JP5668997B2 - Attention-deficit / hyperactivity disorder model rat - Google Patents

Description

  The present invention relates to attention deficit / hyperactivity disorder model non-human mammals. More particularly, the invention relates to a attention deficit / hyperactivity disorder model non-human mammal having a genetic abnormality homologous to a gene associated with human autosomal dominant nocturnal frontal epilepsy, wherein the human attention deficit / hyperactivity This relates to a model of attention deficit / hyperactivity disorder model non-human animals showing behavioral disorders related to sexual disorders. The present invention also relates to a method for screening an attention deficit / hyperactivity disorder prophylactic or therapeutic drug using an attention deficit / hyperactivity disorder model non-human mammal, and a method for evaluating attention deficit / hyperactivity disorder of a test drug. It is about.

  Attention-Deficit / Hyperactivity Disorder (AD / HD) is one of the developmental disorders characterized by hyperactivity, inattention and impulsivity, and maintains attention. It is a mental illness mainly found in a few percent of children from infancy to school age, which is difficult to perform, has a sense of time, and is not good at collecting various information.

  Although the cause of attention deficit / hyperactivity disorder (AD / HD) is unknown, the central nervous system stimulant methylphenidate hydrochloride is now commonly used as the first-line drug for AD / HD. However, methylphenidate hydrochloride is highly addictive, and side effects such as headache and insomnia have been reported. Moreover, although it has been reported that nicotine skin patch therapy reduces AD / HD symptom (nonpatent literature 1), there exists a fault that nicotine also has addictive property. Furthermore, although it has been reported that the nicotine receptor agonist ABT-418 improves inattentive symptoms of AD / HD (Non-patent Document 2), it has not yet been obtained for adaptation (see, for example, Patent Document 1). . In addition, nefiracetam improves the short-term memory processing efficiency, including attentional aspects, using spontaneous alternation behavior as an index in stroke-prone spontaneously hypertensive rats (SHRSP). It is described that it is effective in the treatment of the inattentive symptoms (for example, refer patent document 1). However, at present, there is no established treatment for AD / HD.

  In order to elucidate the cause of AD / HD and establish prevention and treatment methods, it is urgent to establish an animal model of this disease, and various animal models have been developed for this purpose. Such AD / HD animal models include, for example, two rat lines established by selective mating (SHR and NHE), one mouse line produced by gene targeting (DAT-KO), and chromosome deletion due to neutron irradiation. 1 mouse strain (Coloboma mutant mouse), 1 inbred mouse strain (I / LnJ) showing the phenotype of callosal (a / LnJ) (see Non-patent Document 3, for example), hepatitis, liver cancer, human A hypergenic disorder model rat (Patent Document 2) of a congenic strain established by backcrossing a Wilson disease model LEC rat to a Wistar WKAH rat is known.

  Among the various animal models, at present, spontaneously hypertensive rats (SHR) are most frequently used (see, for example, Non-Patent Document 4). However, the hyperactivity disorder observed in SHR does not necessarily reflect the hyperactivity disorder in humans, and heritability is still unclear (for example, see Non-patent Document 5). In addition, SHR's successor, stroke-prone spontaneously hypertensive rat (SHRSP), shows impaired spontaneous alternation behavior due to the Y-maze, and behavioral behavior as an ADHD model such as inattention, hyperactivity and impulsivity In addition, there are reports of having pharmacological characteristics (see Non-Patent Document 6, for example).

  In view of the current state of the prior art as described above, there is still a need to establish an AD / HD animal model that exhibits behavioral disorders that approximate human AD / HD. Therefore, the present inventors are an autosomal chromosome that is one of the familial epilepsy characterized by an epileptic seizure at night, which is an epilepsy model rat established by Shinichi Hirose et al., One of the present inventors as an epilepsy model animal. Behavioral patterns of rats having mutations in the genes of CHRNA4 and CHRNB2, which are genes of α4 and β2 subunits of neuronal acetylcholine receptor as a causative gene abnormality of dominant nocturnal frontal lobe epilepsy (see, for example, Non-Patent Documents 7 to 14) As a result, the present invention was completed by finding that the epilepsy model rat exhibits a behavioral disorder that more closely resembles human AD / HD.

JP 2005-89299 A JP 2001-186828 A

Psychopharmacol Bull 32 (1996) 67-73, Psychopharmacology 123 (1996) 55-63 Am J Psychiatry 156 (1999) 1931-1937 Davids, E., et al. 2003. Brain Research Reviews, 42, 1-21 Hendley ED, et al. Am J Physiol 1991; 261 (2 Pt 2): H583-589; Boix F, et al. Behav Brain Res 1998; 94: 153-162; Carey MP, et al. Behav Brain Res 1998; 94: 173-185; Papa M, et al. Behav Brain Res 1998; 94: 187-195; Papa M, et al. Behav Brain Res 1998; 94: 197-211 Behav Neural Biol 53 (1990) 88-102; Behav Neural Biol 58 (1992) 103-112, Behav Brain Res 94 (1998) 73-82 Jpn J Pharmacol 82 (Suppl I) (2000) 230P; Clin Exp Hypertens 22 (2000) 387; Jpn J Pharmacol 85 (Suppl I) (2001) 249P; Clin Exp Hypertens 23 (2001) 427-42 Hirose, S., et al., Neurology 53: 1749-1753, 1999 Steinlein, O.K., et al. Nat Genet 11, 201-203 (1995). Hirose, S., et al. Neurology 53, 1749-1753 (1999). Steinlein, O.K., et al. Epilepsia 41, 529-535 (2000). Steinlein, O.K., et al. Hum Mol Genet 6, 943-947 (1997). De Fusco, M., et al. Nat Genet 26, 275-276 (2000). Phillips, H.A., et al. Am J Hum Genet 68, 225-231 (2001). Bertrand, D., et al. Neurobiol Dis 20, 799-804 (2005)

  Accordingly, an object of the present invention is to provide an AD / HD model non-human mammal exhibiting a behavioral disorder associated with attention deficit / hyperactivity disorder that approximates human AD / HD.

Specifically, the present invention relates to a non-human mammal having the same genetic abnormality as a human epilepsy gene abnormality, wherein the non-human β2 subunit CHRNB2 of the neuronal acetylcholine receptor gene associated with human autosomal dominant nocturnal frontal lobe epilepsy is disclosed. and to provide attention deficit / hyperactivity disorder (AD / HD) models of non-human mammals in which the gene mutation is mutagenized to C Hrnb2 human mammal.

  In order to achieve the above object, the present invention provides an AD / HD model non-human mammal that exhibits behavioral disorders related to attention deficit / hyperactivity disorder that is more similar to human AD / HD.

