JP4883656B2 - NaV2 channel gene-deficient non-human animal - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a null mutant non-human animal useful as a model animal of excessive salt intake experiments, and showing salt intake behavior similar to that of wild-type animals under water-sufficient conditions and much more intakes of hypertonic salt compared with wild type animals under water-depleted conditions, e.g., an Nav2 channel gene-deficient non-human animal. <P>SOLUTION: The Nav2 knockout mouse is prepared by screening mouse genomic DNA libraries with rat NaGcDNA as a probe, isolating Nav2 gene of genomic DNA, preparing a targeting vector by inserting marker gene such as neo gene into the exon of Nav2, introducing the prepared targeting vector into ES cells, selecting homologously recombined ES cells, preparing germ line chimeric mice by using the ES cells and mutually intercrossing heterozygous mutant mice having been prepared by hybridizing the chimeric mice with the wild type mice. <P>COPYRIGHT: (C)2011,JPO&amp;INPIT

Description

In the present invention, Na _V 2 channel gene function shows the intake behavior of salt similar to that of the wild type under the water-filling condition and the intake behavior of a large amount of hypertonic salt compared with the wild-type under the water-starved condition. The present invention relates to a protein that acts as a sensor of Na ion level in a deficient non-human animal, a brain neuron that monitors osmotic pressure in cerebrospinal fluid and blood, a gene encoding the same, and the like.

  Voltage-dependent sodium channels are known as ion channels that play a central role in the generation and propagation of action potentials in excitable cells such as nerve cells and muscle cells, as well as voltage-dependent potassium channels. The sodium channel protein constitutes an ion-selective channel with a potential detection system, and is composed of an α-subunit consisting of a 270 kDa glycoprotein and one or two smaller β-subunits. The voltage-gated sodium channel is closed when the cell membrane is at resting potential (usually -70 to -90 mV), but the channel opens when the cell membrane depolarizes, and the channel closes after about 1 msec. Molecules are said to constitute a potential sensor that senses the membrane potential, activation dependence that moves in conjunction with it, a selectivity filter that selectively permeates sodium ions, and inactivation dependence. .

Since the identification of brain sodium channel protein α-subunit cDNA types I, II and III by the present inventors (Non-Patent Documents 1 and 2), many isoforms of α-subunits that are structurally related have various types. They have been cloned from tissues and these form a multigene family. Recently, in addition to excitable cells, glial cells have also been found to express voltage-sensitive sodium current (Non-patent Document 3), in situ hybridization, RT-PCR, Northern blot and immunocytochemistry. The presence of brain-types I, II, III, H1, Na _S , NaCH6 and the like in glial cells has been reported by such techniques (Non-patent Document 4). However, the function of voltage-gated sodium channels in so-called electrically non-excitable cells has not been elucidated.

Several years ago, a partial cDNA homologous to the voltage-gated sodium channel α-subunit was cloned from a cDNA library derived from rat astrocytes and named NaG (Non-patent Document 5). Subsequently, similar α-subunit isoforms have been cloned independently from various animal species. For example, rat spinal nerve corresponding to Na _V 2.1 from human heart (Non-patent document 6), Na _V 2.3 from mouse arterial tumor cell line (Non-patent document 7) and NaG splicing variant. SCL11 derived from knot has been reported (Non-patent Document 8). These are also considered as species ortholouges due to sequence homology, and are different subfamilies within the voltage-gated sodium channel (NaCh) α-subunit family, ie subfamily 2 NaCh (Na _V 2) Can be classified. Their entire amino acid sequences are less than 50% less homologous than previously cloned voltage-gated sodium channels, even in regions related to ion selectivity and voltage-dependent activation / deactivation. The sequence is specific. Since these regions are completely conserved among all other subfamily members, Na _V 2 is thought to have special channel properties, but functional Na _V 2 channels are linked to Xenopus oocytes, Attempts to express in heterologous expression systems using CHO cells, HEK293 cells, etc. have not been successful so far, and the function of the Na _V 2 channel in vivo has not been known at all.

NAG / SCL11 since been cloned from astrocytes, have been considered one of the voltage-dependent sodium channels expressed in astrocytes (Nach), Na _V Subsequent in situ hybridization It was revealed that 2 is not expressed in astrocytes in vivo but is expressed in Schwann cells and spinal sensory neurons (Non-patent Document 9). NaG mRNA was detected at a relatively high level in the nervous system, particularly in the lungs and heart, and RNase protection and Northern blotting showed that NaG mRNA was present in the central nervous system. It has been reported that NaG mRNA cannot be detected except in mesencephalic nucleus V by in situ hybridization using a probe (Non-patent Document 10). This suggests that NaG mRNA may be expressed at low levels throughout the central nervous system or limitedly in specific regions of the central nervous system. Since the NaG channel is distributed in such a wide range of tissues and a wide variety of cell types including electrically non-excitable cells, the NaG channel is considered to have functions other than action potential generation and propagation.

Nature 320,188-192 (1986) FEBS Lett.228,187-194 (1988) Trends Neurosci. 19,325-332 (1996) Glia 26,92-96 (1999) Proc.Natl.Acad.Sci.USA 89,7272-7276 (1992) Proc.Natl.Acad.Sci.USA 89,4893-4897 (1992) J. Biol. Chem. 269, 30125-30131 FEBS Lett.400,183-187 (1997) Glia 21,269-276 (1997) Mol.Brain Res. 45, 71-82 (1997)

To date, no experimental animal model of salt overdose has been shown that exhibits salt intake behavior similar to that of the wild type under water-filled conditions and abnormal hypertonic salt intake behavior under the condition of water starvation compared to the wild type. . In addition, there is no known protein that acts as a sensor of Na ion level or a gene that encodes it in brain neurons that monitor osmotic pressure in cerebrospinal fluid and blood. The subject of the present invention is useful as an experimental model animal for excessive salt intake, showing salt intake behavior similar to that of the wild type under water-filling conditions, and intake behavior of a large amount of hypertonic salt compared to the wild type under water-starvation conditions Null mutant non-human animals showing Na, such as Na _V 2 channel gene-deficient non-human animals, brain cerebrospinal fluid and brain nerve cells that monitor osmotic pressure in blood It is to provide a gene to do.

The present inventors have intensively studied in order to elucidate the function and role of Na _V 2 channel function in vivo was not known to prepare a Na _V 2 channel knockout mice, Na _V 2 channels in the brain Confirming that it plays a role in sensing and issuing sodium ion levels in the spinal fluid, this Na _V 2 channel knockout mouse shows salt intake behavior similar to the wild type under water-filling conditions, Under the conditions, it was found that it showed an abnormal behavior of ingesting a large amount of hypertonic salt compared to the wild type, and the present invention was completed.

That is, the present invention
Use of any of the following proteins (a) to (c) as a sensor for extracellular Na ion level:
(A) a protein comprising the amino acid sequence shown in SEQ ID NO: 3 and acting as a sensor for Na ion level in brain neurons that monitor osmotic pressure in cerebrospinal fluid and blood:
(B) A brain nerve that comprises an amino acid sequence in which one or several amino acids are deleted, substituted, or added in the amino acid sequence shown in SEQ ID NO: 3, and that monitors osmotic pressure in cerebrospinal fluid and blood Protein that acts as a sensor for Na ion levels in cells: (c) stringent including hybridization at 65 ° C. and washing at 65 ° C. with a buffer containing 0.1 × SSC, 0.1% SDS In a brain neuron that is encoded by a DNA that hybridizes with a DNA consisting of a complementary sequence of the base sequence shown in SEQ ID NO: 2 and that monitors osmotic pressure in cerebrospinal fluid and blood under various conditions Proteins that act as level sensors:
About.

A null mutant non-human animal, such as a Na _V 2 channel gene, which shows salt intake behavior similar to that of the wild type under the water-sufficient condition of the present invention, and which shows a high hypertonic salt intake behavior compared to the wild type under the water-starved condition. The deficient mouse is useful as an experimental animal model for excessive salt intake. Moreover, by using this Na _V 2 channel gene-deficient mouse, the Na _V 2 channel plays a role of sensing and issuing a sodium ion level in the cerebral spinal fluid, and the Na _V 2 channel is a central nervous system. Expressed in neurons and ependymal cells, especially in periventricular organs involved in fluid homeostasis, and that Na _V 2 channel plays an important role in the control of fluid osmolality perception and salt intake behavior Became clear.

