

For example, as conditions for the hybridization reaction, the reaction temperature is preferably 35 to 70 ° C, more preferably 40 to 65 ° C, and the time for hybridization is preferably about 1 minute to 16 hours.
The washing conditions of the microarray after hybridization are preferably 0.12M Tris · HCl / 0.12M NaCl / 0.05% Tween-20, and the washing temperature is 35-80 ° C. or 40 -65 degreeC is preferable, More preferably, it is 45-60 degreeC. More specifically, the condition that the salt (sodium) concentration is 48 to 780 mM and the temperature is 37 to 80 ° C. is preferable, and the salt concentration is preferably 97.5 to 390 mM and the temperature is 45 to 60 ° C. It is a condition.

After washing, the detection intensity is measured for each spot using an apparatus capable of detecting a label such as a nucleic acid bound to the probe. For example, when the nucleic acid or the like has been fluorescently labeled, various fluorescent detection devices such as CRBIO (Hitachi Software Engineering Co., Ltd.), arrayWoRx (GE Healthcare), Affymetrix 428 Array Scanner (Affymetrix, Inc.), GenePix ( Axon Instruments), ScanArray (PerkinElmer), a cooled CCD fluorescence detector manufactured by Mitsubishi Rayon Co., Ltd., and the like can be used to measure fluorescence intensity. For these devices, for example, in the case of a fluorescent scanner, scanning can be performed by appropriately adjusting the laser output and the sensitivity of the detector, and in the case of a CCD camera type scanner, the exposure time can be adjusted appropriately. A scan can be performed. A quantitative method based on the scan result is performed by quantitative software. There is no particular limitation on the quantification software, and quantification can be performed using the average value, median value, etc. of the fluorescence intensity of the spots. In quantification, in consideration of the dimensional accuracy of the spot range of the DNA fragment, it is preferable to make adjustments such as using the fluorescence intensity of the spot on which the probe is not mounted as the background (BG).
In this way, by detecting the detection intensity, nucleic acids derived from harmful or toxic dinoflagellates for detection purposes are detected, and then the abundance of various dinoflagellates is measured using the detection results as an index according to a conventional method. be able to.

5. Ocean monitoring method The ocean monitoring method of the present invention is a method characterized by analyzing a detection result obtained by using the detection method of the present invention and estimating the state of the ocean using the analysis result as an index.
A subject collected from seawater in a predetermined sea area to be monitored may be collected from one sea area or may be collected from a plurality of sea areas. If the target is collected from the sea area of Japan, the detection results of each of these subjects are compared and analyzed, and the analysis results are used as an index, for example, to estimate the impact of global warming on the marine situation You can also In this case, it is preferable to compare whether or not the predetermined dinoflagellate is detected for each of a plurality of subjects. Specifically, the presence or absence of detection for either or both of the genus Pyrodinium and the genus Gambierdiscus It is preferable to compare the degree of abundance.

In the above analysis, specifically, the detection pattern of the labeling substance on the microarray used for detection is considered to indicate the characteristics of the sea area. For example, when a specimen is collected from one sea area, the presence or absence of harmful or toxic dinoflagellates present in that sea area and the environmental condition of the ocean can be estimated. As another analysis mode, seawater is collected from a plurality of sea areas to form a plurality of specimens, and a statistical analysis is performed on the detection pattern of the labeled substance on the microarray used for each detection. It is done.
Examples of statistical analysis methods include correlation analysis, hierarchical clustering, and non-hierarchical clustering. More specifically, methods such as Pearson correlation and Cosine coefficient can be cited as distance functions used during correlation analysis. As hierarchical clustering, a technique such as UPGMA (unweighted-pair group method using arithmetic averages) can be cited. By performing cluster analysis using such an analysis method, it is possible to group each sea area, and further to determine the analogy of each sea area. As a result, for example, as described above, the influence of global warming on the marine situation can be estimated.

Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited to these examples.