The present invention provides, as one preferred embodiment, an attention deficit / hyperactivity disorder (AD / HD) model rat having the same gene abnormality as a human epilepsy gene abnormality, and a neuron associated with human autosomal dominant nocturnal frontal lobe epilepsy to C Hrnb2 non-human mammals beta 2 subunit CHRNB2 of acetylcholine receptor gene, by mutagenesis, a 856 th of the cDNA G (guanine) is C (cytosine) (c.856G> C) or a (adenine (2) An attention deficit / hyperactivity disorder (AD / HD) model rat characterized by having a base sequence represented by SEQ ID NO: 19 or 22 mutated in (c.856G> A), respectively .

The present invention, as still another preferred embodiment, the upper Symbol Chrnb2 to c.856G> C or c.856G> A is introduced mutations, is p.286 No. homologous amino acid residue Val of the β2 subunit CHRNB2 Attention deficit / hyperactivity disorder (AD / HD) model rats are provided, each of which is replaced by Leu or Met;

  The attention deficit / hyperactivity disorder (AD / HD) model non-human mammal according to the present invention exhibits a behavioral disorder related to attention deficit / hyperactivity disorder approximated by human AD / HD. Can be screened for preventive or therapeutic agents for attention deficit / hyperactivity disorder (AD / HD) by confirming their effectiveness against attention deficit / hyperactivity disorder (AD / HD) Efficacy against deficit / hyperactivity disorder (AD / HD) can be assessed.

The figure which shows the enzyme site in Sma I / Bpu1102 I site | part of CHRNA4. (A) shows the enzyme site of wild type CHRNA4, (B) shows the enzyme site of the probe. 1 is a schematic diagram showing an expression vector constructed in Example 1. FIG. Schematic which shows the structure of PDGF promoter and rat Chrna4 in a SnaB I / NaeI site. The figure which shows the enzyme site in Hinc II / Sma I site | part of CHRNB2. (A) shows the enzyme site of wild type CHRNB2, and (B) shows the enzyme site of the probe. Schematic showing the expression vector constructed in Example 4. Schematic which shows the structure of PDGF promoter and rat Chrnb2 in SnaB I / Dra III site. The figure which shows the result of having measured the electroencephalogram (EEG) of a transgenic rat (Chrnb2 V287L). The enlarged view of the symbol A part of FIG. The enlarged view of the symbol B part of FIG. The figure which shows the open field apparatus used for the measurement of a spontaneous exercise amount. The figure which shows the spontaneous momentum of a Tg rat and a nonTg rat. The figure which shows the frequency | count of a standup of a Tg rat and a nonTg rat. The figure which shows the elevated plus maze apparatus used for measurement of anxiety-like action. The figure which shows the open arm residence time of a Tg rat and a nonTg rat, and the frequency | count which crossed the open arm.

  The attention deficit / hyperactivity disorder (AD / HD) model non-human mammal according to the present invention is a neuron associated with human autosomal dominant nocturnal frontal lobe epilepsy, which is one of familial epilepsy characterized by nocturnal epileptic seizures Recombinant gene mutation of nicotinic acetylcholine receptor α4 subunit (CHRNA4) gene or β2 subunit (CHRNB2) gene, part of the nucleotide sequence of the gene is different from the nucleotide sequence, but the amino acid sequence is It is a genetically modified non-human mammal that has a mutant gene into which an identical probe is introduced and that lacks or lacks the function of the α4 subunit CHRNA4 gene or β2 subunit CHRNB2 gene of the neuronal nicotinic acetylcholine receptor. It is characterized by exhibiting behavioral disorders that closely approximate human AD / HD. Therefore, the model mammal according to the present invention can be used as an attention deficit / hyperactivity disorder (AD / HD) model. This attention deficit / hyperactivity disorder (AD / HD) model non-human mammal is an epilepsy model rat that has been established as an epilepsy model animal by Shinichi Hirose, one of the inventors of the present invention. Has already filed a patent application as Japanese Patent Application No. 2008-31002. Therefore, the matters described in Japanese Patent Application No. 2008-31002 can be regarded as constituting part of the present patent application.

  Here, the term “non-human mammal” means mammals other than humans such as mice, rats, rabbits, dogs, cats, pigs, horses, cows, etc., but rats are used for the development of antiepileptic drugs. It can be said that it is more preferable from the viewpoint that it has been used for many years. Further, in this specification, for the sake of brevity, the description will be made with a rat as an example, but the present invention is not particularly limited to the rat.

  At present, a disease model animal having a genetic abnormality can be generally produced by a recombinant animal production method commonly used in the art. In this invention, attention deficit / hyperactivity disorder (AD / HD) model non-human mammal is an epilepsy model for human autosomal dominant nocturnal frontal lobe epilepsy, which is one of familial epilepsy characterized by nocturnal epileptic seizures. Animals (ie, attention deficit / hyperactivity disorder (AD / HD) model non-human mammals) can be produced by recombinant animal production methods conventionally used in the art.

  For this purpose, first, homologous genes of neuronal nicotinic acetylcholine receptor α4 subunit (CHRNA4) gene or β2 subunit (CHRNB2) gene related to human autosomal dominant nocturnal frontal lobe epilepsy are obtained from rats and other conventional methods such as PCR cloning. Isolated according to The nucleotide sequence information of rat Chrna4 cDNA is registered as NM_000744 (NCBI) of the nucleotide sequence information of L31620 human CHRNA4 cDNA, and the nucleotide sequence information of rat Chrnb2 cDNA is registered as NM_019297 (NCBI).

  The base sequence of cDNA (wild type) of rat neuronal nicotinic acetylcholine receptor α4 subunit (Chrna4) gene is as follows. The underlined portion indicates a portion that is replaced with a probe in the present invention. The corresponding amino acid sequence is as shown in SEQ ID NO: 30.

(SEQ ID NO: 1)
ATGGCCAATTCGGGCACCGGGGCGCCGCCGCCGCTGCTGCTACTGCGCTGCTGCTGCTCCTAGGGACCGGCCTCTTGCCTGCTAGCAGCCACATAGAGACCC GGGCCCATGCGGAGGAGCGGCTCCTGAAGAGACTCTTCTCCGGTTACAACAAGTGGTCTCGGTCAGCATTGTTGGCTCTTCCT

  The nucleotide sequence of the rat neuronal nicotinic acetylcholine receptor β2 subunit (Chrnb2) gene cDNA (wild type) is as follows. The underlined portion indicates a portion that is replaced with a probe in the present invention. The corresponding amino acid sequence is as shown in SEQ ID NO: 31.