Na _V 2 knockout mice genetic map of the present invention (a), the results of Southern blots of genomic DNA (b), a diagram showing the genomic PCR results (c) and Western blot results of (d). Embryos Na _V 2 knockout mice of the present invention, showing a lacZ expression site in the spinal cord ganglia and breast. It is a diagram illustrating a lacZ expression site in the brain of Na _V 2 knockout mice of the present invention. It is a diagram showing the results on the effects of moisture starvation on the expression of Fos nucleoprotein in Na _V 2 knockout mice of the present invention. Mice Na _V 2 channel defect in the present invention is a diagram showing the results on the effects of moisture and salt intake in mice. Shows the results of reaction in the chorda tympani nerve to various taste stimuli in Na _V 2 knockout mice of the present invention. Is a graph showing measurement results of the preference rate and total intake for 0.3M of NaCl before and after the 24-hour water starvation in Na _V 2 knockout mice of the present invention. It is a diagram showing the results of salt appetite test sodium starving process induced in Na _V 2 knockout mice of the present invention. For wild-type mice and Na _v 2 gene-deficient mice were prepared from dorsal root ganglion neurons, is a diagram showing fluorescence imaging results of the fluorescence ratio of intracellular sodium ions and intracellular calcium ions (F340 / F380) . For wild-type mice and Na _v 2 gene-deficient mice were prepared from dorsal root ganglion neurons, is a diagram showing fluorescence imaging results of the fluorescence ratio of intracellular sodium ions and intracellular calcium ions (F340 / F380) . For wild-type mice and Na _v 2 gene-deficient mice subfornical organ of neuronal cells prepared from a diagram showing the fluorescence imaging results of the fluorescence ratio of intracellular sodium ions and intracellular calcium ions (F340 / F380).

The null mutant non-human animal of the present invention is a non-human animal that shows salt intake behavior similar to that of the wild type under water-filled conditions, and that shows a higher amount of hypertonic salt intake behavior than the wild type under water-starved conditions. Although there is no particular limitation as long as it is present, a specific example of such a non-human animal is a null-mutated non-human animal in which the Na _V 2 gene function is deleted on the chromosome. Here, the intake behavior of a large amount of hypertonic salt compared to the wild type under water starvation conditions is, for example, that in mice, the intake of 0.3 M saline is wild type, preferably the same litter under the water starvation condition for 24 hours. Null mutant non-human animals in which the Na _V 2 gene function is deficient on the chromosome are non-human animals that encode Na _V 2. A non-human animal in which the endogenous gene of a human animal has been inactivated by disruption, deletion, substitution, etc. and has lost the function of expressing Na _V 2, and a non-human animal is a rodent such as a mouse or a rat Although an animal can be mentioned concretely, it is not limited to these. Hereinafter, a case where the non-human animal is a mouse will be described as an example.

As a manufacturing method of Na _V 2 knockout mice, may be any production method as long as it is a method capable of knockout mice that have lost the ability to express Na _V 2. For example, the species of mouse Na _V 2 Using the cDNA encoding rat NaG, which is the counterpart, as a probe, a mouse genomic DNA library is screened, the Na _V 2 gene of the genomic DNA is isolated, and a marker gene such as a neo gene is inserted into the exon portion of Na _V 2. A target vector is prepared by insertion, the prepared target vector is introduced into ES cells by electroporation, ES cells that have undergone homologous recombination are selected, and germline chimeras using this ES cell line Heterozygous mice obtained by creating mice and mating with wild-type mice ( 1: by mating the F1 hybrid) together, it is possible to produce wild-type mice of Na _V 2 knockout mice and littermates produced in accordance with Mendel's laws.

The protein that acts as a sensor for Na ion level in brain neurons that monitor osmotic pressure in the cerebrospinal fluid and blood of the present invention is particularly suitable as long as it functions as a sensor for Na ion levels in brain neurons. For example, Na _V 2 (GenBank accession number: L36179) shown in SEQ ID NO: 3 or the amino acid sequence shown in SEQ ID NO: 3 is deleted or substituted. Or a protein that consists of an added amino acid sequence and acts as a sensor of Na ion level in brain neurons that monitor osmotic pressure in cerebrospinal fluid and blood, and these recombinant proteins. it can. Such a protein that acts as a sensor for Na ion level in brain neurons that monitor osmotic pressure in the cerebrospinal fluid and blood can be prepared by a known method based on the DNA sequence information and the like.

In addition, as a gene encoding a protein that acts as a sensor for Na ion level in brain neurons that monitor osmotic pressure in cerebrospinal fluid and blood of the present invention, Na _V 2 shown in SEQ ID NO: 3 in the Sequence Listing is used. A protein comprising an amino acid sequence in which one or several amino acids have been deleted, substituted, or added in the Na _V 2 gene shown in SEQ ID NO: 2 or the amino acid sequence shown in SEQ ID NO: 3 Encodes the gene DNA that encodes and a protein that hybridizes with these gene DNAs under stringent conditions and acts as a sensor for Na ion level in brain neurons that monitor osmotic pressure in cerebrospinal fluid and blood DNA is also included, and these are based on the DNA sequence information etc., for example, cell line R1 Et made mouse genomic library or was, can be prepared by known methods from 129 / SvJ mouse gene library and the like.

Further, hybridization is carried out under stringent conditions on a mouse-derived DNA library using the nucleotide sequence shown in SEQ ID NO: 2 or a complementary sequence thereof and a part or all of these sequences as probes. to by isolating the hybridizing DNA, human Na _v 2.1 (GenBank accession number: M91556) to Na _V 2 gene and the valid object and rat NaG / SCL11 (GenBank accession number: Y09164) It is also possible to obtain DNA encoding a protein that acts as a sensor of Na ion level in brain neurons that monitor cerebral spinal fluid and osmotic pressure in blood. Examples of hybridization conditions for obtaining such DNA include hybridization at 42 ° C. and washing treatment at 42 ° C. with a buffer containing 1 × SSC and 0.1% SDS. More preferably, hybridization at 65 ° C. and washing treatment at 65 ° C. with a buffer containing 0.1 × SSC and 0.1% SDS can be mentioned. In addition, there are various factors other than the above temperature conditions as factors affecting the stringency of hybridization, and those skilled in the art will be able to combine various components as appropriate to achieve the same stringency of hybridization as exemplified above. Stringency can be realized.

The fusion protein of the present invention binds a marker protein and / or a peptide tag to a protein that acts as a sensor of Na ion level in cerebrospinal fluid such as Na _V 2 and brain neurons that monitor osmotic pressure in blood. The marker protein may be any conventionally known marker protein, such as alkaline phosphatase, antibody Fc region, HRP, GFP, etc. As peptide tags in the present invention, conventionally known peptide tags such as Myc tag, His tag, FLAG tag, and GST tag can be specifically exemplified. Such a fusion protein can be prepared by a conventional method, and acts as a sensor for Na ion level in cerebrospinal fluid using the affinity between Ni-NTA and His tag and in brain neurons that monitor osmotic pressure in blood. It is also useful as a reagent for research in this field, such as purification of proteins to be detected, detection of such proteins, quantification of antibodies to such proteins, and the like.

Examples of the antibody that specifically binds to a protein that acts as a sensor of Na ion level in brain cerebrospinal fluid and cerebral nerve cells for monitoring osmotic pressure in blood of the present invention include monoclonal antibodies, polyclonal antibodies, chimeric antibodies, one Specific examples include immunospecific antibodies such as chain antibodies and humanized antibodies, which act as Na ion level sensors in the above-mentioned cerebrospinal fluid and brain neurons that monitor osmotic pressure in blood. Although it can be prepared by a conventional method using a protein as an antigen, a monoclonal antibody is more preferable in terms of its specificity. An antibody that specifically binds to a protein that acts as a sensor for Na ion level in cerebrospinal fluid and cerebral nerve cells that monitor osmotic pressure in the blood, such as a monoclonal antibody, is a chronic disease caused by excessive intake of human salt, for example. Of a protein that acts as a sensor of Na ion level in diagnosis of diseases caused by mutation or deletion of Na _V 2 such as Na _V 2, and cerebrospinal fluid such as Na _V 2 and cerebral nerve cells that monitor osmotic pressure in blood This is useful for clarifying the molecular mechanism.