Confirmation of probe specificity in mixed samples The following plankton genomic DNA was established and established in the cultivated strains of the Red Sea Environment Department Toxic Plankton Lab and the Red Sea Biology Lab. Extracted from subcultured samples. Genomic DNA extraction was performed using a nucleic acid extraction kit DNeasy Plant Mini Kit (QIGEN).
1 Cochlodinium Polykrikoides
2 Heterocapsa pygmaea
3 Heterocapsa triquetra
4 Heterocapsa ildefina
5 Heterocapsa arctica
6 Heterocapsa circularisquama
7 Chattonella ovata
8 Karenia mikimotoi
9 Gymnodinium catenatum
10 Alexandrium affine
11 Alexandrium catenella
12 Alexandrium fraterculus
13 Alexandrium tamiyavanichii
14 Alexandrium tamarense
15 Heterosigma akashiwo
16 Alexandrium minutum
17 Karenia degitata
18 Alexandrium taylori
19 Alexandrium ostenfeldii

The resulting genomic DNA concentration was adjusted to 1 ng / μl and stored at −80 ° C. until used as a PCR template.
Then, according to the following Table 1, genomic DNA was mixed and 20 types of samples were prepared. In Table 1, the part marked with “◯” indicates that 1 μl of the genomic DNA was mixed, and the part marked with “x” indicates that 1 μl of sterile water was mixed instead. That is, 20 kinds of 19 μl genomic DNA mixed solution were prepared.

<PCR reaction>
Next, the sequences of the large subunit ribosomal RNA (LSU rRNA) genes D1 and D2 of these harmful or toxic dinoflagellates were amplified.
PCR was performed with the following reaction solution composition and reaction conditions using the above-mentioned harmful or toxic dinoflagellate mixed genomic DNA as a template. The template DNA used was 19 μl to 1 μl mixed. The PCR kit was QIGEN HotStarTaq Master Mix Kit (QIAGEN) and GeneAmp 9700 (Applied Biosystems, 50 μl, 9600 emulation mode). Primers having the following sequences were used. The reverse primer used was one whose 5 ′ end was fluorescently labeled with Cy5.

Forward primer D1R:
5'-ACCCGCTGAATTTAAGCATA-3 '(SEQ ID NO: 1)
Reverse primer D2C:
5'-Cy5-CCTTGGTCCGTGTTTCAAGA-3 '(SEQ ID NO: 2)

<Reaction solution composition>
2 x HotStarTaq Master Mix 25μl
Primer mix (10μM each) 5μl
Template DNA (genomic mixture) 1μl
Sterile water 19μl
50 μl total

<Reaction conditions>
After heating at 94 ° C. for 5 minutes, “dissociation: 94 ° C. (30 sec) → annealing: 50 ° C. (60 sec) → synthesis: 72 ° C. (30 sec)” was performed for a total of 50 cycles, and then heated at 72 ° C. for 5 minutes. Then, it was cooled at 4 ° C.

The reaction solution after the PCR was subjected to column purification using a QIAGEN PCR MinElute purification kit (QIGEN) and eluted with 22 μl once. About 20 μl of PCR product was collected.

<DNA chip: Production of substrate for detecting harmful or toxic dinoflagellate algae>
A through-hole type DNA chip was produced by the same method as described in Example 1 of JP 2007-74950 A (Method for detecting methylated DNA and / or unmethylated DNA).
However, the mounted oligonucleotide probe (capture probe) was a probe having the sequence information shown in SEQ ID NOs: 3 to 23 below. FIG. 1 shows a sequence diagram of the produced DNA chip. The numbers in the figure indicate the probe numbers shown in SEQ ID NOs: 3 to 23. Here, the probes shown in SEQ ID NOs: 3, 5, 7, 17, 18, and 23 are known sequences.

Probe number 1 Bax-28F620_A.tamarense
GGTGTATGTGTGTGTTCCTGTGCTT (SEQ ID NO: 3)

Probe number 2 No1_1_A.tamarense
TGGGCTGTGGGTGTAATGATTCTTTC (SEQ ID NO: 4)

Probe number 3 Bac-28F630_A.catenella
GTTTGTGTCCTTGTCCTTGAGGTTG (SEQ ID NO: 5)

Probe number 4 No4_9_A.catenella
CTTGTCCTTGAGGTTGCTTTCTCCCTT (SEQ ID NO: 6)

Probe number 5 Atamiy-602_A.tamiyavanichii
TGTGTGCACATATTGTTCTTCAGGA (SEQ ID NO: 7)

