JP4505511B2 - Recombinant swinepox virus - Google Patents

Description

  This application is a U.S. Patent Application No. 08 / 480,640 filed on June 7, 1995, a U.S. Patent Application No. 08 / 488,237 filed on June 7, 1995, and filed June 7, 1995. US patent application Ser. No. 08 / 472,679 filed and US patent application Ser. No. 08 / 375,992 filed Jan. 19, 1995. The contents of these parent applications are incorporated herein by reference as part of the present specification.

  Within this application, several publications are referenced by Arabic numerals in parentheses. Full bibliographic citations for these documents can be found at the end of the specification, ie immediately before the claims. The disclosures of these documents are incorporated herein by reference as part of the present specification.

Background of the Invention

  Swinepox virus (SPV) belongs to the Poxviridae family. Viruses belonging to this group are large double-stranded DNA viruses that develop characteristically in the cytoplasm of the host cell. SPV is the only member of the genus Suipoxvirus. SPV is distinguished from other polyviruses by several features. Compared to the broad host range of other poxviruses such as vaccinia, SPV shows species specificity (18). There is a dramatic difference between infecting tissue culture cell lines with SPV and other poxviruses (24). SPV shows no antigen cross-reactivity with vaccinia virus and no detectable overall homology at the DNA level with ortho, lepoli, avi, and insect pox groups (24). Therefore, what is known and described in the prior art for other poxviruses is not prior art for swinepox virus. SPV is the only mild pathogen characterized by a self-regulating infection with lesions that are detected only in the skin and local lymph nodes. Although SPV infection is very limited, it can be seen that pigs recovered from SPV are immune to SPV sensitization and have developed active immunity (18).

  The present invention relates to the use of SPV as a delivery vector for vaccine antigens and therapeutic agents for pigs. This principle is supported by the following characteristics of SPV. SPV is the only mild pathogen in pigs, is species specific and induces a protective immune response. Thus, SPV is an excellent candidate for a viral vector delivery system that has few inherent risks that must be balanced with the benefits afforded by the vector's vaccine and therapeutic attributes.

  The prior art of the present invention includes firstly the technique of DNA cloning and analysis in a bacterial plasmid. The technology used is detailed in the majority of Maniatis et al. 1983 and Sunblock et al. 1989. These documents teach the state of the art of general recombinant DNA techniques.

  Five of the poxviruses (vaccinia, poultry pox, canary pox, pigeon and raccoon pox) were engineered to contain foreign DNA sequences prior to this disclosure. Vaccinia virus has been used extensively as a vector for foreign genes (25), which is the subject of US Patents 4,603, 112 and 4,722,848. Similarly, poultry pox has been used as a vector for foreign genes, which is the subject of several patent applications, EPA 0 284 416, PCT WO89 / 03429, and PCT WO 89/12684. Raccoon pox (10) and canary pox (31) have been used to express antigens of rabies virus origin. Examples of foreign gene inserts inserted into poxviruses do not include examples from the genus Suipoxvirus. Thus, there is no teaching on how to genetically engineer swinepox virus, that is, where to insert it and how to obtain the expression in porcine pox.

  The idea of using live virus as an antigen delivery system has a very long history when going back to the first live virus vaccine. The delivered antigen was not foreign and was naturally expressed in the vaccine by the live virus. The use of viruses to deliver foreign antigens has now been facilitated by studies of recombinant vaccinia viruses. Vaccinia virus is a vector, various antigens from other diseases that cause infectivity are foreign antigens, and the vaccine is made by genetic engineering. While these disclosures have clarified these concepts, what has not been clarified was an answer to practical questions rather than what makes the best viral vector candidates. In answering this question, details of the pathogenicity of the virus, the site of replication, the type of immune response it induces, the possibility that the virus will express foreign antigens, the suitability of genetic engineering, and the potential for regulatory approval All the factors for selection. The prior art teaches nothing about these practical problems.

  Prior art involving the use of poxviruses to deliver therapeutic agents includes the use of vaccinia viruses that deliver interleukin 2 (12). In this case, although interleukin 2 showed an attenuated effect on vaccinia virus, no therapeutic effect in the host was demonstrated.

  The therapeutic agent delivered by the viral vector of the present invention must be a biological molecule, ie, a byproduct of porcine virus replication. Thus, the therapeutic agent is initially limited to DNA, RNA or protein. Examples of therapeutic agents derived from these compound classes include antisense DNA, antisense RNA (16), ribosome (34), suppressor tRNAs (2), and interferon-induced double-stranded RNA forms. Examples of protein therapeutic agents include hormones such as insulin, lymphokines such as interferon and interleukin, and natural anesthetics. The discovery of these therapeutic agents and elucidation of their structure and action do not facilitate the skill of using them in viral vector delivery systems.

Summary of the Invention

  The present invention relates to a recombinant swinepox virus comprising a foreign DNA sequence to be inserted into swinepox virus genomic DNA, wherein the foreign DNA is inserted into a Hind III N fragment of swinepox virus genomic DNA, and A recombinant swinepox virus that can be expressed in an infected host cell is provided.

  The invention further provides homology vectors, vaccines and methods of immunization.

Brief Description of Drawings
1A-1B:
A detailed view of SPV genomic DNA (kasza strain) containing the characteristic long terminal repeat (TR) region is shown. A restriction map is shown for the enzyme Hind III (23). Fragments are displayed in letters in order of decreasing size. The terminal repeat size is larger than 2.1 Kb but smaller than 9.7 Kb.

2A-2B:
The DNA sequence originating from homology vector 515-85.1 is shown. The sequences of the two regions of homology vector 515-85.1 are shown. The first region (FIG. 2A) (SEQ ID NO: 1) spans a 599 base pair sequence and a unique AccI site is flanked as shown in FIGS. 3A-3C. The beginning and end of the 115 amino acid ORF is indicated by the amino acid translations Met and Val below the DNA sequence. The second region (FIG. 2B) (SEQ ID NO: 3) spans 899 base pairs upstream of the characteristic HIind III site, as shown in FIGS. 3A-3C. The beginning and end of the 220 amino acid ORF is indicated by the amino acid translations Asp and Ile below the DNA sequence.

3A-3C:
5 shows the homology between 515-85.1 ORF and vaccinia virus 01LORF. In FIG. 3A, two maps are shown. The first line in FIG. 3A is a restriction map of the SPVHind III M fragment and the second line is a restriction map of the DNA insert in plasmid 515-85.1. The location of the 515-85.1 [VV 01L-like] ORF is also shown in the map. The positions of the DNA sequences shown in FIGS. 3B and 3C are indicated by thick bars below the map in FIG. 3A. FIG. 3B shows the homology between VV01LORF (SEQ ID NO: 5) and 515-85.1ORF (SEQ ID NO: 6) at their respective N-termini. FIG. 3C shows the homology between VV01LORF (SEQ ID NO: 7) and 515-85.1ORF (SEQ ID NO: 8) at their respective C-termini.
4A-4D
The DNA insert in homology vector 520-17.5 has been described. FIG. 4A contains a diagram showing the orientation of DNA fragments associated with plasmid 520-17.5 and a table showing the origin of each fragment. FIG. 4B shows the arrangement located at each of the junctions A and B between the fragments. FIG. 4C shows the sequences located at the junctions C and D (sequence recognition numbers 9, 10, 13 and 16). FIGS. 4B and 4C further describe for each ligation the synthetic linker sequences used to join the fragments as well as the restriction sites that generate each fragment. Synthetic linker sequences are underlined with thick bars. The position of the sequences encoding several genes, regulatory elements are also presented. The following two conventions were used. The numbers in parentheses () indicate amino acids, and the restriction sites in square brackets [] indicate the remainder of the site that was destroyed during construction. The following abbreviations are used: swinepox virus (SPV), early promoter (EP1), late promoter (LP2), lactose operon Z gene (lacZ) and E. coli.

5A-5D
The DNA insert at 538-46.16 in the homology vector has been described in detail. FIG. 5A contains a diagram showing the orientation of the DNA fragments associated with plasmid 538-46.16 and a table showing the origin of each fragment. FIG. 5B shows the sequence located at the junctions A and B between the fragments. FIG. 5C shows an array located at the connecting part C, and FIG. 5D shows an array located at the connecting parts D and E (sequence recognition numbers 17, 18, 21, 26 and 28). In FIGS. 5B-5D, the synthetic linker sequences used to join the fragments as well as the restriction sites used to generate each fragment are described for each linkage. The synthetic reinker sequence is underlined with a thick bar. The position of several genetic coding regions and regulatory elements are also given. The following two conventions are used. The numbers in () indicate amino acids, and the restriction sites in square brackets [] indicate the remainder of the sites that were destroyed during construction. The following abbreviations are used: swinepox virus (SPV), pseudorabies virus (PRV), g50 (gD), glycoprotein 63 (g63), early promoter (EP1), late promoter 1 (LP1) (sequence recognition) No. 46), late promoter 2 (LP2), lactose operon Z gene (lacZ), and E. coli.

Fig. 6
Western blot of lysates of cells infected with recombinant SPV with antisera to PRV. Lane (A) Uninfected Vero cell melt, (B) Melt of cells infected with S-PRV-000 (pseudo-rabies virus S62 / 26), (C) Stained molecular weight marker, (D) Uninfected EMSK cells Melt, (E) Melt of cells infected with S-SPV-000, (F) Melt of cells infected with S-SPV-003, (G) Melt of cells infected with S-SPV-008 . Cell lysates were prepared as described in “Preparation of infected cell melts”. Approximately 1/5 of the total melt sample was loaded in each lane.

Figure 7:
DNA sequence (HN) of NDV hemagglutinin neuramidase gene (SEQ ID NO: 29). The 1907 base pair sequence of the NDV HN cDNA coulomb is shown. The translation start / stop of the HN gene is indicated by amino acid translation below the DNA sequence.
8A-8D
The DNA insert in homology vector 538-46.26 has been described in detail. FIG. 5A contains a diagram showing the orientation of the DNA fragments associated with plasmid 538-46.26 and a table showing the origin of each fragment. FIG. 8B shows the sequence located at the junctions A and B between the fragments. FIG. 8C shows an array located at the connecting portions C and D, and FIG. 8D shows an array located at the connecting portion E (sequence recognition numbers 31, 32, 34, 37 and 40). In FIGS. 8B and 8D, the synthetic linker sequences used to join the fragments as well as the restriction sites used to generate each fragment are described for each linkage. The synthetic reinker sequence is underlined with a thick bar. The position of several genetic coding regions and regulatory elements are also given. The following two conventions are used. The numbers in () indicate amino acids, and the restriction sites in square brackets [] indicate the remainder of the sites that were destroyed during construction. The following abbreviations are used: swinepox virus (SPV), Newcastle disease virus (NDV), hemagglutinin neuramidase (HN), early promoter (EP1), late promoter 1 (LP1), late promoter 2 (LP2) , The lactose operon Z gene (lacZ), and E. coli.

9A-9C
The DNA inserts in swinepox virus S-SPV-010 and homology vector 561-36.26 have been described in detail. FIG. 9A contains a diagram showing the orientation of the DNA fragments associated with plasmid 561-36.26 and a table showing the origin of each fragment. FIG. 9B shows the sequences located at the junctions A and B between the fragments. FIG. 9C shows the sequences (sequence recognition numbers 47, 48, 49, 50) located in the connecting portions C and D. In FIGS. 9B and 9C, the synthetic linker sequences used to join the fragments as well as the restriction sites used to generate each fragment are described for each linkage. The position of several genetic coding regions and regulatory elements are also given. The following two conventions are used. The numbers in () indicate amino acids, and the restriction sites in square brackets [] indicate the remainder of the sites that were destroyed during construction. The following abbreviations are used: swinepox virus (SPV), E. coli, thymine kinase (TK), late promoter of pox synthesis 1 (LP1), base pair (BP).

10A-10D
The DNA inserts in swinepox virus S-SPV-011 and homology vector 570-91.21 have been described in detail. FIG. 10A contains a diagram showing the orientation of the DNA fragments associated with plasmid 570-91.21 and a table showing the origin of each fragment. FIG. 10B shows the sequence located at the junctions A and B between the fragments. FIG. 10C shows an array located at the connecting portion C, and FIG. 10D shows an array located at the connecting portions 10D and 10E (sequence recognition numbers 51, 52, 53, 54, 55).
In FIGS. 10B-10D, the synthetic linker sequences used to join the fragments as well as the restriction sites used to generate each fragment are described for each linkage. The position of several genetic coding regions and regulatory elements are also given. The following two conventions are used. The numbers in () indicate amino acids, and the restriction sites in square brackets [] indicate the remainder of the sites that were destroyed during construction. The following abbreviations are used: swinepox virus (SPV), pseudo-rabies virus (PRV), E. coli, late synthesis of pox promoter 1 (LP1), early promoter of pox synthesis 2 (EP2) (sequence recognition) No. 45), gIII (gC), base pair (BP).

11A-11D
The DNA inserts in swinepox virus S-SPV-012 and homology vector 570-91.41 have been described in detail. FIG. 11A contains a diagram showing the orientation of the DNA fragments associated with plasmid 570-91.41 and a table showing the origin of each fragment. FIG. 11B shows the sequence located at the junctions A and B between the fragments. FIG. 11C shows an arrangement located at the connecting portion C, and FIG. 11D shows an arrangement located at the connecting portions D and E (sequence recognition numbers 56, 57, 58, 59, 60).
In FIGS. 11B-11D, the synthetic linker sequences used to join the fragments as well as the restriction sites used to generate each fragment are described for each linkage. The position of several genetic coding regions and regulatory elements are also given. The following two conventions are used. The numbers in () indicate amino acids, and the restriction sites in square brackets [] indicate the remainder of the sites that were destroyed during construction. The following abbreviations are used: swinepox virus (SPV), pseudorabies virus (PRV), E. coli (E. coli), late promoter of pox synthesis 1 (LP1), early promoter of pox synthesis 1 late promoter 2 (EP1LP2) (Sequence recognition number 43), gIII (gC), base pair (BP).

Figures 12A-12D:
The DNA inserts in swinepox virus S-SPV-013 and the same vector 570-91.64 are described in detail. FIG. 12A contains a diagram showing the orientation of the DNA fragments associated with plasmid 570-91.64 and a table showing the origin of each fragment. FIG. 12B shows the sequence located at the junctions A and B between the fragments. FIG. 12C shows an array located at the connecting portion C, and FIG. 12D shows an array located at the connecting portions D and E (sequence recognition numbers 61, 62, 63, 64, 65). In 12B to 12D, the synthetic linker sequences used to join the fragments as well as the restriction sites used to generate each fragment are described for each linkage. The position of several genetic coding regions and regulatory elements are also given. The following two conventions are used. The numbers in () indicate amino acids, and the restriction sites in square brackets [] indicate the remainder of the sites that were destroyed during construction. The following abbreviations are used: swinepox virus (SPV), pseudorabies virus (PRV), E. coli (E. coli), late promoter of pox synthesis 1 (LP1), late promoter 2 of pox synthesis 2 early promoter 2 (LP2EP2) (Sequence recognition number 44), gIII (gC), base pair (BP).

13A-13D:
The DNA inserts in swinepox virus S-SPV-014 and the same vector 599-65.25 are described in detail. FIG. 13A includes a diagram showing the orientation of DNA fragments associated with plasmid 599-65.25 and a table showing the origin of each fragment. FIG. 13B shows the sequence located at the junctions A and B between the fragments. FIG. 13C shows an array located at the connecting portion C, and FIG. 13D shows an array located at the connecting portions D and E (sequence recognition numbers 66, 67, 68, 69, 70). In 13B to 13D, the synthetic linker sequences used to join the fragments as well as the restriction sites used to generate each fragment are described for each linkage. The position of several genetic coding regions and regulatory elements are also given. The following two conventions are used. The numbers in () indicate amino acids, and the restriction sites in square brackets [] indicate the remainder of the sites that were destroyed during construction. The following abbreviations are used: swinepox virus (SPV), infectious throat tracheitis virus (ILT), E. coli, late promoter of pox synthesis 1 (LP1), early promoter of pox synthesis 1 late promoter 2 (EP1LP2), glycoprotein G (gG), polymerase chain reaction (PCR), base pair (BP).

14A-14D
The DNA inserts in swinepox virus S-SPV-016 and vector 624-20.1C are described in detail. FIG. 14A contains a diagram showing the orientation of the DNA fragments associated with plasmid 624-20.1C and a table showing the origin of each fragment. FIG. 14B shows the sequence located at the junctions A and B between the fragments. FIG. 14C shows an arrangement located at the connecting portion C, and FIG. 14D shows an arrangement located at the connecting portions D and E (sequence recognition numbers 71, 72, 73, 74 and 75). In 14B to 14D, the synthetic linker sequences used to join the fragments as well as the restriction sites used to generate each fragment are described for each linkage. The position of several genetic coding regions and regulatory elements are also given. The following two conventions are used. The numbers in () indicate amino acids, and the restriction sites in square brackets [] indicate the remainder of the sites that were destroyed during construction. The following abbreviations are used: swinepox virus (SPV), infectious throat tracheitis virus (ILT), Escherichia coli (E. coli), late promoter of pox synthesis 1 (LP1), late promoter of pox synthesis 2 early promoter 2 (LP2EP2), glycoprotein I (gI), polymerase chain reaction (PCR), base pair (BP).
15A-15D
The DNA inserts in swinepox virus S-SPV-017 and homology vector 614-83.18 have been described in detail. FIG. 15A contains a diagram showing the orientation of the DNA fragments associated with plasmid 614--83.18 and a table showing the origin of each fragment. FIG. 15B shows the sequence located at the junctions A and B between the fragments. FIG. 15C shows an arrangement located at the connecting portion C, and FIG. 15D shows an arrangement located at the connecting portions D and E. In 15B to 15D, the synthetic linker sequences used to join the fragments as well as the restriction sites used to generate each fragment are described for each linkage. The position of several genetic coding regions and regulatory elements are also given. The following two conventions are used. The numbers in () indicate amino acids, and the restriction sites in square brackets [] indicate the remainder of the sites that were destroyed during construction. The following abbreviations are used: swinepox virus (SPV), infectious bovine rhinotracheitis virus (IBR), Escherichia coli (E. coli), late promoter of pox synthesis 1 (LP1), late promoter of pox synthesis 2 early promoter 2 (LP2EP2), glycoprotein G (gG), polymerase chain reaction (PCR), base pair (BP).

FIG.
Western blot with polyclonal goat anti-PRVgIII (gC) of a melt of cells infected with recombinant SPV. Lane (A) Melt of cells infected with S-PRV-002 (US Pat. No. 4,877,737, filed Oct. 31, 1989), (B) prestained molecular weight marker, (C) mock-infected EMSK cell melt, D) Melt of cells infected with S-SPV-003, (E) Melt of cells infected with S-SPV-008, (F) Melt of cells infected with S-SPV-011, (G) S -Melt of cells infected with SPV-012, (H) Melt of cells infected with S-SPV-013. Cell lysates were prepared as described in “Preparation of infected cell melts”. Approximately 1/5 of the total melt sample was loaded in each lane.

Figure 17:
Map showing 5.6 kilobase pair Hind III M swinepox virus genomic DNA fragment. An open reading frame (ORF) is shown along with the number of amino acid codes in each open reading frame. The swinepox virus ORFs show significant sequence identity with the vaccinia virus ORFs and are labeled according to the vaccinia virus nomenclature (56 and 58). I4LORF (SEQ ID NO: 196) shows amino acid sequence homology with a large unit of ribonucleotide reductase (57), and 01LORF (SEQ ID NO: 193) is characterized by a certain eukaryotic translational regulatory protein (13). Amino acid sequence homology to a typical leucine zipper motif. The BglII site in I4LORF and the AccI site in 01LORF are insertion sites for foreign DNA into non-essential regions of the porcine pox genome. Homology vector 738-94.4 contains a deletion of SPV DNA from nucleotides 1679 to 2452 (SEQ ID NO: 189). The black bar at the bottom indicates the region where the DNA sequence is known and shows SEQ ID NOs: 189 and 195. The positions of the restriction sites AccI, BglII, and HindIII are indicated. I3LORF (sequence recognition number 190), I2LORF (sequence recognition number 191), and E1OR ORF (sequence recognition number 194) are shown. Sequence recognition number 221 contains the complete 5785 base pair sequence of the Hind III M fragment. The open reading frames within the SPV HindIII M fragment are: partial I4LORF (445AA; nucleotides 2 to 1336); I3LORF (275AA; nucleotides 1387 to 2211); I2LORF (75AA; nucleotides 2215 to 2439); I1LORF (313AA; from nucleotide 2443) 3381); 01LORF (677AA; nucleotides 3520 to 5550); partial E1OR ORF (64AA; nucleotides 5787-5596).

18A-18D:
The DNA inserts in swinepox virus S-SPV-034 and homology vector 723-59A9.22 are described in detail. FIG. 18A includes a diagram showing the orientation of the DNA fragments associated with plasmid 723-59A9.22 and a table showing the origin of each fragment. FIG. 18B shows an arrangement located at the connecting portions A and B between the fragments, FIG. 18C shows an arrangement located at the connecting portion C, and FIG. 18D shows an arrangement located at the connecting portions D and E. Is shown. 18B-18D describe for each linkage the synthetic linker sequence used to join the fragments as well as the restriction sites used to generate each fragment. The position of several genetic coding regions and regulatory elements are also given. The following two conventions are used. The numbers in () indicate amino acids, and the restriction sites in square brackets [] indicate the remainder of the sites that were destroyed during construction. The following abbreviations are used: swinepox virus (SPV), equine influenza virus (EIV). E. coli, late promoter of pox synthesis 1 (LP1), late promoter of pox synthesis 2 early promoter 2 (LP2EP2), neuramidase (NA), Prague (PR), polymerase chain reaction (PCR), base pair (BP) .

19A-19D:
The DNA inserts in swinepox virus S-SPV-015 and homology vector 727-54.60 have been described in detail. FIG. 19A contains a diagram showing the orientation of the DNA fragments associated with plasmid 727-54.60 and a table showing the origin of each fragment. FIG. 19B shows an arrangement located at the connection parts A and B between the fragments, FIG. 19C shows an arrangement located at the connection part C, and FIG. 19D shows an arrangement located at the connection parts D and E. Is shown. In 19B to 19D, the synthetic linker sequences used to join the fragments as well as the restriction sites used to generate each fragment are described for each linkage. The position of several genetic coding regions and regulatory elements are also given. The following two conventions are used. The numbers in () indicate amino acids, and the restriction sites in square brackets [] indicate the remainder of the sites that were destroyed during construction. The following abbreviations are used: swinepox virus (SPV), pseudo-rabies (PRV), E. coli (E. coli), late promoter of pox synthesis 1 (LP1), late promoter of pox synthesis 2 early promoter 2 (LP2EP2), Glycoprotein B (gB), base pair (BP).

Figures 20A-20D:
The DNA inserts in swinepox virus S-SPV-031 and homology vector 727-67.18 have been described in detail. FIG. 20A contains a diagram showing the orientation of the DNA fragments associated with plasmid 727-67.18 and a table showing the origin of each fragment. FIG. 20B shows an arrangement located at the connecting portions A and B between the fragments, FIG. 20C shows an arrangement located at the connecting portion C, and FIG. 20D shows an arrangement located at the connecting portions D and E. Is shown. From 20B to 20D, the synthetic linker sequences used to join the fragments as well as the restriction sites used to generate each fragment are described for each linkage. The position of several genetic coding regions and regulatory elements are also given. The following two conventions are used. The numbers in () indicate amino acids, and the restriction sites in square brackets [] indicate the remainder of the sites that were destroyed during construction. The following abbreviations are used: swinepox virus (SPV), E. coli, late promoter of pox synthesis 1 (LP1), early promoter of pox synthesis 1 late promoter 2 (EP1LP2), antigen (Ag) base pair (BP).

