JP5525683B2 - Production and use of experimental animals with mutated cells shining - Google Patents

Description

  The present invention relates to a cell in which a fluorescent protein is knocked in so that a mutated cell can be visualized.

A conventional technique for measuring in vivo mutation is to use a transgenic mouse (MutaMouse or BigBlue mouse) into which a phage vector having a lacZ or lacI gene is introduced (Non-patent Document 1). These target genes are small and exogenous, and due to system limitations, cells that make up individuals, mutation frequency per tissue is not required, or only small mutations can be detected, or animals can be detected to detect mutations. There is a problem that DNA must be extracted from the tissue, inserted into a phage vector, and transduced into E. coli. On the other hand, a system for detecting a mutation in a gene endogenous to a cell can target a gene important for a living body, and is ideal as a test system (Non-patent Document 2). However, there is a problem that the tissue that can detect an in vivo mutation is limited to each gene because it greatly depends on the expression of the target gene and the presence or absence of a detection system. In recent years, a screening system for carcinogens using a deletion mutation caused by recombination between homologous base sequences as an index has been created in yeast or the like (Non-patent Document 3, Patent Document 1). It cannot be applied. In mammals, the mousepink eyed unstable locus has been devised as a screening system for carcinogens using the deletion mutation caused by recombination between homologous nucleotide sequences as an index. However, this system has a problem that it can only detect mutations occurring in mouse hair color and retinal cells (Patent Document 2).

U.S. Patent No. 5792633 U.S. Pat. Katoh et al., Mutat Res. 341: 17-28, 1994, Barnett et al., Environ MolMutagen. 40: 251-7, 2002 Shiestl, et al., Proc. Natl. Acad. Sci. USA 94: 4576-4581,1997, Tao etal., Mutagenesis. 9: 187-91, 1994, Kyoizumi, et al., Mutat Res. 214: 215- 22, 1989 Yeast DEL assay; Galli et al., Genetics 149: 1235-1250, 1998

In order to more accurately measure the effects of radiation and environmental mutagens, as well as pharmaceuticals and foods on the living body, systems that can accurately and visually measure mutations caused by tissue cells in individuals are needed. . Moreover, there is a need for an experimental animal that can measure mutations in all tissue cells without shifting to a specific tissue.

  The present inventor paid attention to the above-mentioned problem, and by linking a structural gene duplication or partial duplication and a gene portion encoding a fluorescent protein in-frame to the 3 ′ end of the duplication, When this happened, it was found that the cells themselves could be detected with fluorescence, and the present invention was completed.

That is, the present invention
[1] A knock-in target vector characterized by ligating the following genes from the 5 ′ side in the following order:
(1) A partial gene sequence of a structural gene, the sequence length of which is 1 kb or more (2) a marker gene sequence (3) a partial gene sequence of a structural gene comprising the same partial gene sequence as (1) above A gene sequence in which a gene portion encoding a fluorescent protein is linked in-frame to the 3 ′ end. (4) A partial gene sequence containing 1 kb or more of a gene downstream of the structural gene.
[2] Gene partial duplication / GFP knock-in cell production method using the vector of [1] above,
[3] A knock-in cell produced using the method described in [2] above,
[4] A knock-in non-human mammal produced using the method described in [2] above,
[5] A method for measuring the effect on a living body of a pharmaceutical / food, radiation / environmental mutagen, etc. by using the cell according to [3] above, when the cell shines,
Consists of.

Since the cells themselves fluoresce, mutations can be easily detected without removing the cells from the individual or performing special operations. To date, there is little information on how mutant cells are born in various tissues in the body and how they are destined. For this reason, the in vivo system has a wide range of applications because it can examine the relationship between the environment and the individual, and the relationship between various diseases and mutations for all cells constituting the body. For example, by measuring the increase in mutation frequency when an individual animal or cell of the present invention is exposed to various drugs, the risk of canceration due to gene mutation caused by the drug can be predicted, making it more dangerous It is possible to develop a drug with a small amount. In addition, it is known that mutations increase due to irradiation with ultraviolet rays, X-rays, etc., but mutation caused by radiation exposure is performed by irradiating individuals and cells of the present invention with radiation and measuring the frequency of mutation. It is also possible to develop preventive and therapeutic drugs for (or canceration due to mutation).
In addition to exposure to radiation and environmental mutagens, there are no experimental animals that have been able to measure the effects of food intake, air, etc. on animals including humans. The animals obtained by the present invention can be used for long-term risk assessment of work environments in all industries.

