JP5082125B2 - Novel microorganisms and biodegradable plastic degrading enzymes - Google Patents

Description

  The present invention relates to a novel microorganism having a high biodegradable plastic degrading activity, and a biodegradable plastic degrading enzyme produced by the microorganism.

Plastics are used in large quantities in pipehouse coverings and mulch as an indispensable material at agricultural sites, and the amount of used plastic for agricultural and forestry is currently estimated to be about 150,000 tons. This used plastic not only takes effort to collect, but it also has an adverse effect on the environment such as global warming due to the generation of CO ₂ and dioxins due to combustion. In recent years, biodegradable plastics have been researched and put into practical use from the viewpoint of using resources with low environmental impact.
At present, domestic production of biodegradable plastics, including those produced for purposes other than agricultural materials, is estimated to have exceeded 100,000 tons. In addition, biodegradable plastic-degrading enzymes have been isolated from microorganisms collected from soil, sludge, air, etc. (Patent Documents 1, 2, and 3). However, it is difficult to balance the strength and biodegradability required for agricultural materials, and there is a problem that the biodegradability cannot be sufficiently exhibited if the materials are given strength. Also, depending on the type of biodegradable plastic, it may be difficult to decompose under normal conditions. Therefore, in order to solve this problem, it is required to obtain a microorganism having higher biodegradable plastic degrading activity and an enzyme produced by the microorganism.

JP 2004-261102 A JP 2004-75905 A JP-A-2005-304388

  Accordingly, an object of the present invention is to provide a novel microorganism having a high biodegradable plastic degrading activity, and a biodegradable plastic degrading enzyme produced by the novel microorganism.

In order to achieve the above object, the inventors of the present application have isolated and identified a strain having high biodegradable plastic resolution from various separation sources, and as a result, have high biodegradable plastic degrading activity. The present inventors succeeded in isolating a novel microorganism that does not fall into the conventionally known microorganisms, which produces a degrading enzyme with high efficiency in the culture solution, and reached the present invention.
That is, the present invention relates to a filamentous fungus belonging to the incomplete fungus Agonomycetales, 4 cm ^{2 made} of PBS having a molecular weight of 140 to 150,000 placed on a solid medium inoculated with the filamentous fungus. Provided is a filamentous fungus that, when a 2 μm thick film is allowed to stand for 10 days under a temperature condition of 25 ° C., the film is decomposed by 90% or more in terms of area.
Furthermore, the present invention provides a biodegradable plastic degrading enzyme produced by the filamentous fungus.
Further, the present invention includes (a) a step of culturing the filamentous fungus in a medium containing a biodegradable plastic to secrete the biodegradable plastic degrading enzyme into the culture solution, and (b) a biodegradable plastic degrading enzyme from the culture solution. A method for producing a biodegradable plastic degrading enzyme, comprising:
Furthermore, the present invention provides a biodegradable plastic degrading enzyme having a molecular weight of about 18-22 kDa obtained by the above-mentioned method by SDS electrophoresis.
Furthermore, the present invention provides a protein comprising an amino acid sequence shown in SEQ ID NOs: 4 to 8 described later, having a molecular weight of about 18 to 22 kDa by SDS electrophoresis, and having a degrading activity of PBS and PBSA.
Furthermore, the present invention provides a method for degrading a biodegradable plastic, comprising contacting the biodegradable plastic degrading enzyme or protein with a biodegradable plastic.
Furthermore, the present invention provides a biodegradable plastic degrading preparation comprising the filamentous fungus and / or the biodegradable plastic degrading enzyme or protein.

Furthermore, the present invention provides a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 20, a vector comprising the nucleic acid, and a protein encoded by the nucleic acid.
Furthermore, the present invention includes a protein comprising the sequence of SEQ ID NO: 21, and an amino acid sequence in which one or several amino acids of the sequence of SEQ ID NO: 21 have been deleted, substituted or added, and degradation of PBS and PBSA Proteins having activity are provided.
Furthermore, the present invention provides a method for degrading a biodegradable plastic, comprising contacting the protein with the biodegradable plastic.
Furthermore, the present invention provides a biodegradable plastic degrading preparation comprising the protein.
Furthermore, the present invention provides a method for producing the biodegradable plastic degrading enzyme, wherein the biodegradable plastic contained in the medium is a PBSA pellet.
Further, the present invention includes (c) a step of adding the filamentous fungus to a medium containing biodegradable plastic, (d) a step of culturing the filamentous fungus and secreting a biodegradable plastic degrading enzyme into a culture solution, (e ) A step of recovering the culture solution in step (d), (f) a step of adding a new medium to the filamentous fungi remaining in the culture vessel after the culture solution is recovered, and (g) steps (d) to (f). A method for producing a biodegradable plastic degrading enzyme comprising the step of repeating.
Further, the present invention provides (h) a step of culturing the filamentous fungus in a medium containing biodegradable plastic to secrete the biodegradable plastic degrading enzyme into the culture solution, (i) lyophilizing the supernatant of the culture solution A process for producing a biodegradable plastic-degrading enzyme powder.
Furthermore, this invention provides the biodegradable plastic degrading enzyme powder manufactured by the said method.

  The filamentous fungus of the present invention has a high biodegradable plastic resolution, and a highly pure enzyme solution can be easily obtained from the filamentous fungus. By using the filamentous fungus of the present invention or the enzyme produced by it, the component is polybutylene succinate (PBS), which has high material strength but has been difficult to put into practical use in the agricultural field due to low biodegradability. The biodegradable plastic multi-film of agricultural materials can also be efficiently decomposed.