Figures 21A-21D:
The DNA inserts in swinepox virus S-SPV-033 and homology vector 732-18.4 are described in detail. FIG. 21A contains a diagram showing the orientation of the DNA fragments associated with plasmid 732-18.4 and a table showing the origin of each fragment. FIG. 21B shows an arrangement located at the connecting portions A and B between the fragments, FIG. 21C shows an arrangement located at the connecting portion C, and FIG. 21D shows an arrangement located at the connecting portions D and E. Is shown. 21B to 21D describe, for each linkage, the synthetic linker sequence used to join the fragments as well as the restriction sites used to generate each fragment. The position of several genetic coding regions and regulatory elements are also given. The following two conventions are used. The numbers in () indicate amino acids, and the restriction sites in square brackets [] indicate the remainder of the sites that were destroyed during construction. The following abbreviations are used: swinepox virus (SPV), E. coli (E. coli), late promoter of pox synthesis 1 (LP1), late promoter of pox synthesis 2 early promoter 2 (LP2EP2), equine influenza virus (EIV) , Neuramidase (NA), Alaska (AK) polymerase chain reaction (PCR), base pair (BP).

22A-22C:
The DNA inserts in swinepox virus S-SPV-036 and homology vector 741-80.3 have been described in detail. FIG. 22A contains a diagram showing the orientation of the DNA fragments associated with plasmid 741-80.3 and a table showing the origin of each fragment. FIG. 22B shows an arrangement located at the connecting portions A, B, and C between the fragments, and FIG. 22C shows an arrangement located at the connecting portions D, E, and F. 22B and 22C describe for each linkage the synthetic linker sequences used to join the fragments as well as the restriction sites used to generate each fragment. The position of several genetic coding regions and regulatory elements are also given. The following two conventions are used. The numbers in () indicate amino acids, and the restriction sites in square brackets [] indicate the remainder of the sites that were destroyed during construction. The following abbreviations are used: swinepox virus (SPV), pseudorabies virus (PRV). E. coli, human cytomegalovirus immediate early (HCMVIE), pox synthesis late promoter 1 (LP1), pox synthesis late promoter 2 early promoter 2 (LP2EP2), polyadenylation site, base pair (BP).

Figures 23A-23D:
The DNA insert in swinepox virus S-SPV-035 and homology vector 741-84.14 has been described in detail. FIG. 23A contains a diagram showing the orientation of the DNA fragments associated with plasmid 741-84.14 and a table showing the origin of each fragment. FIG. 23B shows the arrangement at the junctions A and B between the fragments, FIG. 23C shows the arrangement located at the junction C, and FIG. 23D is located at the junctions D and E. An array is shown. In 23B to 23D, not only the restriction sites used to generate each fragment, but also the synthetic linker sequence used to join the fragments is described for each linkage. The position of several genetic coding regions and regulatory elements are also given. The following two conventions are used. The numbers in () indicate amino acids, and the restriction sites in square brackets [] indicate the remainder of the sites that were destroyed during construction. The following abbreviations are used: swinepox virus (SPV), pseudorabies virus (PRV). E. coli, late promoter of pox synthesis 1 (LP1), late promoter of pox synthesis 2 early promoter 2 (LP2EP2), interleukin-2 (IL-2), glycoprotein X (gX) polymerase chain reaction (PCR) , Sequence (seq), base pair (BP).

Figures 24A-24D:
The DNA insert in swinepox virus S-SPV-038 and homology vector 744-34. Is described in detail. FIG. 24A contains a diagram showing the orientation of the DNA fragments associated with plasmid 744-34 and a table showing the origin of each fragment. FIG. 24B shows the arrangement at the junctions A and B between the fragments, FIG. 24C shows the arrangement located at the junction C, and FIG. 24D is located at the junctions D and E. An array is shown. 24B and 24D describe for each linkage the synthetic linker sequence used to join the fragments as well as the restriction sites used to generate each fragment. The position of several genetic coding regions and regulatory elements are also given. The following two conventions are used. The numbers in () indicate amino acids, and the restriction sites in square brackets [] indicate the remainder of the sites that were destroyed during construction. The following abbreviations are used: swinepox virus (SPV), equine herpesvirus type 1 (EHV-1), E. coli, pox synthesis late promoter 1 (LP1), pox synthesis late promoter 2 early Promoter 2 (LP2EP2), glycoprotein B (gB), polymerase chain reaction (PCR), base pair (BP).

Figures 25A-25D:
The DNA inserts in swinepox virus S-SPV-039 and homology vector 744-38 have been described in detail. FIG. 25A contains a diagram showing the orientation of the DNA fragments associated with plasmid 744-38 and a table showing the origin of each fragment. FIG. 25B shows the arrangement at the junctions A and B between the fragments, FIG. 25C shows the arrangement located at the junction C, and FIG. 25D is located at the junctions D and E. An array is shown. From 25B to 25D, the synthetic linker sequences used to join the fragments as well as the restriction sites used to generate each fragment are described for each linkage. The position of several genetic coding regions and regulatory elements are also given. The following two conventions are used. The numbers in () indicate amino acids, and the restriction sites in square brackets [] indicate the remainder of the sites that were destroyed during construction. The following abbreviations are used: swinepox virus (SPV), equine herpesvirus type 1 (EHV-1), Escherichia coli (E. coli), late promoter of pox synthesis 1 (LP1), late promoter of pox synthesis 2 Promoter 2 (LP2EP2), glycoprotein D (gD), polymerase chain reaction (PCR), base pair (BP).

Figures 26A-26D:
Detailed description of DNA inserts in swinepox virus S-SPV-042 and homology vector 751-07A1. The figure shows the orientation of the DNA fragment associated with 751-07A1. The origin of each fragment is shown in the table. Also shown are sequences located at each of the junctions between the fragments. The synthetic linker sequences used to join the fragments as well as the restriction sites used to generate each fragment are described for each linkage. 26A to 26D show the connection between fragments A (sequence recognition number 197), (sequence recognition number 198) C (sequence recognition number 199), D (sequence recognition number 200) and E (sequence recognition number 201). The sequence located and the sequence located in the junction are shown. The position of several genetic coding regions and regulatory elements are also given. The following two conventions are used. The numbers in () indicate amino acids, and the restriction sites in square brackets [] indicate the remainder of the sites that were destroyed during construction. The following abbreviations are used: swinepox virus (SPV), chicken interferon (cIFN), E. coli (E. coli), late promoter of pox synthesis 1 (LP1), late promoter of pox synthesis 2 early promoter 2 (LP2EP2) , Polymerase chain reaction (PCR), base pair (BP).

Figures 27A-27D:
Detailed description of the DNA insert in swinepox virus S-SPV-043 and homology vector 751-56A1. The figure shows the orientation of the DNA fragment associated with plasmid 751-56A1. The origin of each fragment is shown in the table. Also shown are sequences located at each of the junctions between the fragments. 27A to 27D show the connection between fragments A (sequence recognition number 202), (sequence recognition number 203) C (sequence recognition number 204), D (sequence recognition number 205) and E (sequence recognition number 206). The sequence located and the sequence located in the junction are shown. Also provided are the synthetic linker sequences and regulatory elements used to join several genetic coding regions as well as the restriction sites used to generate each fragment. The following two conventions are used. The numbers in () indicate amino acids, and the restriction sites in square brackets [] indicate the remainder of the sites that were destroyed during construction. The following abbreviations are used: swinepox virus (SPV), chicken and myelomonocytic growth factor (cMGF), E. coli, pox synthesis late promoter 1 (LP1), pox synthesis late promoter 2 early Promoter 2 (LPE2EP2), polymerase chain reaction (PCR), base pair (BP).

Figures 28A-28D:
Detailed description of the DNA insert in swinepox virus S-SPV-043 and homology vector 752-22.1. The figure shows the orientation of the DNA fragment associated with plasmid 752-22.1. The origin of each fragment is shown in the table. Also shown are sequences located at each of the junctions between the fragments. 28A to 28D show the sequence and the junction located between the junctions A (sequence recognition number 207), (sequence recognition number 208) C (sequence recognition number 209), and D (sequence recognition number 210) between the fragments. The located sequence is shown. The synthetic linker sequences used to join the fragments as well as the restriction sites used to generate each fragment are described for each linkage. Several genetic coding regions and regulatory elements are also provided. The following two conventions are used. The numbers in () indicate amino acids, and the restriction sites in square brackets [] indicate the remainder of the sites that were destroyed during construction. The following abbreviations are used: swinepox virus (SPV), E. coli (E. coli), late promoter of pox synthesis 2 early promoter 2 (LP2EP2), polymerase chain reaction (PCR), base pair (BP).

Figures 29A-29B:
FIG. 29A: Restriction endonuclease map and open reading frame in SPV HindIII N fragment and part of SPV HindIIIM fragment. For insertion of foreign genes into non-essential sites of swinepox virus Hind III N and Hind III M genomic DNA, EcoR V site (S-SPV-060), SnaBI site (S-SPV-061), Hind III N There is a Bgl II site in (S-SPV-062) and a Bgl II site in Hind III M (S-SPV-047). Due to the insertion of foreign genes into I7LORF (SEQ ID NO: 230) and I4LORF (SEQ ID NO: 231), the entire open reading frame is non-essential for swinepox virus replication and optimal for insertion of foreign genes. Something is suggested. Other insertion sites for foreign genes include, but are not limited to, two Hind III sites and AvaI and BamHI.

FIG. 29B: Restriction endonuclease map and open reading frame in SPV HindIIIK fragment. An insertion of a foreign gene inserted into a non-essential site of swinepox virus Hind IIIK genomic DNA includes, but is not limited to, an EcoRI site (S-SPV-059). In the 3.2 kB region of the SPVHind IIIK fragment, three open reading frames are confirmed. The insertion of a foreign gene into B18RORF (SEQ ID NO: 228) suggests that the entire open reading frame is not essential for swinepox virus replication and is optimal for the insertion of foreign genes. Moreover, B4RORF (sequence recognition number 229) was confirmed as a foreign gene insertion site. SPVB18RORF is homologous to vaccinia virus (VV) B18RORF. SPVB18RORF is more homologous than the rabbit fibroma virus (RFV) 77.2 kd protein. SPVB4RORF is homologous to vaccinia virus (VV) B4RORF. SPVB4RORF is more homologous to the R5 rabbit fibroma virus (RFV) T5 protein. The confirmed open reading frame is within about 3200 base pairs of the SPVHindIII K fragment. The remaining approximately 3500 base pairs of the SPV Hind III K fragment have been sequenced previously (RF Massung et al. Virology 197, 511-528 (1993)).
Figures 30A-30C:
Detailed description of DNA inserts in swinepox virus S-SPV-047 and homology vector 779-94.31. The figure shows the orientation of the DNA fragment associated with plasmid 779-94.31. The origin of each fragment is shown in the table. Also shown are sequences located at each of the junctions between the fragments. FIGS. 30A to 30C show connections between fragments A (sequence recognition number :), (sequence recognition number :) C (sequence recognition number :), D (sequence recognition number :) and E (sequence recognition number :). The sequence located and the sequence located in the junction are shown. The synthetic linker sequences used to join the fragments as well as the restriction sites used to generate each fragment are described for each linkage. The position of several genetic coding regions and regulatory elements are also given. The following two conventions are used. The numbers in () indicate amino acids, and the restriction sites in square brackets [] indicate the remainder of the sites that were destroyed during construction. The following abbreviations are used: swinepox virus (SPV), pseudorabies (PRV), E. coli (E. coli), late promoter of pox synthesis 2 early promoter 2 (LP2EP2), late promoter of pox synthesis 1 (LP1), Base pair (BP).

Figures 31A-31D:
Detailed description of DNA inserts in swinepox virus S-SPV-052 and homology vector 789-41.7. The figure shows the orientation of the DNA fragment associated with plasmid 789-41.7. The origin of each fragment is shown in the table. Also shown are sequences located at each of the junctions between the fragments. 31A-31D shows the junctions A between fragments (sequence recognition number :), (sequence recognition number :) C (sequence recognition number :), D (sequence recognition number :), E (sequence recognition number :) and The sequence located at F (sequence recognition number :) and the sequence located at the junction are shown. The synthetic linker sequences used to join the fragments as well as the restriction sites used to generate each fragment are described for each linkage. The position of several genetic coding regions and regulatory elements are also given. The following two conventions are used. The numbers in () indicate amino acids, and the restriction sites in square brackets [] indicate the remainder of the sites that were destroyed during construction. The following abbreviations are used: swinepox virus (SPV), pseudo-rabies (PRV), Escherichia coli (E. coli), pox synthesis late promoter 2 early promoter 2 (LP2EP2), pox synthesis early promoter 1 late promoter 2 ( EP1LP2), late promoter of pox synthesis 1 (LP1), base pair (BP).

Figures 32A-32D:
Detailed description of DNA inserts in swinepox virus S-SPV-053 and homology vector 789-41.27. The figure shows the orientation of the DNA fragment associated with plasmid 789-41.27. The origin of each fragment is shown in the table. Also shown are sequences located at each of the junctions between the fragments. 32A-32D shows the connection part A (sequence recognition number :), (sequence recognition number :) C (sequence recognition number :), D (sequence recognition number :), E (sequence recognition number :) between fragments, A sequence located at F (sequence recognition number :) and G (sequence recognition number :) and a sequence located at the junction are shown. The synthetic linker sequences used to join the fragments as well as the restriction sites used to generate each fragment are described for each linkage. The position of several genetic coding regions and regulatory elements are also given. The following two conventions are used. The numbers in () indicate amino acids, and the restriction sites in square brackets [] indicate the remainder of the sites that were destroyed during construction. The following abbreviations are used: swinepox virus (SPV), pseudo-rabies (PRV), Escherichia coli (E. coli), pox synthesis late promoter 2 early promoter 2 (LP2EP2), pox synthesis early promoter 1 late promoter 2 ( EP1LP2), late promoter of pox synthesis 1 (LP1), base pair (BP).

Figures 33A-33D:
Detailed description of DNA inserts in swinepox virus S-SPV-054 and homology vector 789-41.47. The figure shows the orientation of the DNA fragment associated with plasmid 789-41.47. The origin of each fragment is shown in the table. Also shown are sequences located at each of the junctions between the fragments. 33A-33D shows the connection part A (sequence recognition number :), (sequence recognition number :) C (sequence recognition number :), D (sequence recognition number :), E (sequence recognition number :) between fragments, A sequence located at F (sequence recognition number :) and G (sequence recognition number :) and a sequence located at the junction are shown. The synthetic linker sequences used to join the fragments as well as the restriction sites used to generate each fragment are described for each linkage. The position of several genetic coding regions and regulatory elements are also given. The following two conventions are used. The numbers in () indicate amino acids, and the restriction sites in square brackets [] indicate the remainder of the sites that were destroyed during construction. The following abbreviations are used: swinepox virus (SPV), pseudorabies (PRV), E. coli (E. coli), early promoter of pox synthesis 1 late promoter 2 (EP1LP2), late promoter of pox synthesis 1 (LP1), Base pair (BP).

34A-34E:
Detailed description of DNA inserts in swinepox virus S-SPV-055 and homology vector 789-41.73. The figure shows the orientation of the DNA fragment associated with plasmid 789-41.73. The origin of each fragment is shown in the table. Also shown are sequences located at each of the junctions between the fragments. FIGS. 34A-34E show the connections between fragments A (sequence recognition number :), (sequence recognition number :) C (sequence recognition number :), D (sequence recognition number :), E (sequence recognition number :), F (Sequence recognition number :), sequences located at G (sequence recognition number :) and H (sequence recognition number :), and sequences located at the junction are shown. The synthetic linker sequences used to join the fragments as well as the restriction sites used to generate each fragment are described for each linkage. The position of several genetic coding regions and regulatory elements are also given. The following two conventions are used. The numbers in () indicate amino acids, and the restriction sites in square brackets [] indicate the remainder of the sites that were destroyed during construction. The following abbreviations are used: swinepox virus (SPV), pseudo-rabies (PRV), Escherichia coli (E. coli), pox synthesis late promoter 2 early promoter 2 (LP2EP2), pox synthesis early promoter 1 late promoter 2 ( EP1LP2), late promoter of pox synthesis 1 (LP1), base pair (BP).

Detailed Description of the Invention

  The present invention relates to a recombinant swinepox virus containing a foreign DNA sequence inserted into swinepox virus genomic DNA, wherein the foreign DNA sequence is inserted into a HindIIIK fragment of swinepox virus genomic DNA, Provided is a recombinant swinepox virus that can be expressed in a host cell infected with the virus.

  In one embodiment, the recombinant swinepox virus comprises the exogenous DNA inserted within the approximately 2 kB HindIII-BamHI subfragment in the HindIII N fragment of swinepox virus genomic DNA. In another embodiment, the foreign DNA sequence is inserted into an open reading frame within an approximately 2 Kb HindIII to BamHI subfragment in the HindIII N fragment of swinepox virus genomic DNA. In other embodiments, the open reading frame encodes the I7L gene.

  In another embodiment, the foreign DNA sequence is inserted into an EcoRV restriction endonuclease site within an approximately 2 kB HindIII to BamHI subfragment of swinepox virus genomic DNA. In another embodiment, the foreign DNA sequence is inserted into a SnaBI restriction endonuclease site within an approximately 2.0 kB HindIII to BamHI subfragment of swinepox virus genomic DNA.

  In another embodiment, the foreign DNA sequence is inserted within an approximately 1.2 Kb BamHI to HindIII subfragment in the HindIII N fragment of swinepox virus genomic DNA. In another embodiment, the foreign DNA sequence is inserted into an open reading frame within the approximately 1.2 kB BamHI to HindIII subfragment of the HindIII N fragment of swinepox virus genomic DNA. In other embodiments, the foreign DNA sequence is inserted into an open reading frame encoding the I4L gene. In another embodiment, the foreign DNA sequence is inserted into a BglII restriction endonuclease within the approximately 1.2 kB BamHI-HindIII subfragment of swinepox virus genomic DNA.

  The present invention relates to a recombinant swinepox virus comprising a foreign DNA sequence inserted into swinepox virus genomic DNA, wherein the foreign DNA sequence is inserted into a HindIII M fragment of swinepox virus genomic DNA, Provided is a recombinant swinepox virus that can be expressed in a host cell infected with a pox virus.

  In one embodiment, the recombinant swinepox virus has the foreign DNA sequence inserted within an approximately 2 Kb BglII-HindIII subfragment in the HindIII M fragment of swinepox virus genomic DNA. In another embodiment, the foreign DNA sequence is inserted into an open reading frame within an approximately 2 Kb BglII to HindIII subfragment of the HindIII M fragment of swinepox virus genomic DNA. In other embodiments, the open reading frame encodes an O1L gene. In a preferred embodiment, the foreign gene is inserted into a BglII restriction endonuclease site within an approximately 2 kB BglII-HindIII subfragment of swinepox virus genomic DNA.

  In another embodiment, the recombinant swinepox virus is inserted within the larger HindIII-BglII subfragment of approximately 3.6 kB in the HindIIIM fragment of swinepox virus genomic DNA. In another embodiment, the foreign sequence is inserted into an open reading frame within a larger HindIII to BglII subfragment of approximately 3.6 kB. In other embodiments, the open reading frame encodes the I4L gene.

  In one embodiment, the foreign DNA sequence is inserted within a nonessential open reading frame (ORF) of the HindIIIM fragment. Examples of ORFs include, but are not limited to I4L, I2L, O1L, and E10L.

  In another embodiment, the recombinant swinepox virus foreign DNA sequence is inserted within an approximately 2 Kb HindIII-BglII subfragment in the HindIII M fragment of swinepox virus genomic DNA. In a preferred embodiment, the foreign DNA sequence is inserted into a BglII site located within the approximately 2 Kb HindIII to BglII subfragment of swinepox virus genomic DNA.

  In another embodiment, the foreign DNA sequence is inserted within the larger HindIII-BglII subfragment in the HindIII M fragment of swinepox virus genomic DNA. In a preferred embodiment, the foreign DNA sequence is inserted into an AccI site located within the larger HindIII to BglII subfragment of swinepox virus genomic DNA.

  In another embodiment, the recombinant swinepox virus further comprises a foreign DNA sequence inserted into an open reading frame encoding swinepox virus thymidine kinase. In one embodiment, the foreign DNA sequence is inserted into an NdeI site located within an open reading frame encoding swinepox virus thymidine kinase.

  The present invention relates to a recombinant swinepox virus containing a foreign DNA sequence inserted into swinepox virus genomic DNA, wherein the foreign DNA sequence is inserted into a HindIIIK fragment of swinepox virus genomic DNA, A recombinant swinepox virus that can be expressed in a host cell infected with the virus is provided.

  In one embodiment, the foreign DNA sequence is inserted within an approximately 3.2 Kb subfragment in the HindIII K fragment of swinepox virus genomic DNA. In another embodiment, the foreign DNA sequence is inserted into an open reading frame within an approximately 3.2 Kb subfragment in the HindIII K fragment of swinepox virus genomic DNA. In other embodiments, the open reading frame encodes the B18R gene. In other embodiments, the open reading frame encodes a B4R gene.

  For the purposes of the present invention, “replicating recombinant swinepox virus” refers to recombination methods well known to those skilled in the art, for example, the methods described in Homologous recombination methods for making recombinant SPVs in the <Materials and Methods> section. It is a live swinepox virus that has been created and lacks the genetic material essential for the replication of recombinant swinepox virus.

  For purposes of the present invention, “an insertion site that is not essential for swinepox virus replication” refers to a position in the swinepox virus genome where the DNA sequence is not required for viral replication, eg, complex protein binding sequences, reverse transcription. Examples include sequences encoding enzymes or essential glycoproteins, DNA sequences necessary for packaging, and the like.

  For the purposes of the present invention, a “promoter” is a specific DNA sequence on a DNA molecule to which foreign RNA polymerase is attached where replication of the foreign RNA is initiated.

  For the purposes of the present invention, an “open reading frame” is a DNA segment that contains codons that are transcribed into RNA and translated into an amino acid sequence and that do not contain a stop codon.

  In addition, the present invention provides a recombinant swinepox virus (SPV) that can be replicated in an animal into which the recombinant swinepox virus is introduced, wherein the swinepox virus DNA and the animal into which the recombinant swinepox virus is introduced A recombinant swine that is inserted into the swinepox virus DNA at a site that is not essential for swinepox virus replication and that is under the control of a promoter.痘 Provide virus.

  The invention further provides a foreign DNA sequence or foreign RNA that encodes the polypeptide. Preferably the polypeptide is antigenic in the animal. Preferably, the antigenic polypeptide is a linear polymer in which more than 10 amino acids are joined by peptide bonds to stimulate the animal to produce antibodies.

  The present invention further provides a replicable recombinant swinepox virus containing a foreign DNA encoding a polypeptide that is a detection marker. Preferably, the detection marker is the polypeptide E. coli β-galactosidase or E. coli β-glucuronidase. Preferably, the insertion site for the foreign DNA encoding E. coli β-galactosidase is an AccI restriction endonuclease located within the HindIIIM fragment of swinepox virus DNA. Preferably, this recombinant swinepox virus is designated S-SPV-003 (ATCC accession number VR2335). This S-SPV-003 swinepox virus is in accordance with the Budapest Treaty on the International Approval of Deposits of Microorganisms in Patent Procedures under ATCC Receipt No. VR2335 under USC code 20852 Rockville, Maryland, Park Lane Drive 12301 Deposited at the American Type Culture Collection patent culture depository.

  For the purposes of the present invention, “polypeptide as a detection marker” includes dimers, trimers and tetramers in the form of polypeptides. E. coli β-galactosidase is a tetrahedron composed of four polypeptides or sub-monomeric subunits.

  The present invention further relates to a replicable recombinant swinepox virus, pseudorabies virus (PRV) glycoprotein 50 (gD), pseudorabies virus (PRV) gII (gB), pseudorabies virus (PRV) gIII (gC). , Pseudorabies virus (PRV) glycoprotein H, pseudorabies virus (PRV) glycoprotein E, hereditary gastroenteritis (TGE) glycoprotein 195, hereditary gastroenteritis (TGE) matrix protein, porcine rotavirus glycoprotein 38, swine Parvovirus capsid protein, Serpulina hydodysenteriae protective antigen, bovine viral diarrhea (BVD) glycoprotein 55, Newcastle disease virus (NDV) hemagglutinin-neuraminidase, swine flu hemagglutinin, or swine flu neuraminidase An antigenic polypeptide Tide, or to provide a recombinant swinepox virus containing the foreign DNA encoding an antigenic polypeptide derived therefrom. Preferably, the antigenic polypeptide is pseudorabies virus (PRV) glycoprotein 50 (gD). Preferably, the antigenic polypeptide is Newcastle disease virus (NDV) hemagglutinin-neuraminidase.

