JP5176248B2 - Methods for detecting genetic mutations related to eggshell strength of chicken eggs - Google Patents

Description

  The present invention relates to a gene related to eggshell strength, and a gene mutation thereof, which is characterized by detecting a mutation on the ovocalixin 32 gene, and is a chicken laying an egg with improved eggshell strength-related traits? The present invention relates to a method for determining whether or not.

  Genetic improvements in chickens have been made using statistical genetic techniques. That is, after measuring the phenotype, the degree of ability (genetic ability) transmitted from the parent to the child is estimated, thereby selecting the excellent individual.

  Measurement of egg quality, represented by eggshell strength, can only be performed on mature females. Male information can only be estimated from the fact that it inherits half of the genetic ability of the mother who gave birth to the male. Therefore, it is not easy to improve egg quality and to select individuals because it is necessary to maintain a large number of mature individuals with a large generation interval. Accordingly, there is a strong demand for providing a technique capable of easily selecting individuals with excellent egg quality such as eggshell strength in a short period of time.

  By the way, traits represented by continuous real numbers or integers, such as chicken egg-laying rate and eggshell strength, are called “quantitative traits”. In recent years, analysis of chicken genome has reported loci genetically linked to many quantitative traits, ie, quantitative trait loci (QTL) (Non-patent Document 1: Poultry Science 85: 2079-2096, 2006). QTLs related to eggshell strength are reported to be on chromosomes 1, 4, 7 and Z.

Prior art document information related to the invention of the present application is shown below.
Poultry Science 85: 2079-2096, 2006

  The above Non-Patent Document 1 is a valuable report, but even if it is assumed that a gene related to eggshell strength may be included in the QTL proposed in the non-patent document, any gene is eggshell. It does not give any knowledge or suggestion about whether it is related to strength or what kind of gene mutation is related to eggshell strength.

  The present invention has been made in view of such circumstances, and its purpose is to clarify the existence of a gene related to chicken eggshell strength and to identify what kind of gene mutation leads to improvement of eggshell strength. Another object of the present invention is to provide a technique for identifying a chicken with a strong eggshell strength by detecting a genetic mutation.

  The National Institute of Agricultural and Food Sciences, National Institute of Animal Husbandry, has created a weak eggshell line and a strong eggshell line that have been selected for 14 generations or more of the white leghorn species that are the main varieties of hens for eggs. Is maintained. In order to elucidate the genes related to eggshell strength, an F2 hybrid family with both parents as parents was created. The weak eggshell line and the strong eggshell line have the same line as their ancestors, so if you carefully analyze this family line, you can obtain genetic information that fluctuates due to the selection of eggshell strength. QTL (Quantitative trait loci) analysis was performed on the assumption that “determined genes” were included.

  And QTL relevant to eggshell strength was found on the 9th chromosome. This does not overlap at all with the position of QTL (first, fourth, seventh and Z chromosomes) described in Non-Patent Document 1.

  The QTL information and the base sequence of the chicken genome (Ensembl Chicken Genome Browser http://www.ensembl.org/Gallus_gallus/ and UCSC Chicken Genome Browser Gateway (2004) http://genome.ucsc.edu/cgi- bin / hgGateway? org = Chicken & db = 0 & hgsid = 30948908) and came to focus on the Ovocalyxin-32 gene.

  As a result of intensive studies on the relationship between the gene and traits related to eggshell strength (egg shell weight, egg weight), (1) single nucleotide polymorphism (SNP) with amino acid residue substitution in the sixth exon of the gene (2) The protein database of the National Biotechnology Information Center Entrez (http://www.ncbi.nlm.nih.gov/sites/entrez? a protein with the amino acid sequence registered in (db = protein) (wild type) as a transcription / translation product, and a wild type derived from a single nucleotide polymorphism of exon 6 have a protein with 5 amino acid mutations (Mutation type) is a transcription / translation product, but it is roughly divided into two types of genotypes. (3) Furthermore, when eggs produced by chickens with two genotypes are compared, egg weight, eggshell Heavy, short The present inventors have found that eggshell strength-related traits such as diameter and major axis are significantly different and have completed the present invention.

More specifically, the present invention provides the following [1] to [15].
[1] A method for determining whether or not to produce an egg having improved eggshell strength-related traits compared to a wild-type individual, characterized by detecting a mutation on the ovocalixin 32 gene for a test chicken, A method comprising the following steps (a) to (d).
(A) Step of extracting DNA from chicken to be tested (b) Step of amplifying DNA fragment containing polymorphic site in extracted DNA (c) Analyzing amplified DNA fragment and detecting polymorphism In the step of (d) and (c), the step [2] of determining whether the chicken lays an egg with strong eggshell strength based on the detected mutation. The polymorphism is a single nucleotide polymorphism. The method described.
[3] In the polymorphic site, C in the base sequence described in SEQ ID NO: 1 compared to G in the case where the base species at position 7052 is C and C in comparison to the case where the base type at position 7056 is A. , A compared to the case where the base species at position 7057 is G, T compared to the case where the base type at position 7063 is C, G compared to the case where the base type at position 7068 is T, or The method according to [2], wherein when the base species at position 7086 is C as compared to T, the test chicken is a chicken that lays eggs with improved eggshell strength-related traits.
[4] The method according to any one of [1] to [3], wherein the target trait for determining an egg shell strength-related trait is egg weight, eggshell weight, or eggshell strength.
[5] The method according to [1], wherein in the step (b), the base sequence is amplified by a PCR method.
[6] The method according to [1], wherein in step (c), the presence of a single nucleotide polymorphism is detected by detecting a restriction fragment length polymorphism (RFLP).
[7] The single nucleotide polymorphism at position 7052 in the nucleotide sequence set forth in SEQ ID NO: 1 is detected using the restriction enzymes Hinf I, CviBI, FnuAI, HhaII or TfiI. the method of.
[8] The method according to [1], wherein in the step (c), a single nucleotide polymorphism is detected by determining a base sequence of the amplified DNA fragment.
[9] The method according to [1], wherein in the step (c), the single nucleotide polymorphism is detected with a probe that specifically hybridizes to the DNA containing the single nucleotide polymorphism site.
[10] The protein according to any one of the following (a) to (d), which is a variant of ovocalixin 32 protein and has a function of improving eggshell strength-related traits as compared to a wild-type individual.
(A) In the base sequence described in SEQ ID NO: 1, the base type at position 7052 is C to G, the base type at position 7056 is A to C, the base type at position 7057 is G to A, and the base type at position 7063 is A protein encoded by DNA comprising a base sequence in which the base species at position C68 to T, the base species at position 7068 is mutated from T to G, and the base species at position 7086 from T to C (b) in the base sequence set forth in SEQ ID NO: 1 , 7052-position base species from C to G, 7056-position base species from A to C, 7057-position base species from G to A, 7063-position base species from C to T, 7068-position base species from T to G , A protein encoded by DNA that hybridizes under stringent conditions to a DNA containing a nucleotide sequence in which the nucleotide species at position 7086 has been mutated from T to C (c) a protein comprising the amino acid sequence of SEQ ID NO: 3 ( d) In the amino acid sequence of SEQ ID NO: 3, one or more amino acids are substituted, deleted, inserted, and / or Other antibodies that specifically bind to the protein or fragment thereof according to the protein [11] [10] comprising the amino acid sequence added.
[12] Specifically hybridizes to DNA containing a polymorphic site at positions 7052, 7056, 7057, 7063, 7068, or 7086 in the base sequence set forth in SEQ ID NO: 1, and has at least 15 nucleotides A probe having a chain length.
[13] A DNA chip on which the probe according to [12] is fixed.
[14] A primer oligonucleotide for amplifying DNA containing a polymorphic site at positions 7052, 7056, 7057, 7063, 7068, or 7086 in the base sequence set forth in SEQ ID NO: 1.
[15] Egg shell strength-related, comprising the probe according to [12], the DNA chip according to [13], the primer according to [14], or a restriction enzyme for detecting a restriction fragment length polymorphism (RFLP) A kit for determining whether a chicken lays eggs with improved traits.