The flora of the filamentous fungus of the present invention (47-9 strain) on oatmeal medium is shown. The degradation of the PBSA membrane by the filamentous fungus of the present invention is shown. (Left 47-9 ₁ : PBSA film, 47-9 ₂ : PBS film; right No treatment) Figure 2 shows the degradation of PBSA emulsion by the filamentous fungus of the present invention. (Left: first day of culture, right: 7 days after culture) The photograph of the tricine / SDS-PAGE (silver stain) of the enzyme which the filamentous fungus of this invention produces is shown. (M: Marker, 1: Enzyme filtrate, 2: Purified product using affinity) The chromatogram when the biodegradable plastic-degrading enzyme of the present invention is decomposed with trypsin and separated by HPLC is shown. The degradation of PBS, PBSA and PBS / PBSA mixed film by the filamentous fungus enzyme solution of the present invention is shown. (Upper: After 6 days of culture, Lower: after weighing) The production of biodegradable plastic degrading enzyme using a medium containing pelleted PBSA is shown. The change of the enzyme activity of the primary culture by a jar fermenter is shown. The enzyme activity of the culture solution which subcultured using the jar fermenter and was collect | recovered for every passage number is shown. The enzyme activity of the supernatant of the culture broth left for 98 days at 4 ° C. and 28 ° C. is shown. The enzyme activity of the culture supernatant which was allowed to stand for 115 days at -20 ° C is shown. The enzyme activity of the enzyme which freeze-dried the culture supernatant was shown. The enzyme activity is shown after leaving the culture supernatant in a vacuum freeze-dried state for 50 days at 4 ° C.

The filamentous fungus of the present invention is obtained by isolating and identifying filamentous fungi (47-9 inoculum of Aspergillus oryzae incomplete fungi) that produce high-purity biodegradable plastic-degrading enzyme in the culture solution. It is obtained. As for the biodegradable plastic degradation by filamentous fungi, one example of research on multi-film degradation that is practically used in the agricultural field is known in Aspergillus oryzae , but Aspergillus spp. Are black on malt extract agar and zapek agar. It is characterized by forming colonies having colors such as green and orange, producing a large number of conidia on the surface of the medium, and producing a large amount of conidia from the phialide. The filamentous fungus of the present invention is another species that is morphologically different from the genus Aspergillus in that it forms only dark olive mycelium on malt extract agar medium and Czapek-Dox agar medium. In addition, since the filamentous fungus of the present invention does not show the formation of spores as shown in the scientific properties described later, it belongs to the order of the incomplete fungi of incomplete fungi. In addition, filamentous fungi can be classified by comparing the form of spores of sexual generation, but sexual generation is not confirmed, it is known that there are many bacteria that only repeat asexual reproduction, These bacteria are classified in the form of asexual reproduction until the sexual generation is confirmed. Fungi whose sexual generation is unknown or absent are generally classified as incomplete fungi.

The filamentous fungus of the present invention is a 4 cm ² , 2 μm thick film of polybutylene succinate (PBS) having a molecular weight of 150,000 to 150,000 placed on a solid medium inoculated with the filamentous fungus under a temperature condition of 25 ° C. When left standing for 10 days, the film is decomposed by 90% or more in terms of area. Preferably, the filamentous fungus of the present invention further degrades 90% or more of the film made of polybutylene succinate adipate (PBSA) under the same conditions as described above.
The above-described decomposition test methods are known to those skilled in the art, and can be performed, for example, by the methods described in the examples described later. In addition, many biodegradable plastics such as PBS and PBSA are commercially available, and those skilled in the art can easily prepare or prepare a film suitable for use in the above-described degradability test. Further, the solid medium inoculated with the filamentous fungus can be prepared so that the filamentous fungus effectively exhibits its biodegradable plastic degrading activity. Specifically, for example, as shown in the examples described later. It can be used by inoculating 5 mm square cells at the center of the film. A person skilled in the art can select any medium composition. Moreover, the analysis of the decomposition rate in terms of area can be examined by measuring the luminance of the film, for example, by image analysis shown in Examples described later.

  In the present invention, the term “biodegradable plastic” means “when used it has a function similar to that of a conventional petroleum-derived plastic. It has the meaning commonly understood in the art of “plastic that is decomposed into carbon dioxide”. Specific examples include polyhydroxybutyric acid, polycaprolactone, and polyesters such as polybutylene succinate and polylactic acid. ] Is preferable.

The filamentous fungus of the present invention further has the following scientific properties.
(Culture conditions)
Medium name: Potato dextrose agar medium Composition:
Potato 200g
Glucose 20g
Agar 20g
1L of distilled water
Medium pH (before sterilization): 5.6
Sterilization temperature and time: 121 ° C 15 minutes Culture temperature: 25 ° C
Culture period: 7 days Oxygen requirement: Aerobic ・ Colony growth is observed after 2 days of culture on the potato glucose agar medium.
-The colony has a grayish white surface and dark olive flora on the back.
-In addition to the potato glucose agar medium, the same growth is exhibited on corn meal agar medium and oatmeal agar medium.
-Optimal growth conditions: 25 ° C, pH 5-9
・ Growth range: 5 ℃ ～ 35 ℃, pH3 ～ 10
・ The characteristic forms are as follows.
-Vegetative hyphae is colored dark brown and is formed on or in the agar surface, with formation of septal hyphae.
-The mycelium width is almost constant, and the surface of the mycelium is smooth. The formation of a clamp connection cannot be confirmed.
-Conidium, chlamydospore and telemorph are not formed even after long-term culture.