(SEQ ID NO: 2)
GTG CCTCCCACCTCCCTCGATGTACCGCTGGTGGGCAAGTACCTCATGTTTACCATGGTGCTAGTCACCTTCTCCATCGTCACCAGCGTGTGTGTGCTCAATGTGCACCACCGCTCGCCTACCACGCACACCATGGCCCCCTGGGTCAAGGTGGTCTTCCTGGAGAAGCTGCCCACCCTGCTCTTCCTGCAGCAGCCACGCCACCGCTGTGCACGTCAGCGTCTGCGCTTGAGGAGGCGCCAGCGAGAGCGTGAGGGCGCAGGCGCGCTTTTCTTCCGTGAAGGTCCTGCGGCTGACCCATGTACCTGCTTTGTC AACCCTGCATCAGTGCAGGGCTTGGCTGGGGCTTTCCGAGCTGAGCCCACTGCAGCCGGCCC GGGGCGCTCTGTGGGGCCATGCAGCTGTGGCCTCCGGGAAGCAGTGGATGGCGTACGCTTCATTGCGGACCACATGCGAAGTGAGGATGATGACCAGAGTGTGAGGGAGGACTGGAAATACGTTGCCATGGTGATCGACCGCCTGTTCCTGTGGATCTTTGTCTTTGTCTGTGTCTTTGGGACCGTCGGCATGTTCCTGCAGCCTCTCTTCCAGAACTACACTGCCACTACCTTCCTCCACCCTGACCACTCAGCTCCCAGCTCCAAGTGA

  Thus obtained cDNA clones can be mutated by known mutagenesis methods. As the mutagenesis method that can be used in the present invention, a conventional method such as a site-specific mutagenesis method that has been widely used in the art may be used. This site-directed mutagenesis method can introduce any mutation into cDNA at any site in a site-specific manner. The mutation that can be introduced into the cDNA site in a site-specific manner is not particularly limited, and the mutation may be a modification such as deletion, deletion, substitution or addition.

  Therefore, also in this invention, the site-specific mutagenesis method can be used to introduce a predetermined mutation into isolated rat Chrna4 or Chrnb2, and as a result, the homologous gene Chrna4 or Chrnb2 of the rat into which the mutation has been introduced is It retains a base sequence encoding a protein having a function related to seizures of human autosomal dominant nighttime frontal epilepsy.

  As used herein, the term “homologous gene” or a related term is a genetic term that refers to a base sequence of a gene that is similar to that of a gene in a heterologous animal that is considered to have the same ancestor. In addition, the encoded protein also has a similar function.

  In this invention, the cDNA of rat neuronal nicotinic acetylcholine receptor subunit gene can be prepared as follows.

  Specifically, using a rat cDNA clone as a template, based on the existing rat Chrna4 or Chrnb2 cDNA sequence, two types of primers, for example, a forward primer and a reverse primer having the following base sequences are designed and prepared.

The forward primer (40mer) (SEQ ID NO: 3) and reverse primer (38mer) (SEQ ID NO: 4) prepared based on the cDNA sequence of rat Chrna4 have the following base sequences.
Sequence number 3: AGATCTCGCGAAGCTTCACCATGGCCAATTCGGGCACCGG
Sequence number 4: AGATCTAGATCAGCAAGCAGCCAGCCAGGGAGGCAGGA
The forward primer (41mer) (SEQ ID NO: 5) and reverse primer (40mer) (SEQ ID NO: 6) prepared based on the rat Chrnb2 cDNA sequence have the following base sequences.
Sequence number 5: AGATCTCGCGACATGGCCGGGCACTCCAACTCAATGGCGCT
Sequence number 6: ATCGATGGATCCTCACTTGGAGCTGGGAGCTGAGTGGTCA

  PCR is performed using these primers, and the resulting PCR product is subcloned into an appropriate vector. Sequence the resulting clones and confirm the nucleotide sequences of the Chrna4 and Chrnb2 cDNAs.

  Next, a mutation is introduced into an arbitrary site of the cDNA clone obtained as described above. Various methods are known for introducing mutations, any of which can be applied to the present invention. In particular, any mutation can be introduced at any site by using a mutation introducing method such as site-directed mutagenesis.

As described above, CH280 gene abnormalities include S280F, S284L, and 291-2.
92insL has been reported. Further, V287L, V287M and I312M have been reported as genetic mutations in the CHRNB2 gene.

  Therefore, in the present invention, for example, the CHRNA4 gene is isolated from rat Chrna4 (wild type) (SEQ ID NO: 1) and rat Chrnb2 (wild type) (SEQ ID NO: 2) isolated by PCR cloning as described above. A mutation of a species-specific homologous gene corresponding to V287L or V287M, which is a gene mutation of S280F, S284L, or 291-292insL or CHRNB2, which is a genetic abnormality, can be mutated by the above-described mutagenesis method.

  That is, for the mutation introduction, a predetermined mutation can be introduced into a predetermined mutation introduction site by a commercially available kit using an appropriate sense primer and antisense primer. The sense primer and antisense primer that can be used for this mutagenesis are generally 20 mer to 40 mer, preferably 25 mer to 35 mer. In this case, it is preferable to introduce a mutation by devising a primer, a mutation introduction site, etc. so that a restriction enzyme cleavage site newly appears at the mutation introduction site.

  Specifically, for example, to introduce a mutation of S282F (S280F in humans) into wild-type rat Chrna4, using the following sense primer (29mer) and antisense primer (29mer), cDNA nucleotide sequence # 845 C can be mutated to T (c.845C> T) and G at position 846 to C (c.846G> C). By this mutagenesis, the amino acid residue Ser homologous to the p.282 of CHRNA4 is replaced with Phe.

The base sequences of the sense primer (SEQ ID NO: 7) and the antisense primer (SEQ ID NO: 8) that can be used are as follows.
SEQ ID NO: 7: CACACTGTGCATCTTCGTGCTGCTTTCTC
Sequence number 8: GAGAAAGCAGCACGAAGATGCACAGTGTG
The base sequence of the mutagenized rat cDNA generated by the mutagenesis is as follows.

(SEQ ID NO: 9)

  Similarly, in order to introduce a mutation of S286L (S284L in humans) into wild-type rat Chrna4, the T of the nucleotide sequence 856 of cDNA is changed to C using the following sense primer (29mer) and antisense primer (29mer). (c.856T> C) and 857 C can be mutated to T (c.857C> T). This mutagenesis replaces the amino acid residue Ser homologous to p.286 of CHRNA4 with Leu.

The base sequences of the sense primer (SEQ ID NO: 10) and the antisense primer (SEQ ID NO: 11) that can be used are as follows.
Sequence number 10: CGGTGCTGCTTCTTCTCACCGTCTTCCTG
Sequence number 11: CAGGAAGACGGTGAGAAGAAGCAGCACCG

  The base sequence of the mutagenized cDNA generated by the mutagenesis is as follows.