Antibodies against a protein that acts as a sensor for Na ion levels in cerebrospinal fluid and cerebral nerve cells that monitor osmotic pressure in blood can be administered to animals (preferably non-humans) in cerebrospinal fluid and cerebrospinal fluid using conventional protocols. It can be produced by administering a protein or epitope-containing fragment that acts as a sensor for Na ion levels in brain neurons that monitor osmotic pressure in the blood, or cells expressing the protein on the membrane surface. For example, a polyclonal antibody is obtained by immunizing a rabbit or the like with an antigen peptide as an immunogen, preparing antiserum by a conventional method, and purifying the prepared antiserum with a column on which the peptide used for the immunogen is immobilized. Can be prepared. Monoclonal antibodies also produce antibodies produced by continuous cell line cultures. Hybridoma method (Nature 256, 495-497, 1975), trioma method, human B cell hybridoma method (Immunology Today 4, 72, 1983) And EBV-hybridoma method (MONOCLONAL ANTIBODIES AND CANCER THERAPY, pp. 77-96, Alan R. Liss, Inc., 1985). In the following, as a protein that acts as a sensor of Na ion level in brain neurons that monitor osmotic pressure in cerebrospinal fluid and blood, mouse-derived Na _V 2 is taken as an example for mouse-derived Na _V 2. A method for producing a monoclonal antibody that specifically binds, that is, an anti-mNa _V 2 monoclonal antibody will be described.

The anti-mNa _V 2 monoclonal antibody can be produced by culturing an anti-mNa _V 2 monoclonal antibody-producing hybridoma in vivo or in vitro by a conventional method. For example, in an in vivo system, it can be obtained by culturing in the abdominal cavity of a rodent, preferably a mouse or a rat. In an in vitro system, it can be obtained by culturing in an animal cell culture medium. As a medium for culturing a hybridoma in an in vitro system, a cell culture medium such as RPMI 1640 or MEM containing an antibiotic such as streptomycin or penicillin can be exemplified.

An anti-mNa _V 2 monoclonal antibody-producing hybridoma can be obtained by, for example, immunizing a BALB / c mouse with Na _V 2 obtained from a mouse or the like, and spleen cells and mouse NS-1 cells (ATCC TIB-18) of the immunized mouse. ) Can be fused by a conventional method and screened with an immunofluorescent staining pattern to produce an anti-mNa _V 2 monoclonal antibody-producing hybridoma. In addition, as a method for separating and purifying the monoclonal antibody, any method can be used as long as it is a method generally used for protein purification, and liquid chromatography such as affinity chromatography can be specifically exemplified. .

  In order to produce a single-chain antibody against a protein that acts as a sensor of Na ion level in brain neurons that monitor osmotic pressure in the cerebrospinal fluid and blood of the present invention, a method for preparing a single-chain antibody (US Pat. No. 4,946,778) can be applied. Furthermore, in order to express humanized antibodies, transgenic mice or other mammals can be used, or the above antibodies can be used to monitor the cerebral spinal fluid and blood osmotic pressure in brain neurons. A clone expressing a protein acting as an ion level sensor can be isolated and identified, or the polypeptide can be purified by affinity chromatography. An antibody against a protein that acts as a sensor of Na ion level in brain neurons that monitor osmotic pressure in cerebrospinal fluid and blood is an antibody against Na ion levels in nerve cells in brain that monitor osmotic pressure in cerebrospinal fluid and blood. This is useful for clarifying the molecular mechanism of proteins acting as sensors.

Examples of the anti-mNa _V 2 monoclonal antibody include fluorescent substances such as FITC (fluorescein isocyanate) or tetramethylrhodamine isocyanate, radioisotopes such as ¹²⁵ I, ³² P, ¹⁴ C, ³⁵ S or ³ H. , Alkaline phosphatase, peroxidase, β-galactosidase or phycoerythrin labeled with an enzyme such as a fluorescent protein such as green fluorescent protein (GFP), etc. Analysis of the function of a protein that acts as a sensor of Na ion level in brain neurons that monitor the osmotic pressure of the cerebral can be performed. Examples of the immunological measurement method include RIA method, ELISA method, fluorescent antibody method, plaque method, spot method, hemagglutination method, and octalony method.

  The present invention also relates to a host cell comprising an expression system capable of expressing a protein that acts as a sensor for Na ion level in brain neurons that monitor osmotic pressure in the cerebrospinal fluid and blood. Introducing a gene encoding a protein that acts as a sensor for Na ion levels in brain neurons that monitor osmotic pressure in the cerebrospinal fluid and blood into a host cell is described in Davis et al. (BASIC METHODS IN MOLECULAR BIOLOGY, 1986). And Sambrook et al. (MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989), for example, methods described in many standard laboratory manuals such as calcium phosphate transfection, DEAE-dextran mediated transfection, transvection, microinjection, cationic lipid mediated transfection, electroporation, transduction, scrape loading, ballistic introduction, infection, etc. it can. As host cells, bacterial prokaryotic cells such as Escherichia coli, Streptomyces, Bacillus subtilis, Streptococcus, Staphylococcus, fungal cells such as yeast and Aspergillus, insect cells such as Drosophila S2 and Spodoptera Sf9, L cells, Animal and plant cells such as CHO cells, COS cells, HeLa cells, C127 cells, BALB / c3T3 cells (including mutants lacking dihydrofolate reductase and thymidine kinase), BHK21 cells, HEK293 cells, Bowes melanoma cells, oocytes, etc. And so on.

  As an expression system, any expression system can be used as long as it can express a protein acting as a sensor of Na ion level in a neuron in the brain that monitors osmotic pressure in the cerebrospinal fluid and blood. Expression systems derived from chromosomes, episomes and viruses such as bacterial plasmids, yeast plasmids, papovaviruses such as SV40, vaccinia viruses, adenoviruses, fowlpox virus, pseudorabies virus, retroviruses Vector, bacteriophage-derived, transposon-derived and combinations thereof, for example, plasmids such as cosmids and phagemids and bacteriophage genetic elements. These expression systems may contain control sequences that not only cause expression but also regulate expression.

Proteins that act as Na ion level sensors in host cells comprising the above expression system, cell membranes of such cells, cerebrospinal fluid obtained by culturing such cells, and brain neurons that monitor osmotic pressure in blood Can be used in the screening method of the present invention as described later. For example, as a method for obtaining a cell membrane, the method of F. Pietri-Rouxel (Eur. J. Biochem., 247, 1174-1179, 1997) and the like can be used, and the cerebrospinal fluid and blood To recover and purify proteins from cell cultures that act as sensors for Na ion levels in brain neurons that monitor osmotic pressure, ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography , Known methods including hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography and lectin chromatography, preferably high performance liquid chromatography. In particular, as a column used for affinity chromatography, for example, an anti-cerebral spinal fluid such as an anti-Na _V 2 monoclonal antibody and a protein antibody that acts as a sensor for Na ion level in brain neurons that monitor osmotic pressure in blood are used. When a normal peptide tag is added to a protein that acts as a Na ion level sensor in a bound column or a brain neuron that monitors osmotic pressure in cerebrospinal fluid and blood such as Na _V 2 above, By using a column to which a substance having an affinity for this peptide tag is bound, it is possible to obtain a protein that acts as a sensor of Na ion level in brain neurons that monitor cerebral spinal fluid and blood osmotic pressure. it can.

  In the present invention, a transgenic non-human animal overexpressing a gene encoding a protein that acts as a sensor of Na ion level in brain neurons that monitor cerebrospinal fluid and blood osmotic pressure is a wild type non-human animal. This refers to a non-human animal that produces a large amount of protein that acts as a sensor for Na ion level in brain neurons that monitor cerebral spinal fluid and blood osmotic pressure compared to human animals. Specific examples of non-human animals in the present invention include, but are not limited to, non-human animals such as rabbits, rodents such as mice and rats.

  By the way, homozygous non-human animals born according to Mendel's law include protein overexpression that acts as a sensor of Na ion level in brain neurons that monitor osmotic pressure in cerebrospinal fluid and blood, and its overexpression type. Wild-type non-humans can be used for accurate comparison experiments at the individual level by simultaneously using the overexpression type in these homozygous non-human animals and the wild-type of the same litter. Animals, i.e., animals of the same species as non-human animals that overexpress a gene encoding a protein that acts as a sensor of Na ion level in brain neurons that monitor osmotic pressure in cerebrospinal fluid and blood, and animals that are the same Are preferably used together in the screening of the present invention described below, for example. A method for producing a non-human animal in which a gene encoding a protein that acts as a sensor of Na ion level in a brain nerve cell that monitors cerebral spinal fluid and blood osmotic pressure is expressed in cerebrospinal fluid and blood. A protein transgenic mouse that acts as a sensor for Na ion level in brain neurons that monitor osmotic pressure will be described below as an example.