  The present invention further provides a recombinant swinepox virus that is replicable and contains a foreign DNA encoding pseudorabies virus (PRV) g50 (gD). This recombinant swinepox virus can be further processed to include foreign DNA encoding a detection marker such as E. coli β-galactosidase. A preferred site in the swinepox virus genome for inserting foreign DNA encoding PRVg50 (gD) and E. coli β-galactosidase is the AccI site in the HindIIIM fragment of swinepox virus DNA. Preferably, this recombinant swinepox virus is designated S-SPV-008 (ATCC accession number 2339). The S-SPV-008 swinepox virus is in accordance with the Budapest Treaty on the International Approval of Deposits of Microorganisms in Patent Procedures, under ATCC Accession Number VR2339, and in Parklone Drive 12301, Rockville, Maryland, USA Deposited at the American Type Culture Collection patent culture depository.

  The present invention further provides a replicable recombinant swinepox virus containing foreign DNA encoding pseudorabies virus (PRV) gIII (gC). This recombinant swinepox virus can be further processed to include foreign DNA encoding a detection marker such as E. coli β-galactosidase. A preferred site in the swinepox virus genome for inserting foreign DNA encoding PRVC and E. coli β-galactosidase is the AccI site in the HindIIIM fragment of swinepox virus DNA. Preferably, the recombinant swinepox virus is designated S-SPV-011, S-SPV-012, or S-SPV-013. The swinepox virus, designated S-SPV-013, was issued on June 16, 1993 in accordance with the Budapest Treaty on the International Approval of Deposits of Microorganisms in Patent Procedures under the United States Postal Code 20852 under ATCC Accession Number VR2418. Deposited at the American Type Culture Collection patent culture depository located at Park Lane Drive 12301, Rockville, Maryland.

  The present invention further provides a replicable recombinant swinepox virus containing foreign DNA encoding pseudorabies virus (PRV) gII (gB). This recombinant swinepox virus can be further processed to include foreign DNA encoding a detection marker such as E. coli β-galactosidase. A preferred site in the swinepox virus genome for inserting foreign DNA encoding PRV gII (gB) and E. coli β-galactosidase is the AccI site in the HindIIIM fragment of swinepox virus DNA. Preferably, the recombinant swinepox virus is designated S-SPV-015 (ATCC accession number VR2466). This S-SPV-015 swinepox virus was founded on July 22, 1994 in accordance with the Budapest Treaty on the International Approval of Deposits of Microorganisms in Patent Proceedings under ATCC Accession Number VR2466, United States ZIP Code 20852 Maryland Deposited at the American Type Culture Collection patent culture depository located at Rockville, Park Lane Drive 12301.

  The present invention further provides a replicable recombinant swinepox virus containing foreign DNA encoding pseudorabies virus (PRV) g50 (gD) and pseudorabies virus (PRV) gIII (gC). This recombinant swinepox virus can also be further processed to include foreign DNA encoding a detection marker such as E. coli β-galactosidase. The preferred site in the swinepox virus genome for inserting foreign DNA encoding PRVg50 (gD), PRVgIII (gC) and E. coli β-galactosidase is the AccI site in the HindIIIM fragment of swinepox virus DNA.

The present invention further provides a replicable recombinant swinepox virus containing foreign DNA encoding pseudorabies virus (PRV) g50 (gD) and pseudorabies virus (PRV) gII (gB). This recombinant swinepox virus can also be further processed to include foreign DNA encoding a detection marker such as E. coli β-galactosidase. A preferred site in the swinepox virus genome for inserting foreign DNA encoding PRVg50 (gD), PRVgII (gB) and E. coli β-galactosidase is the AccI site in the HindIIIM fragment of swinepox virus DNA. Furthermore, a replicable recombinant swinepox virus containing foreign DNA encoding pseudorabies virus (PRV) g50 (gC) and pseudorabies virus (PRV) gII (gB) is provided. This recombinant swinepox virus can also be further processed to include foreign DNA encoding a detection marker such as E. coli β-galactosidase. The preferred site in the swinepox virus genome for inserting foreign DNA encoding PRVgIII (gC), PRVgII (gB) and E. coli β-galactosidase is the AccI site in the HindIIIM fragment of swinepox virus DNA. In addition, a replicable recombinant swinepox virus containing foreign DNA encoding pseudorabies virus (PRV) g50 (gD), pseudorabies virus (PRV) gIII (gC) and pseudorabies virus (PRV) gII (gB) I will provide a. This recombinant swinepox virus can also be further processed to include foreign DNA encoding a detection marker such as E. coli β-galactosidase.

The preferred site in the swinepox virus genome for inserting foreign DNA encoding PRVg50 (gD), PRVgIII (gC), PRVgII (gB) and E. coli β-galactosidase is the AccI site in the HindIIIM fragment of swinepox virus DNA The present invention further comprises a replicable recombinant comprising a foreign DNA encoding an RNA encoding a Newcastle disease virus (NDV) hemagglutinin-neuraminidase and further including a foreign DNA encoding a polypeptide which is a detection marker. Provide swinepox virus. This recombinant swinepox virus is designated S-SPV-009 (ATCC accession number VR2344). This S-SPV-009 swinepox virus is in accordance with the Budapest Treaty on the International Approval of Deposits of Microorganisms for Patent Proceedings under ATCC Accession Number VR2344, and in Purlone Drive 12301, Rockville, Maryland, USA Deposited at the American Type Culture Collection patent culture depository.

  The present invention further relates to a recombinant swinepox virus containing a foreign DNA sequence inserted into a non-essential site of the swinepox virus genome, wherein the foreign DNA sequence contains an antigenic polypeptide derived from an infectious bovine rhinotracheitis virus. Provided is a recombinant swinepox virus that can be encoded and expressed in a host offspring infected with the recombinant swinepox virus. Examples of such antigenic polypeptides are infectious bovine rhinotracheitis virus glycoprotein E and glycoprotein G. A preferred embodiment of the present invention is the recombinant swinepox virus designated S-SPV-017 and S-SPV-019.

  The present invention further relates to a recombinant swinepox virus comprising a foreign DNA sequence inserted into a non-essential site of the swinepox virus genome, wherein the foreign DNA sequence encodes an antigenic polypeptide derived from an infectious pharyngeal tracheitis virus. And a recombinant swinepox virus that can be expressed in a host offspring infected with the recombinant swinepox virus. Examples of such antigenic polypeptides are infectious pharyngeal bronchitis virus glycoprotein G and glycoprotein I. A preferred embodiment of the present invention is the recombinant swinepox virus designated S-SPV-014 and S-SPV-016.

  In one embodiment of the recombinant swinepox virus, the foreign DNA sequence is a cytokine. In other embodiments, the cytokine is chicken bone marrow monocyte growth factor (cMGF) or chicken interferon (cIFN). Cytokines include, but are not limited to: transforming growth factor beta, fibroblast growth factor, hepatocyte growth factor, insulin-like growth factor, vascular endothelial growth factor, Leukin 1, IL-1 receptor antagonist, interleukin 2, interleukin 3, interleukin 4, interleukin 5, interleukin 6, IL-6 soluble receptor, interleukin 7, interleukin 8, interleukin 9, Interleukin 10, interleukin 11, interleukin 12, interleukin 13, angiogenin, chemokines, colony stimulating factor, granulocyte-macrophage colony stimulating factor, erythropoietin, interferon, interferon gamma, c-kit ligand , Neutrophil inhibitory factor, oncostatin M (oncostatin M), prioritization Toro pin (pleiotrophin), secretory blood cell protease inhibitor is a stem cell factor, tumor necrosis factor, and soluble TNF receptors. These cytokines are derived from humans, cows, horses, cats, dogs, pigs or birds. Preferred embodiments of such recombinant viruses are S-SPV-042 and S-SPV-043.

  The present invention further relates to a recombinant swinepox virus comprising a foreign DNA sequence inserted into a non-essential site of the swinepox virus genome, wherein the foreign DNA sequence encodes an antigenic polypeptide derived from a human pathogen, and Provided is a recombinant swinepox virus that can be expressed in a host offspring infected with swinepox virus.

  Recombinant SPVs that express cytokines are used alone or in combination with vaccines containing cytokines or antigen genes of disease-causing microorganisms to enhance immune responsiveness.

  Antigenic polypeptides of human pathogens derived from human herpesviruses include hepatitis B virus and hepatitis C virus, hepatitis B virus surface and core antigen, hepatitis C virus, human immunodeficiency virus, herpes simplex virus- 1. Herpes simplex virus-2, human cytomegalovirus, Epstein-Barr virus, varicella-zoster virus, human herpesvirus-6, human herpesvirus-7, human influenza, measles virus, hantaan virus ), Pneumonia virus, rhinovirus, poliovirus, human respiratory syncytial virus, retrovirus, human T cell leukocyte virus, rabies virus, mumps virus, malaria (Plasmodium falciparum), pertussis, diphtheria, rash typhoid rickettsia, borrelia Berufu burgdorferi (Borrelia berfdorferi), tetanus toxoid, but are malignant tumor antigen, the present invention is not limited to be this.

  In one embodiment of the invention, the recombinant swinepox virus includes a foreign DNA sequence encoding a hepatitis B virus core protein. Preferably, such a recombinant virus is designated S-SPV-031.

  The present invention further provides a recombinant swinepox virus comprising a foreign DNA sequence inserted at a non-essential site of the swinepox virus genome, wherein the foreign DNA sequence stimulates immunity in a host offspring infected with the recombinant swinepox virus. Provided is a recombinant swinepox virus that encodes a cytokine that can be expressed in a host infected with the recombinant swinepox virus.

  In one embodiment of the invention, the recombinant swinepox virus comprises a foreign DNA sequence encoding human interleukin-2. Preferably, such a recombinant virus is designated S-SPV-035.

  The present invention further includes a recombinant swinepox virus comprising a foreign DNA sequence inserted into a non-essential site of the swinepox virus genome, wherein the foreign DNA sequence encodes an antigenic polypeptide derived from an equine pathogen, Provided is a recombinant swinepox virus that can be expressed in a host infected with the recombinant swinepox virus.

  The antigenic polypeptide of an equine pathogen can be derived from equine influenza virus or equine herpesvirus. In one embodiment, the antigenic polypeptide is equine influenza neuraminidase or hemagglutinin. Examples of such antigenic polypeptides include equine influenza virus type A / Alaska 91 neuraminidase, equine influenza virus type A / plaque 56 neuraminidase, equine influenza virus type A / Miami 63 neuraminidase, equine influenza virus type A. / Kentucky 81 neuraminidase, equine influenza virus type A / Kentucky 92 neuraminidase, equine herpesinurus type 1 glycoprotein B, equine herpesinurus type 1 glycoprotein D, Streptocoddus equi, equine infectious anemia Viruses, equine encephalitis virus, equine rhinovirus, and equine rotavirus. Preferred embodiments of such recombinant swinepox viruses are those designated S-SPV-033, S-SPV-034, S-SPV-038, S-SPV-039 and S-SPV-041.

  Furthermore, the present invention provides an antigenic polypeptide. The antigenic polypeptide is derived from the group consisting of swine cholera virus gE1, swine cholera virus gE2, swine influenza virus hemagglutinin, neuraminidase, matrix and nucleoprotein, pseudorabies virus gB, gC and gD, and PRRS virus ORF7. Recombinant swinepox virus is included, but is not limited to these.

  The present invention is further a recombinant swinepox virus comprising a foreign DNA sequence inserted at a non-essential site of the swinepox virus genome, wherein the foreign DNA sequence is derived from bovine respiratory syncytial virus or bovine parainfluenza virus. Provided is a recombinant swinepox virus that encodes the antigenic polypeptide and can be expressed in a host infected with the recombinant swinepox virus.

  For example, the antigenic polypeptides described above include infectious bovine rhinotracheitis virus gE, bovine respiratory syncytial virus, equine pathogen, equine influenza virus, rodent respiratory syncytial virus adhesion protein (BRSV G), bovine respiratory syncytial Can be derived from thiavirus fusion protein (BRSV F), bovine respiratory syncytial virus nuclear capsid protein (BRSV N), bovine parainfluenza virus type 3 fusion protein and bovine parainfluenza virus type 3 hemagglutinin neuraminidase . In a preferred embodiment, the recombinant swinepox virus is designated S-SPV-045.

  Preferred embodiments of the recombinant virus comprising foreign DNA encoding an antigenic polypeptide derived from bovine respiratory syncytia virus are those designated S-SPV-020, S-SPV-029, and S-SPV-030. is there. Moreover, the preferable aspect of the recombinant virus containing the foreign DNA which codes the antigenic polypeptide derived from bovine parainfluenza virus is named S-SPV-028.

  The present invention further relates to a recombinant swinepox virus comprising a foreign DNA sequence inserted into a non-essential site of the swinepox virus genome, wherein the foreign DNA sequence is bovine viral diarrhea virus (BVDV) glycoprotein 48 or sugar. The foreign DNA sequence that encodes protein 53 also provides a recombinant swinepox virus that can be expressed in a host infected with the recombinant swinepox virus. Preferred embodiments of such viruses are those designated S-SPV-032, S-SPV-040, S-SPV-049, and S-SPV-050.

  The present invention further relates to a recombinant swinepox virus comprising a foreign DNA sequence inserted into a non-essential site of the swinepox virus genome, wherein the foreign DNA sequence comprises an antigenic polypeptide derived from an infectious cyst virus. The foreign DNA sequence that encodes and provides a recombinant swinepox virus that can be expressed in a host infected with the recombinant swinepox virus. Examples of such antigenic polypeptides are infectious cyst virus polyprotein and VP2. Preferred embodiments of such viruses are those designated S-SPV-026 and S-SPV-027.

The present invention further provides a recombinant swinepox virus containing a foreign DNA sequence inserted into a non-essential site of the swinepox virus genome, wherein the foreign DNA sequence encodes an antigenic polypeptide. Such antigenic polypeptides include, but are not limited to: MDV gA, MDV gB, MDV D, NDV HN, NDV F, ILT gB,
ILT gI, ILT gD, IBDV VP2, IBDV VP3,
IBDV VP4, IBDV polyprotein, IBV spike, IBV matrix, avian encephalomyelitis virus, avian reovirus, avian paramyxovirus, avian rotavirus, chicken anemia virus, Salmonella spp. Escherichia coli, Pasteurella spp. Bordetella pertussis spp. (Bordetella spp.), Eimeria spp. (Eimeria spp.), Histomonas ssp. Trichomonas ssp. Poultry nematodes, tapeworms, flukes, avian mites / lices, avian protozoa.

  The present invention further provides a recombinant swinepox virus in which the inserted foreign DNA sequence is under the control of a promoter. In one embodiment, the promoter is a swinepox virus promoter. In other embodiments, the foreign DNA sequence is under the control of an endogenous upstream swinepox virus promoter. In other embodiments, the foreign DNA sequence is under the control of a heterologous upstream promoter.

  For the purposes of the present invention, the promoter includes synthetic swinepox virus promoter, late pox synthesis promoter 1, late pox synthesis promoter 2, early promoter 2, pox 01L promoter, pox I4L promoter, pox I3L promoter, pox I2L promoter, pox I1L promoter, Pox E10R promoter, PRV gX, HSV-1 alpha 4, HCMV immediate early, MDV gA, MDV gB, MDV gD, ILT gB, BHV-1.1 VP8 and ILT gD It is not a thing. Other promoters are made by methods well known to those skilled in the art, for example, the methods described in “Basic Techniques for the Construction of Synthetic Poxvirus Promoters” in the Materials and Methods section.

  The present invention provides a homology vector for producing recombinant swinepox virus by inserting foreign DNA into swinepox virus genomic DNA.

  This homology vector comprises a double-stranded DNA molecule consisting of a substantially double-stranded foreign DN (RNA) sequence that is not inherently present in the animal into which the recombinant swinepox virus is introduced. One end of the double-stranded DNA has a double-stranded swinepox virus DNA that is homologous to the viral genome located on one side of the genomic DNA that is not essential for swinepox virus replication, and The other end has a double-stranded swinepox virus DNA that is homologous to the viral genome located on the other side of the swinepox virus genome. Preferably, the RNA encodes a polypeptide.

  In another embodiment of the invention, the double-stranded swinepox virus DNA of the homology vector is homologous to the genomic DNA present in the HindIIIM fragment. In another correspondence, the double-stranded swinepox virus DNA of the homology vector is homologous to the genomic DNA present in the approximately 2 kB HindIII to BglII subfragment. In a preferred embodiment, the double stranded swinepox virus DNA is homologous to the genomic DNA present in the BglII site located in this HindIII to BglII subfragment.

  In other embodiments, the double-stranded swinepox virus DNA is homologous to the genomic DNA present in the open reading frame contained in the larger HindIII to BglII subfragment. Preferably, the double stranded swinepox virus DNA is homologous to the genomic DNA present within the AccI restriction endonuclease site located in the larger HindIII to BglII subfragment.

  In preferred embodiments, the homology vectors have been named 752-29.33, 751-07.A1, 751-56.A1, 751-22.1, 746-94.1, 767-67.3, 738-94.4, and 771-55.11. Is.

  In one embodiment, the polypeptide is a detection marker. Preferably, the polypeptide that is a detection marker is E. coli β-galactosidase.

  In one embodiment, the polypeptide is antigenic in the animal. Preferably, the antigenic polypeptide is pseudorabies virus (PRV) glycoprotein 50 (gD), pseudorabies virus (PRV) gII (gB), pseudorabies virus (PRV) gIII (gC), pseudorabies virus (PRV) ) Glycoprotein H, hereditary gastroenteritis (TGE) glycoprotein 195, hereditary gastroenteritis (TGE) matrix protein, porcine rotavirus glycoprotein 38, porcine parvovirus capsid protein, Serpulina hydodysenteriae protective antigen, bovine Viral diarrhea (BVD) glycoprotein 55 and g48, Newcastle disease virus (NDV) hemagglutinin-neuraminidase, porcine flu hemagglutinin, or porcine flu neuraminidase, or derived therefrom. Preferably, the antigenic polypeptide is pseudorabies virus (PRV) glycoprotein 50 (gD). Preferably, the antigenic polypeptide is Serpulina Hyodysenteriae, foot-and-mouth disease virus, swine these viruses gE1 and gE2, swine influenza virus, African swine fever virus or Mycoplasma hyponumoniae, swine influenza virus erythrocyte Agglutinin, neuraminidase and matrix and nucleoprotein, PRRS virus ORF7, and hepatitis B virus nucleoprotein, or derived therefrom.

  In one embodiment of the invention, the double stranded foreign DNA sequence in the homology vector encodes an antigenic polypeptide derived from a human pathogen.

For example, human pathogen antigenic polypeptides include human herpesvirus, herpes simplex virus-1, herpes simplex virus-2, human cytomegalovirus, Epstein-Barr virus, varicella-zoster virus, human herpesvirus-6. , Human herpesvirus-7, human influenza, human immunodeficiency virus, rabies virus, measles virus, hepatitis B virus and hepatitis C virus. Furthermore, human pathogen antigenic polypeptides are:
It may be associated with malaria or malignancy selected from the group consisting of Plasmodium falciparum, Bordetelia pertussis and malignancy.

  In one embodiment of the invention, the double-stranded foreign DNA sequence in the homology vector encodes a cytokine capable of stimulating a human immune response. In one embodiment, the cytokine is chicken bone marrow monocyte growth factor (cMGF) or chicken interferon (cIFN). For example, the cytokine can be, but is not limited to, interleukin-2, interleukin-6, interleukin-12, interferon, granulocyte-macrophage colony stimulating factor, and interleukin receptor. Absent.

  In one embodiment of the invention, the double-stranded foreign DNA sequence in the homology vector encodes an antigenic polypeptide derived from an equine pathogen.

  The antigenic polypeptide of an equine pathogen can be derived from equine influenza virus or equine herpesvirus. Examples of such antigenic polypeptides include equine influenza virus type A / Alaska 91 neuraminidase, equine influenza virus type A / plaque 56 neuraminidase, equine influenza virus type A / Miami 63 neuraminidase, equine influenza virus type A. / Recombinant swinepox virus selected from the group consisting of Kentucky 81 neuraminidase, equine herpesvirus type 1 glycoprotein B, and equine herpesvirus type 1 glycoprotein D.

  In one embodiment of the invention, the double stranded foreign DNA sequence of the homology vector encodes bovine respiratory syncytial virus or bovine parainfluenza virus.

  For example, the antigenic polypeptide includes infectious bovine rhinotracheitis virus gE, bovine respiratory syncytial virus adhesion protein (BRSV G), bovine respiratory syncytial virus fusion protein (BRSV F), bovine respiratory syncytial virus Derived from nuclear capsid protein (BRSV N), bovine parainfluenza virus type 3 fusion protein, and bovine parainfluenza virus type 3 hemagglutinin neuraminidase.

  In one embodiment of the invention, the double-stranded foreign DNA sequence of the homology vector is derived from an infectious cyst virus. Examples of such antigenic polypeptides are infectious cyst virus viruses and infectious cyst viruses VP2, VP3 or VP4.

  For the purposes of the present invention, a “homology vector” is a plasmid constructed to insert foreign DNA at a specific site in the swinepox virus genome.

  In one embodiment of the invention, the double stranded swinepox virus DNA of the homology vector described above is homologous to the genomic DNA present in the open reading frame encoding swinepox thymidine kinase. Preferably, the double stranded swinepox virus DNA is homologous to the genomic DNA present in the NdeI restriction endonuclease located in the open reading frame encoding swinepox thymidine kinase.

  The present invention further provides a homology vector as described above, wherein the foreign DNA sequence is under the control of a promoter located upstream of the foreign DNA sequence. The promoter can be an endogenous swinepox virus promoter or an exogenous promoter. Promoters include synthetic poxvirus promoter, pox synthesis late promoter 1, pox synthesis late promoter 2, early promoter 2, pox 01L promoter, pox I4L promoter, pox I3L promoter, pox I2L promoter, pox I1L promoter and pox E10R promoter, PRV gX HSV-1, alpha4, HCMV immediate type, BHV-1.1 VP8, infectious pharyngeal tracheitis virus glycoprotein B, infectious pharyngeal tracheitis virus gD, Marek's disease virus glycoprotein A, Marek's disease virus glycoprotein B, Marek's disease virus glycoprotein D is included, but is not limited thereto.

  The present invention relates to S-SPV-044, S-SPV-046, S-SPV-047, S-SPV-048, S-SPV-052, S-SPV-051, S-SPV-053, S-SPV- 054, S-SPV-055, S-SPV-056, S-SPV-057, S-SPV-058, S-SPV-059, S-SPV-066, S-SPV-061, S-SPV-062 Provide the designated recombinant swinepox virus.

  The present invention further provides a vaccine comprising an effective immunizing amount of the recombinant swinepox virus of the present invention and a suitable carrier.

  Suitable carriers for swinepox virus are well known in the art and include proteins, sugars and the like. One example of such a suitable carrier is a physiologically balanced culture medium that contains one or more stable households such as stabilized hydrolyzed proteins, lactose, and the like.

For purposes of the present invention, an “effective immunizing amount” of the recombinant swinepox virus of the present invention is in the range of 10 ³ to 10 ⁹ PFU / dose.

  The invention also provides a method of immunizing an animal, wherein the animal is a human, a pig, a cow, a caprine or an ovine. For purposes of the present invention, the method includes immunizing an animal against the disease-causing virus (s), which include pseudorabies, hereditary gastroenteritis ( TGE) virus, porcine rotavirus, porcine parvovirus, Serpulina hydodysenteriae, bovine viral diarrhea (BVD) virus, Newcastle disease virus (NDV), swine influenza virus, PRRS, bovine respiratory syncytial virus , Bovine parainfluenza virus type 3, foot-and-mouth disease virus, swine fever virus, African swine fever virus or mycoplasma hypoponnier. For the purposes of the present invention, this immunization method also includes immunizing animals against human, bovine, equine and avian pathogens.