As a result of homology analysis of the base sequence of ITS1-5.8S rDNA-ITS2 (SEQ ID NO: 1) with respect to the isolated strain of the filamentous fungus, the base of ITS1-5.8S rDNA-ITS2 of Neopolonema gloeosporioides of Ascomycota The sequence (DNA Data Bank of Japan database accession number AJ534443) showed a high homology of 97%, indicating that this bacterium is an incomplete fungus of the Aspergillus oryzae closely related to the Neoplaconema genus. Therefore, the filamentous fungus of the present invention preferably has an ITS1-5.8S rDNA-ITS2 region containing a base sequence having a homology of 97% or more with the base sequence of ITS1-5.8S rDNA-ITS2 of Neoploconema gloeosporioides . Preferably, it has an ITS1-5.8S rDNA-ITS2 region containing a base sequence having a homology of 99% or more with the base sequence shown in SEQ ID NO: 1, and more preferably an ITS1 containing the base sequence shown in SEQ ID NO: 1. -5.8 It has SrDNA-ITS2 region.

  The isolated strain of the filamentous fungus was deposited as an accession number NITE P-573 with the Patent Microorganism Deposit Center of Product Evaluation Technology Platform, an independent administrative agency. Therefore, the filamentous fungus of the present invention is preferably a filamentous fungus whose accession number is NITE P-573. Moreover, as long as it has the biodegradable plastic degradation activity similar to this strain, the above-mentioned mutant strains of filamentous fungi are also included in the present invention. This may be due to spontaneous mutation, or artificially induced addition, deletion, substitution, etc. of bases by applying physical or chemical treatments such as UV irradiation or chemical mutagen treatment. It may be a thing.

The present invention further includes a biodegradable plastic degrading enzyme produced by the above filamentous fungus. The biodegradable plastic degrading enzyme can be isolated by any method known to those skilled in the art. In the present invention, for example, a method for producing a biodegradable plastic degrading enzyme comprising the following steps is used. Can be used:
(a) a step of culturing the filamentous fungus of the present invention in a medium containing a biodegradable plastic to secrete the biodegradable plastic degrading enzyme into the culture solution;
(b) A step of purifying the biodegradable plastic degrading enzyme from the culture solution.

In step (a) of the method, the enzyme is secreted into an extracellular medium by culturing the filamentous fungus of the present invention under conditions for producing a biodegradable plastic degradation active enzyme. The culture conditions can be arbitrarily set by those skilled in the art. For example, a liquid medium of FMZ medium supplemented with 1% PBSA emulsion, which will be described later in the Examples section, is prepared, inoculated, and cultured by shaking. And the biodegradable plastic-degrading enzyme can be secreted into the medium. For example, Kamini NR et al. Production, purification and characterization of an extracellular lipase from the yeast, Cryptococcus sp.S-2.Process Biochemistry 36 p. 317-324 (2000) and Kolattukudy PE et al. Cutinases from fungi and pollen. Methods in Enzymology 71 p. 652-664 (1981) or modified methods thereof can be used. Moreover, the method of extracting from the solid culture using the plant body as a support | carrier generally used for the enzyme production by a filamentous fungus, or foaming support | carriers, such as a urethane foam, can also be used.

  In the above step (a), it is also possible to use PBSA pellets instead of PBSA emulsion as a biodegradable plastic to be added to the medium. The shape of the pellet is not particularly limited, and specifically, for example, Bionore pellet standard # 3020 manufactured by Showa Polymer Co., Ltd. can be used.

  In addition, non-sugar substances such as natural fats and oils (for example, soybean oil) and glycerol can be used as the carbon source. By using these carbon sources, biodegradable plastic degrading enzymes can be efficiently induced. In particular, when glycerol is used, there is an advantage that the enzyme is hardly inactivated through the subsequent purification step, and the enzyme activity can be kept high.

In the step (b), the biodegradable plastic degrading enzyme is purified from the culture solution. The enzyme can be purified by any method known in the art, and the literature cited in step (a) can also be referred to. For example, ammonium sulfate may be added to the supernatant of the culture solution to obtain a precipitate, or the culture solution may be concentrated using a ultrafiltration method using Asahi Kasei Microza or the like. Further, the precipitate may be dissolved in 20 mM Tris-HCl buffer and then dialyzed against 20 mM Tris-HCl buffer using a dialysis tube such as spectrapor MWCO 12000-14000, and then passed through a DEAE sepharose column. The existing protein may be removed, and the enzyme may be further purified through an SP sepharose column if necessary. Moreover, you may combine said operation suitably.
In another example, it is possible to easily purify by utilizing the affinity between the enzyme of the present invention and the substrate (PBSA) and the fact that PBSA is insoluble in an aqueous solvent. For example, a PBSA emulsion is added to a culture solution that has been concentrated and buffered (10 mM PIPES, pH 6.8) exchanged by ultrafiltration, and then the enzyme-PBSA complex is precipitated by centrifugation, and contains impurities such as other proteins. The supernatant is removed, the enzyme-PBSA complex is resuspended with 10 mM Tris-HCl (pH 8.0) containing 5 mM CaCl ₂ to completely decompose PBSA at 30 ° C, and finally PBSA is obtained by dialysis or ultrafiltration. A pure enzyme solution can be obtained by removing the degradation product.