Probe number 6 No7_2_A.tamiyavanichii
GCATGCGTGTATAAGCATTTGTGTGC (SEQ ID NO: 8)

Probe number 7 No7_3_A.tamiyavanichii
CATGAATGGTATTATTCCTGTGGGGG (SEQ ID NO: 9)

Probe number 8 No8_6_Afraterculus
GTGTGTGCTAGTTATTTGTGCATGTGCTGAC (SEQ ID NO: 10)

Probe number 9 No8_9_Afraterculus
GCAATGTTTGTTGCTGTGTGTGCTAG (SEQ ID NO: 11)

Probe number 10 No13_3_A.affine
TTCTTGAAGCTGGGCCTACCCTACTAGAG (SEQ ID NO: 12)

Probe number 11 GC01_G.catenatum
ACAAGCTAATGGTGACGAAATGGT (SEQ ID NO: 13)

Probe number 12 GC02_G.catenatum
ACACGCGTGGCACCTTCCTTACAAGC (SEQ ID NO: 14)

Probe number 13 No17_1_Gcatenatum
CAACAAACAGTTCAACCTTTGTGGGG (SEQ ID NO: 15)

Probe number 14 No.17_629_Gcatenatum
GTTGCTTCGTGTTGCGTGCTCTGGCG (SEQ ID NO: 16)

Probe number 15 Ki_and_Han_2006_Chattonella marina
TTACTCTCCTGTTGCTGTTTCTGTC (SEQ ID NO: 17)

Probe No. 16 BCp-28F689_C.polykrikoides
CTTGGGTTGATCGTGGGTCCTGACA (SEQ ID NO: 18)

Probe number 17 Kg01_K.degitata
AGAACTCATTTCTTAACTGATCTCTGC (SEQ ID NO: 19)

Probe number 18 Kg02_K.degitata
TGCTTCGGGTCTGGAGCTTCGGCTCT (SEQ ID NO: 20)

Probe number 19 No26_30_Karenia-degitata
CTTAACTGATCTCTGCATGTCTGGTCGC (SEQ ID NO: 21)

Probe number 20 No33_1_Karenia mikimotoi
GATCTTCTGCTCTGCATGAAGGTTGTTG (SEQ ID NO: 22)

Probe number 21 Bha-28F618_H.akashiwo
GTATGCTGGTGTCTACTGCTTGCAG (SEQ ID NO: 23)

<Hybridization to DNA chip>
Each solution was mixed as follows to prepare a hybridization solution.

19 μl of each sample number shown in Table 1
Sterile water 80μl
1M Tris / HCl (pH7.5) 18μl
1M NaCl 18μl
0.5% Tween-20 15μl
150 μl total

150 μl of the hybridization solution was brought into contact with (applied to) the DNA chip, and a hybridization reaction was performed at 50 ° C. for 16 hours.

<Washing>
After the hybridization reaction, the DNA chip was washed by the following procedures (a) to (d)
(a) Ten ml of 0.12M Tris · HCl / 0.12M NaCl / 0.05% Tween-20 was placed in a sterilized centrifuge tube, and two of them were prepared. Similarly, 10 ml of 0.12M Tris · HCl / 0.12M NaCl was put into a sterilized centrifuge tube, and one was prepared.
(b) Two containing 0.12M Tris · HCl / 0.12M NaCl / 0.05% Tween-20 solution were kept at 50 ° C., and the other one was kept at room temperature.
(c) When the heated washing solution was warmed to 50 ° C., the DNA chip was taken out of the chamber and immersed for 20 minutes. Thereafter, the DNA chip was taken out and transferred into another cleaning solution, and immersed again for 20 minutes.
(d) Thereafter, the DNA chip was transferred from the washing solution at 50 ° C. to the washing solution at room temperature.

<Detection>
After the washing, the fluorescence intensity of each spot was measured under the following detection conditions using a cooled CCD fluorescence detection device (model number: 0060304) manufactured by Mitsubishi Rayon.
<Detection conditions>
Central excitation wavelength: 630nm
Fluorescent filter: Cy5 filter Exposure time: 1000msec

<Background subtraction>
For each chip, the background value (the median value excluding the upper and lower 20% of the spot where the probe is not mounted) is subtracted from the fluorescence intensity of each spot, and the fluorescence intensity derived from hybridization (hereinafter referred to as signal intensity) Was calculated.