(SEQ ID NO: 12)

  Similarly, by inserting GCT (c.878-879insGCT) between nucleotide sequences 878 and 879 of the cDNA of wild type rat Chrna4, using the following sense primer (30mer) and antisense primer (30mer) Leu is inserted between amino acid residue Leu that is homologous to p.293 of CHRNA4 (291 in humans) and Ile that is homologous to p.294 (292 of humans).

The base sequences of the sense primer (SEQ ID NO: 13) and the antisense primer (SEQ ID NO: 14) that can be used are as follows.
Sequence number 13: GTCTTCCTGCTGCTGCTCATCACCGAGATC
Sequence number 14: GATCTCGGTGATGAGCAGCAGCAGGAAGAC

  The base sequence of the mutagenized cDNA generated by the mutagenesis is as follows.

(SEQ ID NO: 15)

  In the same manner as in the case of c.878-879insGCT above, by inserting TTA (c.879-880insTTA) between the nucleotide sequence 879 and 880 of the wild-type rat Chrna4 cDNA, Leu is inserted between amino acid residue Leu which is homologous to human and the amino acid residue Ile which is homologous to p.294 (human and 292).

(SEQ ID NO: 16)

  Similarly, for example, by introducing a mutation of V287L into wild type rat Chrnb2, the cDNA of the rat homologous gene Chrnb2 has a forward primer consisting of the base sequence represented by SEQ ID NO: 16 and the base represented by SEQ ID NO: 17. Using the reverse primer consisting of the sequence, c.856th G was replaced with C (c.856G> C), and Val of amino acid residue p.286 homologous to human neuronal acetylcholine receptor β2 subunit CHRNB2 Is replaced by Leu.

The base sequences of the sense primer (30mer) (SEQ ID NO: 17) and the antisense primer (30mer) (SEQ ID NO: 18) that can be used are as follows.
Sequence number 17: CTCATCTCCAAGATTATGCCTCCCACCTCC
Sequence number 18: GGAGGTGGGAGGCATAATCTTGGAGATGAG

  The base sequence of the mutagenized cDNA generated by the mutagenesis is as follows.

(SEQ ID NO: 19)

  Similarly, by introducing a mutation of V287M into wild-type rat Chrnb2, the cDNA of the rat homologous gene Chrnb2 has a forward primer consisting of the nucleotide sequence represented by SEQ ID NO: 20 and the nucleotide sequence represented by SEQ ID NO: 21. Using the reverse primer consisting of: c.856th G is replaced with A (c.856G> A), and the Val of amino acid residue p.286 homologous to human neuronal acetylcholine receptor β2 subunit CHRNB2 is Replaced by Met.

The base sequences of the sense primer (30mer) (SEQ ID NO: 20) and the antisense primer (30mer) (SEQ ID NO: 21) that can be used are as follows.
Sequence number 20: CTCATCTCCAAGATTCTGCCTCCCACCTCC
Sequence number 21: GGAGGTGGGAGGCAGAATCTTGGAGATGAG
The base sequence of the mutagenized cDNA generated by the mutagenesis is as follows.

(SEQ ID NO: 22)

  In this invention, by devising the type of mutation to be mutated as described above so as to correspond to the base sequence of the codon located at the mutation introduction site, a new enzyme site appears at the mutation introduction site. Can do.

  For example, for Chrna4, a cleavage site (T ↓ TAA) by restriction enzyme Tru9 I (MseI) appears by mutating 879-880insTTA. As for Chrnb2, a cleavage site (G ↓ ANTG) by the restriction enzyme Hinf If appears by introducing V287L or V287M. In addition, the arrow (↓) has shown the cutting | disconnection location. However, the types of restriction enzymes and cleavage sites are not limited to these, and can be appropriately selected by changing the mutation introduction.

  In the present invention, nucleotides having a predetermined base sequence are introduced into the cDNA as a probe. The probe to be introduced is a nucleotide that is devised so that the original amino acid sequence is the same, although the base sequence is completely or almost completely different from the original base sequence, and the number of bases is generally about 30 bp to 200 bp, preferably about 50 bp to 150 bp, more preferably about 60 bp to 120 bp. These nucleotides can be prepared according to a conventional method commonly used in the art, such as a DNA synthesis method.

  Specifically, for example, for a mutated cDNA of the Chrna4 gene, the base sequence from the c.104th to the c.221st of the cDNA is different, but the amino acid sequence is the same. Thus, a nucleotide having the following base sequence (118 bp) can be prepared as a probe.

(SEQ ID NO: 23)
GGGCTCACGCCGAAGAACGCCTGCTCAAAAGGCTGTTTTCTGGCTATAATAAATGGTCCCGCCCCGTGGCTAACATTTCCGACGTCGTGCTGGTGCGGTTCGGATTATCTATCGCTCA

  Similarly, for example, for a mutated cDNA of Chrnb2, the base sequence from c.1171 to c.1232 of the cDNA is different from the base sequence, but the amino acid sequence is the same. A nucleotide having the following base sequence (62 bp) can be prepared as a probe.

(SEQ ID NO: 24)
AACCCCGCCTCCGTCCAAGGACTCGCCGGCGCCTTTAGGGCCGAACCTACCGCCGCTGGCCC

  Next, after hybridization of the nucleotide probe prepared as described above, the probe is introduced according to a conventional method using a restriction enzyme site. For example, an appropriate vector such as pCRII-TOPO vector Sma I and Bpu1102 I (also known as Esp I or Cel II) is inserted into a predetermined site of the Chrna4 mutation-introduced cDNA having the above-mentioned base sequence. The site can be inserted by a probe introduction method commonly used in the art. In addition, for example, the probe represented by SEQ ID NO: 22 is added to a predetermined site of the Chrnb2 mutation-introduced cDNA having the above base sequence, to the restriction enzyme sites Hinc I and Sma I of an appropriate vector such as pCRII-TOPO vector. It can be inserted by a probe introduction method commonly used in the art. Sequencing was performed at each step, and the base sequence was confirmed.

  The nucleotide sequence (SEQ ID NO: 25) of the probe-introduced mutant gene cDNA (S282FPB) obtained by introducing the probe represented by SEQ ID NO: 2 into the rat Chrana4 mutant cDNA (S282F) (S280F in humans) is as follows: It is. In addition, due to mutations of c.845C> T and c.846G> C, the 844th to 846th TCG is mutated to TTC as underlined, and the probe portion has a base number of 118 as shown by the underline. It is located from 104th to 221th in bp.