[Embodiment of the Invention]
Hereinafter, specific embodiments and technical scope of the present invention will be described in detail.

  The present invention is a method for determining whether or not to produce an egg having improved eggshell strength-related traits as compared to a wild-type individual, characterized by detecting a mutation on the ovocalixin 32 gene for a test chicken. The following steps (a) a step of extracting DNA from a chicken to be tested, (b) a step of amplifying a DNA fragment containing a polymorphic site in the extracted DNA, (c) analysis of the amplified DNA fragment And (d) determining whether the chicken lays an egg with strong eggshell strength based on the detected mutation.

  In the present invention, “chicken” means an animal belonging to the scientific name Gallus gallus domesticus. As chicken breeds, white leghorn, brown leghorn, Minorca, Andalusian, Australope and other egg species, side patch Plymouth Rock, white Plymouth Rock, Rhode Island Red, New Hampshire, Wyen Red, Orpington, etc. “Chicken” that is largely classified into meat-type species such as white cornish and pet chickens such as tail-length chickens and chabos (Livestock Dictionary, Yokendo, Tokyo) Well, or a hybrid of these. Preferred examples include egg seeds, combined use species, and hybrids thereof, and progeny thereof, and more preferable examples include white leghorns, white leghorn hybrids and progeny thereof.

  In the present specification, “Ovocalyxin-32 (hereinafter also referred to as“ OCX-32 ”for short) is a base protein constituting the eggshell. The genome base sequence of OCX-32 is shown in SEQ ID NO: 1. The sequences are Ensembl Chicken Genome Browser http://www.ensembl.org/Gallus_gallus/ and UCSC Chicken Genome Browser Gateway (2004) http://genome.ucsc.edu/cgi-bin/hgGateway?org=Chicken&db=0&hgsid = 30948908) of chromosome 9, 23,996,312-24,003,804, and can be easily obtained by those skilled in the art. The amino acid sequence of OCX-32 is shown in SEQ ID NO: 2. This sequence is described in the accession number Q90YI1 of the protein database Entrez (http://www.ncbi.nlm.nih.gov/sites/entrez?db=protein) of the National Center for Biotechnology Information. If there is, it can be acquired easily.

  FIG. 3 schematically shows the open reading frame (ORF) region of the OCX-32 gene. There are six exons in the ORF. In the following, the position information indicates the number of nucleotides from which the first position of the ORF region corresponds to “1” and each position corresponds to the same position.

  Examples of the “polymorphism” in the present invention include single nucleotide polymorphism. The “single nucleotide polymorphic site” of the present invention is not particularly limited as long as it is a polymorphism present in the OCX-32 gene or a DNA region adjacent to the gene.

  As a result of detailed investigations and studies by the present inventors, six single nucleotide polymorphisms (SNPs) found in the sixth exon of the OCX-32 gene and the resulting change in the amino acid sequence of the OCX-32 protein are shown.

  Specifically, the polymorphic site used in the method of the present invention corresponds to the polymorphic site at positions 7052, 7056, 7057, 7063, 7068, or 7086 in the base sequence described in SEQ ID NO: 1. The polymorphic site to do can be mentioned.

  In a preferred embodiment of the present invention, the mutation of the base species at the polymorphic site described above is such that the base sequence at position 7052 in the base sequence set forth in SEQ ID NO: 1 is compared to that at position G, 7056. C compared to the case where the base type is A, A compared to the case where the base type at position 7057 is G, T as compared to the case where the base type at position 7063 is C, and the base type at position 7068 The test chicken is a chicken that lays eggs with improved eggshell strength-related traits when the base species at position 7086 is C compared to the case where T is T compared to the case where T is T. It can be determined that there is.

  The genomic DNA sequence shown in SEQ ID NO: 1 may have a deletion or insertion of one to several bases in the OCX-32 gene (particularly the untranslated region (UTR)) due to mutation or the like. There is. In this case, the polymorphic site should be read and interpreted in consideration of such base deletion or insertion.

  In addition, the base type of the single nucleotide polymorphism site shown above may indicate a base type on the complementary strand side with respect to the sequence shown in the sequence listing. If it is used, it is easy for those skilled in the art to confirm the difference, and in performing detection, the other result can be determined inevitably by examining either the plus strand or the minus strand.