<Result>
The detection results (calculation results) of the signal intensities of sample numbers 1 to 20 are shown in Table 2 below.
For example, consider the result for sample number 15. Sample No. 15 does not contain A. tamarense genomic DNA from Table 1 and should not be detected by the DNA chip. Looking at the results in Table 2, when sample 15 is used, the signal intensity of probe numbers 1 and 2 is extremely low compared to other samples, and probe numbers 1 and 2 Both were considered to be detected specifically.

Similarly, consider the result for sample number 12. Sample No. 12 does not contain A.catenella genomic DNA from Table 1 and should not be detected by the DNA chip. The results of Table 2 show that when sample 12 is used, the signal intensity of probe numbers 3 and 4 is extremely low compared to other samples, and probe numbers 3 and 4 Both were considered to be detected specifically.
In the same manner, the specificity of other probes could be confirmed.

Addition of probe for tropical and subtropical plankton and additional test probe The following probe was added to the probe of the through-hole type DNA chip used in Example 1 to newly produce a through-hole type DNA chip.

Probe number 22 90622tamarense1
TTGGTGGGAGTGTTGCACT (SEQ ID NO: 24)

Probe number 23 90622tamarense2
ACTTGCTTGACAAGAGCTTTGGGC (SEQ ID NO: 25)

Probe number 24 90622tamarense3
CTGGTGTATGTGTGTGTTCC (SEQ ID NO: 26)

Probe number 25 90622tamarense4
GCTTGGGGATGCTTCCTTCCTTGGA (SEQ ID NO: 27)

Probe number 26 90622catenella1
TAACAATGGGTTTTGGCTGCA (SEQ ID NO: 28)

Probe number 27 90622catenella2
TGTGCCAGTTTTTATGTGGA (SEQ ID NO: 29)

Probe number 28 90622catenella3
GCATATGCATGTAATGATTTGCATGT (SEQ ID NO: 30)

Probe number 29 90622catenella4
TCCTTGTCCTTGAGGTTGCTTTCTC (SEQ ID NO: 31)

Probe number 30 90622fraterculus1
TGCATGTCGATGTGAATTGC (SEQ ID NO: 32)

Probe number 31 90622fraterculus2
GTGTGTGCTAGTTATTTGTGCATG (SEQ ID NO: 33)

Probe number 32 90622fraterculus3
CATGCATGCATGTGTGCTCAGG (SEQ ID NO: 34)

Probe number 33 90622fraterculus4
TGGGTGTTGTTCGCTGTATGG (SEQ ID NO: 35)

Probe number 34 90622ostenfeldii1
GAGATTGTTGCGTCCACTTGT (SEQ ID NO: 36)

Probe number 35 90622ostenfeldii2
GTGTGCCCTCTTGCCAAATG (SEQ ID NO: 37)

Probe number 36 90622ostenfeldii3
GGGCTCTCCTCCCTGGGCAC (SEQ ID NO: 38)

Probe number 37 90622bahamense1
GATTGTTGTGTGTTAGTGAC (SEQ ID NO: 39)

Probe number 38 90622bahamense2
AGTGACATAGGTCACCATGCAC (SEQ ID NO: 40)

Probe number 39 90622bahamense3
ACCTTGACATGTGTGCTGCAAG (SEQ ID NO: 41)

Probe number 40 90622bahamense4
TGTGCACCTTCTGGAACAACCC (SEQ ID NO: 42)

Probe number 41 90622mexicanum1
CTTGCTCCTCGCGCCCAGC (SEQ ID NO: 43)

Probe number 42 90622mexicanum2
GCTCCTCGCACCCAGCGCTCGGG (SEQ ID NO: 44)

Probe number 43 90622mexicanum3
CTTGGACGTGCTTGGGCGTGGGAGCTT (SEQ ID NO: 45)

Probe number 44 90622lima1
CATTCCCTTGCCAATTAATGCAA (SEQ ID NO: 46)

Probe number 45 90622lima2
CATTCCCTTGCCAACTAATGCAA (SEQ ID NO: 47)

Probe number 46 90622lima3
TGCAGCTCCCTGCCTACGAGGCA (SEQ ID NO: 48)