  This method includes administering to the animal an effective immunizing dose of a vaccine of the present invention. The vaccine may be administered by any method known to those skilled in the art, for example, intramuscular injection, subcutaneous injection, sub-intra-injection or intravenous injection. Alternatively, the vaccine may be administered intranasally or orally.

  The present invention also relates to whether pigs have been vaccinated with an embodiment containing a vaccine of the present invention, in particular a recombinant swinepox virus S-SPV-008 (ATCC accession number VR2339), or a naturally occurring wild-type pseudonym. Provide a way to test pigs to determine if they are infected with rabies virus. This method obtains a sample of the appropriate body fluid from the pig to be tested and detects the presence of antibodies against pseudorabies virus in the sample (the absence of such antibodies causes the pig to vaccinate And in pigs that have antibodies against pseudorabies virus, in the sample, they are usually present in the bodily fluids of pigs infected with naturally occurring pseudorabies virus. Detecting that the antibody against the pseudorabies virus antigen not present in the vaccinated pig is not present, indicating that the pig has been vaccinated or not infected. To do.

  The present invention provides a recombinant SPV that can be used as a diagnostic test when inserted with a foreign DNA sequence or gene. In one embodiment, the FIVenv and gag genes, and D. Immitis p39 and 22 kd detect feline immunodeficiency caused by FIV, and Used in diagnostic tests to detect dog filamentous worms caused by imimitis.

  The invention also provides host cells infected with a recombinant swinepox virus capable of replication. In one embodiment, the host cell is a mammalian cell. Preferably, the mammalian cell is a Vero cell. Preferably, the mammalian cell is an ESK-4 cell, a PK-15 cell or an EMSK cell.

  For the purposes of the present invention, a “host cell” is a cell used to propagate a vector and its insert. Infection of harmful cells was achieved by methods well known to those skilled in the art, for example, the method described in “Infection-Transfection Method” in <Materials and Methods>.

  Methods for constructing, selecting and purifying the above recombinant swinepox virus are detailed in the <Materials and Methods> section below.

Experimental details

<Materials and methods>
Preparation of swinepox virus stock sample The swinepox virus (SPV) sample contains Iscove's Modified Dulbecco's Medium (IMDM), 2 mM glutamine, 100 units / ml penicillin, 100 units / ml streptomycin. Porcine fetal kidney (EMSK) cells, ESK in a 1: 1 mixture of RPMI 1640 medium (these components are obtained from Sigma or equivalent sources and are hereinafter referred to as EMSK negative medium) -4 cells, PK-15 cells or Vero cells were prepared by infecting at a multiplicity of infection of 0.01 PFU / cell. Prior to infection, the cell monolayer was washed once with EMSK negative medium to remove traces of fetal calf serum. The SPV contained in the initial inoculum (0.5 ml for 10 cm plates; 10 ml for T175 cm flasks) is then redistributed every 30 minutes while the cells are isolated for 2 hours. Absorbed into the layer. After this period, the first inoculum was supplemented with complete EMSK medium (EMSK negative medium with 5% fetal calf serum) to the recommended volume. Plates were incubated at 37 ° C. in 5% CO ₂ until the cytopathic effect was complete. Media and cells were harvested and frozen at -70 ° C in a 50 ml conical screw cap tube. Once thawed at 37 ° C, the virus stock was aliquoted into 1.0 ml vials and refrozen at -70 ° C. The titer was usually about 106 PFU / ml.

Preparation of SPV DNA To isolate swinepox virus DNA, confluent EMSK cell monolayers in T175 cm2 flasks were infected at a multiplicity of 0.1 and 4 to 6 until the cells were 100% cytopathic. Incubated for hours. Infected cells were then scraped off into the medium and recovered by centrifugation at 300 rpm for 5 minutes in a clinical centrifuge. The medium is transferred to a separate container and the cell pellet is 1.0 ml phosphate buffer solution (PBS: 1.5 g disodium phosphate, 0.2 g potassium dihydrogen phosphate, 0.8 g sodium chloride and 0.2 g in 1 liter of water. Of potassium chloride) (per T175) and gently subjected to two freeze-thaw treatments (from -70 ° C to 37 ° C). During the final thawing, the cells (on ice) were sonicated twice for 30 seconds, with a 45 second cooling time between the first and second time. Thereafter, cell debris was removed by centrifugation (Sorvall RC-5B superspeed centrifuge) at 4 ° C and 3000 rpm for 5 minutes using an HB4 rotor. The SPV virions present in the supernatant are then pelleted by centrifugation at 15,000 rpm for 20 minutes at 4 ° C in an SS34 rotor (Sorvall) and in 10 mM Tris (pH 7.5). Resuspended. This fraction was then layered into a 36% sucrose density gradient (w / v in 10 mM Tris pH 7.5) and centrifuged at 18,000 rpm for 60 minutes at 4 ° C in a SW41 rotor (Beckman) (Beckman). L8-70M ultracentrifuge) (Beckman L8-70M ultracentrifuge). The virus particle pellet was resuspended in 10 mM Tris buffer pH 7.5 and sonicated on ice for 30 seconds. This fraction was layered with a continuous sucrose gradient of 20% to 50% and centrifuged at 16,000 rpm for 60 minutes at 4 ° C with a SW41 rotor. A band of SPV virus particles located approximately 3/4 below the gradient was recovered, diluted with 20% sucrose solution, and pelleted by centrifugation at 18,000 rpm for 60 minutes at 4 ° C in a SW41 rotor. . The resulting pellet was then washed once with 10 mM Tris buffer solution pH 7.5 to remove traces of sucrose and finally resuspended in 10 mM Tris buffer solution pH 7.5. . Subsequently, virus particles purified by lysis (60 ° C, 4 hours) induced by adding EDTA, SDS and proteinase K to final concentrations of 20 mM, 0.5% and 0.5 mg / ml respectively. SPV DNA was extracted. After digestion, phenol: chloroform (1: 1) extraction was performed three times, and the sample was precipitated by addition of 2 volumes of 100% ethanol and incubation at -20 ° C for 30 minutes. The sample was then centrifuged at full speed for 5 minutes in an eppendorf minifuge. The supernatant was transferred to another container, the pellet was air-dried and rehydrated in 0.01 M Tris buffer pH 7.5 containing 1 mM EDTA at 4 ° C.

Preparation of infected cell lysates For the preparation of cell lysates, medium without serum was used. Confluent cell monolayers (EMSK, ESK-4, PK-15 or Vero for SPV or VERO for PRV) were infected with 100 μl of virus sample in a 25 cm2 flask or 60 mm Petri dish . After the cytopathic effect was complete, media and cells were collected and the cells were pelleted by clinical centrifuge at 3000 rpm for 5 minutes. The cell pellet was resuspended in 250 μl disruption buffer (2% sodium dodecyl sulfate, 2% β-mercaptoethanol). Samples were sonicated for 30 seconds on ice and stored at -20 ° C.

Western blotting cell lysate samples and standard proteins were run on polyacrylamide gels according to the method of Laemnli (1970). After gel electrophoresis, the protein was denatured and processed according to the method of Sambrook et al. (1982). The primary antibody was 5 in Tris sodium chloride and sodium azide (TSA: containing 6.61 g Tris hydrochloric acid, 0.97 g Tris base, 9.0 g sodium chloride and 2.0 g sodium azide in 1 liter of water). It was porcine anti-PRV serum (Shope strain; lot370, PDV8201, NVSL, Ames, IA) diluted 1: 100 with non-fat dry milk. The secondary antibody was a goat anti-swine alkaline phosphatase conjugate diluted 1: 1000 with TSA.

Molecular Biology Methods Digestion with restriction endonucleases, gel electrophoresis, DNA extraction from gels, ligation, phosphorylation with kinases, treatment with phosphatases, growth of bacterial cultures, growth of bacteria using DNA Techniques for manipulation of bacteria and DNA, including transformation methods, and other molecular biological methods are shown by Maniatis et al. (1982) and Sambrook et al. (1989). Has been. As an exception, these methods have been modified slightly.

DNA sequencing Sequencing was performed using the USB Sequenase Kit and 35S-dATP (NEN). Reactions using both dGTP and dITP mixtures were performed to elucidate the areas of compression. Alternatively, compressed areas were analyzed with formamide gel. Templates were double-stranded plasmid subclones or single-strand M13 subclones, and primers were generated for the vector just outside the insert to be sequenced or for the previously obtained sequence. The resulting sequences were edited and compared using Dnastar software. Handling and comparison of the obtained sequences were performed using Superclone ™ and Supersee ™ programs from Coral Software.

Cloning Using the Polymerase Chain Reaction The Polymerase Chain Reaction (PCR) was used to introduce restriction (enzyme) sites that are convenient for the production of various DNAs. The method used is shown by Innis, et al. (1990). In general, the amplified fragment is smaller than 500 base pairs in size, and the critical region of the amplified fragment is confirmed by DNA sequencing. The primers used in each case are described in detail in the description of homology vector construction below.

Homologous Recombination Prodecure for Recombinant SPV Generation
This method relies on homologous recombination between swinepox virus DNA and plasmid homologous vector DNA generated in tissue culture cells containing both swinepox virus DNA and the transfected plasmid homology vector. To cause homologous recombination, EMSK cell monolayers are capable of inducing SPV replication (ie DNA synthesis) into these cells with a multiplicity of infection of 0.01 PFU / cell (S-SPV-001). , 17) Infected with (Kasza SPV strain, 17). The plasmid homology vector DNA is then transfected into these cells according to the Infection-Transfected Procedure. The construction of the homology vector used in this method is shown below.

Infection-Transfection method
A 6 cm plate of EMSK cells (concentration approximately 80%) was infected with S-SPV-001 at a multiplicity of infection of 0.01 PFU / cell in EMSK negative medium, and in a humid environment with a CO ₂ concentration of 5%. Incubated at 37 ° C for 5 hours. The transfection method used is basically the method shown in the instructions for use of Lipofectin ™ Reagent (BRL). Briefly, for each 6 cm plate, 15 μg of plasmid DNA was diluted to 100 μl with water. Separately, 50 μg of lipofectin reagent was diluted to 100 μl with water. Thereafter, 100 μl of diluted lipofectin reagent was added dropwise to the diluted plasmid DNA in a 5 ml snap-cap test tube made of polystyrene and mixed gently. The mixture was then incubated for 15-20 minutes at room temperature. During this time, the virus inoculum was removed from the 6 cm plate and the cell monolayer was washed once with EMSK negative media. Subsequently, 3 ml of EMSK negative medium was added to the plasmid DNA / lipofectin mixture and its contents were pipetted onto the cell monolayer. The cells were incubated overnight (about 16 hours) at 37 ° C. in a humidified environment with a CO ₂ concentration of 5%. The next day, 3 ml of EMSK negative medium was removed and replaced with 5 ml of EMSK complete medium. Cells were incubated for 3-7 days at 37 ° C with 5% CO ₂ concentration until the cytopathic effect of the virus was reduced from 80% to 100%. Virus was recovered as described above in virus stock preparation. This stock is called the transfection stock, and the detection of the recombinant virus is subsequently carried out by the Bluogal Screen for detection of the recombinant swinepox virus or the CPRG screen for detection of the recombinant swinepox virus (CPRG Screen). Was made.

Detection of recombinant SPV expressing β-galactosidase (Screen)
(Bluogal and CPRG analysis)
When the recombinant virus incorporated the E. coli β-galactosidase (lacZ) marker gene, the plaques containing the recombinant were visualized by one of two simple methods. . In the first method, during the plaque analysis, the Bluogal ™ reagent (Bethesda Research Labs) was incorporated into the agarose overlay (200 μg / ml) to express β-galactosidase activity. Plaques that turn blue. Blue plaques were then picked on new cells (EMSK) and purified by further isolation of blue plaques. In the second method, CPRG (Boehringer Mannheim) is incorporated into the agarose overlay (400 μg / ml) and plaques expressing β-galactosidase activity turn red during plaque analysis . Red plaques were then picked on new cells (EMSK) and purified by further isolation of red plaques. In both cases, the virus was typically purified with three rounds of plaque purification.

Using Black Plaque Assays
Detection of foreign gene expression in recombinant SPV (screen)
To analyze the expression of foreign antigens expressed by recombinant swinepox virus, EMSK cell monolayers were infected with recombinant SPV, overlaid on agarose nutrient medium, and 37 ° C until plaque development occurred Incubated for 6 to 7 days. The agarose overlay was then removed from the petri dish and the cells were fixed with 100% methanol for 10 minutes at room temperature and air dried. Cytoplasmic antigens can be detected as well as surface antigens by cell fixation, but expression of specific surface antigens can be detected by using unfixed cells. Thereafter, the primary antibody was diluted to an appropriate dilution factor with PBS and incubated on the cell monolayer at room temperature for 2 hours. To detect the expression of PRV g50 (gD) from S-SPV-008, swine anti-PRV serum (Shoop strain; lot 370, PDV8201, NVSL, Ames, IA) (shope strain; lot370, PDV8201, NVSL, Ames , IA) was used (1: 100 dilution). To detect the expression of NDV HN from S-SPV-009, rabbit anti-serum (rabbit anti-NDV # 2) specific for HN protein was used (1: 1000 dilution). Unbound antibody was then removed by washing the cells 3 times at room temperature with PBS. As a secondary antibody, a conjugate of either goat anti-pig (PRV g50 (gD); S-SPV-008) or goat anti-rabbit (NDV HN; S-SPV-009) and horseradish peroxidase was used as PBS. Diluted 1: 250 and incubated with cells for 2 hours at room temperature. Subsequently, unbound secondary antibody was removed by washing the cells three times at room temperature with PBS. The cells are then placed at room temperature with a freshly prepared substrate solution (100 μg / ml 4-chloro-1-naphthol, 0.003% hydrogen peroxide in PBS). Incubated for 15 to 30 minutes. Plaques expressing the correct antigenicity are stained black.

Methods for purification of viral glycoproteins for use as diagnostic methods Viral glycoproteins are purified using an antibody affinity column. To generate monoclonal antibodies, BALB / c female mice aged 8 to 10 weeks were treated with 107 PFU of S-SPV-009, -014, -016, -017, -018, or -019 for 2 to 4 weeks. Vaccinated intraperitoneally seven times at intervals. Three weeks after the last vaccination, mice are injected intraperitoneally with the corresponding viral glycoprotein 40 mg. The spleen is removed 3 days after the last challenge.

  Splenocytes are fused with mouse NS1 / Ag4 plasmacytoma cells by a modified version of the technique of Oi and Herzenberg (41). Splenocytes and plasmacytoma cells are pelleted together by centrifugation at 300 x g for 10 minutes. 1 ml of a 50% solution of polyethylene glycol (molecular weight 1300 to 1600) is added to the cell pellet with stirring for 1 minute. Dulbecco's modified Eagles' Medium (5 ml) is added to the cells over 3 minutes. Cells are pelleted by centrifugation at 300 xg for 10 minutes and resuspended in medium (HAT) containing 10% fetal bovine serum and 100 mM hypoxanthine, 0.4 mM aminopterin and 16 mM thymidine. Cells (100 ml) are added to 8 to 10 96-well tissue culture plates containing 100 ml normal spleen feeder layer cells and incubated at 37 ° C. Cells are fed with fresh HAT medium every 3 to 4 days.

  Hybridoma culture supernatants are examined by ELIZA analysis in 96-well microtiter plates coated with 100 ng viral glycoprotein. The supernatant from the active hybridoma is further analyzed by black-plaque assay and Western Blot. Selected hybridomas are cloned twice by limiting dilution. Ascetic fluid is generated by intraperitoneal injection of 5 × 10 6 hybridoma cells into pristane-treated BALB / c mice.

  Cell lysates from S-SPV-009, -014, -016, -017, -018 or -019 are obtained as shown in the preparation of infected cell lysates. Cell lysate containing glycoprotein (100 mls) is passed through 2 ml of agarose affinity resin. According to the manufacturer's instructions (AFC Medium, New Brunswick Scientific, Edison, NJ), 20 mg glycoprotein monoclonal antibody is immobilized on the column. The column was washed with 100 ml of phosphate buffer solution (PBS) containing 0.1% Nonidet P-40 to remove non-specifically bound material. The bound glycoprotein is eluted with 100 mM carbonate buffer, pH 10.6 (40). Pre-posteluted fractions are monitored for purity by activity against the SPV monoclonal antibody in the ELISA system.

ELISA ASSAY
Standard enzyme-linked immunosorbent assay (ELISA) procedures are used to measure the immune status of cattle following vaccination and challenge.

  Glycoprotein antigen solution (100 ml at ng / ml in PBS) (100 ml at ng / ml in PBS) is adsorbed to the wells of the microtiter dish at 4 ° C. for 18 hours. Coated holes are rinsed once with PBS. The wells are blocked by adding 250 ml of PBS containing 1% BSA (Sigma) and incubated at 37 ° C for 1 hour. Blocked holes are rinsed once with PBS containing 0.02% Tween20. 50 ml of test serum (previously diluted 1: 2 in PBS containing 1% BSA) is added to the wells and incubated at 37 ° C for 1 hour. The antiserum is removed and the wells are washed 3 times with PBS containing 0.02% Tween20. To visualize holes containing antibodies to specific antigens, horseradish peroxidase (diluted 1: 500 in PBS containing 1% BSA, Kirkegaard and Perry Laboratories) 50 ml of solution containing anti-bovine IgG conjugated to Laboratories, Inc.)) is added. The solution is incubated for 1 hour at 37 ° C, after which the solution is removed and washed 3 times with PBS containing 0.02% Tween20. 100 ml of the substrate solution (ATBS, Kirkegaard and Perry Laboratories, Inc.) was added to each hole and allowed to develop for 15 minutes. The reaction was terminated by the addition of 0.1 M oxalic acid. The color was read at an absorbance of 410 nm with an automatic plate reader.

Basic Techniques for the Construction of Synthetic Pox Virus Promoters With regard to recombinant porcine pox vectors, synthetic pox promoters offer several advantages, including the ability to control the intensity and timing of foreign gene expression. Three promoter cassettes LP1, EP1 and LP2 were designed based on the promoters determined in vaccinia virus (1,7 and 8). Each cassette was designed to contain a DNA sequence determined in vaccinia with restriction enzyme sites. This restriction enzyme site allows the cassettes to be used in any order and in any combination. Initiator methionine was also designed in each cassette to allow inframe fusion at EcoRI or BamHI sites. A series of translation termination codons and early transcriptional termination signals (9) included in all three reading frames were also incorporated downstream of the inframe fusion site. DNA encoding each cassette was synthesized according to standard procedures and cloned into an appropriate homology vector (see FIGS. 4, 5 and 8).

Contains the pseudoprotein rabies (Pseudorabies) virus glycoprotein gene
Vaccination experiments in pigs using recombinant swinepox virus:
Used to test the efficacy of recombinant swinepox virus with one or more pseudorabies virus glycoprotein genes (SPV / PRV) in weaned pigs from the pseudorabies non-infected group It is done. About 103 to 107 plaque-forming units (PFU) of recombinant SPV / PRV virus are inoculated into piglets intramuscularly, subcutaneously, or orally.

  Immunity is determined by measuring the level of PRV serum antibodies and challenge the vaccinated pig with a pathogenic strain of pseudorabies virus. Three to four weeks after vaccination, both swine and non-vaccinated groups are challenged with a pathogenic strain of pseudorabies virus (VDL4892). After challenge, pigs are observed daily for 14 days for clinical signs of pseudorabies.

  Serum samples were obtained at the time of vaccination, at the time of antigen administration, and every other week for 2 to 3 weeks after vaccination and tested for serum neutralizing antibodies.

Cloning of Equine Influenza Virus Hemagglutinin and Neuraminidase Genes Equivalent to equine influenza virus hemagglutinin (HA) in a manner similar to that shown by Katz et al. (42) for the HA gene of human influenza virus. ) And neuraminidase (NA) genes have been cloned. Viral RNA is present in MDBK cells (for influenza A / equine / Alaska / 91 and influenza A / equine / Miami / 63) or MDCK cells (for influenza A / equine / Prague / 56 and influenza A / equine / Kentucky / 81). Prepared from the grown virus, it was first converted to cDNA using oligonucleotide primers specific for the target gene. The cDNA was used as a template for PCR cloning (51) of the targeted gene region. PCR primers were designed to incorporate restriction enzyme sites that allow cloning of the amplified coding region into a vector containing the appropriate signal for expression in EHV. One pair of oligonucleotide primers was required for each encoding region. The region encoding the HA gene from antigen type 2 (H3) virus (influenza A / equine / Miami / 63, influenza A / equine / Kentucky / 81, and influenza A / equine / Alaska / 91) Cloned using the following primer 5'-GGAGGCCTTCATGACAGACAACCATTATTTTGATACTACTGA-3 '(SEQ ID NO: 120) for priming and ligated with 5'-GAAGGCCTTCTCAAATGCAAATGTTGCATCTGATGTTGCC-3' (SEQ ID NO: 121) for PCR It was. The region encoding the HA gene from antigen type 1 (H7) virus (influenza A / horse / Prague / 56) is the following primer for priming cDNA
5'-GGGATCCATGAACACTCAAATTCTAATATTAG-3 '(SEQ ID NO: 122)
For PCR and for cloning
5'-GGGATCCTTATATACAAATAGTGCACCGCA-3 '(SEQ ID NO: 123)
Combined with. The region encoding the NA gene from the antigen type 2 (N8) virus (influenza A / equine / Miami / 63, influenza A / equine / Kentucky / 81, and influenza A / equine / Alaska / 91) The following primers for priming
5'-GGGTCGACATGAATCCAAATCAAAAGATAA-3 '(SEQ ID NO: 124)
For PCR and for cloning
5'-GGGTCGACTTACATCTTATCGATGTCAAA-3 '(SEQ ID NO: 125)
Combined with. The region encoding the NA gene from antigen type 1 (N7) virus (influenza A / horse / Prague / 56) is the primer 5'-GGGATCCATGAATCCTAATCAAAAACTCTTT-3 '(SEQ ID NO: 118) for PCR and
5'-GGGATCCTTACGAAAAGTATTTAATTTGTGC-3 '(SEQ ID NO: 119)
Combined with. Note that this general approach was used to clone regions encoding HA and NA genes from other strains of equine influenza A virus. The EIV HA or NA gene was cloned as a blunt-ended salI or BamHI fragment into the blunt-ended EcoRI site downstream of the LP2EP2 promoter of the SPV homology vector.

Cloning of parainfluenza-3 virus fusion and hemagglutinin gene PCR cloning basically similar to that shown by Katz et al. (42) for the HA gene of human influenza virus By the method, parainfluenza-3 virus fusion (F) and hemagglutinin (HN) gene were cloned. Viral RNA prepared from bovine PI-3 virus grown in Madin-Darby bovine kidney (MDBK) cells is first converted to cDNA using oligonucleotide primers specific for the target gene. It was. The cDNA was then used as a template for replication chain reaction (PCR) cloning (15) of the targeted region. PCR primers were designed to incorporate restriction enzyme sites that allow cloning of the amplified coding region into a vector that contains the appropriate signal for expression in SPV. One pair of oligonucleotide primers was required for each encoding region. The region encoding the F gene from PI-3 strain SF-4 (VR-281) contains the following primers for cDNA priming:
5'-TTATGGATCCTGCTGCTGTGTTGAACAACTTTGT-3 '
(SEQID NO: 130)
For PCR and for cloning
5'-CCGCGGATCCCATGACCATCACAACCATAATCATAGCC-3 '
(SEQ ID NO: 131)
Combined with. The region encoding the HN gene from PI-3 strain SF-4 (VR-281) is the following primer for priming cDNA:
5'-CGTCGGATCCCTTAGCTGCAGTTTTTTGGAACTTCTGTTTTGA-3 '
(SEQ ID NO: 132)
For PCR and for cloning
5'-CATAGGATCCCATGGAATATTGGAAACACACAAACAGCAC-3 '
(SEQ ID NO: 133)
Combined with. Note that this general approach was used to clone regions encoding F and HN genes from other strains of PI-3. DNA fragments corresponding to PI-3 HN (gene) or F (gene) were digested with BamHI to obtain 1730 bp or 1620 bp fragments, respectively. The PI-3 HN fragment was cloned into the BamHI site adjacent to the LP2EP2 promoter of the SPV homology vector. The PI-3 F fragment was cloned into the BamHI site adjacent to the LP2EP2 promoter of the SPV homology vector to obtain the homology vector 713-55.10.