Hereinafter, the configuration of the present invention will be described in detail.
[1] To solve the problem, it is easy to identify the cells that have been mutated in vivo, and if the mutant cells survive and continue to function like other cells, they can be removed alive if possible. It is only necessary to grow and analyze the structure of the mutation. The cell is preferably a mammal-derived cell, more preferably a mouse, rat, guinea pig, hamster, rabbit, dog, cat, sheep, pig, goat, cow, monkey, or a human-derived cell taken from an individual. .
[2] A method for observing mutant cells alive is the introduction of fluorescent protein genes. Examples of fluorescent proteins include GFP, HcRed, and DsRed. The target gene for mutation is preferably other than a recessive lethal gene. This is because the mutant cells want to live and shine. It is desirable that the inactivated mutation does not lead to cell lethality and that the gene is ubiquitously expressed in vivo. Specific examples include HPRT and APRT.
[3] By introducing an overlapping structure into the target gene and using a reversion from this duplication as a mutation detection system, mutations can be detected more efficiently than conventional mutation detection systems.
[4] If a gene part that encodes a fluorescent protein in frame is introduced into the 3 'end of the duplicate gene, a fusion protein of the target gene and the fluorescent protein gene is expressed along with the reverse mutation from the duplicate, and the cell becomes the target gene. It shines with the resurrection of activity.
[5] Create a knock-in mouse by duplicating the target gene and introducing the target vector with the gene part encoding the fluorescent protein in-frame at the 3 'end into ES cells and replacing the endogenous gene with this vector. To do.
[6] Establish an in vivo genetic effect measurement system for pharmaceuticals / foods, radiation / environmental mutagens using the mice.

An example of construction of the target vector of the present invention is shown below.
(1) A partial gene sequence including a part of a structural gene (hereinafter referred to as a partial sequence) is amplified by PCR or the like. Alternatively, it can be isolated directly from genomic DNA using a BAC clone or the like. The length of the partial gene sequence is preferably 1 kb or more, and more preferably 10 kb or less.
(2) If the partial gene sequence obtained in (1) contains a termination codon, the termination codon is deleted and the open reading frame of the fluorescent protein gene is combined with the gene and the codon (in-frame) Connect).
(3) The partial gene sequence of the partial gene sequence obtained in (1) is amplified again by PCR or the like. The length of the partial gene sequence is preferably 1 kb or more, and more preferably 10 kb or less.
(4) A marker gene expression unit is connected to the 3 ′ end of the partial gene sequence obtained in (3).
(5) Amplify the genomic base sequence downstream of the structural gene by PCR or the like. The length of the partial gene sequence is preferably 1 kb or more, and more preferably 3 kb or less. A sequence existing within 3 kb downstream from the structural gene is preferred.
(6) The sequence obtained in (2), (4), (5) is ligated from the 5 ′ side so as to be aligned with (4), (2), (5), and inserted into a plasmid to target vector Can be built.

Examples of production and selection of recombinant cells are shown below.
The target vector is introduced into ES cells by a conventional method. In order to obtain cells in which the target vector is introduced into the target gene locus, the expression of the marker or the functional defect of the targeted gene is used as an index.