When the molecular weight of the biodegradable plastic degrading enzyme produced by the method of the present invention is measured by SDS electrophoresis, it shows a molecular weight of about 18-22 kDa, more specifically about 19-21 kDa, and more specifically about 20 kDa.
The enzyme produced by the method of the present invention has PBSA and PBS degrading activity. The activity of the purified biodegradable plastic degrading enzyme can be determined by, for example, suspending PBSA emulsion in 20 mM Tris-HCl (pH 6.8) and adding 1.8 ml of an aqueous solution having an absorbance (OD ₆₆₀ ) of about 0.5 to a test tube with a 13 mm diameter. In addition, 200 μl of the crude enzyme solution or the microorganism culture supernatant is added, and the transmittance can be determined by measuring the transmittance using a device such as Spectronic20A (Shimadzu).

Furthermore, the biodegradable plastic degrading enzyme of the present invention can use a method for producing a biodegradable plastic degrading enzyme including the following steps:
(c) adding the filamentous fungus to a medium containing a biodegradable plastic;
(d) culturing the filamentous fungus and secreting the biodegradable plastic degrading enzyme into the culture solution;
(e) recovering the culture medium of step (d),
(f) adding a new medium to the filamentous fungi remaining in the culture vessel after collecting the culture solution;
(g) A step of repeating steps (d) to (f).

  Here, as the culture vessel in the above step (f), it is preferable to use a culture vessel that can be aseptically operated. For example, a jar fermenter (Sakura Seiki Co., Ltd. Bioreactor TBR-2-1) is used. be able to. Further, the number of times of repeating steps (d) to (f) is not particularly limited as long as the biodegradable plastic-degrading bacterium can produce biodegradable plastic-degrading enzyme, but for example 2 to 10 times, for example, 5 times or more , 6 times or more. The biodegradable plastic degrading enzyme contained in the culture solution collected by the above method can be purified by the above-described purification method as necessary.

  In addition, the present inventors purified the above-described purified biodegradable plastic degrading enzyme of the present invention and determined the partial amino acid sequence thereof. The enzyme of the present invention comprises the amino acid sequences shown in SEQ ID NOs: 4-8. As long as the protein has biodegradable plastic degradation activity, one or several amino acids may be deleted, substituted or added.

  Furthermore, the present inventors further determined the nucleotide sequence (SEQ ID NO: 20) encoding the above-described biodegradable plastic degrading enzyme and the full-length amino acid sequence (SEQ ID NO: 21) of the enzyme. In the present invention, one or several amino acids may be deleted, substituted or added as long as the protein has biodegradable plastic degradation activity.

  In addition, a biodegradable plastic degradation preparation containing the filamentous fungus of the present invention and / or a biodegradable plastic degradation enzyme or protein can be produced. Those skilled in the art can prepare the above-described biodegradable plastic degradation preparation by a well-known method. The filamentous fungus or the like may be used alone, or may be mixed with a well-known solvent, additive and the like.

  The biodegradable plastic-degrading enzyme of the present invention has excellent storage stability, and in the state of the supernatant after removing the cells from the bacterial culture of the present invention, temperature conditions in the range of 28 ° C to -20 ° C, For example, it can be stably stored at 28 ° C. (room temperature), 4 ° C., −20 ° C., etc. for 90 days or longer, for example, 100 days or longer, or even 110 days or longer. Furthermore, the biodegradable plastic-degrading enzyme of the present invention can maintain its activity even when freeze-dried by a conventional method, and can be stably stored, for example, at 4 ° C. for 50 days or more.

Hereinafter, the present invention will be described in more detail with reference to examples, but the present invention is not limited thereto.
1. Isolation of biodegradable plastic-degrading microorganisms Many of the multi-films are made from succinic polyesters (polybutylene succinate (PBS) and adipic acid ester mixture (PBSA)). Microorganisms capable of degrading were searched from the natural world and conserved strains.
As a separation method, first, a PBSA emulsion (molecular weight of about 10,000, 1%) degrading bacteria was selected on an agar plate medium, and then a PBSA and PBS multi-film (molecular weight of about 140 to 150,000) was selected from these bacteria. The selection method was a two-step selection method for selecting bacteria that decompose 2 μm thick).

In addition, the following culture media were used for selection of the filamentous fungus which decomposes | disassembles a biodegradable plastic.
Inducible enzyme producing strain selection medium for filamentous fungi (FMZ: Czapek-Dox Minimum Medium)
Underlayer

Upper layer B
About 15 ml of the lower layer plate medium was prepared in a 9 cm petri dish, and after setting, it was stored in a 45 ° C. incubator. Meanwhile, about 5 ml of the upper layer B dissolved and sterilized in an Erlenmeyer flask containing a stirrer was overlaid. At this time, the upper layer B was stirred with a stirrer so that the oil was uniformly mixed. Chloramphenicol was added as an antibiotic at a final concentration of 40 ppm.