Probe number 47 90622lima4
AGCGCTCCATGCCTATCAGGCA (SEQ ID NO: 49)

Probe number 48 90622montis1
CTGTTGCAATGATTTTTTGTATCGTGATGC (SEQ ID NO: 50)

Probe number 49 90622montis2
GCAAGGCTATTGCAATGATTTTTTGTATAGTGATGC (SEQ ID NO: 51)

Probe number 50 90622montis3
AGAGCTTGCAATTGCTGAACTGATAAGC (SEQ ID NO: 52)

Probe number 51 90622Karenia brevis1
GGGACATGGTAATTTGCTTCCGGGC (SEQ ID NO: 53)

Probe number 52 90622Karenia brevis2
GTGTCTGGTCGCACTGCTCCG (SEQ ID NO: 54)

Probe number 53 90622Karenia brevis3
AATCTTCTGCTTGGCATGAAGGTTGCTA (SEQ ID NO: 55)

Probe number 54 90622taylory1
GCATGGGTTTAATGTGTAAATTGTATGAGC (SEQ ID NO: 56)

Probe number 55 90622taylory2
TTAGCTCGCATGTAGAGTGTCTGTGC (SEQ ID NO: 57)

Probe number 56 90622taylory3
CTGTGCAATGTAACATTGCAAC (SEQ ID NO: 58)

Probe number 57 90622 convolutum 1
GATGACAAAATGGTTCCATACG (SEQ ID NO: 59)

Probe number 58 90622 convolutum 2
GACAAAATGGTTCCATACGAC (SEQ ID NO: 60)

Probe number 59 90622 convolutum 3
GATGACAAAATGGTTCCATACGAC (SEQ ID NO: 61)

Probe number 60 90622toxicus1
GRAAGTGGAGTGYAAAGTGGGTGGTA (SEQ ID NO: 62)

Probe number 61 90622 toxicus2
TGAGGGAARYGTGAAAAGGACTTTGGA (SEQ ID NO: 63)

Probe number 62 90622toxicus3
ACTTGCTGAWGDGCAAGCATACAG (SEQ ID NO: 64)

The sequence diagram of the manufactured DNA chip is shown in FIG.
The numbers 1 to 21 in the figure are the probe numbers in Example 1 (probe numbers shown in SEQ ID NOs: 3 to 23), and the numbers 22 to 62 are the probe numbers (SEQ ID NOs: enumerated in Example 2). Probe numbers shown in 24-64).

As in Example 1, the following plankton genomic DNA was extracted and obtained, adjusted to 1 ng / μl, and stored at −80 ° C. until use.
20 Pyrodinium bahamense
21 Prorocentrum mexicanum
22 Prorocentrum lima
23 Karenia brevis
24 Alexandrium taylori
25 Cochlodinium convolutum
26 Gambierdiscus toxicus
27 Coolia montis
28 Ostreopsis siamensis

<PCR reaction>
Next, the sequences of the large subunit ribosomal RNA (LSU rRNA) genes D1 and D2 of these nine toxic dinoflagellates were amplified.
1 ng / μl Genomic DNA 1 μl was used as a template, and PCR was performed under the following reaction solution composition and reaction conditions. The PCR kit was QIGEN HotStarTaq Master Mix Kit (QIAGEN) and GeneAmp 9700 (Applied Biosystems, 50 μl, 9600 emulation mode). Primers having the following sequences were used. The reverse primer used was one whose 5 ′ end was fluorescently labeled with Cy5.

Forward primer D1R:
5'-ACCCGCTGAATTTAAGCATA-3 '(SEQ ID NO: 1)
Reverse primer D2C:
5'-Cy5-CCTTGGTCCGTGTTTCAAGA-3 '(SEQ ID NO: 2)

<Reaction solution composition>
2 x HotStarTaq Master Mix 25μl
Primer mix (10μM each) 5μl
Template DNA (genomic DNA) 1μl
Sterile water 19μl
50 μl total

<Reaction conditions>
After heating at 94 ° C. for 5 minutes, “dissociation: 94 ° C. (30 sec) → annealing: 68 ° C. (60 sec) → synthesis: 72 ° C. (30 sec)” was performed for a total of 50 cycles, and then heated at 72 ° C. for 5 minutes. Then, it was cooled at 4 ° C.