[Example 1] Introduction of HPRT gene into mouse-derived cells As an example of mutation of a mammalian gene, an HPRT ( Hypoxanthine phosphoribosyl transferase) gene on the mouse X chromosome is used. However, the present invention can be applied to many genes other than the HPRT gene. The HPRT structural gene region is registered as BX64962 etc. in nucleobase sequence databases such as NCBI, EMBL, SAKURA. This gene is the gene that plays the most important role in the salvage pathway in the nucleic acid biosynthesis system, and is considered to be expressed in all tissue cells in the living body. It is known that cells in which this gene is mutated and lacks function are resistant to 6 thioguanine (6TG), so that the mutation can also be detected by an in vitro cell culture method. On the other hand, it is known that cells in which the HPRT gene is functioning can be selected using a HAT ( Hypoxanthine Aminopterin Thymidine) -containing medium. Mutations with HPRT gene deficiency cause Leschnaihan syndrome in humans, but HPRT knockout mice have shown that no particular pathological symptoms appear in mice. This is because in mice, the salvage pathway dependence of nucleic acid biosynthesis is small. In the present invention, the gene part from exon 6 to exon 9 is duplicated among mouse HPRT structural genes, and the open reading frame of the GFP (Green Fluorescent Protein) gene is linked in-frame to the 3 ′ end of the duplicated part. Indicates.
1. Preparation of target vector: (1) About 8.5 kb from HPRT exon 6 to exon 9 is isolated from mouse genomic DNA by PCR and the nucleotide sequence is confirmed. Specifically, genomic DNA derived from 129 mice is PCR primer ATGTGTTTTGCTGCTCATGA (SEQ ID NO: 1) using the nucleotide sequence corresponding to the position of 270 bases downstream of mouse HPRT structural gene exon 5 and immediately before the stop codon (TAA) in exon 9 By PCR amplification using the reverse primer CTTTGTATTTGGCTTTTCCA (SEQ ID NO: 2) corresponding to the position of 8, an 8.5 kb region DNA fragment containing exon 9 to exon 9 is isolated. It was confirmed that this PCR amplification was most efficient with Takara Shuzo's LA-Taq polymerase, and the base sequence of the amplified DNA was also accurate. (2) This 8.5 kb DNA is TA cloned into pCR2.1TOPO vector of Invitrogen . The resulting pCR-8.5 kb plasmid was purified, and the 8.5 kb insert DNA fragment was isolated by digestion with the restriction enzyme EcoRI, and the Eco RI digested GFP vector plasmid (pQBI25-fNI, Wako Pure Chemical Industries, Ltd.) Binding was performed using T4 ligase. The resulting plasmid, pQBI-mhprt8.5-1, is followed by the start codon of the GFP gene from the position where the stop codon of the mouse HPRT gene is deleted, and if the HPRT gene is normally expressed and translated, the CRT of the HPRT protein The GFP protein is linked to the end as a fusion protein. Using the plasmid pQBI-mhprt8.5 as a template, the 5 ′ end of this mouse HPRT DNA and the 3 ′ end of the GFP expression unit ( 3 ′ end of polyA signal) are amplified again using LA-Taq. In this case, the amplified DNA end has a Sal I cleavage base sequence. The primer base sequence is GTCGACATGTGTTTTGCTGCTCATGA (SEQ ID NO: 3), GTCGACTATTGTCTTCCCAATCCTCC (SEQ ID NO: 4). The amplified DNA fragment of about 9.5 Kb was TA cloned into pTA2 vector (Toyobo) to confirm the accuracy of the base sequence. The resulting plasmid pTA-8.5GFP # 12 was digested with SalI, and the HPRT-GFP conjugate was isolated as a 9.5 Kb SalI DNA fragment. (3) Using the plasmid pQBI-mhprt8.5 as a template again, the DNA region (7.8 Kb) from exon 6 to exon 8 of mouse HPRT DNA is PCR amplified. In this case, base sequences digested with Bam HI were added to both ends of the PCR primer. The primer base sequence is as follows. GGATCCATGTGTTTTGCTGCTCATGA (SEQ ID NO: 5), GGATCCCAAATCCCTGAAGTACTCAT (SEQ ID NO: 6). The amplified 7.8 Kb DNA was TA cloned into the pTA2 vector and named pTA-Left arm # 12 to confirm the nucleotide sequence. Thereafter, Bam HI was digested to isolate a 7.8 Kb DNA fragment. (4) Plasmid pBS which was isolated from plasmid pMC1-neo-PA (Stratagene) by digesting neomycin resistance gene with Xho I and Bam HI and inserted into EcoRV site of plasmid pBluescript II ( Stratagene ) using DNA ligase. -neo was created. pBS-neo was digested with Bam HI, and the 7.8 Kb DNA obtained in (3) was inserted using ligase. The plasmid in which 7.8 Kb was inserted in the forward direction was designated as pBS-neo-loxP-7.8 # 6. (5) After digesting plasmid pBS-neo-loxP-7.8 # 6 with SalI, the 9.5 Kb DNA obtained in (2) was ligated with ligase. The plasmid bound in the forward direction was confirmed and designated pBS-neo-loxP-7.8-8.5GFP # 17. (6) About 2.3 Kb downstream of the 3 ′ end of the HPRT structural gene was isolated from mouse genomic DNA by PCR amplification. A base sequence digested with ApaI is added to both ends of the PCR primer. The primer base sequences are as follows, GGGCCCTTTGGGACCAAAAGTCCTGT (SEQ ID NO: 7), GGGCCCCTGGGAATTGAACTCAGGAC (SEQ ID NO: 8), which are located 0.99 Kb and 3.3 Kb downstream of the mouse HPRT gene stop codon. This amplified DNA was isolated and TA cloned into the pTA2 vector to obtain pTA2.3-2 ( right arm ). pTA2.3-21 was digested with ApaI, and a 2.3 Kb DNA fragment was isolated. (7) The plasmid pBS-neo-loxP-7.8-8.5GFP # 17 was digested with ApaI, and then the 2.3 Kb DNA obtained in (6) was ligated using ligase. A plasmid having 2.3 Kb DNA inserted in the forward direction was selected and used as a target vector for ES cells as pBS-neo-loxP-7.8-8.5GFP2.3-2. (8) Plasmid pBS-neo-loxP-7.8-8.5GFP2.3-2 was digested with BssHII to cleave approximately 22 Kb of DNA from the pBS vector. This DNA was introduced into mouse ES cells (Funakoshi and Dainippon Sumitomo Pharma) by electroporation. G418 selection was started 2 days after the introduction, and 6TG was further added after 5 days to select cell clones in which DNA was inserted into the endogenous HPRT gene of ES cells and the HPRT function was destroyed.
2. When the HPRT gene in the X chromosome and the target vectors HPRT7.8Kb (left arm) and HPRT2.3Kb ( right arm ) undergo homologous recombination in mouse ES cells, the endogenous HPRT gene is exon 6 to exon. 8 overlaps, and the 3 ′ end of the overlapping portion has a structure in which the GFP gene is bound (FIG. 1). This ES cell (HPRT-dup-GFP cell) lacks the function of the HPRT gene. This is because 7.8 Kb of the left arm is only up to the middle of exon 8, and an abnormal HPRT protein is synthesized in the cell. These ES cells spontaneously mutate the overlapping part at a low frequency, and the overlapping part is lost (deletion mutation, FIG. 2). This is a typical reverse mutation. When this mutation occurs, the structure of the wild type HPRT gene is restored, and the HPRT-GFP fusion mRNA is expressed, so that the HPRT-GFP fusion protein is produced in the cell. Since the HPRT-GFP fusion protein retains HPRT activity and GFP activity, the cells are resistant to HAT medium and emit GFP. When the HPRT partial duplication-GFP knock-in ES cells are grown in a medium containing 6TG (6 thioguanine), about 10 5 cells are seeded in a 10 cm petri dish and 6TG is removed and selection is performed in a medium containing HAT in about 7 days. Several resistant colonies appear. This mutation can be confirmed by Southern blotting or PCR inspection of genomic DNA derived from ES cell clones. FIG. 3 shows an example in which several HPRT-dup-GFP cell DNAs were subjected to PCR. The structure of the HPRT locus of HPRT-dup-GFP cells can be confirmed by the following PCR. (1) A 7.8 Kb left arm is inserted into the homologous site of the endogenous HPRT locus (FIG. 3A). A PCR amplified DNA of about 7.8 Kb can be confirmed by PCR using the HPRT gene base sequence upstream of the left arm DNA and the base sequence in the neomycin resistance gene as primers. The primer base sequences used were TAGTGAGTTTAAAGACCGAG (about 150 bases downstream of HPRT exon 5) (SEQ ID NO: 9), CTTCTATCGCCTTCTTGAC (about 10 bases upstream of the stop codon of the neomycin resistance gene) (SEQ ID NO: 10). (2) It shows that a right arm of about 2.3 Kb is inserted into the homologous site of the endogenous HPRT locus. A PCR amplified DNA of about 2.5 Kb can be confirmed by PCR using the nucleotide sequence in the GFP gene expression unit and the HPRT gene nucleotide sequence further downstream from the right arm DNA as a primer (FIG. 3B). The primer base sequences used were CAGCAAGGGGGAGGATTGGGAAGAC (about 240 bases downstream of the stop codon of the GFP gene) (SEQ ID NO: 11), GCATTTGTCACATGTCAGGT (about 3.5 Kb downstream of the HPRT stop codon) (SEQ ID NO: 12). (3) The insertion of the GFP gene into the mouse HPRT locus can be confirmed by PCR amplification of the approximately 0.36 Kb portion containing the GFP gene (FIG. 3B). The primer base sequences used were TGTCCTCTTCAAGTTGCTGG (180 bases upstream of HPRT exon 9) (SEQ ID NO: 13), TTCAAGTAGACGTGATGACC (180 bases downstream from the Eco RI site of the pQBI-25fN1 plasmid) (SEQ ID NO: 14). Mutated ES cell clones selected with HAT-containing medium are confirmed as approximately 8.6 Kb DNA by PCR amplification of the HPRT base sequence further upstream from the HPRT gene site introduced by homologous recombination and the base sequence in the GFP gene Yes (Figure 3C). The primer base sequences used were TAGTGAGTTTAAAGACCGAG (about 150 bases downstream of HPRT exon 5) (SEQ ID NO: 15), CCAGTAGTGCAGATGAACTT (170 bases downstream from the EcoRI site in the pQBI-25fN1 plasmid) (SEQ ID NO: 16). It can also be confirmed that PCR amplification of 8.6 Kb DNA does not occur in the parental HPRT-dup-GFP cells by this PCR (FIG. 3C). The frequency of spontaneous mutation in HPRT-dup-GFP cells is about 10 to the fifth power. When these colonies are observed with a fluorescence microscope, they all emit green fluorescence (FIG. 4), and by examining the genotype, it can be confirmed that all have returned to wild-type HPRT (FIG. 3C).