The inventors have already separated and identified from rice and wheat leaves, and used to determine whether the preserved filamentous fungi dissolve the PBSA emulsion, using a medium in which the PBSA emulsion is overlaid as the sole carbon source in the FMZ medium. This was examined by confirming that the emulsion contained in the upper layer of the medium was decomposed to form a clear zone around the bacteria. As a result, 70 fungi capable of degrading emulsion were isolated from 1227 strains. Among them, we found that in May 2006, the incomplete fungal 47-9 strain (Fig. 1) isolated from barley in Tsukuba City, Ibaraki Prefecture has a particularly high raw plastic resolution. This strain decomposed 93% and 91% of 4cm ² PBSA and PBS multifilms in terms of area in 10 days, respectively (Figure 2). As for strains other than this strain, filamentous fungi such as 41-12 strains (88.1% and 46.5%) and 40-6 strains (83.6% and 39.4%) had a degrading activity, but PBS degradability was 47- Nine strains were particularly superior.

Here, the above values are obtained by making a medium only for the lower layer of FMZ medium in a 9 cm Petri dish, and in the center, four square 4 cm ² PBSA and four PBS multi-films with a 5 mm gap between each other. It is a value measured by the following measurement method, in which 5 mm square bacteria cultured on a potato dextrose agar medium were transplanted at the center of the gap and cultured at 25 ° C. for 10 days.
“Transparent original positive film mode scans the film at 300 dpi. Use Aquacosmos ver2.0 for analysis and save the image as a TIFF file (grayscale). Open the file on Aquacosmos and select the toolbar in the measurement window. , Drag to enclose a picture of plastic film Select “Create same measurement window as last time” and select all the films on the captured image as independent measurement windows of the same size. (At this time, the unprocessed film and the white spot without film are also enclosed in the same way as a control.) The luminance of each area is calculated from “Area Analysis” in the analysis menu. Based on the control, calculate the amount of membrane degradation. "
(Measured film brightness-brightness of undegraded film) / (white screen brightness-brightness of undegraded film) X100 = decomposition (%)

When the culture conditions of this bacterium are examined in detail, the degradation activity is most enhanced when it is shaken and cultured for 7 days at 28 ° C and 90 rpm / min in a medium containing 1% PBSA emulsion in FMZ liquid medium. (FIG. 3). In addition, by utilizing the affinity for PBSA, it is possible to purify degrading enzyme from the medium, and about 100 μg is produced per liter of medium by comparing the intensity of the band of the enzyme with a marker by electrophoresis. (Fig. 4). Furthermore, by removing the degradation product of PBSA by ultrafiltration of the supernatant, it was possible to purify the pure enzyme, and the production amount was approximately 100 μg per liter of the medium.
In addition, the bacterium showed almost no contaminating protein even in the unpurified culture filtrate, and showed the ability to secrete only highly pure degrading enzyme (FIG. 4, M: marker, 1: enzyme filtrate, 2: affinity). Purified product). Therefore, it is possible to produce a highly pure heterologous protein by using the filamentous fungus of the present invention as a host. The production of the heterologous protein can be performed by a conventional method. For example, the biodegradable plastic degrading enzyme of the present invention can be obtained by exchanging the biodegradable plastic degrading enzyme gene of the filamentous fungus with the gene of the heterologous organism by genetic recombination technology By fusing a part of the gene with a heterologous organism gene and connecting the heterologous organism gene immediately downstream of the secretion signal of the biodegradable plastic degradation gene, production of the protein derived from the heterologous gene can be induced.
Moreover, this bacterium also had a resolution of polycaprolactone (PCL), which is a biodegradable plastic other than PBSA and PBS. Dissolve 0.25 g of PCL with a molecular weight of 40,000 in 5 ml of dichloromethane, then spread the solution thinly in a petri dish with a diameter of 9 cm in a fume hood, volatilize dichloromethane to create a PCL film, and the rate of membrane decomposition is similar to PBSA. As a result, it was decomposed by 53.0% in 10 days after the treatment.

2. Genetic analysis The bacterium is potato glucose agar, elementary agar, potato carrot agar, cornmeal agar, oatmeal agar, V-8 agar, Sabouraud glucose agar, Czapek-Dox agar, Foust agar. Although culture was carried out with various types of culture media, near-ultraviolet irradiation, and wounding, no spore formation was observed. Therefore, after culturing in a potato sucrose liquid medium for 3 days, the cells were ground with liquid nitrogen, and DNA was extracted with QIAquick PCR Purification Kit (manufactured by Qiagen) for gene analysis. Based on the method of White et al. (1990), a reaction mixture containing two PCR primers of ITS1 and ITS4 is added to the DNA extract, and denaturation (95 ° C for 30 seconds), annealing (55 ° C for 30 seconds), DNA was amplified by repeating 35 cycles under the PCR conditions of extension (72 ° C. for 2 minutes). The ITS1-5.8S rDNA-ITS2 region of the amplified rDNA was directly sequenced by the Dye Terminator method to determine the base sequence, and the DNA DNA Bank (DDBJ http://www.ddbj.nig.ac.jp/Welcome-j BLAST search was performed on .html). As a result, 97% high homology with the base sequence of ITS1-5.8S rDNA-ITS2 of Neopolaconema gloeosporioides , the Ascomycota fungus, is shown, and this fungus is an incomplete fungus of the Ascomycota family closely related to Neoplaconema. It was shown that there is.
The details of the analysis were performed in accordance with the descriptions in the following documents.
White TJ, Bruns TD, Lee SB, Taylor, JW (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics.
In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds) PCR Protocols, a guide to methods and applications.Academic, San Diego, CA, pp 315-322.
The primer sequences used are as follows.
ITS1: TCCGTAGGTGAACCTGCG (SEQ ID NO: 2)
ITS4: TCCTCCGCTTATTGATATGC (SEQ ID NO: 3)

3. Purification of biodegradable plastic-degrading enzyme 100 ml of the inducible enzyme production medium (FMZ: Fungal Minimum Medium Czapek-Dox Base) from the slant medium (potato dextrose agar medium) of unidentified strain 47-9 ). Medium composition is NaNO ₃ 0.2%, KCl 0.05%, K ₂ HPO ₄ 0.1%, MgSO ₄ · 7H ₂ O 0.05%, FeSO ₄ · 7H ₂ O 0.001% (added after sterilization after autoclaving), PBSA The emulsion was 1.0% (Bionole Emulsion EM-301, Showa Polymer Co., Ltd.). The culture was carried out in a 300 ml Erlenmeyer flask at 90 rpm / min for 7 days at 28 ° C., and the enzyme was purified from the supernatant obtained by filtering this culture solution.