  Of the six single nucleotide polymorphisms (SNPs) in the sixth exon, five base substitutions result in amino acid substitutions. As a result of detailed investigations and studies by the present inventors, it has been found that the six SNPs are not in an independent relationship with each other and are linked in principle. For example, when the 7052nd base is cytosine (C), the 7056th base is adenine (A), the 7057th base is guanine (G), the 7063rd base is C, and the 7068th base is thymine (T ), The 7086th base was T. The amino acid sequence derived from this base sequence is the same as SEQ ID NO: 2, and is hereinafter referred to as “wild type”. On the other hand, in the mutant newly discovered in the present invention, when the 7052nd base is guanine (G), the 7056th base is C, the 7057th base is A, the 7063rd base is T, The 7068th base was G, and the 7086th base was C. The amino acid sequence derived from this base sequence is shown in SEQ ID NO: 3, and is hereinafter referred to as “mutant type”. For example, when examining whether a chicken is a “wild type” genotype or “mutant type” genotype, one base of any one of 7052, 7056, 7057, 7063, 7068, 7086 is used. It means that it can be determined by examining polymorphism (SNP).

In the present invention, “the eggshell strength-related character is improved” preferably means that the eggshell strength is improved. In the present invention, the eggshell strength should be higher than the average value of a general market egg. Preferably, it is 2.5 kg / cm ² or more, preferably 3.0 kg / cm ² or more, more preferably 3.5 kg / cm ² or more, 4.5 kg / cm ² or more, 5.0 kg / cm ² or more.

  In the present invention, the target trait for determining the eggshell strength-related character is not particularly limited, and examples thereof include egg weight, eggshell weight, eggshell strength, and the like.

  As a result of investigating the strong eggshell line in the present invention, the egg of the hen having the “mutant” gene has an egg weight, eggshell weight, minor axis, and major axis that are larger than those of the hen having the “wild type” gene. The value was significantly higher. That is, the egg of a hen having a “mutant” gene discovered in the present invention was found to be significantly larger than the egg of a hen having a “wild type” gene homozygously. A hen that has a strong egg shell without reducing the egg volume. This tendency is even greater in chickens that have homozygote than chickens that have a heterozygous “mutant” gene discovered in the present application.

  In the determination method of the present invention, the method for examining the genotype of the OCX-32 gene is not particularly limited, and one base of any one of the 7052, 7056, 7057, 7063, 7068, and 7086 positions of the OCX-32 gene. A conventionally known method capable of directly or indirectly examining a polymorphism (SNP) can be applied.

  A person skilled in the art can determine the base type in the single nucleotide polymorphic site of the present invention by various methods.

  The method of the present invention includes (a) a step of extracting a nucleic acid from a chicken to be tested. Nucleic acids can be extracted by methods known to those skilled in the art.

  The gene sample used for determination may be either genomic DNA or cDNA. In the case of genomic DNA, culture of any organ / tissue / cell / blood body fluid, chicken embryo-derived cells collected from amniotic fluid or chorioallantoic fluid, tissues collected, etc. DNA may be purified and extracted from the cells thus obtained according to a conventional method. In the case of cDNA, mRNA may be purified and extracted from any organ, tissue, cell, etc. of the subject chicken according to a conventional method and then synthesized by reverse transcriptase. Extraction of DNA or RNA can be carried out by those skilled in the art using generally known methods such as the phenol / chloroform method or a commercially available genomic DNA extraction kit.

  In sperm eggs, eggshell strength-related traits are determined for parent chickens in shell-derived nucleic acids, and for chicken embryos in chicken-derived cells collected from amniotic fluid or chorioallantoic fluid. be able to.

  Next, in the method of the present invention, (b) a step of amplifying a nucleic acid fragment containing a polymorphic site in the extracted nucleic acid is performed. Amplification of the nucleic acid can be performed, for example, by performing PCR using a nucleic acid sample as a template, using a primer that hybridizes to a nucleic acid fragment containing the polymorphic site of the present invention. For those skilled in the art, PCR can be performed by appropriately selecting optimal conditions for the reaction conditions and the like based on experiments or experience. Usually, PCR can be easily carried out using a commercially available reagent kit containing a reaction solution and a heat-resistant polymerase, a commercially available PCR device, and the like. The DNA region amplified by PCR is not particularly limited as long as it is a DNA region containing the polymorphic site of the present invention, but positions 7052, 7056, 7057, 7063 in the base sequence described in SEQ ID NO: 1. A DNA region containing a portion corresponding to either position 7068 or position 7086 is preferred.

  The primer used in the PCR of the present invention includes a nucleotide sequence containing a portion corresponding to any of positions 7052, 7056, 7057, 7063, 7068, or 7086 in the nucleotide sequence set forth in SEQ ID NO: 1. The oligonucleotide is not particularly limited as long as it is an oligonucleotide that specifically hybridizes under stringent conditions. Here, “specifically hybridize” means normal hybridization conditions, preferably stringent hybridization conditions (for example, Sambrook et al., Molecular Cloning, Cold Spring Harbor Laboratory Press, New York, USA, In the condition described in the second edition 1989), it means that cross-hybridization does not occur significantly with DNA encoding other proteins.

  Hybridization conditions can be appropriately selected by those skilled in the art. An example is 25% formamide, 50% formamide under more severe conditions, 4 × SSC, 50 mM Hepes pH 7.0, 10 × Denhardt's solution, 20 μg / ml denatured in a hybridization solution containing denatured salmon sperm DNA at 42 ° C. After overnight prehybridization, a labeled probe is added and hybridization is performed by incubating overnight at 42 ° C. The cleaning solution and temperature conditions for the subsequent cleaning are about 1xSSC, 0.1% SDS, 37 ° C, more severe conditions are about 0.5xSSC, 0.1% SDS, 42 ° C, and more severe conditions are about 0.2xSSC. , 0.1% SDS, about 65 ° C. ”. Thus, isolation of DNA having high homology with the probe sequence can be expected as the conditions for washing hybridization are more severe. However, combinations of the above SSC, SDS, and temperature conditions are exemplary, and those skilled in the art will understand the above or other factors that determine the stringency of hybridization (eg, probe concentration, probe length, hybridization reaction). It is possible to achieve the same stringency as above by appropriately combining the time and the like.

  A primer oligonucleotide sequence capable of amplifying a DNA region containing SNP used in the present invention can be appropriately designed by those skilled in the art based on sequence information of DNA serving as a template. Preferably, it is complementary to DNA containing a portion corresponding to any of positions 7052, 7056, 7057, 7063, 7068, or 7086 in the nucleotide sequence shown in SEQ ID NO: 1, or a complementary strand thereof. An oligonucleotide containing 15 consecutive bases. In PCR, when a DNA region containing the SNP is amplified, a pair of oligonucleotides set so as to sandwich the DNA region containing the SNP is usually used. The oligonucleotides consisting of the nucleotide sequences set forth in SEQ ID NOs: 4 and 5 are the most preferred examples of the oligonucleotide of the present invention.