(SEQ ID NO: 25)

  The nucleotide sequence (SEQ ID NO: 26) of the probe-introduced mutant gene cDNA (S284LPB) obtained by introducing the probe represented by SEQ ID NO: 23 into the rat Chrna4 mutant cDNA (S286L) (in the human, S284L) is as follows. It is. The underlined 856th to 858th TCT was mutated to CTT due to mutations of c.856T> C and c.857C> T, and the probe portion had a base number of 118 bp as shown by the underline. And it is located from 104th to 221th.

(SEQ ID NO: 26)

  The nucleotide sequence (SEQ ID NO: 27) of the probe-introduced mutant gene cDNA (S282FPB) obtained by introducing the probe represented by SEQ ID NO: 23 into the mutant cDNA of rat Chrana4 (879-880insL) is as follows. As a result of c.845C> T and c.846G> C mutations, the 844th to 846th TCGs are mutated to TTC as enclosed by squares (□), and the probe part is underlined, 118 bp, located from 104th to 221st. However, it is S280F in humans.

(SEQ ID NO: 27)

  The nucleotide sequence (SEQ ID NO: 28) of the probe-introduced mutant gene cDNA (V286L) obtained by introducing the probe represented by SEQ ID NO: 24 into the rat Chrnb2 mutant cDNA is as follows.

(SEQ ID NO: 28)

  The nucleotide sequence (SEQ ID NO: 29) of the probe-introduced mutant gene cDNA (V286M) obtained by introducing the probe represented by SEQ ID NO: 24 into the rat Chrnb2 mutant cDNA is as follows.

(SEQ ID NO: 29)

Using the rat Chrna4 or Chrb2 cDNA introduced with the above mutation and probe prepared as described above, the epilepsy non-human mammal according to the present invention is produced according to a conventional method by a known non-human mammal production method. can do. Such a non-human mammal production method includes a method for producing a transgenic animal in which a target gene is introduced into an animal individual, a method for producing a gene-substituted animal in which a target gene and a target transgene are recombined, and a cell in which the target gene is modified. And a method for producing a clone individual using the nucleus of.
In this specification, a method for producing a transgenic animal in which the cDNA of the mutant gene, which is the target gene, is introduced into a fertilized egg of an animal individual such as a rat will be described as an example.

  First, a DNA encoding a mutant gene having the mutation in the homologous gene of α4 subunit (CHRNA4) gene or β2 subunit (CHRNB2) gene of neuronal nicotinic acetylcholine receptor related to human autosomal dominant nocturnal frontal lobe epilepsy An expression vector is prepared.

  In other words, non-human mammalian neuronal nicotinic acetylcholine receptor α4 subunit (Chrna4) gene or β2 subunit (Chrnb2) gene containing DNA is isolated, and an exogenous gene is inserted into this DNA fragment. Can be built. As such a foreign gene, a marker gene is preferable, and an antibiotic resistance gene such as a neomycin resistance gene is particularly preferable. When an antibiotic resistance gene is inserted, cell lines that have undergone homologous recombination can be selected simply by culturing in a medium containing the antibiotic. In order to perform more efficient selection, a thymidine kinase gene or the like can be bound to an expression vector. Thereby, a cell line in which non-homologous recombination has occurred can be excluded. In addition, when a diphtheria toxin A fragment (DT-A) gene or the like is bound to an expression vector, a cell line in which non-homologous recombination has occurred can be eliminated. As the expression vector, for example, pCI-neo, pMCIneo, pXT1, pSG5, pcDNA3.neo, pLITMUS28, pcDNAIamp, pcDNA3 and the like are used.

  The DNA is preferably introduced into a non-human mammal using an expression vector in which the DNA is linked downstream of a suitable promoter as a transgene. As the promoter, any promoter can be used as long as it can initiate transcription in a non-human mammal cell into which the DNA encoding the receptor subunit is introduced. Examples include promoters such as genes derived from viruses such as Omavirus, adenovirus 2, human cytomegalovirus, and retrovirus.

  In addition, the expression vector used in the present invention is an mRNA 3 downstream of the DNA encoding the mutant gene of α4 subunit (Chrna2) gene or β2 subunit (Chrnb2) of neuronal nicotinic acetylcholine receptor of non-human animals. It preferably has a polyadenylation signal necessary for terminal polyadenylation. Examples of the polyadenylation signal include a polyadenylation signal such as a late gene or early gene of SV40 contained in each gene derived from the above viruses and the like. In addition, in order to achieve higher expression of the target gene, the expression vector includes a splicing signal of each gene, an enhancer region, and a part of the intron 5 ′ upstream of the promoter region, between the promoter region and the translation region, or 3 ′ of the translation region. You may connect downstream.

  In this invention, for example, the cDNA of the rat mutation Chrna4 or Chrnb2 introduced with the above mutation and probe can be transferred to an expression vector using restriction enzyme sites XhoI and NotI, and then cleaved with restriction enzymes SnaBI and NaeI. . For example, when transferring the cDNA of rat mutant Chrna4 to an expression vector with PDGF promoter derived from pCI-neo vector, transfer using restriction enzyme sites XhoI and NotI, and cleave with restriction enzymes SnaBI and NaeI. In addition, when transferring rat Chrb2 cDNA, it can be transferred using restriction enzyme sites Xho I and Sal I and cleaved with restriction enzymes SnaBI and DraIII. As a result, a fragment comprising the PDGF promoter, rat mutant Chrna4 or Chrnb2 cDNA, and poly A portion can be isolated and purified by gel cutting as a DNA construct.

  In this invention, for example, a non-human mammal can be produced by introducing a DNA construct or the like isolated and purified as described above into a totipotent cell of a non-human mammal. Examples of the totipotent cells that can be used include fertilized eggs, early embryos, embryonic stem cells, and the like. For fertilized eggs into which DNA constructs are introduced, for example, ovulation-inducing agents such as gonadotropin (PMS) are administered intraperitoneally to induce superovulation in female animals, and fertilized eggs into which DNA constructs can be introduced are collected. The oviduct of a pseudopregnant female mated with a male mouse castrated by ligation or the like can be extracted and collected under a microscope.

  Next, a DNA construct is introduced into the obtained fertilized egg. Various methods are known as means for introducing a construct into a fertilized egg, but the microinjection method is preferable in consideration of the production efficiency of a transgenic animal individual and the transgene transfer efficiency to the next generation. The fertilized egg injected with the mutated gene is transplanted into the oviduct of the foster parent, generated to the individual, DNA is extracted from somatic cells of a part of the body (for example, the tip of the tail), Southern analysis and PCR method. To confirm the presence of the introduced gene. Thus, the target transgenic animal can be produced by selecting the individual into which the transgene is incorporated into the genome of the somatic cell.