After adding PBSA emulsion to the culture solution concentrated and buffer exchanged (10 mM PIPES, pH 6.8) by ultrafiltration, the enzyme-PBSA complex is precipitated by centrifugation, and the supernatant contains impurities such as other proteins. The enzyme-PBSA complex is resuspended in 10 mM Tris-HCl (pH 8.0) containing 5 mM CaCl ₂ to completely decompose PBSA at 30 ° C, and finally PBSA is decomposed by dialysis or ultrafiltration. A pure enzyme solution was obtained by removing the product. When the molecular weight of the biodegradable plastic degrading enzyme produced by the above method was measured by SDS electrophoresis, it was about 20 kD.

4). Identification of internal amino acid sequence of biodegradable plastic degrading enzyme The internal amino acid sequence of the biodegradable plastic degrading enzyme purified from the culture supernatant of the 47-9 strain was determined.
Among the enzymes decomposed with trypsin and separated on an HPLC column under the following conditions, the peak N-terminal sequences of No. 1, No. 2, No. 3, No. 4, and No. 5 were identified (see FIG. 5).
HPLC condition column Reversed phase C18
Size 2mmID × 150mm
Solvent A = 0.1% TFA B = 0.075TFA / MeCN
Flow rate 0.2ml / min detection 216nm
Fraction 0.1 ml / fraction Start: 20 minutes, End: 70 minutes No. 1: GGIPGYPQDR (SEQ ID NO: 4)
No. 2: NEAPAFLISK (SEQ ID NO: 5)
No. 3: GSTETGNLGTLGAPLGDALE (SEQ ID NO: 6)
No. 4: YGASNVWVQGVGGPYDAALGDNALP (SEQ ID NO: 7)
No. 5: VVAGGYSQGAALAAAAISDAST (SEQ ID NO: 8)

5. Degradation of biodegradable plastic multi-film with enzyme solution Eiken No. 2 square petri dish (length 10 cm, width 14 cm, height 1.5 cm: made by Eiken Chemical Co., Ltd.) Horticultural soil (Kumiai Horticultural nursery soil: Kureha Chemical Co., Ltd.) 70 g spread, and a PBS, PBSA, and PBS / PBSA mixed film (Biomulti: manufactured by Takii Tanae Co., Ltd.) (thickness 20 μm) cut into a petri dish (10 cm long and 14 cm wide) was placed thereon. 70 ml of enzyme solution filtered with gauze was poured from above, and left in a 30 ° C. incubator. The enzyme solution was 20 platinum loops from 47-9 strain slant medium (potato dextrose agar medium) in 1 L filamentous fungus-derived inducible enzyme production medium in a 2 L Erlenmeyer flask at 90 rpm / min. Cultured at 14 ° C. for 14 days, a supernatant obtained by filtering this culture solution with gauze was used.
After 6 days of culture, the bacteria grew on each film, and decomposition was observed (FIG. 6). Each film was peeled off, washed with distilled water, dried thoroughly and weighed to obtain a ratio with the control (3 replicates).
As a result, the PBSA film was most decomposed, the entire surface of the multi-film was collapsed and could not be peeled, and 91.2% of the film was decomposed compared to the control. PBS and PBS / PBSA mixed film degraded by 23.7% and 14.6%, respectively. Decomposition was highly effective when in contact with air. When various films were laid on the bottom of Eiken No. 2 square petri dish and soil was put in, almost no film was decomposed.