Cloning of Bovine Viral Diarrhea Virus g48 and g53 genes Using a PCR cloning technique similar to that shown by Katz et al. (42) for the HA gene of human influenza virus, The bovine viral diarrhea virus g48 and g53 genes have been cloned. Viral RNA prepared from BVD Virus Singer strain grown in Madin-Darby bovine kidney (MDBK) cells first utilizes oligonucleotide primers specific for the target gene. Changed to cDNA. The cDNA was then used as a template for replication chain reaction (PCR) cloning (15). PCR primers were designed to incorporate restriction enzyme sites that allow cloning of the amplified coding region into a vector that contains the appropriate signal for expression in SPV. One pair of oligonucleotide primers was required for each encoding region. The region encoding the g48 gene from the BVDV Singer strain (49) is the following primer for priming cDNA:
5'-ACGTCGGATCCCTTACCAAACCACGTCTTACTCTTGTTTTCC-3 '
(SEQ ID NO: 134)
For PCR and for cloning
5'-ACATAGGATCCCATGGGAGAAAACATAACACAGTGGAACC-3 '
(SEQ ID NO: 135)
Combined with. The region encoding the g53 gene from the BVDV virus singer strain (49) is the following primer for priming cDNA:
Cloned using 5'-CGTGGATCCTCAATTACAAGAGGTATCGTCTAC-3 '(SEQ ID NO: 136) for PCR
5'-CATAGATCTTGTGGTGCTGTCCGACTTCGCA-3 '(SEQ ID NO: 137)
Combined with. Note that this general approach was used to clone regions encoding the g48 and g53 genes from other strains of BVDV. The DNA fragment corresponding to BVDV g48 was digested with BamHI to obtain a 678 bp fragment. The DNA fragment corresponding to BVDV g53 was digested with BglII and BamHI to obtain a 1187 bp fragment. The BVDV g48 and g53 DNA fragments were cloned into the BamHI site adjacent to the LP2EP2 promoter of the SPV homology vector to obtain homology vectors 727-78.1 and 738-96, respectively.

Basic Cloning of Bovine Respiratory Syncytial Virus Fusion, Nucleocapsid, and Glycoprotein Genes Katz et al. (42) showed the HA gene of human influenza virus Similarly, bovine respiratory syncytial virus fusion (F), nucleocapsid (N) and glycoprotein (G) genes were cloned by the same PCR cloning technique. Viral RNA prepared from BRSV grown in bovine nasal turbinate (BT) cells was first converted to cDNA using oligonucleotide primers specific for the target gene. The cDNA was then used as a template for replication chain reaction (PCR) cloning (15). PCR primers were designed to incorporate restriction enzyme sites that allow cloning of the amplified coding region into a vector containing the appropriate signal for expression in SPV. One pair of oligonucleotide primers was required for each encoding region. The region encoding the F gene from BRSV strain 375 (VR-1339) contains the following primers for cDNA priming:
5'-TGCAGGATCCTCATTTACTAAAGGAAAGATTGTTGAT-3 '
(SEQ ID NO: 138)
For PCR and for cloning
5'-CTCTGGATCCTACAGCCATGAGGATGATCATCAGC-3 '
(SEQ ID NO: 139)
Combined with. The N gene encoding the region derived from BRSV strain 375 (VR-1339) has the following primers for priming cDNA:
5'-CGTCGGATCCCTCACAGTTCCACATCATTGTCTTTGGGAT-3 '
(SEQ ID NO: 140)
For PCR and for cloning
5'-CTTAGGATCCCATGGCTCTTAGCAAGGTCAAACTAAATGAC-3 '
(SEQ ID NO: 141)
Combined with. The region encoding the G gene from BRSV strain 375 (VR-1339) contains the following primers for cDNA priming:
5'-CGTTGGATCCCTAGATCTGTGTAGTTGATTGATTTGTGTGA-3 '
(SEQ ID NO: 142)
For PCR and for cloning
5'-CTCTGGATCCTCATACCCATCATCTTAAATTCAAGACATTA-3 '
(SEQ ID NO: 143)
Combined with. Note that this general approach was used to clone regions encoding F, N, and G genes from other strains of BRSV. DNA fragments corresponding to BRSV F, N and G were digested with BamHI to obtain fragments 1722 bp, 1173 bp and 771 bp, respectively. The BRSV F, N, and G DNA fragments were each cloned into the BamHI site adjacent to the LP2EP2 promoter of the SPV homology vector to obtain homology vectors 727-20.10, 713-55.37, and 727-20.5, respectively. .

RNA isolated from chicken spleen cells treated with Concanavalin A
The chicken spleen was dissected and removed from 3-week-old SPAFAS chicks, washed, and crushed through a syringe / needle to dissociate the cells. After removal of cytoplasm and debris, the cells were pelleted and washed twice with PBS. Cell pellets were treated with hypotonic lysis buffer to lyse red blood cells and splenocytes were collected and washed twice with PBS. Splenocytes were resuspended at 5 × 10 6 cells / ml in RPMI containing 5% FBS and 5 μg / ml concanavalin A and incubated at 39 ° C. for 48 hours. Total RNA can be isolated from cells using the procedures of guanidine isothionate lysis reagents and Promega RNA isolation kit (Promega Corporation Madison Wisconsin). Was released. 4 μg of total RNA was used for each 1st strand reaction containing the appropriate antisense primer and AMV reverse transcriptase (Promega Corporation, Madison Wis.). Reverse transcriptase reaction followed by cDNA synthesis in the same tube using appropriate sense primers and VentR DNA polymerase (Life technologies, Inc. Bethesda, MD) It was conducted.

Detection of recombinant herpesvirus expressing enzyme marker gene (Screen)
When the E. coli β-galactosidase (uidA) marker gene was integrated into a recombinant virus, plaques containing the recombinant were visualized by simple analysis. During plaque analysis, the enzyme substrate was incorporated into the agarose overlay (300 μg / ml). For the uidA marker gene, the substrate X-GlucuroChx (X-GlucuroChx) (5-bromo-4chloro-3-indolyl-β-D-glucuronic acid cyclohexylammonium salt, Biosynthesis AG) (5-bromo-4- chloro-3-indolyl-β-D-glucuronic acid Cyclohexylammonium salt, Biosynth AG) was used. Plaques that showed marker enzyme activity turned blue. The blue plaques were then picked on new ESK-4 cells and purified by further isolation of the blue plaques. In the case of the recombinant virus method in which the enzyme marker gene was removed, white plaque purified from the background of the parent (generation) blue plaque was used for the analysis. In either case, the virus was typically purified by three plaque purifications.

Homology vector 515-85.1
Plasmid 515-85.1 was constructed for the purpose of inserting foreign DNA into SPV. This plasmid contains a unique AccI restriction enzyme site into which foreign DNA can be inserted. If a plasmid with a foreign DNA insert (fragment) at the AccI site is used according to "Homologous Recombination Methods for Recombinant SPV Generation", a virus with foreign DNA will result. A restriction enzyme map of the DNA insertion (fragment) in the homology vector 515-85.1 is shown in FIGS. 4A-4D. This plasmid is constructed using standard recombinant DNA techniques (22 and 29) and joining two restriction enzyme (cleavage) fragments from the following sources: The first fragment is a restriction enzyme digestion fragment of about 2972 base pairs from HindIII to BamHI of pSP64 (Promega) (Promega). The second fragment is an approximately 3628 base pair sub-fragment from HindIII to BglII of SPV HindIII digested fragment M (23).

Homology vector 520-17.5
Plasmid 520-17.5 was constructed for the purpose of inserting foreign DNA into SPV. This plasmid carries the E. coli β-galactosidase (lacZ) marker gene adjacent to the SPV DNA. Upstream of the marker gene is an approximately 2149 base pair fragment of SPV DNA. Downstream of the marker gene is an approximately 1484 base pair fragment of SPV DNA. If this plasmid is used according to "Homologous Recombination Methods for Recombinant SPV Generation", viruses with DNA encoding the marker gene will be generated. Note that the β-galactosidase (lacZ) marker gene is under the control of an early / late 痘 promoter. Details of the plasmid are shown in FIGS. 4A-4D. This plasmid will be constructed using standard recombinant DNA techniques (22 and 30) by adding a restriction enzyme (cleavage) fragment from a source with the following synthetic DNA sequence: This sequence is shown in FIGS. 4A-4D. This plasmid vector originates from a restriction fragment of approximately 2972 base pairs from HindIII to BamHI of pSP64 (Promega). Fragment 1 is a sub-fragment of approximately 2149 base pairs from HindIII to AccI of SPV HindIII digested fragment M (23). Fragment 2 is a restriction enzyme fragment of about 3006 base pairs from BamHI to PvuII of plasmid pJF751 (11). Fragment 3 is a sub-fragment of about 1484 base pairs from AccI to BglII of SPV HindIII digested fragment M (23).

Homology vector 538-46.16
Plasmid 538-46.16 was constructed for the purpose of inserting foreign DNA into SPV. This plasmid has an E. coli β-galactosidase (lacZ) marker gene and a PRV g50 (gD) gene adjacent to the SPV DNA. Upstream of the foreign gene is an approximately 2149 base pair fragment of SPV DNA. Downstream of the foreign gene is an approximately 1484 base pair fragment of SPV DNA. If this plasmid is used according to "Homologous Recombination Methods for Recombinant SPV Generation", viruses with DNA encoding foreign genes will be generated. The β-galactosidase (lacZ) marker gene is under the control of the late synthesis (late) 痘 promoter (LP1) and the g50 (gD) gene is under the control of the early / late 痘 promoter (EP1Lp1) Please note that. Details of the plasmid are shown in FIGS. 5A-5D. This plasmid will be constructed using standard recombinant DNA techniques (22 and 30) by adding a restriction enzyme (cleavage) fragment from a source with the following synthetic DNA sequence: This sequence is shown in FIGS. 5A-5D. This plasmid vector originates from a restriction fragment of approximately 2972 base pairs from HindIII to BamHI of pSP64 (Promega). Fragment 1 is a sub-fragment of approximately 2149 base pairs from HindIII to AccI of SPV HindIII digested fragment M (23). Fragment 2 is a restriction enzyme fragment of about 3006 base pairs from BamHI to PvuII of plasmid pJF751 (11). Fragment 3 is an approximately 1571 base pair sub-fragment of PRV BamHI digested fragment 7 (21) from EcoRI to StuI. Note that the EcoRI site was introduced into this fragment by PCR cloning. In this procedure, the primers shown below were used with a template consisting of the PRV BamHI # 7 fragment subcloned into pSP64. The first primer 87.03 (5'-CGCGAATTCGCTCGCAGCGCTATTGGC-3 ') (SEQ ID NO: 41) is an approximate amino acid priming on the PRV g50 (gD) sequence (26) in the direction of the 3' end of the gene. Bind to position 3 (sit down). The second primer 87.06 (5'-GTAGGAGTGGCTGCTGAAG-3 ') (SEQ ID NO: 42) bound to the position of approximately amino acid 174 on the reverse strand while priming toward the 5' end of the gene. down). The PCR product may be digested with EcoRI and SalI to obtain an approximately 509 base pair fragment. An approximately 1049 base pair sub-fragment of PRV BamHI # 7 from SalI to StuI is then obtained from EcoRI to SalI of approximately 509 base pairs to obtain fragment 3 of approximately 1558 base pairs from EcoRI to StuI. May be ligated to the fragments. Fragment 4 is a sub-fragment of approximately 1484 base pairs from AccI to BglII of SPV HindIII digested fragment M (23).

Homology vector 570-91.21
Plasmid 570-91.21 was constructed for the purpose of inserting foreign DNA into SPV. The plasmid carries the E. coli β-galactosidase (lacZ) marker gene and the PRV gIII (gC) gene adjacent to the SPV DNA. Upstream of the foreign gene is an approximately 1484 base pair fragment of SPV DNA. Downstream of the foreign gene is an approximately 2149 base pair fragment of SPV DNA. If this plasmid is used according to "Homologous Recombination Methods for Recombinant SPV Generation", viruses with DNA encoding foreign genes will be generated. Note that the β-galactosidase (lacZ) marker gene is under the control of the late 痘 promoter (LP1) and the gIII (gC) gene is under the control of the early 痘 promoter (EP2). . Details of the plasmid are shown in FIGS. 10A-10D. This plasmid will be constructed using standard recombinant DNA techniques (22 and 30) by adding a restriction enzyme (cleavage) fragment from a source with the following synthetic DNA sequence: This sequence is shown in FIGS. 10A-10D. This plasmid vector originates from a restriction fragment of approximately 2972 base pairs from HindIII to BamHI of pSP64 (Promega). Fragment 1 is a sub-fragment of about 1484 base pairs from BglII to AccI of SPV HindIII digested fragment M (23). Fragment 2 is a restriction enzyme fragment of about 3002 base pairs from BamHI to PvuII of plasmid pJF751 (11). Fragment 3 is a sub-fragment of PRV BamHI # 2 and # 9, a fragment of about 2378 base pairs from NcoI to NcoI of plasmid 251-41.A. The NcoI site and NcoI site at the end of this fragment were replaced with an EcoRI linker. Fragment 4 is a sub-fragment of about 2149 base pairs from AccI to HindIII of SPV HindIII digested fragment M (23). The AccI site in fragment 1 and fragment 4 was converted to PstI using a synthetic DNA linker.

Homology vector 570-91.41
Plasmid 570-91.41 was constructed for the purpose of inserting foreign DNA into SPV. The plasmid carries the E. coli β-galactosidase (lacZ) marker gene and the PRV gIII (gC) gene adjacent to the SPV DNA. Upstream of the foreign gene is an approximately 2149 base pair fragment of SPV DNA. Downstream of the foreign gene is an approximately 1484 base pair fragment of SPV DNA. If this plasmid is used according to "Homologous Recombination Methods for Recombinant SPV Generation", viruses with DNA encoding foreign genes will be generated. Note that the β-galactosidase (lacZ) marker gene is under the control of the late 痘 promoter (LP1) and the gIII (gC) gene is under the control of the early late 痘 promoter (EP1LP2). I want to be. Details of the plasmid are shown in FIGS. 11A-11D. This plasmid will be constructed using standard recombinant DNA techniques (22 and 30) by adding a restriction enzyme (cleavage) fragment from a source with the following synthetic DNA sequence: This sequence is shown in FIGS. 11A-11D. This plasmid vector originates from a restriction fragment of approximately 2972 base pairs from HindIII to BamHI of pSP64 (Promega). Fragment 1 is a sub-fragment of about 1484 base pairs from BglII to AccI of SPV HindIII digested fragment M (23). Fragment 2 is a restriction enzyme fragment of about 3002 base pairs from BamHI to PvuII of plasmid pJF751 (11). Fragment 3 is a sub-fragment of PRV BamHI # 2 and # 9, a fragment of about 2378 base pairs from NcoI to NcoI of plasmid 251-41.A. The NcoI site and NcoI site at the end of this fragment were replaced with an EcoRI linker. Fragment 4 is a sub-fragment of about 2149 base pairs from AccI to HindIII of SPV HindIII digested fragment M (23). The AccI site in fragment 1 and fragment 4 was converted to PstI using a synthetic DNA linker.

Homology vector 570-91.64
Plasmid 570-91.64 was constructed for the purpose of inserting foreign DNA into SPV. The plasmid carries the E. coli β-galactosidase (lacZ) marker gene and the PRV gIII (gC) gene adjacent to the SPV DNA. Upstream of the foreign gene is an approximately 1484 base pair fragment of SPV DNA. Downstream of the foreign gene is an approximately 2149 base pair fragment of SPV DNA. If this plasmid is used according to "Homologous Recombination Methods for Recombinant SPV Generation", viruses with DNA encoding foreign genes will be generated. Note that the β-galactosidase (lacZ) marker gene is under the control of the late synthesis (late) 痘 promoter (LP1) and the gIII (gC) gene is under the control of the late synthesis 痘 promoter (Lp2EP2) I want to be. Details of the plasmid are shown in FIGS. 12A-12D. This plasmid will be constructed using standard recombinant DNA techniques (22 and 30) by adding a restriction enzyme (cleavage) fragment from a source with the following synthetic DNA sequence: This sequence is shown in FIGS. 12A-12D. This plasmid vector originates from a restriction fragment of approximately 2972 base pairs from HindIII to BamHI of pSP64 (Promega). Fragment 1 is a sub-fragment of about 1484 base pairs from BglII to AccI of SPV HindIII digested fragment M (23). Fragment 2 is a restriction enzyme fragment of about 3002 base pairs from BamHI to PvuII of plasmid pJF751 (11). Fragment 3 is a sub-fragment of PRV BamHI # 2 and # 9, a fragment of about 2378 base pairs from NcoI to NcoI of plasmid 251-41.A. The NcoI site and NcoI site at the end of this fragment were replaced with an EcoRI linker. Fragment 4 is a sub-fragment of about 2149 base pairs from AccI to HindIII of SPV HindIII digested fragment M (23). The AccI site in fragment 1 and fragment 4 was converted to PstI using a synthetic DNA linker.

Homology vector 538-46.26
Plasmid 538-46.26 was constructed for the purpose of inserting foreign DNA into SPV. The plasmid carries the E. coli β-galactosidase (lacZ) marker gene and the Newcastle disease virus (NDV) hemagglutinin-neuraminidase (HN) gene adjacent to the SPV DNA. Upstream of the foreign gene is an approximately 2149 base pair fragment of SPV DNA. Downstream of the foreign gene is an approximately 1484 base pair fragment of SPV DNA. If this plasmid is used according to "Homologous Recombination Methods for Recombinant SPV Generation", viruses with DNA encoding foreign genes will be generated. It is noted that the β-galactosidase (lacZ) marker gene is under the control of the late synthesis (late) 痘 promoter (LP1) and the HN gene is under the control of the early / late 痘 promoter (EP1Lp2). I want. Details of the plasmid are shown in FIGS. 8A-8D. This plasmid will be constructed using standard recombinant DNA techniques (22 and 30) by adding a restriction enzyme (cleavage) fragment from a source with the following synthetic DNA sequence: This sequence is shown in FIGS. 8A-8D. This plasmid vector originates from a restriction fragment of approximately 2972 base pairs from HindIII to BamHI of pSP64 (Promega). Fragment 1 is a sub-fragment of approximately 2149 base pairs from HindIII to AccI of SPV HindIII digested fragment M (23). Fragment 2 is an approximately 1810 base pair restriction enzyme fragment from AvaII to NaeI of the NDV HN cDNA clone. The sequence of the HN cDNA clone is shown in FIG. cDNA clones were collected from NDV strain B1 using standard cDNA cloning techniques (14). Fragment 3 is a restriction enzyme fragment of about 3006 base pairs from BamHI to PvuII of plasmid pJF751 (11). Fragment 4 is a sub-fragment of approximately 1484 base pairs from AccI to BglII of SPV HindIII digested fragment M (23).

Homology vector 599-65.25
Plasmid 599-65.25 was constructed for the purpose of inserting foreign DNA into SPV. The plasmid carries the E. coli β-galactosidase (lacZ) marker gene and the ILT gG gene adjacent to the SPV DNA. Upstream of the foreign gene is an approximately 1484 base pair fragment of SPV DNA. Downstream of the foreign gene is an approximately 2149 base pair fragment of SPV DNA. If this plasmid is used according to "Homologous Recombination Methods for Recombinant SPV Generation", viruses with DNA encoding foreign genes will be generated. Note that the β-galactosidase (lacZ) marker gene is under the control of the late synthesis (late) 痘 promoter (LP1) and the ILT gG gene is under the control of the early / late 痘 promoter (EP1LP2) I want to be. Details of the plasmid are shown in FIGS. 13A-13D. This plasmid will be constructed using standard recombinant DNA techniques (22 and 30) by adding a restriction enzyme (cleavage) fragment from a source with the following synthetic DNA sequence: This sequence is shown in FIGS. 13A-13D. This plasmid vector originates from a restriction fragment of approximately 2972 base pairs from HindIII to BamHI of pSP64 (Promega). Fragment 1 is a sub-fragment of about 1484 base pairs from BglII to AccI of SPV HindIII digested fragment M (23). Fragment 2 is an approximately 1073 base pair fragment from EcoRI to MboI. Note that the EcoRI site was introduced by PCR cloning. In this procedure, the primers shown below were used with a template consisting of a 2.6 kb sub-fragment from Sst I to Asp718I of the 5.1 Kb Asp718I fragment of the ILT virus genome. The first primer 91.13 (5′-CCGAATTCCGGCTTCAGTAACATAGGATCG-3 ′) (SEQ ID NO: 81) binds to the position of amino acid 2 on the ILT gG sequence. This primer also adds an asparagine residue between amino acid 1 and amino acid 2 and introduces an EcoRI restriction enzyme site. The second primer 91.14 (5'-GTACCCATACTGGTCGTGGC-3 ') (SEQ ID NO: 82) binds to approximately amino acid 196, priming on the reverse strand in the direction of the 5' end of the gene ( sit down). PCR products. It is digested with EcoRI and BamHI to obtain a fragment of about 454 base pairs. An MboI sub-fragment of about 485 base pairs of the ILT Asp718I (5.1 Kb) fragment is used to obtain fragment 2 from EcoRI to MboI (fragment) of about 939 base pairs (293 amino acids) in length. And ligated to an EcoRI to BamHI fragment of about 454 base pairs. Fragment 3 is a restriction enzyme fragment of about 3002 base pairs from BamHI to PvuII of plasmid pJF751 (11). Fragment 4 is an approximately 2149 base pair sub-fragment from AccI to HindIII of SPV HindIII digested fragment M. The AccI site in fragment 1 and fragment 4 was converted to PstI using a synthetic DNA linker.

Homology vector 624.20.1C
Plasmid 624.20.1C was constructed for the purpose of inserting foreign DNA into SPV. The plasmid carries the E. coli β-galactosidase (lacZ) marker gene and the ILT gI gene adjacent to the SPV DNA. Upstream of the foreign gene is an approximately 1484 base pair fragment of SPV DNA. Downstream of the foreign gene is an approximately 2149 base pair fragment of SPV DNA. If this plasmid is used according to "Homologous Recombination Methods for Recombinant SPV Generation", viruses with DNA encoding foreign genes will be generated. Note that the β-galactosidase (lacZ) marker gene is under the control of the late 痘 promoter (LP1) and the ILT gI gene is under the control of the late / early 痘 promoter (LP2EP2). I want to be. Details of the plasmid are shown in FIGS. 14A-14D. This plasmid will be constructed using standard recombinant DNA techniques (22 and 30) by adding a restriction enzyme (cleavage) fragment from a source with the following synthetic DNA sequence: This sequence is shown in FIGS. 14A-14D. This plasmid vector originates from a restriction fragment of approximately 2972 base pairs from HindIII to BamHI of pSP64 (Promega). Fragment 1 is a sub-fragment of about 1484 base pairs from Bgl II to Acc I of SPV HindIII digested fragment M (23). Fragment 2 is an approximately 1090 base pair fragment with EcoRI and BamHI sites at the end synthesized by PCR cloning and contains a sequence encoding all amino acids of the ILT gI gene. The ILT gI gene was synthesized by two separate PCR reactions. In this procedure, the primers shown below were used with a template consisting of the 8 kb ILT Asp 718I fragment. The first primer 103.6 (5'-CCGGAATTCGCTACTT GGAACTCTGG-3 ') (SEQ ID NO: 83) binds to the amino acid 2 position on the ILT gI sequence and is at the 5' end of the ILT gI gene. Introduce EcoRI site. The second primer 103.3 (5'-CATTGTCCCGAGACGGACAG-3 ') (SEQ ID NO: 84) binds to approximately the amino acid 269 position on the ILT gI sequence on the reverse strand of primer 103.6, and the gene Priming toward the 5 ′ end of In order to obtain a 625 base pair fragment corresponding to the 5 'end of the ILT gI gene, the PCR product was EcoRI and BglI (BglI is 179 base pairs 5' to the primer 2 Digested at 209). The third primer 103.4 (5'-CGCGATCCAACTATCGGTG-3 ') (SEQ ID NO: 85) binds to approximately amino acid 153 position on the ILT gI gene while priming toward the 3' end of the gene. (sit down). The fourth primer 103.5 (5'-GCGGATCCACATTCAG ACTTAATCAC-3 ') (SEQ ID NO: 86) binds to a position 14 base pairs ahead of the UGA stop codon at the 3' end of the ILT gI gene. , Induces priming of BamHI restriction enzyme site and 5 'end of gene. The PCR product is digested with BglI (at 209 amino acids) and BamHI to obtain a 476 base pair fragment corresponding to the 3 'end of the ILT gI gene. Fragment 2 consists of two PCR reaction products ligated together to obtain the ILT gI gene, an EcoRI to BamHI fragment of approximately 1101 base pairs (361 amino acids) in length. Fragment 3 is a restriction enzyme fragment of about 3002 base pairs from BamHI to PvuII of plasmid pJF751 (11). Fragment 4 is an approximately 2149 base pair sub-fragment from AccI to HindIII of SPV HindIII digested fragment M. The AccI site in fragment 1 and fragment 4 was converted to a specific NotI site using a NotI linker.