Transgenic mice of a protein that acts as a sensor of Na ion level in brain neurons that monitor osmotic pressure in cerebrospinal fluid and blood are brains that monitor osmotic pressure in cerebrospinal fluid such as Na _V 2 and blood. Introduced by fusing chicken β-actin, mouse neurofilament, promoter such as SV40 and polyA or intron such as rabbit β-globin and SV40 to cDNA encoding a protein that acts as a sensor of Na ion level in the inner nerve cell After constructing the gene, microinjecting the transgene into the pronucleus of the mouse fertilized egg, culturing the obtained egg cell, transplanting it to the oviduct of the temporary parent mouse, raising the transplanted animal, and then born mouse By selecting a mouse pup having the cDNA from Transgenic mice can be created. In addition, selection of mouse pups that have cDNA is a protein that acts as a sensor for Na ion levels in brain neurons that extract crude DNA from the tail of mice, etc., and monitor cerebral spinal fluid and osmotic pressure in blood. Can be performed by a dot hybridization method using a gene encoding as a probe, a PCR method using a specific primer, or the like.

  In addition, a protein that acts as a sensor of Na ion level in brain neurons that monitor osmotic pressure in the cerebrospinal fluid and blood, a gene encoding such a protein, osmotic pressure in cerebrospinal fluid and blood, In a brain protein that monitors the osmotic pressure in cerebrospinal fluid and blood, or a fusion protein in which a protein that acts as a sensor of Na ion level in the brain nerve cell to be monitored and a marker protein and / or peptide tag are bound Including an antibody against a protein that acts as a sensor for Na ion level, and an expression system that can express a protein that acts as a sensor for Na ion level in brain neurons that monitor osmotic pressure in cerebrospinal fluid and blood Monitor osmotic pressure in host cells, cerebrospinal fluid and blood Non-human animals overexpressing a gene encoding a protein that acts as a sensor of Na ion level in the brain neurons, and the intake behavior of salt similar to that of the wild type under water-filling conditions, Cells expressing a protein that acts as a sensor of Na ion level in null mutant non-human animals that show a higher amount of hypertonic salt intake behavior compared to the wild type, and brain neurons that monitor osmotic pressure in cerebrospinal fluid and blood Monitor the osmotic pressure in the cerebrospinal fluid and blood, and monitor the osmotic pressure in the cerebrospinal fluid and blood. A protein expression promoter or inhibitor that acts as a sensor for Na ion levels in neurons It can be cleaned. What was obtained by these screenings was an inhibitor, preventive or therapeutic agent for chronic diseases caused by excessive salt intake in humans, as well as Na ion levels in brain neurons that monitor cerebrospinal fluid and blood osmotic pressure. There is a possibility that it is a substance useful for diagnosis and treatment of diseases caused by deletion or abnormality of proteins acting as sensors.

  Examples of the screening method include a method of using a test substance and a cell expressing a protein that acts as a sensor for Na ion level in brain neurons that monitor cerebrospinal fluid and blood osmotic pressure. In the present invention, a null mutant non-human animal or cerebrospinal fluid and blood that shows the intake behavior of salt similar to that of the wild type under the water-filled condition and the intake behavior of a large amount of hypertonic salt compared to the wild type under the water-starved condition. Examples thereof include a method using a test substance and a transgenic non-human animal in which a gene encoding a protein that acts as a Na ion level sensor in a brain nerve cell that monitors osmotic pressure therein is overexpressed.

  Examples of screening methods using the test substance using cells expressing a protein that acts as a sensor for Na ion level in brain neurons that monitor cerebral spinal fluid and blood osmotic pressure include, for example, the brain The cerebral spinal fluid and blood osmotic pressure is monitored by bringing the test substance into contact with a cell expressing a protein that acts as a sensor for the Na ion level in brain neurons that monitor the osmotic pressure in the spinal fluid and blood. Examples thereof include a method for measuring / evaluating a change in function or expression of a protein that acts as a sensor of Na ion level in a brain neuron to be monitored.

  Null mutant non-human animals or cerebrospinal fluid and blood that show the intake behavior of salt similar to that of the wild type under the water-filling condition of the present invention and the intake behavior of a large amount of hypertonic salt compared to the wild-type under the water-starved condition As a screening method using a transgenic non-human animal overexpressing a gene encoding a protein that acts as a sensor of Na ion level in brain neurons that monitor the osmotic pressure of the test substance, and a test substance, Below, the salt intake behavior similar to that of the wild type is shown, and the osmotic pressure in the null-mutated non-human animal or cerebrospinal fluid and blood showing the intake behavior of a large amount of hypertonic salt compared to the wild type under the water-starved condition is monitored. Transgenic non-human animal overexpressing a gene encoding a protein that acts as a sensor for Na ion level in neurons in the brain A method of measuring and evaluating a change in the function or expression of the protein in advance, or subjecting the null mutant non-human animal or the transgenic non-human animal to saline in advance. After administration, nerve cells obtained from the non-human animal are cultured in the presence of a test substance, and a method for measuring and evaluating changes in the function or expression of the protein, the null-mutated non-human animal or the transgenic non-human animal A method for measuring and evaluating changes in function or expression of the protein in nerve cells obtained from the non-human animal after administering a test substance and saline in advance to the human animal, the null-mutated non-human animal or the transgenic After administering the test substance and saline in advance to the non-human animal, the function of the protein in the non-human animal or Or the like can be specifically exemplified method for measuring and evaluating the change of the current.

  In addition, when measuring or evaluating changes in the function or expression of a protein that acts as a sensor of Na ion level in brain neurons that monitor osmotic pressure in cerebrospinal fluid and blood, as a control, wild-type non-human animals, particularly It is preferable to compare and evaluate with measured values of wild-type non-human animals of the same litter because variations due to individual differences can be eliminated. It should be noted that the function of a protein that acts as a sensor for the Na ion level in brain neurons that monitor osmotic pressure in cerebrospinal fluid and blood is an osmotic pressure regulating function in a living body, that is, penetration in cerebrospinal fluid and blood. A function that acts as a sensor of Na ion level in nerve cells in the brain that are monitoring pressure. Changes in such functions include changes in function in sensory pathways of body fluid osmolality and preference for water and salt intake. -A change in aversive response can be specifically exemplified, but is not limited thereto.

  In addition, the pharmaceutical composition of the present invention comprises, as an active ingredient, a protein that acts as a sensor of Na ion level in brain neurons that monitor osmotic pressure in the cerebrospinal fluid and blood of the present invention, and cerebrospinal fluid and blood. Promoter or inhibitor of protein functioning as a sensor of Na ion level in brain nerve cells that monitor osmotic pressure in blood or sensor of Na ion level in brain cells that monitor osmotic pressure in cerebrospinal fluid and blood The pharmaceutical composition is not particularly limited as long as it contains a substance that promotes or suppresses the expression of a protein that acts as a cerebral spinal fluid. Patients who need to promote or enhance the function of proteins acting as sensors And it can be used to treat patients in need of inhibition of function or expression of proteins that act as a Na ion level sensor are in brain neurons to monitor the osmotic pressure of blood.

  Hereinafter, the present invention will be described more specifically with reference to examples. However, the technical scope of the present invention is not limited to these examples.

[Construction of targeting vector]
To construct the targeting vector, a mouse genomic fragment containing protein coding exons 1, 2 and 3 was cloned with a rat NaG / SCL11 probe. First, a 446 bp fragment of rat NaG cDNA (nucleotide residues 11-456 including the first three coding exons) from a mouse genomic library (provided by Dr. Mori of Osaka University) made from cell line R1: GenBank Accession Nine independent genomic clones were isolated by hybridization with No. Y09164: SEQ ID No. 1). Southern blot analysis using several restriction enzymes confirmed that all these overlapping clones were derived from a single genomic locus. After subcloning the hybridization-positive 3.2 kb and 3.7 kb Hind III fragments into pBluescriptIISK (-) (Stratagene), the DNA sequence was determined (sequence is GenBank accession number AF190472: SEQ ID NO: 4). . The 3.2 kb fragment contains protein coding exon 1 (13 bases of the 5 'untranslated region and the first 238 bases of the mouse Na _V 2 protein coding sequence: nucleotide residues 238-490 of GenBank accession number L36179). The .7 kb fragment contained exon 2 (same nucleotide residues 491-609) and exon 3 (same nucleotide residues 610-701). The DNA sequence encoding these three exons was the same as the mouse Na _V 2.3 cDNA cloned by Tamkun et al. (J. Biol. Chem. 269, 30125-30131 (1994)). As a result of Southern blotting for the four restriction enzymes (BamH I, Bgl II, EcoR I and Hind III), the cloned genomic fragment showed the same restriction enzyme map as that of the mouse genomic DNA. This finding revealed that mouse Na _v 2.3 is the species counterpart of rat NaG. Therefore, Na _V 2.3, NaG and SCL11 were named Na _V 2.