6). Identification of gene sequence and full-length amino acid sequence of biodegradable plastic degrading enzyme The sequences of “NVWVQG” and “PGYPQD” included in the internal amino acid sequences of SEQ ID NOs: 7 and 4 of the biodegradable plastic degrading enzyme identified in 4 above Based on the above, primers F6 (5′-aaygtytgggtccaggg-3 ′) (SEQ ID NO: 9) and R10 (5′-tcctgrgggtanccgg-3 ′) (SEQ ID NO: 10) were designed and synthesized. On the other hand, 47-9 strains of genomic DNA were extracted using Wizard Genomic DNA Purification Kit (Promega).
As a result of PCR using the extracted genomic DNA as a template and the designed primers, about 350 bp (F6-R10 amplified fragment) was obtained. The base sequence of the F6-R10 amplified fragment was decoded, and based on the results, primers TSP1-1 (5'-aagggcgttgtcaccaagag-3 ') (SEQ ID NO: 11), TSP1-2 (5'-ttgtcaccaagagctgcgtcgta-3') (SEQ ID NO: 12), TSP1-3 (5'-acgccctggacccaaacatt-3 ') (SEQ ID NO: 13), TSP2-1 (5'-acaccaagaaccagcaaaac-3') (SEQ ID NO: 14), TSP2-2 (5'-agaaccagcaaaaccgtggcgg -3 ′) (SEQ ID NO: 15) and TSP2-3 (5′-agcaaaaccgtggcggcatc-3 ′) (SEQ ID NO: 16) were designed.
Next, using the genomic DNA of 47-9 strain as a template, using primers TSP1-1, TSP1-2, TSP1-3 and DNA walking SpeedUPTM Premix Kit (Seegene), upstream of F6-R10 amplified fragment by PCR. The gene was amplified to obtain an amplified fragment (TSP1 amplified fragment) of about 700 bp. Similarly, the downstream gene of the F6-R10 amplified fragment was amplified using TSP2-1, TSP2-2, and TSP2-3 to obtain an amplified fragment of about 650 bp. Further, in order to obtain a gene fragment upstream of the TSP1 amplified fragment, the base sequence of the TSP1 amplified fragment was decoded, and based on the result, primers TSP3-1 (5'-ggtgaatgaaggaccactcc-3 ') (SEQ ID NO: 17), TSP3- 2 (5′-ctccgctgcaccaagtaaagatg-3 ′) (SEQ ID NO: 18) and TSP3-3 (5′-taaagatggaaccgtgtggt-3 ′) (SEQ ID NO: 19) were designed. Similarly, an amplified fragment of about 850 bp upstream of the TSP1 amplified fragment was obtained using TSP3-1, TSP3-2, and TSP3-3 using the genomic DNA of 47-9 strain as a template.
TSP3 amplified fragment, TSP1 amplified fragment, F6-R10 amplified fragment and TSP2 amplified fragment TSP3 amplified fragment were combined and replaced with amino acid sequence, then the amino acid of the enzyme secreted with ORF based on the amino acid sequence result at N-terminal The sequence was determined. The obtained nucleotide sequence and the full-length amino acid sequence of the enzyme are shown in SEQ ID NOs: 20 and 21, respectively.

Based on these results, primers ProbeF2 (5'-atgaagtacttcaccat-3 ') (SEQ ID NO: 22) and ProbeR2 (5'- gttgccgatcttgctgat-3') (SEQ ID NO: 23) were synthesized, and the ProbeF2-ProbeR2 amplified fragment Was used as a probe to perform genomic Southern hybridization of 47-9 strain. As a result, one band hybridized to the chromosomal DNA digested with the restriction enzyme EcoRI was detected, and it was inferred that there was one corresponding gene in the chromosome.
Furthermore, registered sequences that are highly homologous to the DNA and amino acid sequences of the biodegradable plastic degrading enzymes obtained from the 47-9 strain described above were subjected to the BLAST search method at the National Institute of Genetics DNA data bank of Japan (DDBJ). Searched using. The search conditions were the top 10 search conditions Expected value 10 Gap 1 Filter 1 Comparison by three methods: "DNA-DNA comparison", "DNA sequence → amino acid sequence translated DNA sequence-amino acid sequence comparison", "DNA sequence → amino acid sequence translated DNA sequence-amino acid translated DNA sequence comparison" did. As a result, the one with the highest homology in each of the searches was M16876 | M16876. Soybean lipoxygenase-1 mRNA, 3 'end, clone pLX-65 score: 56 E-Value: 3e-04, "DNA sequence → amino acid sequence translated DNA sequence-amino acid sequence comparison", tr | QOTWK1 | QOTWK1_PHANO SubName: Full = Putative uncharacterized protein score: 249 E-Value: 2e-64, "DNA sequence → amino acid sequence" In the translated DNA sequence-amino acid translated DNA sequence, it was CU633899 | CU633899. 1 Podospora anserine genomic DNA chromosome 1, supercontig 4 score: 127 E-Value: 7e-63. From the above, it was speculated that the DNA sequence and amino acid sequence specified this time are novel sequences different from known gene sequences and amino acid sequences.

7). Production of biodegradable plastic-degrading enzyme using a medium containing pelleted PBSA In item 3 above, 47-9 strains of filamentous fungi are cultured using a medium containing PBSA emulsion to produce biodegradable plastic-degrading enzyme. Although it was produced, it was confirmed that a similar biodegradable plastic degrading enzyme could be produced using a medium containing PBSA pellets instead of this PBSA emulsion.
The composition of the medium used is as follows.

When 1 l of a medium was placed in a 3 l flask and cultured at a rotation speed of 90 rpm / min with a shaker, the activity was obtained after 7 days and the highest activity was obtained after 28 days of culture (FIG. 7). The activity was measured according to the method described in JP-A-2008-237212. In the activity measurement results shown in FIG. 7 and subsequent figures, permeability (% T) is used as an activity index. This value is logarithmic in the formula of “absorbance (ABS) = − Log (measurement value of permeability / 100)”. Can be converted into absorbance (ABS) described in JP-A-2008-237212. That is, the higher the permeability, the higher the activity.
From the results of FIG. 7, the biodegradable plastic-degrading bacteria of the present application proliferate even when cultured using not only a medium containing PBSA emulsion but also a medium containing PBSA pellets. It was found that can be produced.