Homology vector 614-83.18
Plasmid 614-83.18 was constructed for the purpose of inserting foreign DNA into SPV. The plasmid carries the E. coli β-galactosidase (lacZ) marker gene and the IBR gG gene adjacent to the SPV DNA. Upstream of the foreign gene is an approximately 1484 base pair fragment of SPV DNA. Downstream of the foreign gene is an approximately 2149 base pair fragment of SPV DNA. If this plasmid is used according to "Homologous Recombination Methods for Recombinant SPV Generation", viruses with DNA encoding foreign genes will be generated. Note that the β-galactosidase (lacZ) marker gene is under the control of the late 痘 promoter (LP1) and the IBR gG gene is under the control of the late / early 痘 promoter (LP2EP2). I want to be. Details of the plasmid are shown in FIGS. 15A-15D. This plasmid will be constructed using standard recombinant DNA techniques (22 and 30) by adding a restriction enzyme (cleavage) fragment from a source with the following synthetic DNA sequence: This sequence is shown in FIGS. 15A-15D. This plasmid vector originates from a restriction fragment of approximately 2972 base pairs from HindIII to BamHI of pSP64 (Promega). Fragment 1 is a sub-fragment of about 1484 base pairs from BglII to AccI of SPV HindIII digested fragment M (23). Fragment 2 is an approximately 1085 base pair fragment synthesized by PCR cloning with EcoRI and BamHI sites at the ends, and contains a sequence encoding amino acids 2 to 362 of the IBR gG gene. In the PCR cloning procedure, the primers shown below were used with a template consisting of IBR-000 virus (Cooper strain) (Cooper Strain). First primer 106.9
(5'-ATGAATTCCCCTGCCGCCCGGACCGGCACC-3 ') (SEQ ID NO: 87)
Binds to the position of amino acid 1 on the IBR gG sequence, adds an EcoRI site at the 5 ′ end of the IBR gG gene, and adds two amino acids between amino acid 1 and amino acid 2. Second primer 106.8
(5'-CATGGATCCCGCTCGAGGCGAGCGGGCTCC-3 ') (SEQ ID NO: 88)
Binds to approximately the position of amino acid 362 on the reverse strand of primer 1 on the IBR gG sequence and primes the synthesis towards the 5 ′ end of the IBR gG gene. Fragment 2 was generated by digesting the PCR product with EcoRI and BamHI to obtain a 1085 base pair fragment corresponding to 362 amino acids (about 80%) on the amino terminal side of the IBR gG gene. Fragment 3 is a restriction enzyme fragment of about 3002 base pairs from BamHI to PvuII of plasmid pJF751 (11). Fragment 4 is an approximately 2149 base pair sub-fragment from AccI to HindIII of SPV HindIII digested fragment M. The AccI site in fragment 1 and fragment 4 was converted to a specific NotI site using a NotI linker.

Homology vector for constructing S-SPV-019
(LacZ / IBR gE homology vector):
This LacZ / IBR gE homology vector was constructed for the purpose of inserting foreign DNA into SPV. The plasmid carries the E. coli β-galactosidase (lacZ) marker gene and the IBR gE gene adjacent to the SPV DNA. If this plasmid is used according to "Homologous Recombination Methods for Recombinant SPV Generation", viruses with DNA encoding foreign genes will be generated. Note that the β-galactosidase (lacZ) marker gene is under the control of the late 痘 promoter and the gE gene is under the control of the late / early 痘 promoter. Homologous vectors will be constructed using standard recombinant DNA techniques (22 and 30) and adding a source-derived restriction enzyme (cleavage) fragment with the appropriate synthetic DNA sequence shown below. This plasmid vector originates from a restriction fragment of approximately 2972 base pairs from HindIII to BamHI of pSP64 (Promega). Upstream of SPV homology is an approximately 1146 base pair BglIII to AccI restriction sub-fragment of SPV HindIII digested fragment M (23). The IBR gE gene is an approximately 1888 base pair fragment synthesized by PCR cloning with EcoRI and BamHI restriction site ends. In the PCR cloning procedure, the primers shown below were used with a template consisting of IBR-000 virus (Cooper Strain). First primer 4 / 93.17DR
(5'-CTGGTTCGGCCCAGAATTCTATGGGTCTCGCGCGGCTCGTGG-3 ')
(SEQ ID NO: 89)
Binds to the amino acid 1 position on the IBR gE gene, introduces an EcoRI site at the 5 'end of the IBR gE gene, and adds two amino acids to the amino terminus of the protein. Second primer 4 / 93.18DR
(5'-CTCGCTCGCCCAGGATCCCTAGCGGAGGATGGACTTGAGTCG-3 ')
(SEQ ID NO: 90)
Binds to approximately the position of amino acid 648 on the IBR gE sequence on the reverse strand to primer 1 and primes the synthesis towards the 5 ′ end of the IBR gE gene. The lacZ promoter and marker gene are the same as those used in plasmid 520-17.5. Downstream of SPV homology is an approximately 2156 base pair AccI to HindIII sub-fragment of SPV HindIII digested fragment M (23). The AccI site in the SPV homology vector was converted to a unique XbaI site.

Homology vector for constructing S-SPV-018
(LacZ / PRV gE homology vector):
Homology vectors were constructed for the purpose of inserting foreign DNA into SPV. The plasmid carries the E. coli β-galactosidase (lacZ) marker gene and the PRV gE gene adjacent to the SPV DNA. Upstream of the foreign gene is an approximately 1484 base pair fragment of SPV DNA. Downstream of the foreign gene is an approximately 2149 base pair fragment of SPV DNA. When this plasmid is used according to "Homologous Recombination Methods for Recombinant SPV Generation", a virus with DNA encoding a foreign gene is generated. Note that the β-galactosidase (lacZ) marker gene is under the control of the late 痘 promoter (LP1) and the PRV gE gene is under the control of the early / late 痘 promoter (EP1LP2) I want to be. This homology vector will be constructed using standard recombinant DNA techniques (22 and 30) by adding a restriction enzyme (cleavage) fragment from a source with the synthetic DNA sequence shown below. This plasmid vector originates from a restriction fragment of approximately 2972 base pairs from HindIII to BamHI of pSP64 (Promega). Fragment 1 is a sub-fragment of about 1484 base pairs from BglII to AccI of SPV HindIII digested fragment M (23). Fragment 2 is the same LacZ promoter and marker gene used in plasmid 520-17.5. Fragment 3 is a sub-fragment of approximately 2484 base pairs from DraI to MluI of PRV derived from the PRV BamHI # 7 DNA fragment. The DraI site was converted to an EcoRI site using a synthetic DNA linker. DraI is located 45 bp upstream of the original gE start codon and extends the amino-terminal open reading frame of the protein by 15 amino acids. The synthetic sputum promoter / EcoRI DNA linker added four additional amino acids. Eventually, a synthesized gE gene containing 19 added amino acids was fused to the amino terminus of gE. The 19 amino acids are Met-Asn-Ser-Gly-Asn-Leu-Gly-Thr-Pro-Ala-Ser-Leu-Ala-His-Thr-Gly-Val-Glu-Thr. Fragment 4 is a sub-fragment of about 2149 base pairs from AccI to HindIII of SPV HindIII digested fragment M (23). The AccI site in fragment 1 and fragment 4 was converted to a PstI site using a synthetic DNA linker.

Homology vector 520-90.15
Plasmid 520-90.15 was constructed for the purpose of inserting foreign DNA into SPV. This plasmid contains a unique NdeI restriction enzyme site into which foreign DNA can be inserted. If a plasmid with a foreign DNA insert (fragment) at the NdeI site is used according to “Homologous Recombination Methods for Recombinant SPV Generation”, a virus with foreign DNA will result. Plasmid 520-90.15 is constructed using standard recombinant DNA techniques (22 and 30) and joining two restriction enzyme (cleavage) fragments from the following sources: The first fragment is a restriction enzyme digestion fragment of about 2972 base pairs from HindIII to BamHI of pSP64 (Promega) (Promega). The second fragment is an approximately 1700 base pair sub-fragment of HindIII to BamHI of SPV HindIII digested fragment G (23).

Homology vector 708-78.9
Plasmid 708-78.9 was constructed for the purpose of inserting foreign DNA into SPV. The plasmid carries the E. coli β-galactosidase (lacZ) marker gene and the infectious bovine rhinotracheitis virus (IBRV) gE gene adjacent to the SPV DNA. Upstream of the foreign gene is an approximately 1484 base pair fragment of SPV DNA. Downstream of the foreign gene is an approximately 2149 base pair fragment of SPV DNA. If this plasmid is used according to "Homologous Recombination Methods for Recombinant SPV Generation", viruses with DNA encoding foreign genes will be generated. Note that the β-galactosidase (lacZ) marker gene is under the control of the late 痘 promoter (LP1) and the IBRV gE gene is under the control of the late / early 痘 promoter (LP2EP2). I want to be. Homology vectors will be constructed using standard recombinant DNA techniques (22 and 30) by adding restriction (cleavage) fragments from the following sources: This plasmid vector originates from a restriction fragment of approximately 2972 base pairs from HindIII to BamHI of pSP64 (Promega). Fragment 1 is a sub-fragment of about 1484 base pairs from BglII to AccI of SPV HindIII digested fragment M (23). Fragment 2 is an approximately 475 base pair fragment with EcoRI and BamHI sites at the ends. EcoRI and BamHI sites were synthesized by PCR cloning. The PCR product contains the sequence of the IBRV gE gene encoding all amino acids. In the PCR cloning procedure, the primers shown below were used with a template consisting of the IBR-000 virus (Cooper Strain) (44). First primer 2 / 94.5DR
(5'-CTGGTTCGGCCCAGAATTCGATGCAACCCACCGCGCCGCCCCG-3 ')
(SEQ ID NO: 116)
Binds to the position of amino acid 1 on the IBR gE gene and introduces an EcoRI site at the 5 ′ end of the IBRV gE gene and two amino acid additions at the amino terminus of the protein. Second primer 4 / 93.18DR
(5'-CTCGCTCGCCCAGGATCCCTAGCGGAGGATGGACTTGAGTCG-3 ')
(SEQ ID NO: 117)
Binds to the position of approximately amino acid 648 on the IBRV gE sequence (44) on the reverse strand to primer 1 and primes the synthesis toward the 5 ′ end of the IBRV gE gene. The PCR product was digested with EcoRI and BamHI to obtain a fragment of approximately 1950 base pairs in length corresponding to the IBRV gE gene. Fragment 3 is a restriction enzyme fragment of about 3002 base pairs from BamHI to PvuII of plasmid pJF751 (11). Fragment 4 is an approximately 2149 base pair sub-fragment from AccI to HindIII of SPV HindIII digested fragment M. The AccI site in fragment 1 and fragment 4 was converted to a specific NotI site using a NotI linker.

Homology vector 723-59A9.22
Plasmid 723-59A9.22 was constructed for the purpose of inserting foreign DNA into SPV. The plasmid carries the E. coli β-galactosidase (lacZ) marker gene and the equine influenza virus NA PR / 56 gene adjacent to the SPV DNA. When this plasmid is used according to “Homologous Recombination Methods for Recombinant SPV Generation”, a virus with a DNA encoding a foreign gene is generated. The β-galactosidase (lacZ) marker gene is under the control of the late synthetic (late) 痘 promoter (LP1), and the EIV PR / 56 NA gene is under the control of the late / early synthetic 痘 promoter (LP2EP2) Please note that. Details of the plasmid are shown in FIGS. 18A-18D. Homologous vectors will be constructed using standard recombinant DNA techniques (22 and 30) and adding a source-derived restriction enzyme (cleavage) fragment with the appropriate synthetic DNA sequence shown below. This plasmid vector originates from a restriction fragment of approximately 2972 base pairs from HindIII to BamHI of pSP64 (Promega). Fragment 1 is a sub-fragment of about 1484 base pairs from BglII to AccI of SPV HindIII digested fragment M (23). Fragment 2 is a region encoding the NA gene from equine influenza A / Prague / 56 (serotype 1 (N7) virus). The following primers are used for priming cDNA:
5'-GGGATCCATGAATCCTAATCAAAAACTCTTT-3 '(SEQ ID NO: 118)
And was cloned as a BamHI fragment of about 1450 base pairs in size. And it is for PCR
5'-GGGATCCTTACGAAAAGTATTTAATTTGTGC-3 '(SEQ ID NO: 119)
Combined with. (See “Cloning of equine influenza virus hemagglutinin and neuraminidase genes”). Fragment 3 is a restriction enzyme fragment of about 3010 base pairs from BamHI to PvuII of plasmid pJF751 (11). Fragment 4 is an approximately 2149 base pair sub-fragment of AccI to HindIII of the SPV HindIII digested fragment M (23). The AccI site in the SPV homology vector was converted to a unique NotI site.

Homology vector 727-54.60
In order to insert foreign DNA into SPV, plasmid 727-54.60 was constructed. This incorporates the pseudorabies virus (PRV) gII (gB) gene and the E. coli β-galactosidase (lacZ) marker gene flanked by SPV DNA. Upstream of these foreign genes is an approximately 1484 base pair fragment of SPV DNA, and downstream of these foreign genes is an approximately 2149 base pair fragment of SPV DNA. By using this plasmid according to the “homologous recombination procedure for generating recombinant SPV”, a virus containing DNA encoding the foreign gene can be obtained. It is noted that the β-galactosidase (lacZ) marker gene is under the control of the synthetic late heel promoter (LP1) and the PRV gB gene is under the control of the synthetic late / early heel promoter (LP2EP2). Details of this plasmid are shown in FIGS. 19A-19D. This plasmid can be constructed by using standard recombinant DNA techniques (22, 30) and ligating together restriction fragments derived from the following sources having the synthetic DNA base sequences shown in FIGS. 19A-19D. . The plasmid vector was derived from an approximately 2972 base pair HindIII-BamHI restriction fragment available from pSP64 (Promega). Fragment 1 is an approximately 1484 base pair BglII-AccI restriction subfragment of SPV HindIII restriction fragment M (23). Fragment 2 is an approximately 3500 base pair fragment containing the sequence encoding the PRV gB gene within the KpnI C fragment (21) of genomic PRV DNA. Fragment 2 consists of an approximately 53 base pair synthetic fragment containing the amino terminus of the PRV gB gene, an approximately 78 base pair SmaI-NheI fragment derived from the PRV KpnI C genomic fragment, and an approximately 3370 base pair NheI-derived from the PRV KpnI C genomic fragment. An EcoRI fragment (21). Fragment 3 is an approximately 3010 base pair BamHI-PvuII restriction fragment of plasmid pJF751 (11). Fragment 4 is an approximately 2149 base pair AccI-HindIII subfragment of SPV HindIII fragment M. The ACCI sites of fragment 1 and fragment 4 were converted to a non-repetitive NotI site using a NotI linker.

Homology vector 727-67.18
Plasmid 727-67.18 was constructed to insert foreign DNA into SPV. This incorporates the hepatitis B virus score antigen gene flanked by SPV DNA and the E. coli β-galactosidase (lacZ) marker gene. Upstream of these foreign genes is an approximately 1484 base pair fragment of SPV DNA, and downstream of these foreign genes is an approximately 2149 base pair fragment of SPV DNA. By using this plasmid in accordance with the “homologous recombination procedure for generating recombinant SPV”, a virus containing the DNA encoding the foreign gene can be obtained. It is noted that the β-galactosidase (lacZ) marker gene is under the control of the synthetic late epilepsy promoter (LP1), and the hepatitis B virus core antigen gene is under the control of the synthetic late / early epithelial promoter (LP2EP2). The Details of this plasmid are shown in FIGS. 20A-20D. This plasmid can be constructed by using standard recombinant DNA techniques (22, 30) and ligating together restriction fragments derived from the following sources having the synthetic DNA base sequences shown in FIGS. 20A-20D. The plasmid vector was derived from an approximately 2972 base pair HindIII-BamHI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1484 base pair BglII-AccI restriction subfragment of SPV HindIII restriction fragment M (23). Fragment 2 is an approximately 3002 base pair BamHI-PvuII restriction fragment of plasmid pJF751 (11). Fragment 3 is an approximately 589 base pair fragment with BamHI and EcoRI restriction sites at the ends. This fragment contains the base sequence (amino acids 25-212) (see 45, 50) encoding hepatitis B core antigen. Fragment 4 is an approximately 2149 base pair AccI-HindIII subfragment of SPV HindIII fragment M. The AccI sites of fragment 1 and fragment 4 were converted to a non-repetitive NotI site using a NotI linker.

Homology vector 732-18.4
Plasmid 732-18.4 was used to insert foreign DNA into SPV. This incorporates the equine influenza virus AK / 91NA gene flanked by SPV DNA and the E. coli β-galactosidase (lacZ) marker gene. By using this plasmid in accordance with the “homologous recombination procedure for generating recombinant SPV”, a virus containing the DNA encoding the foreign gene can be obtained. It is noted that the β-galactosidase (lacZ) marker gene is under the control of the synthetic late epilepsy promoter (LP1), and the equine influenza virus AK / 91NA gene is under the control of the synthetic late / early epilepsy promoter (LP2EP2). The Details of this plasmid are shown in FIGS. 21A-21D. This homology vector was constructed by joining restriction fragments derived from the following sources having an appropriate synthetic DNA base sequence using standard recombinant DNA techniques (22, 30). The plasmid vector was derived from an approximately 2972 base pair HindIII-BamHI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1484 base pair BglII-AccI restriction subfragment of SPV HindIII restriction fragment M (23). Fragment 2 was obtained using a primer in which 5′-GG GTCGAC ATGAATCCAAACAAAGAATAA-3 ′ (SEQ ID NO: 124) for cDNA priming was combined with 5′-GG GTCGAC TTACCATCTTATCG ATG TCAAA-3 ′ (SEQ ID NO: 125) for PCR. A region encoding the NA gene derived from equine influenza A / Alaska / 91 (antigen type 2 (N8) virus) cloned as an approximately 1450 base pair SalI fragment ("cloning of equine influenza virus hemagglutinin and neuraminidase genes""reference). Fragment 3 is an approximately 3010 base pair BamHI-PvuII restriction fragment of plasmid pJF751 (11). Fragment 4 is an approximately 2149 base pair AccI-HindIII subrestriction fragment of SPV HindIII restriction fragment M (23). The AccI site of this SPV homology vector was converted to a non-repetitive NotI site.

Homology vector 741-80.3
Plasmid 741-80.3 was constructed to insert foreign DNA into SPV. This incorporates the E. coli β-galactosidase (lacZ) marker gene flanked by SPV DNA. Upstream of the foreign gene is an approximately 1484 base pair fragment of SPV DNA, and downstream of the foreign gene is an approximately 2149 base pair fragment of SPV DNA. By using this plasmid in accordance with the “homologous recombination procedure for generating recombinant SPV”, a virus containing the DNA encoding the foreign gene can be obtained. It is noted that the β-galactosidase (lacZ) marker gene is under the control of the human cytomegalovirus immediate early (HCMV IE) promoter. Details of this plasmid are shown in Figures 22A-22C. This plasmid can be constructed using standard recombinant DNA techniques (22, 30) by linking together restriction fragments derived from the following sources having the synthetic DNA base sequences shown in FIGS. 22A-22C. The plasmid vector was derived from an approximately 2972 base pair HindIII-BamHI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1484 base pair BglII-AccI restriction subfragment of SPV HindIII restriction fragment M (23). Fragment 2 is a 1154 base pair PstI-AvaII fragment derived from the HCMV 2.1 kb PstI fragment containing the HCMV IE promoter (46). Fragment 3 is a 3010 base pair BamHI-PvuII fragment derived from plasmid pJF751 (49) containing the E. coli lacZ gene. Fragment 4 is an approximately 750 base pair NdeI-SalI fragment derived from PRV BamHI # 7 containing the polyadenylation signal of the PRV gX gene and the 19 amino acids at the carboxy terminus. Fragment 5 is an approximately 2149 base pair AccI-HindIII subfragment of SPV HindIII fragment M. The AccI site of fragment 1 and fragment 5 was converted to a non-repetitive NotI site using a NotI linker.

Homology vector 741-84.14
Plasmid 741-84.14 was constructed to insert foreign DNA into SPV. This incorporates the human interleukin-2 (IL-2) gene and the E. coli β-galactosidase (lacZ) marker gene flanked by SPV DNA. Upstream of these foreign genes is an approximately 1484 base pair fragment of SPV DNA, and downstream of these foreign genes is an approximately 2149 base pair fragment of SPV DNA. By using this plasmid in accordance with the “homologous recombination procedure for generating recombinant SPV”, a virus containing the DNA encoding the foreign gene can be obtained. It is noted that the β-galactosidase (lacZ) marker gene is under the control of a synthetic late heel promoter (LP1) and the human IL-2 gene is under the control of a synthetic late / early heel promoter (LP2EP2). The sequence encoding human IL-2 protein is fused at its amino terminus to a PRV gX signal sequence for membrane trafficking. Details of this plasmid are shown in FIGS. 23A-23D. This plasmid can be constructed by using standard recombinant DNA techniques (22, 30) and binding restriction fragments derived from the following sources having the synthetic DNA base sequences shown in FIGS. 23A-23D. The plasmid vector was derived from an approximately 2972 base pair HindIII-BamHI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1484 base pair BglII-AccI restriction subfragment of SPV HindIII restriction fragment M (23). Fragment 2 is an approximately 475 base pair fragment with EcoRI and BglII restriction sites at the ends. The EcoRI site is synthesized by PCR cloning and the BglII site is located at the 3 ′ end of human IL-2 cDNA (43, 47). The PCR product contains the PRV gX signal sequence-the entire amino acid coding sequence of the human IL-2 gene. In this method, the following primers were applied using a template consisting of PRV gX signal sequence-human IL-2 cDNA (43). The first primer 5 / 94.23 (5′-CTCGAATTCGAAGTGGGCAACGTGGATCCTGCGC-3 ′) (SEQ ID NO: 126) sits at the position of the first amino acid on the PRV gX signal sequence, and the EcoRI site at the 5 ′ end of the gene Is introduced. The second primer 5 / 94.24 (5′-CAGTTAGCCCTCCCCCATCTCCCCA-3 ′) (SEQ ID NO: 127) is in the 3 ′ untranslated region on the opposite strand of primer 5 / 94.23 on the human IL-2 gene sequence. And prime in the direction of the 5 ′ end of the gene. The PCR product was digested with EcoRI and BglII (BglII is located approximately 3 nucleotides beyond the stop codon for the human IL-2 gene) and PRV gX signal sequence in length-human IL A 475 base pair fragment corresponding to the -2 gene was generated. Fragment 3 is an approximately 3010 base pair BamHI-PvuII restriction fragment of plasmid pJF751 (11). Fragment 4 is an approximately 2149 base pair AccI-HindIII subfragment of SPV HindIII fragment M. The AccI sites of fragment 1 and fragment 4 were converted to a non-repetitive NotI site using a NotI linker.