[Example 2] Preparation of HPRT partial duplication-GFP knock-in mice ES cells obtained were prepared by standard methods (for example, “Jean Targeting” written by Joyner AL, translated by Tetsuo Noda, published by Medical Science International, 1995, or Capecchi. Science 244). : 1288-1292, 1989) can be injected into a mouse embryo ( blastocyst ) to produce a chimeric mouse. HPRT-dup-GFP mice can be prepared by laying offspring derived from ES cells by crossing chimeric mice. An example is shown in which an agouti-colored mouse derived from an ES cell was actually created by crossing a chimeric mouse with a C57BL / 6J mouse. In this case, the injected ES cells are derived from 129Sv mice (agouti coat color), but the transplanted embryo ( blastocyst ) is a C57BL / 6J mouse (black), so that the offspring produced by crossing this chimeric mouse with the C57BL / 6J mouse If it is agouti color, it can be easily identified as an ES cell-derived knock-in mouse (FIG. 5). It can also be confirmed that this knock-in mouse holds the same knock-in allyl as ES. Specifically, a PCR-amplified DNA of about 2.5 Kb can be confirmed by PCR using the base sequence in the GFP gene expression unit and the HPRT gene base sequence further downstream from the right arm DNA as a primer. The primer base sequences used were CAGCAAGGGGGAGGATTGGGAAGAC (about 240 bases downstream of the GFP gene stop codon) (SEQ ID NO: 11), GCATTTGTCACATGTCAGGT (about 3.5 Kb downstream of the HPRT stop codon) (SEQ ID NO: 12). In FIG. 6, lanes 1-6 are all agouti mice born by crossing chimeric mice and C57BL / 6J mice, but only # 6 is male. Since ES cells are originally male cells with XY chromosomes and this X chromosome is a knock-in allele, it can also be confirmed that only embryonic females derived from ES cells can inherit the knock-in allele (lane 7 is used in this experiment). Knock-in ES cells used). In the next generation, the X chromosome with this knock-in allele can be inherited by both males and females.