  The oligonucleotide of the present invention does not need to be completely complementary to the DNA region as long as the DNA region containing the SNP can be amplified. For example, even an oligonucleotide having a substitution mutation to other bases on the 5 'end side or about several bases, or an arbitrary base added to the 5' end side, can be used as the oligonucleotide of the present invention. Is considered possible.

  The above-mentioned oligonucleotide of the present invention can be easily obtained by those skilled in the art, usually using a commercially available oligonucleotide synthesizer or a synthetic oligonucleotide contract service.

  The primer of the present invention can be further modified. For example, a fluorescent substance or a primer labeled with a binding affinity substance such as biotin or digoxin can also be used in the method of the present invention.

  Next, in the present invention, (c) a step of analyzing the amplified DNA fragment and detecting a polymorphism is performed. For example, a method using restriction fragment length polymorphism (RFLP) and a method using PCR-RFLP method can be mentioned.

  RFLP utilizes the fact that a restriction enzyme recognition site mutation or a base insertion or deletion in a DNA fragment caused by restriction enzyme treatment can be detected as a change in the size of the fragment produced after the restriction enzyme treatment. If there is a restriction enzyme that recognizes the base sequence containing the polymorphism to be detected, the base of the polymorphic site can be known by the principle of RFLP.

  In the present invention, for example, single-nucleotide polymorphism at position 7052 in the nucleotide sequence set forth in SEQ ID NO: 1 can be detected using the restriction enzyme Hinf I. Also, CviBI, FnuAI, HhaII, TfiI, etc. may be used to detect the 7052th base substitution. Further, any restriction enzyme can be used as long as it is a restriction enzyme that detects the 7056, 7057, 7063, 7068, and 7086th base substitutions.

  It can also be carried out by directly determining the base sequence of DNA containing the single nucleotide polymorphism site of the present invention. Those skilled in the art can easily determine the base sequence of the isolated DNA using a DNA sequencer or the like.

  Various methods for determining the base type of a polymorphic site whose base variation has been clarified in advance are known. The method for determining the base species of the present invention is not particularly limited. For example, TaqMan PCR method, AcycloPrime method, MALDI-TOF / MS method and the like have been put to practical use as analysis methods applying the PCR method. Invader and RCA methods are known as methods for determining base types that do not depend on PCR. Furthermore, the base species can be determined using a DNA array. Any of the methods described herein can be applied to the determination of the base type of the polymorphic site in the present invention.

  In addition, the base species can be determined using the PCR-SSP method. The PCR-SSP method is a method for determining an SNP type by performing an extension reaction using an allele-specific primer on a PCR product. The genotype can be easily determined by discriminating the peak pattern of the PCR product with a sequencer.

  In addition, the DNA species can be used to determine the base species (Cell engineering separate volume “DNA microarray and the latest PCR method”, Shujunsha, published 2000.4 / 20, pp97-103 “SNP analysis using oligo DNA chip”, Sabae. Shinichi). In the DNA array, sample DNA (or RNA) is hybridized to a large number of probes arranged on the same plane, and the hybridization to each probe is detected by scanning the plane. Since responses to many probes can be observed simultaneously, for example, a DNA array is useful for analyzing a large number of polymorphic sites simultaneously.

  More specifically, a DNA chip (or the same kind of instrument) in which a probe for testing any one of the 7052, 7056, 7057, 7063, 7068, and 7086 bases of the OCX-32 gene is arranged on a substrate. And using this DNA chip or the like, single nucleotide polymorphism (SNP) typing is performed based on the presence or absence of a hybridization signal between a gene sample from a subject and a probe. As the probe, a base sequence containing any one of the polymorphic sites (1) to (8) or a complementary sequence thereof can be used. Here, “DNA chip” mainly means a synthetic DNA chip that uses a synthesized oligonucleotide as a probe, but also includes a pasted DNA microarray that uses cDNA such as a PCR product as a probe. And A genetic polymorphism detection instrument such as a DNA chip that can be used in the determination method of the present invention is also included in the present invention.

  In addition to the above method, an allele specific oligonucleotide (ASO) hybridization method can be used to detect a base at a specific site. An allyl-specific oligonucleotide (ASO) is composed of a base sequence that hybridizes to a region where a polymorphic site to be detected is present. When ASO is hybridized to sample DNA, the hybridization efficiency decreases if a mismatch occurs at the polymorphic site due to the polymorphism. Mismatches can be detected by Southern blotting or a method that uses the property of quenching by intercalating a special fluorescent reagent into the hybrid gap. Mismatches can also be detected by the ribonuclease A mismatch cleavage method. In the present invention, the polymorphism described in any of the polymorphic sites corresponding to any of positions 7052, 7056, 7057, 7063, 7068, or 7086 in the nucleotide sequence set forth in SEQ ID NO: 1. Oligonucleotides that hybridize to DNA containing the type site and have a chain length of at least 15 nucleotides can be used as probes for use in hybridization methods.

  The oligonucleotide specifically hybridizes to DNA containing any one of the polymorphic sites of the present invention. Here, “specifically hybridize” means normal hybridization conditions, preferably stringent hybridization conditions (for example, Sambrook et al., Molecular Cloning, Cold Spring Harbor Laboratory Press, New York, USA, In the condition described in the second edition 1989), it means that cross-hybridization does not occur significantly with DNA encoding other proteins. If the specific hybridization is possible, the oligonucleotide does not need to be completely complementary to the DNA base sequence of the OCX-32 gene in the gene to be detected or a DNA region in the vicinity of the gene.

  Further, a dCAPS (derived CAPS) marker that creates a restriction enzyme site by introducing a mutation into a CAPS (Cleaved Amplified Polymorphic Sequence) marker or primer can also be used. The dCAPS marker is a technique of creating a restriction enzyme site on a PCR product by causing a mismatch between a PCR primer and DNA of a template (Japanese Patent Laid-Open No. 2003-259898).