Homology vector 744-34
Plasmid 744-34 was constructed to insert foreign DNA into SPV. This incorporates the equine herpesvirus type 1 gB gene flanked by SPV DNA and the E. coli β-galactosidase (lacZ) marker gene. Upstream of these foreign genes is an approximately 1484 base pair fragment of SPV DNA, and downstream of these foreign genes is an approximately 2149 base pair fragment of SPV DNA. By using this plasmid in accordance with the “homologous recombination procedure for generating recombinant SPV”, a virus containing the DNA encoding the foreign gene can be obtained. It is noted that the β-galactosidase (lacZ) marker gene is under the control of a synthetic late heel promoter (LP1) and the EHV-1 gB gene is under the control of a synthetic late / early heel promoter (LP2EP2). Details of this plasmid are shown in FIGS. 24A-24D. This plasmid can be constructed by using standard recombinant DNA techniques (22, 30) and ligating together restriction fragments derived from the following sources having the synthetic DNA base sequences shown in FIGS. 24A-24D. The plasmid vector was derived from an approximately 2972 base pair HindIII-BamHI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1484 base pair BglII-AccI restriction subfragment of SPV HindIII restriction fragment M (23). Fragment 2 is an approximately 2941 base pair fragment with EcoRI and PmeI restriction sites at the ends. Fragment 2 is an approximately 2941 base pair EcoRI-PmeI fragment. Fragment 2 is located within the BamHI “i” fragment of EHV-1 genomic DNA as well as an approximately 429 base pair PCR fragment having a natural BamHI site and a synthetic EcoRI site in the BamHI “a” fragment of EHV-1 genomic DNA at the 5 ′ end. Was synthesized as an approximately 2512 base pair restriction fragment (48) having BamHI-PmeI at the 3 'end. In preparing the 5 ′ end PCR fragment, the following primers were applied using a template consisting of an EHV-1 BamHI “a” and an “i” fragment. The first primer 5 / 94.3 (5′-CGGAATTCCCTCTGGTTGCCCGT-3 ′) (SEQ ID NO: 128) sits at the position of the second amino acid on the EHV-1 gB sequence, and 5 of the EHV-1 gB gene 'An EcoRI site is introduced at the end and an ATG start codon is introduced. The second primer 5 / 94.4 (5′-GACGGTGGATCCGGTAGGGCGGT-3 ′) (SEQ ID NO: 129) is located at approximately the 144th amino acid position on the opposite strand of primer 5 / 94.3 on the EHV-1 gB sequence. Sit and prime toward the 5 'end of the gene. The PCR product was digested with EcoRI and BamHI to generate a 429 base pair fragment corresponding in chain length to the 5 ′ end of the EHV-1 gB gene. Fragment 2 ligates the EHV-1 gB gene, which is an EcoRI-PmeI fragment of approximately 2941 base pairs (979 amino acids) in length by ligating the PCR reaction product (EcoRI-BamHI) and the restriction fragment (BamHI-PmeI). Generated. Fragment 3 is an approximately 3010 base pair BamHI-PvuII restriction fragment of plasmid pJF751 (11). Fragment 4 is an approximately 2149 base pair AccI-HindIII subfragment of SPV HindIII fragment M. The AccI sites of fragment 1 and fragment 4 were converted to a non-repetitive NotI site using a NotI linker.

Homology vector 744-38
Plasmid 744-38 was constructed to insert foreign DNA into SPV. This incorporates the equine herpesvirus type 1 gD gene flanked by SPV DNA and the E. coli β-galactosidase (lacZ) marker gene. Upstream of these foreign genes is an approximately 1484 base pair fragment of SPV DNA, and downstream of these foreign genes is an approximately 2149 base pair fragment of SPV DNA. By using this plasmid in accordance with the “homologous recombination procedure for generating recombinant SPV”, a virus containing the DNA encoding the foreign gene can be obtained. It is noted that the β-galactosidase (lacZ) marker gene is under the control of the synthetic late heel promoter (LP1) and the EHV-1 gD gene is under the control of the synthetic late / early heel promoter (LP2EP2). Details of this plasmid are shown in FIGS. 25A-25D. This plasmid can be constructed by using standard recombinant DNA techniques (22, 30) and ligating restriction fragments derived from the following sources having the synthetic DNA base sequences shown in FIGS. 25A-25D. The plasmid vector was derived from an approximately 2972 base pair HindIII-BamHI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1484 base pair BglII-AccI restriction subfragment of SPV HindIII restriction fragment M (23). Fragment 2 is an approximately 1240 base pair HindIII fragment within the BamHI “d” fragment (48) of EHV-1. Fragment 3 is an approximately 3010 base pair BamHI-PvuII restriction fragment of plasmid pJF751 (11). Fragment 4 is an approximately 2149 base pair AccI-HindIII subfragment of SPV HindIII fragment M. The AccI sites of fragment 1 and fragment 4 were converted to a non-repetitive NotI site using a NotI linker.

Homology vector 689-50.4
Plasmid 689-50.4 was constructed to insert foreign DNA into SPV. This incorporates an infectious sac disease virus (IBDV) polyprotein gene and an E. coli β-galactosidase (lacZ) marker gene flanked by SPV DNA. Upstream of these foreign genes is an approximately 1484 base pair fragment of SPV DNA, and downstream of these foreign genes is an approximately 2149 base pair fragment of SPV DNA. By using this plasmid in accordance with the “homologous recombination procedure for generating recombinant SPV”, a virus containing the DNA encoding the foreign gene can be obtained. It is noted that the β-galactosidase (lacZ) marker gene is under the control of the synthetic late promoter (LP1) and the IBDV polyprotein gene is under the control of the synthetic late / early promoter (LP2EP2). This plasmid can be constructed using standard recombinant DNA techniques (22, 30) by ligating restriction fragments from the following sources together. The plasmid vector was derived from an approximately 2972 base pair HindIII-BamHI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1484 base pair BglII-AccI restriction subfragment of SPV HindIII restriction fragment M (23). Fragment 2 is an approximately 3400 base pair fragment having SmaI and HpaI restriction sites at the ends derived from plasmid 2-84 / 2-40 (51). This fragment contains the sequence encoding the IBDV polyprotein. Fragment 3 is an approximately 3010 base pair BamHI-PvuII restriction fragment of plasmid pJF751 (11). Fragment 4 is an approximately 2149 base pair AccI-HindIII fragment of SPV HindIII fragment M. The ACCI sites of fragment 1 and fragment 4 were converted to a non-repetitive NotI site using a NotI linker.

Homology vector 689-50.7
Plasmid 689-50.7 was constructed to insert foreign DNA into SPV. This incorporates the infectious sac disease virus (IBDV) VP2 gene and the E. coli β-galactosidase (lacZ) marker gene flanked by SPV DNA. Upstream of these foreign genes is an approximately 1484 base pair fragment of SPV DNA, and downstream of these foreign genes is an approximately 2149 base pair fragment of SPV DNA. By using this plasmid in accordance with the “homologous recombination procedure for generating recombinant SPV”, a virus containing the DNA encoding the foreign gene can be obtained. It is noted that the β-galactosidase (lacZ) marker gene is under the control of the synthetic late heel promoter (LP1) and the IBDV VP2 gene is under the control of the synthetic late / early heel promoter (LP2EP2). This plasmid can be constructed using standard recombinant DNA techniques (22, 30) by ligating restriction fragments from the following sources together. The plasmid vector was derived from an approximately 2972 base pair HindIII-BamHI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1484 base pair BglII-AccI restriction subfragment of SPV HindIII restriction fragment M (23). Fragment 2 is an approximately 1081 base pair fragment with BclI and BamHI restriction sites at both ends. This fragment encodes the IBDV VP2 protein and is derived from the full length IBDV cDNA clone (51). Fragment 3 is an approximately 3010 base pair BamHI-PvuII restriction fragment of plasmid pJF751 (11). Fragment 4 is an approximately 2149 base pair AccI-HindIII subfragment of SPV HindIII fragment M. The ACCI sites of fragment 1 and fragment 4 were converted to a non-repetitive NotI site using a NotI linker.

Homology vector 751-07. A1
Plasmid 751-07. For inserting foreign DNA into SPV. A1 was used. This incorporates the chicken interferon (cIFN) gene flanked by SPV DNA and the E. coli β-galactosidase (lacZ) marker gene. By using this plasmid in accordance with the “homologous recombination procedure for generating recombinant SPV”, a virus containing the DNA encoding the foreign gene can be obtained. It is noted that the β-galactosidase (lacZ) marker gene is under the control of the synthetic late heel promoter (LP1) and the cIFN gene is under the control of the synthetic late / early heel promoter (LP2EP2). This homology vector was constructed by joining restriction fragments derived from the following sources having an appropriate synthetic DNA base sequence using standard recombinant DNA techniques (22, 30). The plasmid vector was derived from an approximately 2972 base pair HindIII-BamHI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1146 base pair BglII-AccI restriction subfragment of SPV HindIII restriction fragment M (23). Fragment 2 is an approximately 577 base pair EcoRI-encoding cIFN gene (54) derived from polymerase chain reaction (PCR) (Sambrook et al., 1989) as well as reverse transcription of RNA isolated from concanavalin A-stimulated chicken spleen cells. BglI fragment. The antisense primer (6 / 94.13) used for reverse transcription and PCR was 5'-CGAC GGATCC GAGGTGCGTTTGGGGCTAAGTGC-3 '(SEQ ID NO: 211). The sense primer (6 / 94.12) used for PCR was 5′-CCAC GGATCC AGCACAACCGGAGTCCCACATGGCT-3 ′ (SEQ ID NO: 212). The BamHI fragment obtained by reverse transcription and PCR was gel purified and used as a template for the second PCR reaction to introduce a non-repetitive EcoRI site at the 5 ′ end and a non-repetitive BglII site at the 3 ′ end. In the second PCR reaction, the primer 6 / 94.22 (5′-CCAC GAATTC GATGGCTGTGCCTGCAAGCCCCACAG-3 ′, SEQ ID NO: 213) was used at the 5 ′ end, and the primer 6 / 94.34 (5′-CGA AGATCT GAGGTGGTTGTGGGGCTAAGTG at the 3 ′ end. -3 ′, SEQ ID NO: 214) was used to produce an approximately 577 base pair fragment. This DNA fragment encodes from amino acid 1 to amino acid 193 of the chicken interferon protein (54) comprising 162 amino acids of the mature protein encoding chicken interferon and the amino terminal 31 amino acid signal sequence. Contains the sequence. Fragment 3 is an approximately 3002 base pair BamHI-PvuII restriction fragment of plasmid pJF751 (11). Fragment 4 is an approximately 2156 base pair AccI-HindIII restriction subfragment of SPV HindIII fragment M (23). The ACCI site of this SPV homology vector was converted to a non-repetitive NotI site.

Homology vector 751-56. A1
Plasmid 751-56. For inserting foreign DNA into SPV. A1 was used. This incorporates the chicken bone marrow monocyte growth factor (cMGF) gene and the E. coli β-galactosidase (lacZ) marker gene flanked by SPV DNA. By using this plasmid in accordance with the “homologous recombination procedure for generating recombinant SPV”, a virus containing the DNA encoding the foreign gene can be obtained. It is noted that the β-galactosidase (lacZ) marker gene is under the control of a synthetic late heel promoter (LP1), and the cMGF gene is under the control of a synthetic late / early heel promoter (LP2EP2). This homology vector was constructed by joining restriction fragments derived from the following sources having an appropriate synthetic DNA base sequence using standard recombinant DNA techniques (22, 30). The plasmid vector was derived from an approximately 2972 base pair HindIII-BamHI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1146 base pair BglII-AccI restriction subfragment of SPV HindIII restriction fragment M (23). Fragment 2 is an approximately 640 base pair EcoRI-encoding cMGF gene (55) derived from polymerase chain reaction (PCR) (Sambrook et al., 1989) as well as reverse transcription of RNA isolated from concanavalin A-stimulated chicken spleen cells. It is a BamHI fragment. The antisense primer (6 / 94.20) used for reverse transcription and PCR was 5'-CGCA GGATCC GGGGCGTCAGAGGCGGGCGAGGTG-3 '(SEQ ID NO: 215). The sense primer (6 / 94.5) used for PCR was 5′-GAGC GGATCC TGCAGGAGGAGACACAGAGCTG-3 ′ (SEQ ID NO: 216). The BamHI fragment derived from PCR was subcloned into a plasmid and used as a template for the second PCR reaction. In the second PCR reaction, the primer 6 / 94.16 (5'-GCGC GAATTC CAGTGCTGCCCTACCCCCTTGTG-3 ', SEQ ID NO: 217) was used at the 5' end, and the primer 6 / 94.20 (5'-CGCA GGATCC GGGGCGTGCAGGGGGGGGGGGGGGGGGGGGGGGGGGGGG -3 ′, SEQ ID NO: 218) was used to produce an approximately 640 base pair fragment. This DNA fragment contains a sequence encoding from the 1st amino acid to the 201st amino acid of cMGF protein (55) comprising 178 amino acids of the mature protein encoding cMGF and the amino acid terminal 23 amino acid signal sequence. contains. Fragment 3 is an approximately 3002 base pair BamHI-PvuII restriction fragment of plasmid pJF751 (11). Fragment 4 is an approximately 2156 base pair AccI-HindIII restriction subfragment of SPV HindIII fragment M (23). The AccI site of this SPV homology vector was converted to a non-repetitive NotI site.

Homology vector 752-22.1
Plasmid 752-22.1 was constructed to insert foreign DNA into SPV. This incorporates the E. coli β-galactosidase (lacZ) marker gene flanked by SPV DNA. Upstream of the foreign gene is an approximately 855 base pair fragment of SPV DNA, and downstream of the foreign gene is an approximately 1113 base pair fragment of SPV DNA. By using this plasmid in accordance with the “homologous recombination procedure for generating recombinant SPV”, a virus containing the DNA encoding the foreign gene can be obtained. It is noted that the β-galactosidase (lacZ) marker gene is under the control of the swinepox virus O1L gene promoter. The homology vector also contains a synthetic late / early promoter (LP2EP2) in which a second foreign gene is inserted into the non-repetitive BamHI or EcoRI site. Details of this plasmid are shown in FIGS. 28A-28D. This plasmid was constructed by joining restriction fragments derived from the following sources having the synthetic DNA base sequences shown in FIGS. 28A-28D using standard recombinant DNA techniques (22, 30). The plasmid vector was derived from an approximately 2519 base pair HindIII-SphI restriction fragment of pSP65 (Promega). Fragment 1 is an approximately 855 base pair subfragment of SPV HindIII restriction fragment M (23). That is, using DNA primers 5'-GAA GCATGC CCGTTCTTTACAATAGTTTTAGTCGAAAATA-3 '(SEQ ID NO: 185) and 5'-CATA AGACT GGCATTGGTTTATTATATACAAAAAATAAG-3' (SEQ ID NO: 186), I was subjected to the polymerase chain reaction in the same way as ph. A 855 base pair fragment was synthesized. Fragment 2 is a 3002 base pair BamHI-PvuII fragment derived from plasmid pJF751 (49) containing the E. coli lacZ gene. Fragment 3 is an approximately 1113 base pair subfragment of SPV HindIII fragment M. That, 5'-CCGTA GTCGAC AAAGATCGACTTATTAATATGTATGGGATT-3 is a DNA primer '(SEQ ID NO: 187) and 5'-GCCTG AAGCTT CTAGTACAGTATTTACGACTTTTGAAAT-3' ( SEQ ID NO: 188) HindIII terminus SalI parallel performing a polymerase chain reaction using a A 1113 base pair fragment was synthesized.

Homologous vector 752-29.33
Plasmid 752-29.33 was constructed to insert foreign DNA into SPV. This incorporates the equine herpesvirus type 1 gB gene flanked by SPV DNA and the E. coli β-galactosidase (lacZ) marker gene. Upstream of this foreign gene is an approximately 855 base pair fragment of SPV DNA, and downstream of these foreign genes is an approximately 113 base pair fragment of SPV DNA. By using this plasmid in accordance with the “homologous recombination procedure for generating recombinant SPV”, a virus containing the DNA encoding the foreign gene can be obtained. It is noted that the β-galactosidase (lacZ) marker gene is under the control of the swinepox virus O1L gene promoter and the EHV-1 gB gene is under the control of the late / early promoter (LP2EP2). The LP2EP2 promoter / EHV-1 gB gene cassette was inserted into the NotI site of the cognate vector 738-94.4. The cognate vector 752-29.33 was constructed using standard recombinant DNA techniques (22, 30) by ligating together restriction fragments from the following sources having synthetic DNA base sequences. The plasmid vector was derived from an approximately 2519 base pair HindIII-SphI restriction fragment of pSP65 (Promega). Fragment 1 is an approximately 855 base pair subfragment of SPV HindIII restriction fragment M (23). That is, 5′-GAAGCATGCCCGTTCTTATTCAATAGTTTTAGTCGAAAATA-3 ′ (SEQ ID NO: 185) and 5′-CATAAGATCTGGCATTGGTTTATATACACTAACAAAAATAATAAG-3 ′ (SEQ ID NO: 186), which are DNA primers, are used to form a base II which has a base of 8 B Paired fragments were synthesized. Fragment 2 is a 3002 base pair BamHI-PvuII fragment derived from plasmid pJF751 (49) containing the E. coli lacZ gene. Fragment 3 ligates the EHV-1 gB gene, which is an EcoRI-PmeI fragment of approximately 2941 base pairs (979 amino acids) in length by ligating the PCR reaction product (EcoRI-BamHI) and the restriction fragment (BamHI-PmeI). Generated. The PCR fragment is an approximately 429 base pair fragment having a natural BamHI site at the 3 ′ end in the BamHI “a” fragment of EHV-1 genomic DNA and a synthetic EcoRI site at the 5 ′ end of the gene. The restriction fragment is an approximately 2512 base pair fragment from BamHI to PmeI in the BamHI “I” fragment of EHV-1 genomic DNA. In preparing the 5 ′ end PCR fragment, the following primers were applied using a template consisting of an EHV-1 BamHI “a” and an “i” fragment. The first primer 5 / 94.3 (5′-CGGAATTCCCTCTGGTTCGCCGT-3 ′) (SEQ ID NO: 128) sits at the position of the second amino acid on the EHV-1 gB sequence and 5 of the EHV-1 gB gene. 'An EcoRI site is introduced at the end and an ATG start codon is introduced. The second primer 5 / 94.4 (5′-GACGGTGGATCCGGTAGGGCGGT-3 ′) (SEQ ID NO: 129) is located at approximately the 144th amino acid position on the opposite strand of primer 5 / 94.3 on the EHV-1 gB sequence. Sit and prime toward the 5 'end of the gene. The PCR product was digested with EcoRI and BamHI to generate a 429 base pair fragment corresponding in chain length to the 5 ′ end of the EHV-1 gB gene. As described above, fragment 3 is an EHV that is an EcoRI-PmeI fragment having a chain length of approximately 2941 base pairs (979 amino acids) by ligating a PCR reaction product (EcoRI-BamHI) and a restriction fragment (BamHI-PmeI). -1 A gene that generates the gB gene. Fragment 4 is an approximately 1113 base pair subfragment of SPV HindIII fragment M. That, 5'-CCGTA GTCGAC AAAGATCGACTTATTAATATGTATGGGATT-3 is a DNA primer '(SEQ ID NO: 187) and 5'-GCCTG AAGCTT CTAGTACAGTATTTACGACTTTTGAAAT-3' ( SEQ ID NO: 188) HindIII terminus SalI parallel performing a polymerase chain reaction using a A 1113 base pair fragment was synthesized.

Homology vector 746-94.1
Plasmid 746-94.1 was constructed to insert foreign DNA into SPV. This incorporates the infectious bovine rhinotracheitis virus glycoprotein E (gE) gene and the E. coli β-galactosidase (lacZ) marker gene flanked by SPV DNA. Upstream of this foreign gene is an approximately 855 base pair fragment of SPV DNA, and downstream of these foreign genes is an approximately 1113 base pair fragment of SPV DNA. By using this plasmid in accordance with the “homologous recombination procedure for generating recombinant SPV”, a virus containing the DNA encoding the foreign gene can be obtained. It is noted that the β-galactosidase (lacZ) marker gene is under the control of the swinepox virus O1L gene promoter and the IBRV gE gene is under the control of the late / early promoter (LP2EP2). This plasmid was constructed by linking together restriction fragments derived from the following sources having a synthetic DNA base sequence using standard recombinant DNA techniques (22, 30). A 1250 base pair EcoRI-BamHI fragment encoding the 1st to 417th amino acids of the IBRV gE gene (lack of 158 amino acids in the carboxy-terminal inner and outer regions) is represented by homology vector 752-22.1 (28A-28D). (Figure) was inserted into the BamHI site as well as the non-repetitive EcoRI. The above 1250 base pair EcoRI-BamHI fragment uses IBRV (Cooper) genomic DNA as a template, and primer 10 / 94.23 (5′-GGG GAATTC AATGCAACCCCACCGCGCCCCCCC-3 ′; SEQ ID NO: 219) is 5 ′ of the IBRV gE gene. Polymerase chain reaction (15) using the terminal (first amino acid) and primer 10 / 94.22 (5′-GGG GGATCC TAGGGCGGCCCGCCGCGCTCGCT-3 ′; SEQ ID NO: 220) at the 417th amino acid of the IBRV gE gene And synthesized.

Homology vector 767-67.3
Plasmid 767-67.3 was constructed to insert foreign DNA into SPV. This incorporates the bovine viral diarrhea virus glycoprotein 53 (BVDV gp53) gene and the E. coli β-galactosidase (lacZ) marker gene flanked by SPV DNA. Upstream of this foreign gene is an approximately 855 base pair fragment of SPV DNA, and downstream of these foreign genes is an approximately 1113 base pair fragment of SPV DNA. By using this plasmid in accordance with the “homologous recombination procedure for generating recombinant SPV”, a virus containing the DNA encoding the foreign gene can be obtained. It is noted that the β-galactosidase (lacZ) marker gene is under the control of the swinepox virus O1L gene promoter and the BVDV gp53 gene is under the control of the late / early promoter (LP2EP2). This plasmid was constructed by linking together restriction fragments derived from the following sources having a synthetic DNA base sequence using standard recombinant DNA techniques (22, 30). A 1187 base pair BamHI fragment encoding BVDV gp53 was inserted into each non-repetitive BamHI site of homology vector 752-22.1 (Figures 28A-28D). The 1187 base pair BamHI fragment was synthesized by the polymerase chain reaction (15) described in “Cloning of gp53 gene as well as bovine viral diarrhea virus gp48”.

Homology vector 771-55.11
Plasmid 771-55.11 was constructed to insert foreign DNA into SPV. This incorporates the bovine viral diarrhea virus glycoprotein 48 (BVDV gp48) gene and the E. coli β-galactosidase (lacZ) marker gene flanked by SPV DNA. Upstream of this foreign gene is an approximately 855 base pair fragment of SPV DNA, and downstream of these foreign genes is an approximately 1113 base pair fragment of SPV DNA. By using this plasmid in accordance with the “homologous recombination procedure for generating recombinant SPV”, a virus containing the DNA encoding the foreign gene can be obtained. It is noted that the β-galactosidase (lacZ) marker gene is under the control of the swinepox virus O1L gene promoter and the BVDV gp48 gene is under the control of the late / early promoter (LP2EP2). This plasmid was constructed by linking together restriction fragments derived from the following sources having a synthetic DNA base sequence using standard recombinant DNA techniques (22, 30). A 678 base pair BamHI fragment encoding BVDV gp48 was inserted into each non-repetitive BamHI site of homologous vector 752-22.1 (Figures 28A-28D). The 678 base pair BamHI fragment was synthesized by the polymerase chain reaction (15) described in “Cloning of gp53 gene along with bovine viral diarrhea virus gp48”.