In order to construct a targeting vector, the lacZ gene was inserted into protein coding exon 1 of the mouse Na _V 2 gene, and the 20 amino acid sequence at the N-terminus of mouse Na _V 2 was designed to be fused with β-galactosidase. That is, a 12.5 kb Sal I fragment containing three exons was inserted into the Xho I site of pDT-A (Anal. Biochem. 214, 77-86 (1993)), and then the Sal I- of the lacZ-neo cassette. The Xho I fragment was introduced into the endogenous Xho I site of exon 1 (see FIG. 1a). This expresses a protein in which the first 20 amino acids of mouse Na _V 2 protein are fused to the N-terminus of β-galactosidase. In addition, in order to reliably express the lacZ gene instead of the mouse Na _V 2 gene in the target mouse, the genomic structure of the original mouse Na _V 2 gene was used as it was except that the lacZ-neo cassette was inserted. An EcoR I linker was pre-inserted at the 5 'end of the lacZ-neo cassette so that it could be used as an exogenous restriction site in Southern blot screening. In FIG. 1a, the upper row shows the restriction enzyme map of the target vector, the middle row shows the wild-type mouse Na _V 2 locus, the lower row shows the recombinant locus, and the restriction site B in the figure is BamHI. , Bg represents Bgl II, E represents EcoR I, H represents Hind III, and X represents Xho I.

[Preparation of Na _V 2 knockout mouse]
The linearized target vector was introduced into ES cells (129 / SV mouse-derived R1 cell line) by electroporation. In accordance with the method described in the literature (Neurosci. Lett. 247, 135-138 (1998)), a neomycin resistant ES clone was selected by G418 and a target clone was screened. Homologous recombinants were confirmed by Southern blotting using EcoR I digestion with probe 1 (see FIG. 1a; 0.3 kb EcoR I-Xba I fragment located approximately 8 kb upstream from Xho I in exon 1). The selected clones were checked with probe 2 (0.6 kb Pst I fragment derived from the neo gene). 1 sense primer (primer 1, ATGTTGAACTTCCCCCAGAGCC in the 5 ′ end region of exon 1; SEQ ID NO: 5) and 2 antisense primers (primer 2, AACCAGGCAAAAGCGCCATTC in the 5 ′ end region of lacZ: SEQ ID NO: 6, primer 3, The targeted locus was confirmed by genomic PCR using CATCTTCCAAGGGCTCTGACA: SEQ ID NO: 7) in the 3 'end region of exon 1. PCR amplification was performed in two steps with EX-Taq polymerase (Takara) using a programmable thermal cycler according to the manufacturer's protocol (first step; 95 ° C for 5 minutes, 60 ° C for 1 minute, 72 ° C). 1 minute, second stage: 95 ° C. 30 seconds, 60 ° C. 30 seconds, 72 ° C. 1 minute).

Two ES clones obtained from 98 ES clones and confirmed to have alleles in which homologous recombination occurred were introduced into 8-cell stage C57BL / 6J mouse embryos. The introduced embryo was cultured overnight in M16 medium to blastocysts, and 7-10 blastocysts were transplanted into the uterus of ICR mice. The male chimeric mouse thus obtained was crossed with a C57BL / 6J female mouse, a heterozygous mouse (F1: hybrid first generation) was created from the litter, and then a homozygous mouse was obtained. This heterozygous mouse was intercrossed to produce Na _V 2 -deficient mice produced according to Mendel's law.

This null mutant animal (mouse Na _V 2 ^{− / −} ) was healthy, breedable and visually normal. As a result of genotype analysis of 458 4-week-old mice obtained from breeding heterozygous animals, wild type was 29.5% (n = 135) and heterozygous type was 48.2% (n = 221). ), The homozygous type was 22.3% (n = 102), which was close to the Mendelian ratio. These indicate that embryo development and body function in heterozygotes and homozygotes are not significantly impaired. It has been reported that expression of mouse Na _V 2 is transiently induced in uterine smooth muscle during the perinatal period (J. Biol. Chem. 269, 30125-30131 (1994) and Am. J. Physiol. 270, C688-696 (1996)), it is noteworthy that the offspring were born normally in Na _V 2 ^{− / −} mice. Further, it is lacZ expression pattern in null mutants was the same as that of heterozygotes of what there is a difference in intensity of expression deficient mouse Na _V 2 is the differentiation or viability of mouse Na _V 2 expressing cells It shows no effect.

  Sample genomic DNA collected from the tails of wild type (+ / +), heterozygous (+/-) and homozygous (-/-) mice, and blotted with EcoRI digested genomic DNA FIG. 1b shows the result of Southern blot analysis in which the protein was hybridized with the probe 1 on the 5 ′ side of the target vector. On the right side of FIG. 1b, the wild type (18 kb) and recombinant (10 kb) genotype sizes are shown. In addition, FIG. 1c shows the results of genomic PCR analysis of wild type (+ / +), heterozygous (+/−) and homozygous (− / −) mice. On the right side of FIG. 1c, the wild type (200 bp) and recombinant (400 bp) genotype sizes are shown.

[Confirmation of Na _V 2 non-expression in Na _V 2 knockout mice]
Mutant mice were tested for mouse Na _V 2 protein expression by Western blot. Wild-type (+ / +), heterozygous (+/-) and homozygous (-/-) mouse lung tissue samples were obtained by the method of Knittle et al. (Am. J. Physiol. 270, C688-696). (1996)). SDS-polyacrylamide gel electrophoresis and immunoblotting were performed by the methods described in the literature (Neurosci. Lett. 247, 135-138 (1998)). Anti-mouse Na _v 2.3 antiserum (provided by Dr. Tumkun, Colorado State University) was used diluted 1: 500 with PBS. The immunoblot was incubated with several non-immune sera and confirmed to be non-specific binding. The result is shown in FIG. On the right side of FIG. 1d, the position of the Na _V 2 protein (220 kDa) is shown. The Na _V 2 protein is highly glycosylated and easily aggregates even in SDS-containing buffers, so the sodium channel is a broad band, but wild in heterozygous (Na _V 2 ^+/− ) mice. mice Na _V 2 protein of approximately half of the mold is detected from the lung membrane, homozygotes (Na V 2 ^_- / _-) mice Na _V 2 protein in mice was detected. Since the mouse Na _V 2 protein is not expressed, it can be seen that this allele is a null mutant.

[Confirmation of lacZ expression in Na _V 2 knockout mice by X-Gal staining]
Embryos were fixed by immersion in a 3.5% formaldehyde PBS solution at room temperature for 1 hour and cut with a razor in the sagittal plane along the midline. FIG. 2a shows X-Gal staining of embryonic day 15 (E15) mouse Na _V 2 ^+/− whole embryos, showing strong β-galactosidase activity in the trigeminal ganglion (arrowhead in FIG. 2a) and spinal nerve. It was observed in the section (arrow) (see Reference Photo 1). LacZ was also expressed in the lungs of the E15 mice (star symbol). Expression of lacZ in these organs persisted with growth, and β-galactosidase activity was detected in spinal sensory neurons of various sizes when spinal ganglia were sliced after X-Gal staining. FIG. 2b shows a cryostat tissue section obtained by staining the spinal ganglia of Na _V 2 ^+/− mice on the second day of life with X-Gal (see Reference Photo 1). lacZ expression was restricted to neuronal cell bodies of the spinal ganglia (in FIG. 2b, the nerve tract is indicated by an asterisk) and was not detected from axons. A similar lacZ expression pattern could also be observed in tissue sections of the trigeminal ganglion. FIG. 2c shows a cryostat section of a grown sympathetic nerve trunk in the chest (see Reference Photo 1). Many cells that are strongly stained are considered to be Schwann cells because of the appearance, distribution, and size of the cell body. LacZ expression was also observed in cardiac autonomic and lingual nerves. These patterns of lacZ expression are the result of rat Na _V 2 and mouse Na _V 2 expression (Proc. Natl. Acad. Sci. USA 89,7272-7276 (1992), FEBS Lett. 400, 183-187 (1997), Glia 21,269-276 (1997)). This shows that lacZ gene expression is controlled by the regulatory region of the mouse Na _V 2 gene. In FIG. 2c, the arrowhead indicates the Schwann cell body, and the scale bar indicates 50 μm.