  As a method that does not require a labeled probe, a method for detecting a difference in base using a change in the secondary structure of DNA as an index is also known. PCR-SSCP utilizes the fact that the secondary structure of single-stranded DNA reflects the difference in its nucleotide sequence (Cloning and polymerase chain reaction-single-strand conformation polymorphism analysis of anonymous Alu repeats on chromosome 11. Genomics 1992 Jan 1; 12 (1): 139-146., Detection of p53 gene mutations in human brain tumors by single-strand conformation polymorphism analysis of polymerase chain reaction products. Oncogene. 1991 Aug 1; 6 (8): 1313- 1318., Multiple fluorescence-based PCR-SSCP analysis with postlabeling., PCR Methods Appl. 1995 Apr 1; 4 (5): 275-282.). The PCR-SSCP method is performed by dissociating the PCR product into single-stranded DNA and separating it on a non-denaturing gel. Since the mobility on the gel varies depending on the secondary structure of the single-stranded DNA, if there is a difference in base at the polymorphic site, it can be detected as a difference in mobility.

  Other examples of methods that do not require a labeled probe include denaturant gradient gel electrophoresis (DGGE method). The DGGE method is a method in which a mixture of DNA fragments is run in a polyacrylamide gel having a concentration gradient of a denaturing agent, and the DNA fragments are separated depending on the instability of each. When a mismatched unstable DNA fragment migrates to a certain denaturant concentration in the gel, the DNA sequence around the mismatch is partially dissociated into single strands due to its instability. The mobility of a partially dissociated DNA fragment becomes very slow and can be separated from the mobility of a complete double-stranded DNA without a dissociated portion.

  Next, in the steps (d) and (c), the present invention includes a step of determining whether or not a chicken lays an egg having a high eggshell strength based on the detected mutation. In the present invention, as described above, the mutation of the base type at the polymorphic site is such that the base at position 7052 in the base sequence at position 7052 in the base sequence described in SEQ ID NO: 1 is compared to that at position 7052. Compared to the case where the species is A, the base species at position 7057 is A, compared to the case where the base species at position 7057 is G, T, compared to the case where the base species at position 7063 is C, the base species at position 7068 is When the base species at position 7086 is C compared to the case where T is T or G compared to the case where T is T, it is possible to determine that the test chicken is a chicken that lays eggs with strong eggshell strength it can.

  The determination method of the present invention can be used to select target chickens and sperm even when breeding chickens using genetic recombination methods, or when genetic experiments useful in the field of livestock are conducted. Available. In addition, it is also possible to determine fertilized eggs before hatching, for example, collecting chicken embryo-derived cells from amniotic fluid or chorioallantoic fluid, preparing a genetic sample from the cells, and at the chick stage before hatching, eggshell It can also be determined whether or not the chicken lays eggs with improved strength.

Furthermore, the present invention includes OCX-32 muteins that have the function of improving eggshell strength-related traits. Specifically, the OCX-32 mutant of the present invention is an OCX-32 mutant having a function that eggshell strength improves a related character, and is derived from a chicken, wherein the proteins (a) to (d) below are: Can be mentioned.
(A) In the base sequence described in SEQ ID NO: 1, the base type at position 7052 is C to G, the base type at position 7056 is A to C, the base type at position 7057 is G to A, and the base type at position 7063 is A protein encoded by DNA comprising a base sequence in which the base species at position C68 to T, the base species at position 7068 is mutated from T to G, and the base species at position 7086 from T to C (b) in the base sequence set forth in SEQ ID NO: 1 , 7052-position base species from C to G, 7056-position base species from A to C, 7057-position base species from G to A, 7063-position base species from C to T, 7068-position base species from T to G , A protein encoded by DNA that hybridizes under stringent conditions to a DNA containing a nucleotide sequence in which the nucleotide species at position 7086 has been mutated from T to C (c) a protein comprising the amino acid sequence of SEQ ID NO: 3 ( d) In the amino acid sequence of SEQ ID NO: 3, one or more amino acids are substituted, deleted, inserted, and / or Proteins other comprising the amino acid sequence obtained by adding

  The OCX-32 protein variant in the present invention is a naturally-occurring protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence shown in SEQ ID NO: 3. In addition, a protein functionally equivalent to the protein consisting of the amino acid sequence set forth in SEQ ID NO: 3 is also included. In the base sequence described in SEQ ID NO: 1, the base species at position 7052 is C to G, the base type at position 7056 is A to C, the base type at position 7057 is G to A, and the base type at position 7063 is C. To T, a protein encoded by a naturally occurring DNA that hybridizes under stringent conditions with a DNA containing a base sequence in which the base species at position 7068 is mutated from T to G and the base species at position 7086 is changed from T to C. A protein that is functionally equivalent to the protein consisting of the amino acid sequence set forth in SEQ ID NO: 3 can also be cited as a variant of the OCX-32 protein.

  In the present invention, the number of amino acids to be mutated is not particularly limited, but is usually within 30 amino acids, preferably within 15 amino acids, and more preferably within 5 amino acids (for example, within 3 amino acids). The amino acid residue to be mutated is preferably mutated to another amino acid in which the properties of the amino acid side chain are conserved. For example, the properties of amino acid side chains include hydrophobic amino acids, hydrophilic amino acids, amino acids having aliphatic side chains, amino acids having hydroxyl group-containing side chains, amino acids having sulfur atom-containing side chains, carboxylic acid and amide-containing side chains. And amino acids having a base-containing side chain and amino acids having an aromatic-containing side chain, and those skilled in the art can appropriately select them. It is already known that a polypeptide having an amino acid sequence modified by deletion, addition and / or substitution by one or more amino acid residues to a certain amino acid sequence maintains its biological activity. Yes.

  In the present invention, “functionally equivalent” means that the target protein has a biological function or biochemical function equivalent to that of a mutant of the OCX-32 protein. In the present invention, examples of the biological function and biochemical function of the OCX-32 protein mutant include a function of improving eggshell strength-related traits. Biological properties include the specificity of the site to be expressed and the expression level.

  The present invention also provides an antibody that specifically binds to the OCX-32 mutant protein of the present invention.

  Another embodiment of the test agent of the present invention is an identification reagent containing an antibody that specifically recognizes an OCX-32 mutant protein. The antibody is not particularly limited as long as it can be used in the method of the present invention, and examples thereof include a polyclonal antibody and a monoclonal antibody. The antibody may be labeled as necessary.