It is a figure which shows the preparation method of a HPRT ^dup GFP cell. When homologous recombination occurs at the position of the X mark in ES cells, duplication of HPRT genomic DNA including exon 6 to exon 8 occurs. FIG. 6 shows deletion mutations occurring at the HPRT ^dup locus. When a deletion mutation (reversion mutation) occurs due to recombination, the normal HPRT gene structure is restored and GFP is linked to the 5 'end. It is a figure which shows the structure of the HPRT ^dup locus in ES cell. When back mutation occurs, 8.6Kb PCR fragment can be detected (121-1Rev in the rightmost photo) (A) Left arm of HPRT ^dup cell clone, (B) Right arm and GFP insertion, (C) Cause back mutation PCR confirmation of leftarm structure of living cells It is a figure which shows the ES cell colony which caused the mutation. Cells with deletion mutations in the overlapping region regain HPRT activity and form HAT-resistant colonies. The cells glow green under a fluorescent microscope. (A) Optical microscope of mutant cell colony, (B) Fluorescence microscope image Agouti mice (2 weeks old) born by crossing of chimeric mice and C57BL / 6J mice. The central offspring mouse is an agouti mouse, and the surrounding two are mother mice (C57BL / 6J). Confirmation of knockin mouse genotype. In lanes 1-6, the presence of knock-in allyl can be confirmed as in FIG. 3B. Lane 6 is a male mouse showing agouti coat color, and it can be seen that there is no X chromosome having a knock-in allele.