[Physiological role of Na _V 2]
To investigate the physiological role of mouse Na _V 2, lacZ expression in the central nervous system was examined using the brains of Na _V 2 ^+/− and Na _V 2 ^{− / −} mice. Newborn animals were first perfused with PBS followed by fixatives under pentobarbital anesthesia. The fixed brain was cut with a razor in a coronal or arrow direction to a thickness of 2 mm. Washed twice with PBS and contains 1 mg / ml X-Gal, 5 mM K ₃ Fe (CN) ₆ , 5 mM K ₄ Fe (CN) ₆ , 2 mM MgCl ₂ , 0.2% NP-40 Incubated overnight at 37 ° C in PBS. For immunostaining, X-Gal stained sections were cut into coronal 14 μm sections with a cryostat microtome and mounted on gelatin-coated slides. Immunostaining was performed using anti-neurofilament 200 rabbit polyclonal antibody (Sigma, N-4142) or anti-glia fibrillary acidic protein (GFAP) rabbit polyclonal antibody (Santa Cruz Biochemistry, sc-6170) (Neurosci. Lett. 247, 135-138). (1998)). FIG. 3 shows that mouse Na _V 2 is expressed in specific neurons and ependymal cells in the central nervous system of growing individuals (see Reference Photo 2).

FIGS. 3a-e show lacZ expression in the central nervous system of Na _v 2 ^+/− mice and FIG. 3f shows na _v 2 ^{− / −} mice in the central nervous system. 3a, b, d, e, and f are obtained by cutting the brain of a fixed growing individual into a coronal shape, and FIG. 3c is a medium sagittal plane cut into 2 mm and stained with X-Gal. In FIG. 3c, the skull under the brain was not removed. In FIG. 3e, homozygous mutant mice were used for analysis to detect low level expression sites. In FIG. 3, AH: anterior hypothalamic area, MH: medial habenular nuleus, ME: median eminence, OVLT: endum organ (organum vasculosum laminae terminalis), MPO: Medial preoptic area, DMH: Dordordial hypothalamus, IPDM: Interpeduncular nucleus of the dorsomedial part, MMR: Medial partof the median raphe), NHP: neurohypophysis, SFO: subfornical organ, CX: cerebral cortex, BLA: basolateral amygdala. In FIG. 3c, OVLT was removed from the central nervous system and attached to the skull. A coronal semi-total brain is cut with a cryostat microtome to a thickness of 50 μm, and anti-neurofilament polyclonal antibody (FIGS. 3g and h), anti-GFAP polyclonal antibody (FIG. 3i), or cresyl violet (FIG. 3j). Stained. The brown signal is the site that reacted with the antibody. Samples are AH (Fig. 3g), SFO (Figs. 3h and i) and ME (Fig. 3j). Arrowheads indicate double positive neurons. The star in FIG. 3j indicates the third ventricle. The back is facing the top of the panel. The scale bar in FIGS. 3g-h is 30 μm and the scale bar in FIG. 3j is 100 μm.

As can be seen from FIG. 3, lacZ expression was found to be restricted to the following specific sites in the central nervous system (FIGS. 3a-f). That is, MPO, AH, DMH, IPDM, MMR, MeV, MH, ME, SFO, OVLT, and NHP. ME, SFO, OVLT and NHP are known as periventricular organs (CVO) and have a dense, highly permeable capillary network that promotes the secretion of substances into the blood and the entry of substances into the central tissues ( FASEB J, 7, 678-686 (1993)). While relatively weak lacZ expression was seen in CX and BLA in Na _V 2 ^+/− mice, lacZ expression at these sites in Na _V 2 ^{− / −} mice was more pronounced (FIG. 3f). To examine the cell type expressing lacZ, the brain was stained with X-Gal, cut into tissue sections with a cryostat microtome, and then immunostained with anti-neurofilament polyclonal antibody or anti-glia fibrillary acidic protein (GFAP) polyclonal antibody Rather, when cresyl violet staining was performed, the majority of lacZ expressing cells were positive for neurofilaments in MPO, AH (Figure 3g), IPDM, MMR, MH and MeV. Also, GFAP positive cells are negative for lacZ expression, indicating that astrocytes are negative for mouse Na _V 2.

  The distribution of lacZ expressing cells in CVO was particularly important, and lacZ expressing cells in ME lined up on the third ventricular floor (FIG. 3j). This distribution corresponds to the position of the ependymal cell without pili. These cells are considered to be tanisite, a special cell that connects between cerebrospinal fluid (CSF), nerve cells and blood vessels (Neuroscience 3,277-283 (1978)). These are thought to be involved in mass exchange between the CSF and the capillary peripheral space. lacZ positive cells were sparsely distributed throughout the SFO, most of which co-localized with the neurofilament (FIG. 3h) and negative for GFAP (FIG. 3i). LacZ-positive cells are concentrated and lined up throughout the third ventricle, suggesting that they are ependymal cells. NHP was densely stained with X-Gal. These seem to correspond to so-called pituitary cells (J. Exp. Biol. 139, 67-79 (1988)).

[Fos-immunohistochemistry]
Analysis of lacZ expression indicates that mouse Na _V 2 is expressed in four peribrain organs and several nuclei of the central nervous system, and that mouse Na _V 2 expressing cells are diverse not only in tissue distribution but also in cell type. As a result, it was difficult to determine the function and characteristics of the Na _V 2 channel, but it is thought that four peri-brain tissues are involved in fluid homeostasis (FASEB J 7,678 -686 (1993), Annu.Rev.Physiol.59,601-619 (1997), Physiol.Rev.78,583-686 (1997), Physiol.Rev.58,582-603 (1978), Ann.NY Acad.Sci, 877,258- 280 (1999)), assuming that the mouse Na _V 2 channel is functioning in sensory pathways with osmolarity of body fluid volume, the activity and gene expression of that channel in these organs is affected in mouse Na _V 2 mutant mice. It was supposed to receive. Therefore, how water starvation affects the central expression of Fos nucleoprotein, which is a marker of changes in neural activity according to extracellular fluid balance in mice and rats, was examined as follows.

Central pre-optica nucleus (MnPO), endplate organ (OVLT), subfornical organ (SFO), ventricular nucleus (PVN), and supraoptic nucleus (MnPO), cerebral optic nucleus, placed in water-filled and water-starved states SON) for Fos-immunopositive cell density changes (vs. time) in five regions (n = 4 per mouse Na _V 2 ^{+ / +} , n per mouse Na _V 2 ^{− / −).} = 4), 12-hour water-deficient mice (n = 5 and 5), 24-hour mice (n = 6 and 7), and 48-hour mice (n = 6 and 5). The mouse brain perfused with the fixative solution was immersed in the same fixative solution at 4 ° C. overnight, and then the brain was formed into a coronal slice having a thickness of 50 μm on a vibratome (Leica, VT1000S). Immunostaining was performed using a 1000-fold diluted PBS of anti-Fos goat polyclonal antibody (Santa Cruz Biochemistry, sc-52-G). Sections containing relevant regions were selected and Fos-immunopositive nuclei were counted. Each area was measured using an image analysis system (Axiophoto 2 with KS400). The number of nuclei per mm ² of the five regions of the brain was measured. The results are shown in FIG. 4 (see Reference Photo 3).

FIG. 4a is a typical image of end-plate organ (OVLT) -containing tissue sections of wild-type (+ / +) and null mutant (− / −) mice in a water-filled or 24-hour water-starved state. The scale bar indicates 200 μm. Also, FIG. 4b shows that per 1 mm ^{2 of the} subfornical organ (SFO), supraoptic nucleus (SON), nucleus accumbens nucleus (PVN), endplate organ (OVLT) and central prooptic nucleus (MnPO) in a water-starved state. The number (average) of Fos-immunopositive cells in the plot is plotted, and the vertical bar in FIG. E. The asterisk indicates that a significant difference (p <0.05) is observed between Na _V 2 ^{− / −} mice and Na _V 2 ^{+ / +} mice. Under water-sufficient conditions, Fos-immunopositive cells were not detected in any area tested. The number of cells with Fos-immunopositive nuclei under water starvation conditions 12, 24 and 48 hours was markedly increased in both Na _V 2 ^{− / −} mice and Na _V 2 ^{+ / +} mice. However, it was observed that the Fos-immunopositive nuclei in Na _V 2 ^{− / −} mice in SFO and OVLT increased 2-fold compared to Na _V 2 ^{+ / +} mice. There was no difference between groups in MnPO, PVN, and SON.