  Antibodies that recognize OCX-32 muteins can be prepared by methods known to those skilled in the art. For example, a polyclonal antibody can be obtained as follows. A small animal such as a rabbit is immunized with a recombinant OCX-32 mutant protein expressed in a microorganism such as Escherichia coli or a partial peptide thereof as a fusion protein with OCX-32 mutant protein or GST, and serum is obtained. This is prepared by, for example, purification by ammonium sulfate precipitation, protein A, protein G column, DEAE ion exchange chromatography, affinity column coupled with OCX-32 mutant protein or synthetic peptide, or the like. In the case of a monoclonal antibody, for example, an OCX-32 mutant protein or a partial peptide thereof is immunized to a small animal such as a mouse, the spleen is removed from the mouse, and this is ground to separate the cells. A myeloma cell is fused with a reagent such as polyethylene glycol, and a clone producing an antibody that binds to the OCX-32 mutant protein is selected from the resulting fused cells (hybridoma). Subsequently, the obtained hybridoma was transplanted into the abdominal cavity of the mouse, and ascites was collected from the mouse, and the obtained monoclonal antibody was obtained by, for example, ammonium sulfate precipitation, protein A, protein G column, DEAE ion exchange chromatography, OCX-32 It can be prepared by purification using an affinity column coupled with a mutant protein or a synthetic peptide.

  The present invention provides a primer for amplifying a region containing the polymorphic site of the present invention, and a probe that hybridizes to a DNA region containing the polymorphic site.

  In the present invention, the primer for amplifying a region containing a polymorphic site also includes a primer that can initiate complementary strand synthesis toward the polymorphic site using DNA containing the polymorphic site as a template. The primer can also be expressed as a primer for providing a replication origin on the 3 ′ side of the polymorphic site in DNA containing the polymorphic site. The interval between the region where the primer hybridizes and the polymorphic site is arbitrary. For the interval between the two, a suitable number of bases can be selected according to the analysis method of the base at the polymorphic site. For example, in the case of a primer for analysis using a DNA chip, the primer can be designed so as to obtain an amplification product having a length of 20 to 500, usually 50 to 200 bases, as a region containing a polymorphic site. A person skilled in the art can design a primer according to the analysis method based on the base sequence information about the surrounding DNA region including the polymorphic site. The base sequence constituting the primer of the present invention can be appropriately modified as well as a base sequence completely complementary to the genomic base sequence.

  In addition to the base sequence complementary to the genomic base sequence, an arbitrary base sequence can be added to the primer of the present invention. For example, in a primer for a polymorphism analysis method using a type IIs restriction enzyme, a primer to which a recognition sequence for a type IIs restriction enzyme is added is used. Such a primer with a modified base sequence is included in the primer of the present invention. Furthermore, the primer of the present invention can be modified. For example, a fluorescent substance or a primer labeled with a binding affinity substance such as biotin or digoxin is used in various genotyping methods. Primers having these modifications are also included in the present invention.

  Specific examples of the primer of the present invention include DNA containing a polymorphic site corresponding to positions 7052, 7056, 7057, 7063, 7068, or 7086 in the nucleotide sequence set forth in SEQ ID NO: 1. Examples include primer oligonucleotides for amplification, but the primer of the present invention is not limited thereto. An example of such a primer is the primer set forth in SEQ ID NO: 4 or 5.

  On the other hand, in the present invention, a probe that hybridizes to a region containing a polymorphic site refers to a probe that can hybridize to a polynucleotide having a base sequence of a region containing a polymorphic site. More specifically, a probe containing a polymorphic site in the base sequence of the probe is preferable as the probe of the present invention. Alternatively, depending on the base analysis method at the polymorphic site, the probe may be designed so that the end of the probe corresponds to a base adjacent to the polymorphic site. Therefore, although the polymorphic site is not included in the base sequence of the probe itself, a probe including a base sequence complementary to the region adjacent to the polymorphic site can also be shown as a desirable probe in the present invention.

  In other words, a probe capable of hybridizing to the polymorphic site of the present invention on genomic DNA or a site adjacent to the polymorphic site is preferred as the probe of the present invention. In the probe of the present invention, modification of the base sequence, addition of the base sequence, or modification is allowed in the same manner as the primer. For example, a probe used for the Invader method is added with a base sequence unrelated to the genome constituting the flap. Such a probe is also included in the probe of the present invention as long as it hybridizes to a region containing a polymorphic site. The base sequence constituting the probe of the present invention can be designed according to the analysis method based on the base sequence of the DNA region surrounding the polymorphic site of the present invention in the genome.

  The primer or probe of the present invention can be synthesized by any method based on the base sequence constituting it. The length of the base sequence complementary to the genomic DNA of the primer or probe of the present invention is usually 15 to 100, generally 15 to 50, preferably 15 to 30. A technique for synthesizing an oligonucleotide having the base sequence based on the given base sequence is known. Furthermore, in the synthesis of the oligonucleotide, any modification can be introduced into the oligonucleotide using a nucleotide derivative modified with a fluorescent dye or biotin. Alternatively, a method of binding a fluorescent dye or the like to a synthesized oligonucleotide is also known.

  Specific examples of the probe of the present invention include polymorphic sites at positions 7052, 7056, 7057, 7063, 7068, and 7086 in the base sequence set forth in SEQ ID NO: 1, as described above. And a probe that hybridizes to a region containing the polymorphic site described in any of the polymorphic sites corresponding to the above, and has a chain length of at least 15 nucleotides.

  The present invention also provides a reagent (test agent) for use in the method for determining whether or not a chicken lays eggs with improved eggshell strength-related traits of the present invention. The reagent of the present invention includes the primer, probe and / or antibody of the present invention. In the determination of eggshell strength-related traits, primers, probes and / or antibodies for amplifying DNA containing the polymorphic site described in any of the polymorphic sites of the present invention are used.

  The reagent of the present invention includes, for example, various enzymes, enzyme substrates, buffers, sterilized water, physiological saline, vegetable oil, in addition to primers, probes and / or antibodies which are active ingredients, depending on the method for determining the base species. , Surfactants, lipids, solubilizers, protein stabilizers (such as BSA and gelatin) and preservatives can be combined. Examples of the enzyme include enzymes necessary for various analysis methods exemplified as the above-described base species determination method, such as DNA polymerase, DNA ligase, or IIs restriction enzyme. As the buffer solution, a buffer solution suitable for maintaining the activity of the enzyme used for these analyzes is appropriately selected. Furthermore, as the enzyme substrate, for example, a substrate for complementary strand synthesis is used.