8). Continuous production of biodegradable plastic enzyme by subculture of biodegradable plastic degrading bacteria It was confirmed whether biodegradable plastic degrading enzymes could be produced continuously by subculturing the biodegradable plastic degrading bacteria of the present application.
Using a 2 liter jar fermenter (Sakura Seiki Co., Ltd. Bioreactor TBR-2-1), the biodegradable plastic-degrading bacteria of the present application under the conditions of 800 ml of culture solution, 28 ° C, 100 rpm / min, and aeration of 0.6 l / min Was cultured. The culture solution was collected every day, and a new medium was added to the jar fermenter after the culture solution was collected and cultured again. The activity was measured for each collected medium. The culture medium composition and activity measurement method followed those described in JP 2008-237212 A.
FIG. 8 shows changes in enzyme activity in primary culture. Moreover, FIG. 9 shows the enzyme activity of the culture solution which subcultured and collect | recovered for every subculture number. From these results, it was found that the biodegradable plastic-degrading bacterium of the present invention can repeatedly produce a biodegradable plastic-degrading enzyme by subculture. In this experiment, it was confirmed that the enzyme could be regenerated in one day after the liquid exchange by repeating 6 times.

9. Storage stability of biodegradable plastic-degrading enzyme The supernatant obtained by removing the cells from the culture solution of the biodegradable plastic-degrading bacterium of the present invention is left under various temperature conditions, and then the enzyme activity is measured. The storage stability of the biodegradable plastic degrading enzyme of the invention was confirmed.
First, the supernatant which was allowed to stand for 98 days under the temperature conditions of 4 ° C. and 28 ° C. was reacted with PBSA for 30 minutes according to the method described in JP-A-2008-237212, and then the enzyme activity was measured. For confirmation of reproducibility, five supernatant samples were taken and stored, and the enzyme activity was measured for each. As a result, as shown in FIG. 10, no significant decrease in activity was observed even when left for 28 days at 28 ° C. and 4 ° C.
Similarly, no significant decrease in activity was observed even after standing at −20 ° C. for 115 days (FIG. 11).
As described above, the biodegradable plastic-degrading enzyme of the present invention can be stably stored for a long period of time in each temperature condition in the range of 28 ° C. to −20 ° C. in the state of the supernatant after removing the cells from the culture solution. I understood.

Next, the stability of the enzyme activity against vacuum lyophilization of the supernatant from which the bacterial cells were removed from the culture broth was confirmed.
10 ml of the supernatant was put in a 300 ml flask and dried at −80 ° C. for 6 hours by Freeze Mobile 12 manufactured by Marto Shokai Co., Ltd. As a result, 4.19 ± 0.53 mg of powder was obtained per ml of the supernatant. Thereafter, when the powder was dissolved in sterilized distilled water so as to be equivalent to the concentration before drying, the same activity as before drying was observed (FIG. 12).

  Furthermore, the storage stability of the biodegradable plastic enzyme of the present application in the lyophilized powder state was confirmed. The enzyme powder freeze-dried as described above was left at 4 ° C. for 50 days. Then, when it melt | dissolved with sterilized distilled water so that it might become equivalent to the density | concentration before drying and the enzyme activity was confirmed, the activity equivalent to before drying was recognized (FIG. 13).

Claims (17)

Filamentous fungi of the contract number N ITE P-57 3. Biodegradable plastic-degrading enzyme producing fungi according to claim 1 Symbol placement. (a) step to secrete filamentous fungus according to claim 1 Symbol placement, and cultured in a medium containing a biodegradable plastic biodegradable plastic-degrading enzyme in the culture solution,
(b) a step of purifying a biodegradable plastic degrading enzyme from the culture solution;
A method for producing a biodegradable plastic degrading enzyme, comprising: Obtained by the method of claim 3 wherein the molecular weight of 1 8～22KDa biodegradable plastic-degrading enzyme by SDS electrophoresis. Comprising contacting a biodegradable plastic-degrading enzyme according to claim 2 or 4, wherein the biodegradable plastics, the method for decomposing a biodegradable plastic. Filamentous fungi of claim 1 Symbol placement, and / or a biodegradable plastic-degrading enzyme according to claim 2 or 4, wherein the biodegradable plastic-degrading preparation.   A nucleic acid comprising the base sequence of SEQ ID NO: 20. A vector comprising the nucleic acid according to claim 7 . A protein encoded by the nucleic acid according to claim 7 .   A protein comprising the sequence of SEQ ID NO: 21.   A protein comprising an amino acid sequence in which one or several amino acids of the sequence of SEQ ID NO: 21 have been deleted, substituted or added, and having a degrading activity of PBS and PBSA. A method for degrading a biodegradable plastic, comprising contacting the protein according to any one of claims 9 to 11 with the biodegradable plastic. Containing protein of any one of claims 9 to 11, the biodegradable plastic-degrading preparation. The method according to claim 3 , wherein the biodegradable plastic contained in the medium is a PBSA pellet. (c) a filamentous fungus of claim 1 Symbol placement, adding to the medium containing biodegradable plastic processes,
(d) culturing the filamentous fungus and secreting the biodegradable plastic degrading enzyme into the culture solution;
(e) recovering the culture medium of step (d),
(f) adding a new medium to the filamentous fungi remaining in the culture vessel after collecting the culture solution;
(g) repeating steps (d)-(f),
A method for producing a biodegradable plastic degrading enzyme, comprising: step (h) to secrete filamentous fungus according to claim 1 Symbol placement, and cultured in a medium containing a biodegradable plastic biodegradable plastic-degrading enzyme in the culture solution,
(i) a step of freeze-drying the culture supernatant,
A method for producing a biodegradable plastic degrading enzyme powder comprising: A biodegradable plastic degrading enzyme powder produced by the method according to claim 16 .