  If the individual (heterozygote) in which the presence of the transgene is confirmed as described above is the first generation (Founder: F0), the transgene is transmitted to 50% of its offspring (F1). Furthermore, an individual (F2) having a transgene on both diploid chromosomes can be created by mating the male and female of this F1 individual.

  In contrast, in the present invention, the endogenous method (Chrna4 gene or Chrnb2 gene) remains normal in the transgenic method used to produce attention deficit / hyperactivity disorder (AD / HD) model non-human mammals. Then, a mutant gene encoding mutant Chrna4 or Chrnb2 is newly introduced at an arbitrary position of the chromosomal DNA. Therefore, in the AD / HD model animal of the present invention, normal Chrna4 or Chrnb2 and mutant Chrna4 or Chrnb2 are produced together. The neuronal nicotinic acetylcholine receptor is a protein that functions as an ion channel (two α subunits and three β subunits). Such an ion channel functions as long as one of the subunits is mutated. Is changed.

  The attention deficit / hyperactivity disorder (AD / HD) model non-human mammal of this invention spontaneously develops an epileptic seizure during sleep, similar to human chromosome dominant nocturnal frontal epilepsy, as shown in the Examples below. It has excellent characteristics.

  In addition, selection of individuals in which the target gene has been integrated on the chromosomes of all cells is usually done by preparing DNA from a part of the tissue such as blood tissue or epithelial tissue constituting the individual, and sequencing the DNA. , By confirming the presence of the transgene at the DNA level. However, in order to select such a recombinant individual by sequencing DNA in this way, it is necessary to perform a complicated task that is laborious, time consuming and expensive.

  That is, when producing a disease model animal having a genetic abnormality, it is necessary to accurately identify homologous recombinants. In a conventional method for producing a disease model animal, in order to discriminate a recombinant, it is necessary to sequence a part of the gene of the individual and to express the mRNA of the transgene. However, it is not easy to express the mRNA of the transgene by RT-PCR or in situ hybridization.

  Thus, in the present invention, the mutant gene is mutated as described above, and the recombinant gene can be easily identified by replacing a part of the mutant gene with a probe. Yes. In addition, even when a new restriction enzyme cleavage site appears by introducing the mutation, the recombinant can be easily identified. It should be understood that this approach is not limited to the specific embodiments described below, but can be comprehensively applied to all types of mutation introduction regardless of the type of gene mutation or restriction enzyme. is there. In the present invention, the type of mutation to be introduced site-specifically into the cDNA clone site is not particularly limited.

  That is, in the present invention, as described above, the α4 subunit (Chrna4) gene or the β2 subunit (Chrnb2) gene of the neuronal nicotinic acetylcholine receptor of a non-human animal can be easily selected. For example, mutations such as S280L, S284L, S291-292L, V287L, V287M and the like are introduced into the DNA coding for a new restriction enzyme cleavage site. By making a new restriction enzyme cleavage site appear in this way, it is possible to facilitate identification of the recombinant when producing the recombinant.

  In the present invention, the base sequence of a part of the prepared mutagenesis cDNA is replaced with a probe consisting of a base sequence that is substantially completely different from the base sequence, but has the same amino acid sequence. Therefore, by using the restriction enzyme of the introduced probe, it is possible not only to easily identify recombinant individuals, but also to express mRNA expressed from the recombinant gene in the original Chrna4 of the rat. Differentiated from mRNA or Chrnb2 mRNA, it can be easily detected by RT-PCR or in situ hybridization.

  In addition, for example, by introducing a mutation (c.856G> C) or (c.856G> A) into the homologous gene Chrnb2 of the α4 subunit CHRNB2 of the neuronal acetylcholine receptor gene, a restriction enzyme cleavage site Hinf If appears. Therefore, the region containing this cleavage site can be discriminated by PCR-RFLP (restriction fragment length polymorphism) method using the restriction enzyme Hinf If. In other words, individuals who have not undergone the desired homologous recombination do not have the Hinf If site, so that the restriction enzyme Hinf If does not cleave, whereas the desired homologous recombination occurs. Since the individual has a Hinf If site, it is cleaved by the restriction enzyme Hinf If. Therefore, in the present invention, a recombinant is obtained by introducing a mutation so that a restriction enzyme cleavage site appears in the homologous gene Chrnb2 of the α4 subunit CHRNA4 of the neuronal acetylcholine receptor gene or the homologous gene Chrnb2 of the β4 subunit CHRNB2. Can be easily identified.

  The PCR-RFLP method used here is a method known per se. By this method, a target site is amplified by PCR, and the amplified product is amplified with a predetermined restriction enzyme such as True9I or Hinf If. It is possible to examine the presence or absence of a cleavage site of the restriction enzyme by electrophoresis or the like by digesting with a restriction enzyme such as.

  The epilepsy model non-human mammal produced as described above can also be applied as the attention deficit / hyperactivity disorder model non-human mammal according to the present invention. Attention deficit / hyperactivity disorder model Evaluation of whether it can be applied as a non-human mammal is performed by measuring spontaneous momentum using an open field device and anxiety-like behavior using an elevated plus maze device, for example. be able to.

  In this invention, the measurement of the spontaneous momentum using the open field device, after setting the desk light so that the light spot hits the center of the bottom of the open field device, and acclimating the experimental animal with the cage in the experimental environment, An experimental animal was placed at the center of the bottom of the open field apparatus, and the number of times that the lumbar part of the experimental animal crossed the boundary of the compartment and the number of risings (including the case where the wall surface was supported) were observed for a predetermined time and judged.

  In this invention, the measurement of anxiety-like behavior using the elevated plus maze device is performed by placing an experimental animal at the center of the intersection of the open arms of the elevated plus maze device and the number of times the experimental animal has entered the open arm and Residence time was measured. Whether or not the experimental animal entered the open arm was determined when the lumbar part of the experimental animal completely entered the open arm.

  EXAMPLES Next, the present invention will be described in more detail by way of examples. However, the present invention is not limited to the following examples, and the following examples are illustrative only for specifically explaining the present invention. It should be understood that the description is not intended to limit the invention in any way.

[Example 1]
First, two primers designed based on the existing rat Chrna4 cDNA sequence using Rat Brain QUICK-Clone cDNA (CLONTECH; Mountain View, CA) as a template, ie, forward primer (BN-Rat CHRNA4 cDNA-F):
AGATCTCGCGAAGCTTCACCATGGCCAATTCGGGCACCGG (40mer) (SEQ ID NO: 3) and reverse primer (Rat CHRNA4 cDNA-BX-R):
AGATCTAGATCAGCAAGCAGCCAGCCAGGGAGGCAGGA (38mer) (SEQ ID NO: 4)
PCR was performed. The resulting PCR product was purified and subcloned into the pCRII-TOPO vector (Invitorogen; Carlsbad, CA). The obtained clone was sequenced and the nucleotide sequence of the Chrna4 cDNA was confirmed. Rat base sequence information is registered as accession number L31620 (NCBI).