[Behavior analysis]
Next, the effect of mouse Na _V 2 channel deficiency on water and salt intake in mice was examined. Mutant mice were backcrossed to male C57BL / 6J for behavioral analysis. As a result, similar results were obtained with F1 mice and N4 mice. Preference-aversion behavior in homozygous, heterozygous, and wild-type littermates was measured by a 48-hour 2-bottle preference test. Mice selected distilled water and taste solution in their own cage for 48 hours. Male mice aged 12-24 weeks were used for all behavioral analysis. Mice were caged separately at constant room temperature, humidity and 12/12 hour light-dark cycle. The position of the two bottles was changed every 24 hours to avoid the influence of side preference. The total intake for each animal was measured, and the preference was calculated by the formula: preference rate = amount of taste solution (ml) / total intake of taste solution and water (ml). The results are shown in FIG. Figure 5a shows the results for graded saline solutions, and Figure 5b shows the results for three basic taste substances with fixed concentrations: homozygous (-/-), heterozygous (+/-), wild-type (+ / +) Used 5 mice. From FIG. 5a, the concentration sensitivity to salt did not change in the three groups under water and salt sufficiency conditions, all groups preferred 0.1M NaCl, and disgusted for concentrations of 0.3M or higher, It was found that the null mutant showed normal preference for various taste substances under conditions where water and salt were satisfied. FIG. 5b shows that there is no difference in palatability for sweet taste (0.5M sucrose), sour taste (0.01M HCl), and bitter taste (0.02M quinine hydrochloride).

[Electrophysiology]
To examine the normality of the null mutant taste response, an electrophysiological analysis of the chorda tympani nerve responsible for the NaCl taste was performed. Pentobarbital sodium (60 mg / kg) in 12-24 week old male mice (4 wild type mice and 5 homozygous mice for normal conditions; 3 mice and 5 mice for acute salt craving conditions) After intraperitoneal administration and deep anesthesia, each mouse was tracheotomized and fixed with a head holder. The chorda tympani was exposed and isolated from surrounding organs and cut at the entrance site of the bulla. The whole nerve bundle was cut and lifted onto a platinum wire recording electrode (0.1 mm diameter). A neutral electrode was attached to the nearby tissue. Neural activity was amplified, displayed on an oscilloscope, and monitored with an audio amplifier. The amplified signal was passed through an integrator with a time constant of 0.3 seconds and displayed on a slip chart recorder.

The taste solutions of 0.1M NH ₄ Cl, NaCl of 0.1M, 0.5M sucrose, 0.01 M of HCl, 0.02 M quinine hydrochloride (Q-HCl), KCl of 0.1M and 0 1M CH ₃ COONa (AcNa) was used. These solutions were made using distilled water and 0.1 mM amiloride solution. Each solution and wash water was applied to the front of the tongue at room temperature (25 ± 2 ° C.). The tongue was washed for at least 45 seconds between successive stimuli. Total neural response was measured as the height of the total response from the baseline 10 seconds after the start of stimulation. The results of recording responses in the chorda nerve to various taste stimuli are shown in FIG. In addition, FIG. 6b shows the intensity of the response to various taste stimuli when the response in the chorda tympani to 0.1M NH ₄ Cl is 1.

  The neurophysiological response to 0.02M quinine hydrochloride and 0.1M sodium acetate was the same strength between null mutant mice and wild type mice. Since the response to 0.1M NaCl and 0.1M sodium acetate was similarly reduced by amiloride in both groups, the amiloride-sensitive channel in the taste buds of mutant mice is judged to be functioning normally. Null mutants and wild type mice showed similar results under acute salt craving conditions. Considering these findings together with normal responses to various taste substances under water and salt-fulfilled conditions (FIG. 5), it can be seen that the null mutant taste receptors are not damaged.

In order to escape from hypertonic conditions under water starvation conditions, animals consume large amounts of water and avoid hypertonic saline. The preference for hypertonic saline (0.3 M NaCl) before and after 24-hour water starvation was then examined. Prior to testing, mice were trained for one week to drink water from two bottles. One day before water deficit, the selection of water and 0.3 M NaCl was given at 10:00 and the fluid intake was measured at 16:00. The next day at 10 o'clock, both bottles were removed and fed dry feed during the water starvation period. After 24 hours of water starvation, both bottles were returned and fluid intake was measured at 16:00. The results are shown in FIG. The null mutant showed abnormal intake of hypertonic saline in a deficient state. The preference rate for 0.3 M NaCl (FIG. 7a) and total intake (FIG. 7b) were measured before and after 24-hour water starvation. The n number (animal) in this experiment is 6 (+ / +), 6 (+/-), 6 (-/-). E. * Indicates that a significant difference (p <0.05) is observed between Na _V 2 ^{− / −} mice and Na _V 2 ^{+ / +} mice. Unlike wild-type and heterozygous mice that showed a clearly reduced preference for hypertonic saline after water starvation, null mutant mice had no change in preference rates (FIG. 7a). Total water intake (water plus 0.3 M NaCl) remained unchanged before and after 24-hour water starvation. Total water intake was more than 4 times after water starvation in all groups (Figure 7b).

In addition, blood before and after the water starvation treatment was collected by decapitation, and the plasma electrolyte concentration was measured by an electrolyte analyzer (9180, AVL Scientific, GA). Serum electrolyte concentrations before and after water starvation were normal in both wild-type and homozygous mice (n = 6 each). Na ⁺ concentration (mM) before water starvation treatment in wild-type and homozygous mice was 153.6 ± 0.6 and 153.0 ± 1.2, respectively, and K ⁺ concentration (mM) was 4.6 ± 0, respectively. 0.1 and 4.7 ± 0.1 and Cl ⁻ concentration (mM) were 118.5 ± 0.6 and 118.3 ± 0.9, respectively. The Na ⁺ concentration (mM) after the water starvation treatment was 151.6 ± 0.8 and 150 ± 0.3, respectively, and the K ⁺ concentration (mM) was 6.5 ± 0.2 and 6.7 ± 0, respectively. .2, Cl ⁻ concentration (mM) was 116.0 ± 1.0 and 116.4 ± 0.8, respectively. These data indicate that the null mutant immediately excretes excess sodium in the urine and normal kidney function.

  Furthermore, salt craving was induced by the method of intraperitoneal injection of furosemide, a diuretic, and the method of giving a salt-deficient diet, and a sodium deficiency treatment-induced salt craving test was conducted by the following method. Control measurements of water and 0.3M NaCl uptake were performed over several days prior to testing. At 10 o'clock, 0.12 ml normal saline (0.9% NaCl) was injected intraperitoneally into mice. The 0.3M NaCl bottle was removed and a sodium-deficient diet was given instead of a regular diet. At 16:00, a second injection of normal saline was given. On the next day, water and 0.3 M NaCl were given at 10:00, and intakes of water and 0.3 M NaCl were measured at 12:00, 14:00, and 16:00. The same mice were then tested with the same protocol by furosemide injection (containing 0.6 mg in 0.12 ml normal saline) and sodium deficient diet (acute salt craving state). Finally, the effect of a sodium-deficient diet was evaluated by a protocol that changed only the point of giving a normal sodium-containing diet. The results are shown in FIG.

In FIG. 8, the amount of ingested water and the amount of 0.3 M NaCl are shown as accumulated amounts every 2 hours. The upper part of FIG. 8 shows the result of combining a sodium-free diet with normal saline injection, the middle part of the result of combining sodium-free diet with furosemide injection, and the lower part of the combination of sodium-containing diet with furosemide injection. The results are shown as an average plot of accumulated total intake of 0.3 M NaCl (right side) and water (left side) every 2 hours immediately after the experimental treatment. In this experiment, n number (animal) is 10 (+ / +), 10 (+/−), 10 (− / −), and the vertical bar in FIG. E. * Indicates that a significant difference (p <0.05) was observed between Na _V 2 ^{− / −} mice and Na _V 2 ^{+ / +} mice. As can be seen from FIG. 8, the amount of water and 0.3 M NaCl ingested in the case of intraperitoneal injection of isotonic saline instead of furosemide (control test) was the same in all groups (upper graph). ). Under acute salt craving conditions induced by furosemide injection and sodium-deficient diet, the null mutant had approximately a 0.3-fold increase in NaCl intake compared to the wild-type and heterozygous types (middle right graph). . This abnormal hypertonic saline intake stopped when a sodium-containing diet was given (lower graph).