The reaction solution after the PCR was subjected to column purification using a QIAGEN PCR MinElute purification kit (QIGEN) and eluted with 22 μl once. About 20 μl of PCR product was collected. When the collected PCR product was electrophoresed, a single band was observed around 700 to 800 bp.
These nine types of purified PCR were hybridized to a DNA chip to confirm the specificity of the probe.

<Hybridization to DNA chip>
Each solution was mixed as follows to prepare a hybridization solution.

15 μl of purified PCR product sample
Sterile water 84μl
1M Tris / HCl (pH7.5) 18μl
1M NaCl 18μl
0.5% Tween-20 15μl
150 μl total

150 μl of the hybridization solution was brought into contact with (applied to) the DNA chip, and a hybridization reaction was performed at 50 ° C. for 16 hours.

<Washing>, <Detection>, <Background subtraction>
These were carried out in the same manner as in Example 1.

<Result>
The signal intensity detection results (calculation results) are shown in Table 3 below. Here, it was found that probe numbers 19 and 20 were not probes to be used because the signal intensity increased when hybridizing Karenia brevis.
Moreover, the following was also found from the results in Table 3.
Comparison of probe numbers 37, 38, 39 and 40 revealed that the probe number 40 had the highest signal intensity and could be detected specifically. That is, it was found that the probe number 40 was suitable for detecting Pyrodinium bahamense.
Comparison of probe numbers 60, 61, and 62 showed that the signals of probes 60 and 61 had an increased signal intensity even with those other than Gambierdiscus toxicus, and only probe 62 could be used. That is, it was found that the probe number 62 sequence is suitable for detection of Gambierdiscus toxicus.

Comparison of probe numbers 41, 42 and 43 revealed that the probe number 43 had the highest signal intensity and could be detected specifically. That is, it was found that the probe number 43 was suitable for detection of Prorocentrum mexicanum.
Comparison of probe numbers 57, 58, and 59 revealed that the 59th probe had the highest signal intensity and could be detected specifically. That is, it was found that the probe number 59 is suitable for detecting Cochlodinium convolutum.
Comparison of probe numbers 51, 52, and 53 revealed that probe 51 or 52 had the highest signal intensity and could be detected specifically. That is, it was found that the probe number 51 or 52 sequence was suitable for detection of Karenia brevis.

Comparison of probe numbers 48, 49 and 50 revealed that the probe number 48 had the highest signal intensity and could be detected specifically. That is, it was found that the probe number 48 was suitable for detection of Coolia montis.
Comparison of probe numbers 44, 45, 46, and 47 revealed that the probe number 44 had the highest signal intensity and could be detected specifically. That is, it was found that the probe number 44 sequence is suitable for detecting Prorocentrum lima.
Comparison of probe numbers 54, 55, and 56 revealed that the 55th probe had the highest signal intensity and could be detected specifically. That is, it was found that the probe number 55 was suitable for detecting Alexandrium taylori.

In order to obtain a DNA chip that can withstand practical evaluation rather than evaluation using a sample obtained by adding specific plankton to seawater, the probe was continuously evaluated using the DNA chip manufactured in Example 2.

<Sample preparation>
About 1 liter of Hiroshima Bay Pier sea water on July 28, 2009 was taken and autoclaved to obtain sterilized sea water. In 50 ml of this sterilized seawater, 50 types of cultured cells were added for each species in the following combinations (1) to (12) and (N) to prepare 13 types of samples. Thereafter, 50 ml of these solutions were filtered on a 5 micron Nuclepore filter (diameter 24 mm). A solution in which Chelex100 Resin (manufactured by Bio-Rad) was suspended in 25 mM NaOH so as to be 10% (w / vol) was prepared. The filtered filter paper was put into 500 μl of this solution and heated at 100 ° C. for 10 minutes. After cooling on ice, vortex mixing was performed, and 100 μl of 100 mM Tris-HCl (pH 7.5) was further added, followed by vortex mixing. Then, it centrifuged with the tabletop centrifuge, the sediment was settled to the bottom, and the supernatant was used as a DNA extraction solution. In this way, 12 types of mixed DNA solutions and a negative control solution were prepared.