Claims (6)

A knock-in target vector comprising a DNA sequence comprising the following gene sequences (1) to (4) linked in order from the 5 ′ side.
(1) a partial gene sequence of a hypoxanthine phosphoribosyltransferase (HPRT) gene that is ubiquitously expressed in a mammal, wherein the sequence length is 1 kb or more (2) a marker gene sequence (3) A gene sequence comprising the same partial gene sequence as in 1) from the partial gene sequence to the 3 ′ end of the HPRT gene, wherein a gene encoding a fluorescent protein is linked in-frame to the 3 ′ end Sequence (4) Gene sequence comprising 1 kb or more downstream of the locus from the 3 ′ end of the HPRT gene   A DNA sequence as defined in claim 1 comprising introducing a knock-in target vector comprising the DNA sequence as defined in claim 1 into a cell in vitro and knocking said DNA sequence into the genome of said cell by homologous recombination. A method for producing a cell containing the same.   A cell comprising the DNA sequence defined in claim 1 knocked into an intracellular genome.   A non-human mammal comprising the DNA sequence defined in claim 1 knocked into an intracellular genome.   A mutagen is given to the cell according to claim 3 or the non-human mammal according to claim 4, and fluorescence is emitted from the cell or the animal cell when a mutation occurs in the cell or the animal cell. A method for measuring the effect of a mutagen on a living body, including measuring.   6. The method of claim 5, wherein the mutagen is a pharmaceutical, food, radiation or environmental mutagen.

Images