  Furthermore, another embodiment of the reagent in the present invention is a chicken that lays eggs having improved eggshell strength-related traits, comprising a solid phase to which a nucleotide probe that hybridizes with the DNA containing the polymorphic site of the present invention is immobilized. It is a reagent for judging.

  These are used for examinations using the polymorphic site of the present invention as an index. These preparation methods can be carried out by methods known to those skilled in the art.

  Moreover, the kit for determining whether it is a chicken which lays the egg which contains at least 1 reagent of this invention and the eggshell strength related character is improved is also contained in this invention. In addition to the substances described in any of the above primers, probes, and antibodies, the kit includes, for example, various reagents, restriction enzymes, reaction solutions, control samples, reaction containers, operations for use in the method of the present invention. Instruments and the like can be included.

  It should be noted that all prior art documents cited in the present specification are incorporated herein by reference.

  EXAMPLES Hereinafter, the present invention will be described more specifically with reference to examples, but the present invention is not limited to these examples.

  Genomic DNA prepared from the subject chicken (white leghorn species) was used as a gene sample, and the determination was made by PCR-RFLP method. Since six SNPs (7052, 7056, 7057, 7063, 7068, 7086) of the OCX-32 gene are linked in principle, any restriction enzyme that recognizes a site containing six SNPs may be used. Is used to detect the 7052st base.

The composition of the PCR reaction solution is more than 30 ng of genomic DNA plus KOD plus polymerase 0.125 Unit, 10 × PCR buffer 0.6 μl, 25 mM dNTP mix 0.6 μl, forward primer (200 μM) and reverse primer (200 μM) each 0.0125 μl The volume was made up to 6 μl with pure water.
In this case, the designed forward primer and reverse primer sequences are as follows.
As shown in (a) and (b).
(a) ATGACAGATAAGGAAGGACAAT (SEQ ID NO: 4)
(b) AAGTAACAGAAAGTGAATGACG (SEQ ID NO: 5)

  The primer sequence is designed based on the base sequence of an intron sandwiching the sixth exon. The PCR reaction conditions were as follows: (1) after heat denaturation at 94 ° C for 75 seconds, heat denaturation (94 ° C for 15 seconds), annealing (60 ° C for 30 seconds), and extension reaction (68 ° C for 60 seconds). 10 cycles of the same conditions except that the annealing temperature is 55 ° C, 30 cycles of the same conditions except that the annealing temperature is 50 ° C, and finally an extension reaction of 68 ° C for 9 minutes Went.

  A PCR amplification product of 569 bp was obtained by the PCR method described above. When this PCR product is treated with the restriction enzyme Hinf I, individuals with the wild type gene homozygous produce 278 bp and 297 bp fragments. Individuals with homozygous mutant genes have a new Hinf I recognition site (GANTC) because the 7052th base is substituted from cytosine (C) to guanine (G), and they are 87 bp, 196 bp and 296 bp. Fragments are produced. Therefore, when three fragments are detected, it is judged as a mutant type. Furthermore, when four fragments of 87 bp, 196 bp, 278 bp and 296 bp are detected, it can be determined that the individual has a wild type and a mutant gene heterozygously.

  In any of the PCR-RFLP methods described above, the restriction enzyme reaction was performed by adding 2.0 μl of a buffer solution corresponding to each restriction enzyme and 2 Units of restriction enzyme to 10 μl of the PCR product, and then adding 20 μl of the volume to 20 μl with ultrapure water. The reaction solution was reacted at 37 ° C. for 1 hour. Electrophoresis was carried out using a 2.5% agarose gel at 100 V for 30 minutes.

  FIG. 1 shows the result of electrophoresis. Thus, according to the PCR-RFLP method, the genotype of the OCX-32 gene can be examined easily and accurately.

  The National Institute of Animal Husbandry maintains a strong eggshell line (strong line) and a weak eggshell line (weak line) selected from the common white leghorn line, using non-destructive deformation as a selection trait for 14 generations or more (non-patented) Literature Nirazawa et al., 1998). The parent generation (P) corresponds to the 20th generation from the system creation. F1 was created by crossing 6 strong males, 16 weak females, 5 weak males and 17 strong females. F2 crossed all 17 siblings of F1 and 60 F1 females to obtain 262 hens. F2 females were hatched on the same incubator on the same day, and given and maintained in the same poultry house. In addition to body weight (at 240 days of age), the characteristics of hens are egg weight, eggshell weight, eggshell thickness, breaking strength, minor axis, major axis, etc. Egg traits are born at 237-242 days of age Of the eggs, the average of the first three measurements was used for the analysis. Genomic DNA was extracted from the blood of each individual P-F1-F2 using a DNA extraction kit. Although 1014 chicken microsatellite markers were tested, only 31 markers were available for QTL analysis. As a result, QTLs for body weight, egg weight, minor axis, major axis, eggshell strength, eggshell thickness and eggshell weight were detected (Table 1).

  QTLs related to eggshell strength such as eggshell thickness and eggshell weight were detected in the same region of chromosome 9.

＊：５％、＊＊：１％

*: 5%, **: 1%

  Therefore, 29 microsatellite markers were newly set between chromosome 9 (Chr9: 8556550-24004576, full length 76.37 centmorgan), and detailed QTL analysis was performed again. The results are shown in FIG. In chickens, comparison of the genes present in the detected QTL region, particularly 74-75 centimorgans, with the draft genome sequence resulted in the discovery of only one gene, OCX-32.

＊：５％、＊＊：１％

*: 5%, **: 1%

  FIG. 3 schematically shows the OCX-32 gene based on the summary decoding result (draft sequence) of the chicken genome.