[Na _v 2 channel is a sodium concentration-dependent sodium channel]
It was confirmed by the following experiment that the Na _v 2 channel is a sodium concentration-dependent sodium channel. First, an anti-Na _v 2 antibody was prepared as follows. Hemocyanin was bound to a peptide consisting of the amino acid sequence (SVSETTVPIAGSEDIK; SEQ ID NO: 8) present in the interdomain 2-3 of rat Na _v 2 channel, white rabbits were immunized using this hemocyanin-binding peptide as an immunogen, Rat Na _v 2 rabbit antiserum was generated. The prepared antiserum was purified by a column on which the peptide used as an immunogen was immobilized, to obtain an anti-Na _v 2 antibody. The specificity of this anti-Na _v 2 antibody was confirmed by Western blot and immunohistochemical analysis. When purified anti-Na _v 2 antibody was used, nonspecific positive signals were not observed in brain, lung, dorsal root ganglia, and tongue sections prepared from gene-deficient mice.

Next, nerve cells of the dorsal root ganglion were isolated. Spinal dorsal root ganglia were prepared from 8-16 week old wild type mice and Na _v 2 gene deficient mice. Nerve cells were dispersed and isolated from dorsal root ganglia according to the method of Renganathan et al. (J Newrophysiol 84, 710-718 (2000)). Prior to use in ion imaging experiments, dispersed and isolated neurons were cultured under conditions of humidity 100%, temperature 37 ° C., 5% carbon dioxide, and adhered to the glass of the culture dish. By staining the nerve cells of the dorsal root ganglia derived from wild type mice with the anti-Na _v 2 antibody, it was confirmed that all the nerve cells were Na _v 2 positive. In addition, dispersed and isolated neurons can be small (25 microns or less in diameter: about 50%), medium (25 to 40 microns in diameter: about 40%), or large (40 microns or more in diameter: about 10%). However, the size, shape, and survival rate of these three cell types did not differ from those isolated from wild type mice or from gene-deficient mice. The survival rate was verified by trypan blue staining.

We also isolated neurons in the subfornical organ. Subfornical organs were prepared from 8-16 week old wild type mice and Na _v 2 gene deficient mice. Evans blue was previously injected intraperitoneally to visualize the subfornical organ. Dispersion of the subfornical organ was performed according to the method of Jurzak et al. (Brain Res 662, 198-208 (1994)). Dispersed and isolated nerve cells were cultured under conditions of 100% humidity, 37 ° C and 5% carbon dioxide, as in the case of nerve cells in the dorsal root ganglion, and adhered to the glass of the culture dish. Used for. When neurons of several subfornical organs derived from wild-type mice were stained with the anti-Na _v 2 antibody, Na _v 2 positive neurons were 20-30%. Note that there was no difference in size and survival rate between neurons isolated from wild-type mice and those isolated from gene-deficient mice.

Intracellular sodium ions and intracellular calcium ions were measured for nerve cells in the dorsal root ganglion and nerve cells in the subfornical organ prepared from the wild type mouse and the Na _v 2 gene deficient mouse. SBFI / AM (sodium-binding benzofuran isophthalate acetoxymethyl ester) was used for measurement of intracellular sodium ion, and Fura-2 / AM was used for measurement of intracellular calcium ion. The culture dish to which the cultured cells loaded with these indicators were attached was fixed on the microscope stage. The fluorescence ratio (F340 / F380) was monitored by a fluorescence imaging system. For data measurement, the nerve cells of the dorsal root ganglion were sampled every 10 seconds, and the neurons of the subfornical organ were sampled every 20 seconds. Prior to measurement, neurons were incubated with physiological isotonic solution (145 mM extracellular sodium concentration) for 30-60 minutes, during which time neurons were in constant reflux (5 mM KCl, 2.5 mM CaCl). _2. Exposed to 1 mM MgCl ₂ , 10 mM HEPES, 10 mM NaOH, a predetermined concentration of NaCl, pH 7.4 (neutralization with HCl), and the reflux solution (extracellular solution) is a constant flow rate (1 ml / min) at room temperature. Circulated at.

The fluorescence imaging results of the fluorescence ratio (F340 / F380) in nerve cells of the dorsal root ganglion are shown in FIG. 9 (see Reference Photo 4) and FIG. As can be seen from FIG. 9, when the extracellular NaCl concentration was increased to 145 to 170 mM, the intracellular sodium ion concentration of the nerve cells in the wild type mouse-derived spinal dorsal root ganglia rapidly increased and reached a steady state as it was. On the other hand, no increase in intracellular sodium ion concentration was observed in the nerve cells of the dorsal root ganglia derived from the gene-deficient mice (FIGS. 9a and b). Moreover, the increase in sodium in nerve cells of wild type mouse-derived dorsal root ganglia was observed in nerve cells of all sizes (FIG. 9c). This is consistent with the expression of Na _v 2 in neurons in the dorsal root ganglia of all wild type mice.

In addition, as can be seen from FIG. 10, the increase in intracellular sodium ion concentration is not caused by osmotic pressure stimulation using mannitol or chlorine ion alone stimulation using choline chloride, but by sodium ion alone using sodium methanesulfonate. Caused by stimulation (Figure 10a). Therefore, this phenomenon was found to be caused only by an increase in sodium ion concentration. In addition, using sodium chloride, the extracellular sodium concentration was adjusted to 10 levels of 120, 130, 140, 150, 160, 165, 170, 180, 190, and 200 mM, and changes in intracellular sodium ion concentration were analyzed. There was no reaction between 120 and 150 mM, an increase was observed at extracellular sodium ion concentrations of 160 and 165 mM, and a very large increase was observed at extracellular sodium ion concentrations of 170 mM and above (FIG. 10b). At this time, when extracellular sodium was returned to the original 145 mM, it was observed that the intracellular sodium concentration gradually returned to the original. Since there is no intracellular sodium store, it was concluded that this increase in intracellular sodium concentration was an influx from outside the cell via the Na _v 2 channel. Further, it can be inferred that the threshold value of the channel opening is between 160 and 170 mM.

In order to investigate the possibility that molecules other than the Na _v 2 channel are involved in the influx of sodium into the cells accompanying the increase in extracellular sodium ion concentration, various sodium ion pumps, sodium ion transporters, sodium ions We examined the effect of each blocker on the channel. As a result, there is no influence of TTX-sensitive voltage-dependent sodium channel (Fig. 10c), amiloride-sensitive sodium channel (Fig. 10c), sodium glucose cotransporter, sodium calcium antiporter, sodium potassium chloride transporter, sodium potassium pump. I understood. In addition, TTX-insensitive voltage-gated sodium channels are specifically expressed in small spinal dorsal root ganglion neurons, and are involved in this phenomenon, which is observed in all cell types. I concluded that I did not. Regarding sodium calcium antiporter, it was confirmed that there was no involvement by calcium imaging (FIG. 10d).

FIG. 11 (see Reference Photo 5) shows the fluorescence imaging results of the fluorescence ratio (F340 / F380) in neurons of the subfornical organ. As can be seen from FIG. 11, basically the same results as those of the spinal dorsal root ganglion were obtained in the neurons of the subfornical organ, which is the sodium ion concentration detection organ of the central nervous system. However, about 20 to 30% of neurons in the subfornical organ are Na _v 2 immunity positive cells, and these Na _v 2 immunity positive cells were observed to have an increased intracellular sodium ion concentration. In Na _v 2 immunonegative cells, as in the Na _v 2 gene-deficient mice, no increase in intracellular sodium ion concentration was observed. From these facts, it was proved that Na _v 2 is a sodium channel that allows sodium ions to flow into cells depending on the extracellular sodium ion concentration even in the subfornical organ. That is, Na _v 2 was found to be a novel sodium channel called a sodium concentration-dependent sodium channel.

Claims (1)

Use of any of the following proteins (a) to (c) as a sensor for extracellular Na ion level:
(A) a protein comprising the amino acid sequence shown in SEQ ID NO: 3 and acting as a sensor for Na ion level in brain neurons that monitor osmotic pressure in cerebrospinal fluid and blood:
(B) A brain nerve that comprises an amino acid sequence in which one or several amino acids are deleted, substituted, or added in the amino acid sequence shown in SEQ ID NO: 3, and that monitors osmotic pressure in cerebrospinal fluid and blood Protein that acts as a sensor for Na ion levels in cells: (c) stringent including hybridization at 65 ° C. and washing at 65 ° C. with a buffer containing 0.1 × SSC, 0.1% SDS In a brain neuron that is encoded by a DNA that hybridizes with a DNA consisting of a complementary sequence of the base sequence shown in SEQ ID NO: 2 and that monitors osmotic pressure in cerebrospinal fluid and blood under various conditions A protein that acts as a level sensor.

Images