Mutations were introduced into the obtained clones using QuikChange Site-Directed Mutagenesis Kit (STRATAGENE; La Jolla, CA). First, r845T846C-sen:
CACACTGTGCATCTTCGTGCTGCTTTCTC (29mer) (SEQ ID NO: 7) and r845T846C-ant:
Using GAGAAAGCAGCACGAAGATGCACAGTGTG (29mer) (SEQ ID NO: 8), C of the cDNA base sequence 845 was mutated to T, and G of 846 was mutated to C. The base sequence of the obtained mutant cDNA is as shown in SEQ ID NO: 9. As a result, Ser at amino acid residue p.282 homologous to the human neuronal acetylcholine receptor α4 subunit was mutated to Phe.
A probe (sequence) consisting of 118 bp nucleotide having the following amino acid sequence that is the same amino acid sequence as that of this site, but is completely different from the original nucleotide sequence, in c.104 to c.221 of the mutagenized cDNA thus prepared. No. 23) was created and introduced.

(SEQ ID NO: 23)
GGGCTCACGCCGAAGAACGCCTGCTCAAAAGGCTGTTTTCTGGCTATAATAAATGGTCCCGCCCCGTGGCTAACATTTCCGACGTCGTGCTGGTGCGGTTCGGATTATCTATCGCTCA

  After hybridization of the mutagenized cDNA into which the probe was introduced as described above, the cDNA of Chrna4 being inserted into the pCRII-TOPO vector was inserted using the restriction enzyme sites SmaI and Bpu1102I. Sequencing was performed at each step, and the base sequence was confirmed.

  Furthermore, rat Chrna4 cDNA with the relevant mutation (S286L) was transferred to an expression vector with PDGF promoter derived from pCI-neo vector using restriction enzyme sites XhoI and NotI, and then cleaved with restriction enzymes SnaBI and NaeI. did. The PDGF promoter, rat Chrna4 cDNA and the stump having the poly A portion were isolated and purified by gel excision. The isolated and purified DNA was microinjected into a fertilized egg, and 200 or more eggs in good condition were transplanted into the oviduct of a fertilized female animal, and a recombinant was produced by a method of natural delivery.

[Example 2]
In the same manner as in Example 1, r856C857T-sen: CGGTGCTGCTTCTTCTCACCGTCTTCCTG (29mer) (SEQ ID NO: 10) and r856C857T-ant:
CAGGAAGACGGTGAGAAGAAGCAGCACCG (29mer) (SEQ ID NO: 11) was used to mutate T of the cDNA base sequence 856 to C and C of 857 to T. The base sequence of the obtained mutant cDNA is as shown in SEQ ID NO: 12. As a result, Ser at amino acid residue p.286 homologous to the human neuron acetylcholine receptor α4 subunit was mutated to Leu.

  In the same manner as in Example 1, a probe consisting of 118 bp nucleotide represented by SEQ ID NO: 23 was prepared and introduced into c.104 to c.221 of the mutagenized cDNA thus prepared.

  A recombinant was produced in the same manner as in Example 1 using the mutation-introduced cDNA into which the probe was introduced as described above.

[Example 3]
As in Example 1, rCHRNA-878insGCT-sen as a sense primer:
GTCTTCCTGCTGCTGCTCATCACCGAGATC (30mer) (SEQ ID NO: 13)
And rCHRNA-878insGCT-ant as antisense primer:
GCT was inserted between the 878th and 879th cDNA nucleotide sequences using GATCTCGGTGATGAGCAGCAGCAGGAAGAC (30mer) (SEQ ID NO: 14). The base sequence of the obtained mutant cDNA is as shown in SEQ ID NO: 15. As a result, Leu was inserted between Leu at the amino acid residue p.293 and homologous to the human neuronal acetylcholine receptor α4 subunit and Ile at p.294.

  Using the mutation-introduced cDNA thus prepared, a recombinant was produced in the same manner as in Example 1.

[Example 4]
C.856G> C and c.856G> A were introduced into rat Chrnb2 isolated by PCR cloning by mutagenesis. In other words, two primers (BN-Rat CHRNB2 cDNA-F) designed based on the existing rat Chrnb2 cDNA sequence using Rat Brain QUICK-Clone cDNA (CLONTECH Mountain View, CA) as a template.
AGATCTCGCGACATGGCCGGGCACTCCAACTCAATGGCGCT (41mer) (SEQ ID NO: 5) and Rat CHRNB2 cDNA-CB-R:
ATCGATGGATCCTCACTTGGAGCTGGGAGCTGAGTGGTCA (40mer) (SEQ ID NO: 6)
PCR was performed. The resulting PCR product was generated and subcloned into the pCRII-TOPO vector (Invitorogen Carlsbad, CA). The obtained clone was sequenced, and the nucleotide sequence of the Chrnb2 cDNA was confirmed. This rat base sequence information is registered under the accession number NM_019297 (NCBI).
Mutations were introduced into the obtained clones using QuikChange Site-Directed Mutagenesis Kit (STRATAGENE, La Jolla, CA). First, Rat CHRNB2 m286V / MF:
CTCATCTCCAAGATTATGCCTCCCACCTCC (30mer) (SEQ ID NO: 17)
And Rat CHRNB2 m286V / MR: GGAGGTGGGAGGCATAATCTTGGAGATGAG (30mer) (SEQ ID NO: 18), G of cDNA base sequence 856 was mutated to C. As a result, Val at amino acid residue p.286 homologous to the human neuronal acetylcholine receptor β2 subunit was mutated to Leu.
At the time of this mutagenesis, by introducing c.856G> C, Hinf If appeared as a restriction enzyme cleavage site, and it was devised to make it easy to identify the recombinant when producing the recombinant.
A probe (SEQ ID NO: 24) having the same amino acid sequence as that of this site but completely different from the base sequence was introduced into c.1171 to c.1232 of the introduced cDNA for mutation introduction.