  The OCX-32 gene has six exons. The DNA base sequence of each of the strong and weak eggshell strains (weak strains) of the parent generation for QTL analysis is obtained by PCR direct sequencing, and both the plus strand (sense strand) and the minus strand (antisense strand) are separated. After decoding, the presence of SNP (single nucleotide polymorphism) was confirmed. As a result, SNPs linked to each other with non-synonymous substitutions of amino acid sequences were found in the sixth exon of the OCX-32 gene (FIG. 3). Of the 6 SNPs in the 6th exon, 5 base substitutions result in amino acid substitutions. As a result of detailed investigations and studies by the present inventors, it has been found that the six SNPs are not in an independent relationship with each other and are linked in principle. For example, when the 7052nd base is cytosine (C), the 7056th base is adenine (A), the 7057th base is guanine (G), the 7063rd base is C, and the 7068th base is thymine (T). The 7086th base was T. The amino acid sequence derived from this base sequence is the same as SEQ ID NO: 2, and is hereinafter referred to as “wild type”. Conversely, when the 7052st base is guanine (G), the 7056th base is C, the 7057th base is A, the 7063th base is T, the 7068th base is G, and the 7086th base is C. Met. The amino acid sequence derived from this base sequence is shown in SEQ ID NO: 3 and is hereinafter referred to as “mutant”. For example, when examining whether a chicken is a “wild type” genotype or “mutant type” genotype, one base of any one of 7052, 7056, 7057, 7063, 7068, 7086 is used. It means that it can be determined by examining a polymorphism (SNP).

  In the OCX-32 gene, it is speculated that the wild type produces an OCX-32 protein having an amino acid sequence registered in Entrez. On the other hand, it is speculated that the mutant type produces OCX-32 protein in which five amino acid residues are continuously mutated as shown in FIG.

  When the strong eggshell lines bred in FY18 were examined, the frequency of wild-type and mutant alleles was 25.34% and 74.66%, respectively. The frequencies of wild-type homozygous individuals (W / W), wild-type and mutant heterozygous individuals (W / M), and mutant-type homozygous individuals (M / M) are 6.47%, 37.74%, and 55.80%, respectively. Met.

  When the strong eggshell strain was investigated, the egg of a hen (M / M) having a homozygous “mutant” gene was found to have a higher egg weight than the egg of a hen (W / W) having a homologous “wild-type” gene. The minor axis, major axis, and eggshell weight showed significantly higher values. That is, it was found that eggs of hens (M / M) having homozygous “mutant” genes are significantly larger than eggs of hens (W / W) having homozygous “wild-type” genes. It was found that hens (M / M) having homozygous “mutant” genes lay eggs with strong eggshells without reducing egg volume.

＊：５％、＊＊：１％

*: 5%, **: 1%

  The present invention relates to a method for determining whether or not a chicken to be tested lays eggs with improved eggshell strength, based on the genotype of the OCX-32 gene, and the animal husbandry (breeding / breeding / breeding / improving chickens) Etc.), and can be used in fields such as egg production and processing. The test target is not limited to hens, and even if it is a rooster, it can be determined whether the offspring possesses a genotype that lays eggs with improved eggshell strength. Available.

  In addition, based on the results of this evaluation, for example, when mating, chickens with genotypes with improved eggshell strength that have been classified based on genotypes are mated together and used for breeding chickens and breeding. it can.

  Furthermore, the method of determination of the present invention can be used to select target chickens and sperm even when breeding chickens using genetic recombination methods, or when genetic experiments useful in fields such as livestock are conducted. Can be used. In addition, it is also possible to determine fertilized eggs before hatching, for example, collecting chicken embryo-derived cells from amniotic fluid or chorioallantoic fluid, preparing a genetic sample from the cells, and at the chick stage before hatching, eggshell It can also be determined whether or not the chicken lays eggs with improved strength.

It is a photograph which shows the SNP detection result of the 7052nd OCX-32 gene by PCR-RFLP method. It is a figure which shows the result of the QTL analysis of a 9th chromosome. It is the schematic diagram of OCX-32 gene based on the outline decoding result of a chicken genome. It is a comparison figure of the amino acid sequence of a wild type OCX-32 gene and a variant.

Claims (10)

Determine whether or not to produce eggs with improved eggshell strength-related traits compared to wild-type individuals, characterized by detecting mutations involving non-synonymous substitutions of exon 6 of the ovocalixin 32 gene in test chickens a method, see contains the processes of the following steps (a) from (d),
(A) Step of extracting DNA from chicken to be tested (b) Step of amplifying DNA fragment containing polymorphic site in extracted DNA (c) Analyzing amplified DNA fragment and detecting polymorphism A step of determining whether or not the chicken lays an egg having a strong eggshell strength based on the detected mutation in the steps (d) and (c).
In the polymorphic site, in the base sequence described in SEQ ID NO: 1, G is compared with the case where the base type at position 7052 is C, and C is compared with the case where the base type at position 7056 is A, 7057. When the base type at the position is A, when compared to the case when the base type at the 7063 position is C, or when the base type at the 7068 position is T compared to when the base type is T And determining that the test chicken is a chicken that lays eggs with improved eggshell strength-related traits . Target trait for determining the eggshell strength-related trait, egg weight, egg shell weight A method according to claim 1, characterized in that the eggshell strength.   The method according to claim 1, wherein in step (b), the amplification of the base sequence is performed by a PCR method.   The method according to claim 1, wherein the presence of a single nucleotide polymorphism is detected by detecting a restriction fragment length polymorphism (RFLP) in step (c). The method according to claim 4 , wherein the single nucleotide polymorphism at position 7052 in the nucleotide sequence represented by SEQ ID NO: 1 is detected using a restriction enzyme Hinf I, CviBI, FnuAI, HhaII or TfiI.   The method according to claim 1, wherein in step (c), the single nucleotide polymorphism is detected by determining the base sequence of the amplified DNA fragment. The protein according to any one of the following (a) and (c), which is a variant of ovocalixin 32 protein and has a function of improving eggshell strength-related traits as compared to a wild-type individual.
(A) In the base sequence described in SEQ ID NO: 1, the base type at position 7052 is C to G, the base type at position 7056 is A to C, the base type at position 7057 is G to A, and the base type at position 7063 is A protein encoded by DNA comprising a base sequence in which the base species at position C68 to T and position 7068 is mutated from T to G (c) a protein comprising the amino acid sequence set forth in SEQ ID NO: 3 DNA encoding the protein according to claim 7 . A primer for amplifying a DNA containing a polymorphic site at positions 7052, 7056, 7057, 7063, or 7068 in the base sequence set forth in SEQ ID NO: 1, comprising any one of claims 1 to 3 Said primer for use in the method of claim 1. A kit for determining whether or not a chicken lays eggs having improved eggshell strength-related traits, comprising the primer according to claim 9 .

Images