<Sample number, combination type>
(1) A.tamarense, A.catenella, A.fraterculus
(2) A. tamarense, A. catenella
(3) A. fraterculus, A. ostenfeldii, H. akashiwo
(4) H.akashiwo, G.catenatum, K.mikimotoi
(5) G.catenatum, K.mikimotoi, K.brevis
(6) K.brevis, C.polykrikoides, H.circularisquama
(7) C.polykrikoides, H.circularisquama, A.affine
(8) A.affine, A.tamiyavanichii, A.taylori
(9) A.tamiyavanichii, A.taylori, C.montis
(10) C.montis, Chattonella ovata, P.bahamense
(11) Chattonella ovata, P.bahamense, P.lima
(12) P.lima, P.mexicanum, A.tamarense
(N) Only seawater without any of the above cultured cells (Negative-Control)

All 26 kinds of these DNA solutions were used as a template for PCR reaction.

<PCR reaction>, <Purification after PCR reaction>, <Hybridization>, <Washing>,
<Detection>, <Background subtraction>
These were carried out in the same manner as in Example 1. However, the DNA chip manufactured in Example 2 was used. The detection results (calculation results) of the signal intensity with the DNA chip are shown in Table 4 below. In Table 4, the portion surrounded by a thick square is the type of plankton added to seawater. Further, the site shown in gray is a site where unexpected cross-hybridization has occurred. When no signal was added and the signal intensity was 500 or more, it was determined that cross-hybridization had occurred.
From a comprehensive judgment combining the results of Table 4 below and the results of Examples 1 and 2, a novel probe was found that could be specifically detected without cross-hybridization in all samples. . These new probes are shown in Table 5.

SEQ ID NOs: 1 to 64: synthetic DNA

Claims (10)

As a base sequence capable of hybridizing to the base sequence of the D1 region or D2 region of the large subunit ribosomal RNA gene in the chromosomal DNA of harmful or toxic dinoflagellates, the base sequence of each of the following DNAs (a) or (b): An oligonucleotide probe set for detecting harmful or toxic dinoflagellates, comprising:
(a) Each DNA consisting of the base sequence shown in SEQ ID NOs: 4, 7, 8, 10-16, 20, 22, 27, 29, 31-35, 39-47 and 50-58
(b) The D1 region or D2 region of the large subunit ribosomal RNA gene in the chromosomal DNA of harmful or toxic dinoflagellate having 90% or more identity to the base sequence of each DNA of (a) above Each DNA having a function capable of detecting the nucleotide sequence of The harmful or toxic dinoflagellate is at least one selected from the group consisting of the genus Alexandrium, Dinophysis, Gambierdiscus, Gymnodinium, Karenia, Ostreopsis, Pfiesteria, Prorocentrum, Protoceratium, Protoperidinium and Pyrodinium there, according to claim 1 Symbol placement oligonucleotide probe sets. A microarray for detecting harmful or toxic dinoflagellates, wherein the oligonucleotide probe set according to claim 1 or 2 is arranged on a substrate. Detection of harmful or toxic dinoflagellate having a plurality of through-holes, wherein the gel is held in the through-holes, wherein the oligonucleotide probe set according to claim 1 or 2 is held in the gel Microarray. A method for detecting harmful or toxic dinoflagellates,
A step of collecting seawater from a predetermined sea area as a specimen, extracting a nucleic acid derived from a living organism in the specimen, and the oligonucleotide probe set according to claim 1 or 2, or the claim 3 or 4. The method comprising the step of contacting the microarray of claim 4 . The method according to claim 5 , wherein the subject is a plurality of subjects obtained by collecting seawater from a plurality of predetermined sea areas. A marine monitoring method, comprising analyzing a detection result obtained by the method according to claim 5 or 6 and estimating a marine situation using the analysis result as an index. A marine monitoring method characterized by comparing and analyzing detection results for each of the plurality of subjects obtained by the method according to claim 6 and estimating the influence of global warming on the marine situation using the analysis results as an index. . 9. The method of claim 8 , comprising comparing for each of the plurality of subjects whether a predetermined harmful or toxic dinoflagellate has been detected. 10. The method according to claim 9 , wherein the predetermined harmful or toxic dinoflagellate is of the genus Pyrodinium and / or Gambierdiscus.