(SEQ ID NO: 24)
AACCCCGCCTCCGTCCAAGGACTCGCCGGCGCCTTTAGGGCCGAACCTACCGCCGCTGGCCC

The 62 bp nucleotide was prepared, and after hybridization, the Chrnb2 cDNA being inserted into the pCRII-TOPO vector was inserted using the restriction enzyme sites Hinc II and Sma I. Sequencing was performed at each step, and the base sequence was confirmed.
Furthermore, two types of rat Chrnb2 cDNAs with the relevant mutations and probes were transferred to an expression vector with a PDGF promoter derived from the pCI-neo vector using restriction enzyme sites Xho I and Sal I, and then the restriction enzymes SnaBI and Cut with DraIII. The PDGF promoter, rat Chrnb2 cDNA and the stump having the poly A portion were isolated and purified by gel excision. The isolated DNA was microinjected into a fertilized egg, and 200 or more eggs in good condition were transplanted into the oviduct of a fertilized female animal, and a recombinant was produced by a method of natural delivery.

[Example 5]
As in Example 4, Rat CHRNB2 m286V / LF:
CTCATCTCCAAGATTCTGCCTCCCACCTCC (30mer)
(SEQ ID NO: 20) and Rat CHRNB2 m286V / LR:
Using GGAGGTGGGAGGCAGAATCTTGGAGATGAG (30mer) (SEQ ID NO: 21), G of cDNA base sequence 856 was mutated to A. This mutated the Val at amino acid residue p.286 homologous to the human neuronal acetylcholine receptor β2 subunit to Met. Using the mutation-introduced cDNA thus obtained, a recombinant was produced in the same manner as in Example 4.

[Example 6]
Electroencephalogram (EEG) measurement in epilepsy model rats
Electroencephalograms (EEG) were measured on 8-10 week old transgenic rats (Chrnb2 V287L). Rats were anesthetized with nembutal (Dainippon Sumitomo Pharma Co., Ltd.), fixed to a stereotaxic device (SR-5, adult weight), and the electrodes were arterial: 2.5 mm, Lateral: 1.5 mm and Arterial from bregma of rat skull : -2.5 mm, Lateral: At 2.5 mm, the indifferent electrode was attached to the thick part of the bone near the rat nasal bone and fixed with dental cement. A Teflon (registered trademark) -coated stainless steel electrode for EEG measurement was attached to the frontal lobe (A = 3 mm, L = 0.8 mm from Bregma) of the left and right cerebral hemispheres, and fixed with dental cement. The indifferent electrode was embedded above the cerebellar region. Electroencephalogram (EEG) was measured using VideoOption (Kissei Comtech) for several days in a chamber with free motion, and electroencephalogram analysis was performed using SleepSign (Kissei Comtech).
The electroencephalogram measurement results are shown in FIG. In the figure, the abnormal electroencephalogram portion is indicated by symbol A and symbol B, an enlarged view of the abnormal electroencephalogram portion indicated by symbol A is shown in FIG. 6, and the abnormal electroencephalogram portion indicated by symbol B is shown in FIG. From this result, it was confirmed that this rat can be used as an epilepsy model rat.

[Example 7]
Measurement of Spontaneous Momentum Using Open Field Device Four to five month old Tg rats (V287M) were used as test animals and five non-Tg rats were used for experiments as controls. Rats were measured for locomotor activity using an open field device (Figure 10: bottom diameter 60 cm x height 50 cm x inlet diameter 80 cm). In the experiment, first, the laboratory light was turned off, a desk light was placed so that the light spot was in the center of the bottom of the open field device, and the rat was allowed to acclimate by placing it in the experimental environment for at least 30 minutes. Thereafter, an experimental animal was placed in the center of the bottom of the open field apparatus, and the number of times that the lumbar part of the experimental animal crossed the boundary of the compartment and the number of rising (including the case where the wall was supported) were observed for 2 minutes. The results are shown in FIGS. 11 and 12, respectively.

As shown in FIG. 11, the 2-minute automatic momentum of the Tg rat (V287M) was significantly higher than the 2-minute automatic momentum of the nonTg rat as a control. This increase in the amount of spontaneous exercise was observed in any observation time period of 1 minute from the start of measurement and 1 minute after 1 minute.
On the other hand, as for the number of rises, as shown in FIG. 12, the number of rises in the Tg rat (V287M) was significantly increased in the number of one minute from the start of measurement compared with that in the nonTg rat, but the number of rises after that was greatly different. There was no. In addition, the total number of rises in 2 minutes was not significantly different between Tg rats (V287M) and nonTg rats.

[Example 8]
Measurement of anxiety-like behavior using an elevated plus-maze device The elevated plus-maze device used in the experiment is as shown in FIG. As experimental animals, Tg rats (V287M) and nonTg rats as controls were used. In the experiment, first, the laboratory lights were turned off, a desk light was placed so that a light spot was applied to the open arm of the elevated plus-maze device, and the rats were trained with the cage on the open arm for at least 30 minutes. . Thereafter, the rat was placed at the center of the intersection of the open arms, and the number of times of entry into the open arms and the staying time at the time of entry were measured for 10 minutes. Whether or not the experimental animal entered the open arm was determined when the lumbar part of the experimental animal completely entered the open arm. The results are shown in FIG.

  As shown in FIG. 14, the 10-minute open arm residence time of Tg rats was significantly increased compared to that of nonTg rats. In addition, the number of times the arm of the Tg rat was crossed significantly increased compared to the nonTg rat.

  The attention deficit / hyperactivity disorder (AD / HD) model non-human mammal according to the present invention causes behavioral disorders that closely resemble human attention deficit / hyperactivity disorder (AD / HD). It is possible to confirm the effectiveness of AD / HD against AD / HD and to screen for AD / HD preventive or therapeutic agents, and to evaluate the effectiveness of the test agent against AD / HD. Therefore, the attention deficit / hyperactivity disorder (AD / HD) model non-human mammal of the test drug of the present invention can greatly contribute to the research and development of AD / HD preventive or therapeutic agents.

Claims (2)

Attention deficit / hyperactivity disorder (AD / HD) model rat with the same genetic abnormality as human epilepsy gene abnormality , β 2 subunit CHRNB2 of neuronal acetylcholine receptor gene associated with human autosomal dominant nocturnal frontal lobe epilepsy to C Hrnb2 non-human mammal, mutations in the mutagenesis, the 856 number of the cDNA G (guanine) is C (cytosine) (c.856G> C) or a (adenine) (c.856G> a) Attention deficit / hyperactivity disorder (AD / HD) model rat characterized by having the nucleotide sequence represented by each of SEQ ID NO: 19 or 22 introduced . The attention-deficit / hyperactivity disorder (AD / HD) model rat according to claim 1, wherein c.856G> C or c.856G> A is mutated into the Chrnb2 by the mutagenesis, and the β2 Attention deficit / hyperactivity disorder (AD / HD) model rat, wherein the amino acid residue Val homologous to the subunit CHRNB2 p.286 is substituted with Leu or Met, respectively.