Homology vector 551-47.23
Plasmid 551-47.23 was constructed to insert foreign DNA into SPV. This plasmid incorporates an E. coli β-glucuronidase (β-glu) marker gene under the control of the late / early epilepsy promoter (LP2EP2). It is useful to produce the recombinant swinepox virus by inserting the marker gene into the SPV genome. This plasmid was constructed by ligating restriction fragments from the following sources using standard recombinant DNA techniques (22, 30). The plasmid vector was derived from an approximately 3005 base pair HindIII restriction fragment of pSP65 (Promega). Fragment 1 is an approximately 1823 base pair EcoRI-SmaI fragment of plasmid pRAJ260 (Clonetech). It is noted that the EcoRI and SmaI sites were introduced by PCR cloning. Recombinant swinepox virus S-SPV-059, S-SPV-060, S-SPV-061 and S-SPV-062 were produced using plasmid 551-47.23.

Homology vector 779-94.31
Plasmid 779-94.31 was constructed to insert foreign DNA into SPV. This incorporates the pseudorabies virus (PRV) gB (gII) gene and the E. coli β-galactosidase (lacZ) marker gene flanked by SPV DNA. Upstream of these foreign genes is an approximately 538 base pair fragment of SPV DNA, and downstream of these foreign genes is an approximately 1180 base pair fragment of SPV DNA. By using this plasmid in accordance with the “homologous recombination procedure for generating recombinant SPV”, a virus containing the DNA encoding the foreign gene can be obtained. It is noted that the β-galactosidase (lacZ) marker gene is under the control of the synthetic late heel promoter (LP1) and the PRV gB gene is under the control of the synthetic late / early heel promoter (LP2EP2). Details of this plasmid are shown in FIGS. 30A-30E. This plasmid was constructed using standard recombinant DNA techniques (22, 30) by ligating together restriction fragments derived from the following sources having a synthetic DNA base sequence. The plasmid vector was derived from an approximately 2986 base pair HindIII-PstI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 542 base pair HindIII-BglII restriction subfragment of SPV HindIII restriction fragment M (23). Fragment 2 is an approximately 3500 base pair fragment containing the sequence encoding the PRV gB gene within the KpnIC fragment (21) of genomic PRV DNA. Fragment 2 consists of an approximately 53 base pair synthetic fragment containing the amino terminus of the PRV gB gene, an approximately 78 base pair SmaI-NheI fragment derived from the PRV KpnI C genomic fragment, and an approximately 3370 base pair NheI-derived from the PRV KpnI C genomic fragment. An EcoRI fragment (21). Fragment 3 is an approximately 3010 base pair BamHI-PvuII restriction fragment of plasmid pJF751 (11). Fragment 4 is an approximately 1180 base pair BglII-PstI subfragment of SPV HindIII fragment M. The BglII site of fragment 1 and fragment 4 was converted to a nonrepeated HindIII site using a HindIII linker.

Homology vector 789-41.7
Plasmid 789-41.7 was constructed to insert foreign DNA into SPV. This incorporates the E. coli β-galactosidase (lacZ) marker gene as well as the pseudorabies virus (PRV) gB (gII) gene and PRV gD (g50) gene flanked by SPV DNA. Upstream of these foreign genes is an approximately 1484 base pair fragment of SPV DNA, and downstream of these foreign genes is an approximately 1560 base pair fragment of SPV DNA. By using this plasmid in accordance with the “homologous recombination procedure for generating recombinant SPV”, a virus containing the DNA encoding the foreign gene can be obtained. The β-galactosidase (lacZ) marker gene is under the control of the late synthetic promoter (LP1), the PRV gB gene is under the control of the synthetic late / early promoter (LP2EP2), and the PRV gD gene is early in the synthesis. It is noted that it is under the control of the / late late promoter (EP1LP2). Details of this plasmid are shown in FIGS. 31A-31D. This plasmid was constructed using standard recombinant DNA techniques (22, 30) by ligating together restriction fragments derived from the following sources having a synthetic DNA base sequence. The plasmid vector was derived from an approximately 2972 base pair HindIII-BamHI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1484 base pair BglII-AccI restriction subfragment of SPV HindIII restriction fragment M (23). Fragment 2 is an approximately 1552 base pair subfragment of the PRV BamHI # 7 fragment containing the sequence encoding the 3rd to 279th amino acids of the PRV gD gene. The EcoRI site and ATG translation initiation codon are derived from the polymerase chain reaction using a 5 ′ primer with an EcoRI site. The 3 ′ terminal StuI site is usually within the PRV gI gene 3′-PRV gD gene. The entire open reading frame starting at the EcoRI site encodes 405 amino acids. Fragment 3 is an approximately 48 base pair AccI-NdeI subfragment of the SPV HindIII M fragment. Fragment 4 is an approximately 3500 base pair fragment containing the sequence encoding the PRV gB gene within the KpnI C fragment of genomic PRV DNA (21). Fragment 4 consists of an approximately 53 base pair synthetic fragment containing the amino terminus of the PRV gB gene, an approximately 78 base pair SmaI-NheI fragment derived from the PRV KpnI C genomic fragment, and an approximately 3370 base pair NheI-derived from the PRV KpnI C genomic fragment. An EcoRI fragment (21). Fragment 5 is an approximately 3010 base pair BamHI-PvuII restriction fragment of plasmid pJF751 (11). Fragment 6 is an approximately 1560 base pair NdeI-HindIII subfragment of SPV HindIII fragment M. Fragment 1 and Fragment 3 AccI sites were converted to non-repetitive PstI sites using a PstI linker. The NdeI site of fragment 3 and fragment 6 was converted to a repeat HindIII site using a HindIII linker. An approximately 545 base pair NdeI-NdeI subfragment (nucleotide numbers 1560 to 2104; SEQ ID NO :) of the SPV HindIIIM fragment extending to SPV fragments 3 and 6 was deleted.

Homology vector 789-41.27
Plasmid 789-41.27 was constructed to insert foreign DNA into SPV. This incorporates the E. coli β-galactosidase (lacZ) marker gene as well as the pseudorabies virus (PRV) gB (gII) gene and PRV gC (gIII) gene flanked by SPV DNA. Upstream of these foreign genes is an approximately 1560 base pair fragment of SPV DNA, and downstream of these foreign genes is an approximately 1484 base pair fragment of SPV DNA. By using this plasmid in accordance with the “homologous recombination procedure for generating recombinant SPV”, a virus containing the DNA encoding the foreign gene can be obtained. The β-galactosidase (lacZ) marker gene is under the control of the late synthetic promoter (LP1), the PRV gB gene is under the control of the synthetic late / early promoter (LP2EP2), and the PRV gC gene is early in the synthesis. It is noted that it is under the control of the / late late promoter (EP1LP2) Details of this plasmid are shown in FIGS. 32A-32D. This plasmid was constructed using standard recombinant DNA techniques (22, 30) and ligating restriction fragments derived from the following sources having the indicated synthetic DNA base sequences. The plasmid vector was derived from an approximately 2972 base pair HindIII-BamHI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1560 base pair HindIII-BamHI restriction subfragment of SPV HindIII fragment M. Fragment 2 is an approximately 3500 base pair fragment containing the sequence encoding the PRV gB gene within the KpnIC fragment (21) of genomic PRV DNA. Fragment 2 consists of an approximately 53 base pair synthetic fragment containing the amino terminus of the PRV gB gene, an approximately 78 base pair SmaI-NheI fragment derived from the PRV KpnI C genomic fragment, and an approximately 3370 base pair NheI-derived from the PRV KpnI C genomic fragment. An EcoRI fragment (21). Fragment 3 is an approximately 3010 base pair BamHI-PvuII restriction fragment of plasmid pJF751 (11). Fragment 4 is an approximately 48 base pair AccI-NdeI subfragment of the SPV HindIIIM fragment. Fragment 5 is PRV BamHI # 2 as well as plasmid 251-41. A approximately 2378 base pair NcoI-NcoI fragment of A. The NcoI site at the end of this fragment was replaced with an EcoRI linker. Fragment 6 is an approximately 1484 base pair AccI-BglII restriction subfragment of SPV HindIII restriction fragment M (23). The NdeI sites of fragment 1 and fragment 4 were converted to a nonrepeated HindIII site using a HindIII linker. The AccI sites of fragment 4 and fragment 6 were converted to a non-repetitive PstI site using a PstI linker. An approximately 545 base pair NdeI-NdeI subfragment (nucleotide numbers 1560 to 2104; SEQ ID NO :) of the SPV HindIIIM fragment that spanned SPV fragments 4 and 6 was deleted.

Homology vector 789-41.47
Plasmid 789-41.47 was constructed to insert foreign DNA into SPV. This incorporates the E. coli β-galactosidase (lacZ) marker gene as well as the pseudorabies virus (PRV) gC (gIII) gene and PRV gD (g50) gene flanked by SPV DNA. Upstream of these foreign genes is an approximately 1484 base pair fragment of SPV DNA, and downstream of these foreign genes is an approximately 1560 base pair fragment of SPV DNA. By using this plasmid in accordance with the “homologous recombination procedure for generating recombinant SPV”, a virus containing the DNA encoding the foreign gene can be obtained. The β-galactosidase (lacZ) marker gene is under the control of the synthetic late cocoon promoter (LP1), the PRV gC gene is under the control of the synthetic early / late cocoon promoter (EP1LP2), and the PRV gD gene is also synthesized early. It is noted that it is under the control of the / late late promoter (EP1LP2). Details of this plasmid are shown in FIGS. 33A-33D. This plasmid was constructed using standard recombinant DNA techniques (22, 30) by ligating together restriction fragments derived from the following sources having a synthetic DNA base sequence. The plasmid vector was derived from an approximately 2972 base pair HindIII-BamHI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1484 base pair BglII-AccI restriction subfragment of SPV HindIII restriction fragment M (23). Fragment 2 is an approximately 1552 base pair subfragment of the PRV BamHI # 7 fragment containing the sequence encoding the 3rd to 279th amino acids of the PRV gD gene. The EcoRI site and ATG translation initiation codon are derived from the polymerase chain reaction using a 5 ′ primer with an EcoRI site. The 3 ′ terminal StuI site is usually within the PRV gI gene 3′-PRV gD gene. The entire open reading frame starting at the EcoRI site encodes 405 amino acids. Fragment 3 is an approximately 48 base pair AccI-NdeI subfragment of the SPV HindIII M fragment. Fragment 4 is an approximately 3010 base pair BamHI-PvuII restriction fragment of plasmid pJF751 (11). Fragment 5 is PRV BamHI # 2 as well as plasmid 251-41. A approximately 2378 base pair NcoI-NcoI fragment of A. The NcoI site at the end of this fragment was replaced with an EcoRI linker. Fragment 6 is an approximately 1560 base pair NdeI-HindIII subfragment of SPV HindIII fragment M. Fragment 1 and Fragment 3 AccI sites were converted to non-repetitive PstI sites using a PstI linker. The NdeI site of fragment 3 and fragment 6 was converted to a repeat HindIII site using a HindIII linker. An approximately 545 base pair NdeI-NdeI subfragment (nucleotide numbers 1560 to 2104; SEQ ID NO :) of the SPV HindIIIM fragment extending to SPV fragments 3 and 6 was deleted.

Homology vector 789-41.73
Plasmid 789-41.73 was constructed to insert foreign DNA into SPV. This incorporates the E. coli β-galactosidase (lacZ) marker gene as well as the pseudorabies virus (PRV) gB (gII) gene, PRV gC (gIII) gene and PRV gD (g50) gene flanked by SPV DNA. Upstream of these foreign genes is an approximately 1484 base pair fragment of SPV DNA, and downstream of these foreign genes is an approximately 1560 base pair fragment of SPV DNA. By using this plasmid in accordance with the “homologous recombination procedure for generating recombinant SPV”, a virus containing the DNA encoding the foreign gene can be obtained. The β-galactosidase (lacZ) marker gene is under the control of the late synthetic promoter (LP1), the PRV gB gene is under the control of the synthetic late / early promoter (LP2EP2), and the PRV gC gene is early in the synthesis. It is noted that the PRV gD gene is under the control of the late / early heel promoter (LP2EP2). Details of this plasmid are shown in FIGS. 34A-34E. This plasmid was constructed using standard recombinant DNA techniques (22, 30) by ligating together restriction fragments derived from the following sources having a synthetic DNA base sequence. The plasmid vector was derived from an approximately 2972 base pair HindIII-BamHI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1484 base pair BglII-AccI restriction subfragment of SPV HindIII fragment M (23). Fragment 2 is an approximately 1552 base pair subfragment of the PRV BamHI # 7 fragment containing the sequence encoding the 3rd to 279th amino acids of the PRV gD gene. The EcoRI site and ATG translation initiation codon are derived from the polymerase chain reaction using a 5 ′ primer with an EcoRI site. The 3 ′ terminal StuI site is usually within the PRV gI gene 3′-PRV gD gene. The entire open reading frame starting at the EcoRI site encodes 405 amino acids. Fragment 3 is the plasmid 251-41.. Which is a subfragment of PRV BamHI # 2 as well as # 9. A approximately 2378 base pair NcoI-NcoI fragment of A. The NcoI site at the end of this fragment was replaced with an EcoRI linker. Fragment 4 is an approximately 48 base pair AccI-NdeI subfragment of the SPV HindIII M fragment. Fragment 5 is an approximately 3500 base pair fragment containing the sequence encoding the PRV gB gene within the KpnI C fragment of genomic PRV DNA (21). Fragment 5 consists of an approximately 53 base pair synthetic fragment containing the amino terminus of the PRV gB gene, an approximately 78 base pair SmaI-NheI fragment derived from the PRV KpnI C genomic fragment, and an approximately 3370 base pair NheI− derived from the PRV KpnI C genomic fragment. An EcoRI fragment (21). Fragment 6 is an approximately 3010 base pair BamHI-PvuII restriction fragment of plasmid pJF751 (11). Fragment 7 is an approximately 1560 base pair NdeI-HindIII subfragment of SPV HindIII fragment M. Fragment 1 and Fragment 3 AccI sites were converted to non-repetitive PstI sites using a PstI linker. The NdeI site of fragment 3 and fragment 6 was converted to a repeat HindIII site using a HindIII linker. The approximately 545 base pair NdeI-NdeI subfragment (nucleotide numbers 1560 to 2104; SEQ ID NO:) of the SPV HindIII M fragment extending to SPV fragments 3 and 6 was deleted.

Homology vector 791-63.19
Plasmid 791-63.19 was constructed to insert foreign DNA into SPV. This incorporates the E. coli β-galactosidase (lacZ) marker gene flanked by SPV DNA. Upstream of the foreign gene is an approximately 1484 base pair fragment of SPV DNA, and downstream of the foreign gene is an approximately 2149 base pair fragment of SPV DNA. By using this plasmid in accordance with the “homologous recombination procedure for generating recombinant SPV”, a virus containing the DNA encoding the foreign gene can be obtained. It is noted that the β-galactosidase (lacZ) marker gene is under the control of the synthetic late heel promoter (LP1). This plasmid was constructed using standard recombinant DNA techniques (22, 30) by ligating together restriction fragments derived from the following sources having a synthetic DNA base sequence. The plasmid vector was derived from an approximately 2972 base pair HindIII-BamHI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1484 base pair BglII-AccI restriction subfragment of SPV HindIII restriction fragment M (23). Fragment 2 is an approximately 3010 base pair BamHI-PvuII restriction fragment of plasmid pJF751 (11). Fragment 3 is an approximately 2149 base pair AccI-HindIII subfragment of SPV HindIII fragment M. The ACCI sites of fragment 1 and fragment 3 were converted to a non-repetitive NotI site using a NotI linker.

Homology vector 791-63.41
Plasmid 791-63.41 was constructed to insert foreign DNA into SPV. This incorporates the E. coli β-galactosidase (lacZ) marker gene flanked by SPV DNA. Upstream of the foreign gene is an approximately 1484 base pair fragment of SPV DNA, and downstream of the foreign gene is an approximately 2149 base pair fragment of SPV DNA. By using this plasmid in accordance with the “homologous recombination procedure for generating recombinant SPV”, a virus containing the DNA encoding the foreign gene can be obtained. It is noted that the β-galactosidase (lacZ) marker gene is under the control of the synthetic late heel promoter (LP1). This plasmid was constructed using standard recombinant DNA techniques (22, 30) by ligating together restriction fragments derived from the following sources having a synthetic DNA base sequence. The plasmid vector was derived from an approximately 2972 base pair HindIII-BamHI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1484 base pair BglII-AccI restriction subfragment of SPV HindIII restriction fragment M (23). Fragment 2 is an approximately 3010 base pair BamHI-PvuII restriction fragment of plasmid pJF751 (11). Fragment 3 is an approximately 2149 base pair AccI-HindIII subfragment of SPV HindIII fragment M. The ACCI sites of fragment 1 and fragment 3 were converted to a non-repetitive NotI site using a NotI linker.

Homology vector 796-18.9
Plasmid 796-18.9 was constructed to insert foreign DNA into SPV. This incorporates the E. coli β-galactosidase (lacZ) marker gene flanked by SPV DNA. Upstream of the foreign gene is an approximately 1484 base pair fragment of SPV DNA, and downstream of the foreign gene is an approximately 2149 base pair fragment of SPV DNA. By using this plasmid in accordance with the “homologous recombination procedure for generating recombinant SPV”, a virus containing the DNA encoding the foreign gene can be obtained. It is noted that the β-galactosidase (lacZ) marker gene is under the control of a synthetic early selection promoter (EP1). This plasmid was constructed using standard recombinant DNA techniques (22, 30) by ligating together restriction fragments derived from the following sources having a synthetic DNA base sequence. The plasmid vector was derived from an approximately 2972 base pair HindIII-BamHI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1484 base pair BglII-AccI restriction subfragment of SPV HindIII restriction fragment M (23). Fragment 2 is an approximately 3010 base pair BamHI-PvuII restriction fragment of plasmid pJF751 (11). Fragment 3 is an approximately 2149 base pair AccI-HindIII subfragment of SPV HindIII fragment M. The ACCI sites of fragment 1 and fragment 3 were converted to a non-repetitive NotI site using a NotI linker.

Homology vector 783-39.2
Plasmid 783-39.2 was constructed to insert foreign DNA into SPV. This incorporates the bovine viral diarrhea virus glycoprotein 53 (BVDV gp53) gene and the E. coli β-galactosidase (lacZ) marker gene flanked by SPV DNA. Upstream of the foreign gene is an approximately 1484 base pair fragment of SPV DNA, and downstream of these foreign genes is an approximately 2149 base pair fragment of SPV DNA. By using this plasmid in accordance with the “homologous recombination procedure for generating recombinant SPV”, a virus containing the DNA encoding the foreign gene can be obtained. It is noted that the β-galactosidase (lacZ) marker gene is under the control of the late promoter (LP1) and the BVDV gp53 gene is under the control of the late / early promoter (LP2EP2). This plasmid was constructed using standard recombinant DNA techniques (22, 30) by ligating together restriction fragments derived from the following sources having synthetic DNA base sequences. The plasmid vector was derived from an approximately 2972 base pair HindIII-BamHI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1484 base pair BglII-AccI restriction subfragment of SPV HindIII restriction fragment M (23). Fragment 2 is an approximately 1187 base pair BamHI fragment encoding BVDV gp53. This 1187 base pair BamHI fragment was synthesized by polymerase chain reaction (15) described in “Cloning of gp53 gene along with bovine viral diarrhea virus gp48”. Fragment 3 is an approximately 3010 base pair BamHI-PvuII restriction fragment of plasmid pJF751 (11). Fragment 4 is an approximately 2149 base pair AccI-HindIII subfragment of SPV HindIII fragment M. The AccI sites of fragment 1 and fragment 4 were converted to a non-repetitive NotI site using a NotI linker.

Homology vector 749-75.78
Plasmid 749-75.78 was constructed to insert foreign DNA into SPV. This incorporates the infectious sac disease virus (IBDV) polymerase gene and the E. coli β-galactosidase (lacZ) marker gene flanked by SPV DNA. Upstream of these foreign genes is an approximately 1484 base pair fragment of SPV DNA, and downstream of these foreign genes is an approximately 2149 base pair fragment of SPV DNA. By using this plasmid in accordance with the “homologous recombination procedure for generating recombinant SPV”, a virus containing the DNA encoding the foreign gene can be obtained. It is noted that the β-galactosidase (lacZ) marker gene is under the control of the late synthetic epilepsy promoter (LP1) and the IBDV polymerase gene is under the control of the late synthetic / early promoter (LP2EP2). This plasmid was constructed using standard recombinant DNA techniques (22, 30) by ligating together restriction fragments derived from the following sources having a synthetic DNA base sequence. The plasmid vector was derived from an approximately 2972 base pair HindIII-BamHI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1484 base pair BglII-AccI restriction subfragment of SPV HindIII restriction fragment M (23). Fragment 2 is an approximately 2700 base pair EcoRI-AscI restriction fragment synthesized by polymerase chain reaction (PCR) from IBDV RNA template and cDNA cloning. Using cDNA and PCR primer (5′-CAC GAATTC TGACATTTCACAGATCCCACAGGCGC-3 ′; 12 / 93.4) (SEQ ID NO :) and (5′-GCTGTGGACATCACGGGCCAGGG-3 ′; 9 / 93.28) (SEQ ID NO :) Thus, an approximately 1400 base pair EcoRI-BclI fragment was synthesized at the 5 ′ end of the IBDV polymerase gene. In addition, cDNA and PCR primer (5′-ACCCGGAACATATGGTCAGCTCCAT-3 ′; 12 / 93.2) (SEQ ID NO :) and (5′- GGCGCGCC AGGCGAAGGCCGGGGATACCG-3 ′; 12 / 93.3) (SEQ ID NO :) An approximately 1800 base pair BclI-AscI fragment was synthesized at the 3 ′ end of the IBDV polymerase gene. These two fragments were ligated at the BclI site to produce an approximately 2700 base pair EcoRI-BclI fragment. Fragment 3 is an approximately 3010 base pair BamHI-PvuII restriction fragment of plasmid pJF751 (11). Fragment 4 is an approximately 2149 base pair AccI-HindIII subfragment of SPV HindIII fragment M. The AccI sites of fragment 1 and fragment 4 were converted to a non-repetitive NotI site using a NotI linker.

Homology vector 761-75. B18
In order to insert foreign DNA into SPV, plasmid 761-75. B18 was constructed. This incorporates the feline immunodeficiency virus (FIV) protease (gag) gene and the E. coli β-galactosidase (lacZ) marker gene flanked by SPV DNA. Upstream of this foreign gene is an approximately 855 base pair fragment of SPV DNA, and downstream of these foreign genes is an approximately 1113 base pair fragment of SPV DNA. By using this plasmid in accordance with the “homologous recombination procedure for generating recombinant SPV”, a virus containing the DNA encoding the foreign gene can be obtained. It is noted that the β-galactosidase (lacZ) marker gene is under the control of the swinepox virus OLL gene promoter and the FIV gag gene is under the control of the late / early promoter (LP2EP2). This homology vector was constructed using the standard recombinant DNA technology (22, 30) and binding restriction fragments derived from the following sources having a synthetic DNA base sequence to each other. The plasmid vector was derived from an approximately 2519 base pair HindIII-SphI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 855 base pair subfragment of SPV HindIII restriction fragment M (23). That is, a polymerase chain reaction using DNA primers 5'-GAAGCATGCCCGTTCTTATCAATAGTTTTAGTCGAAAATA-3 '(SEQ ID NO: 185) and 5'-CATAAGATCTGGCATTGTTTATATACATAACAAAAAAATAAG-3' (SEQ ID NO: 186) was carried out to form a pair of bases that have 8 base pairs in the same manner as the base of SphI. Fragments were synthesized. Fragment 2 is a 3002 base pair BamHI-PvuII fragment derived from plasmid pJF751 (49) containing the E. coli lacZ gene. Fragment 3 is an approximately 1878 base pair EcoRI-BglII restriction fragment synthesized by polymerase chain reaction (PCR) using cDNA derived from FIV (PPR strain) (61). The primer (5′-GCGT GAATTC GGGGAATGGACAGGGGCGAGAT-3 ′; 11 / 94.9) (SEQ ID NO :) was synthesized from the 5 ′ end of the FIV gag gene, and an EcoRI site was added to the 5 ′ end of this gene and an ATG start codon was further added. Introduce. The primer (5′-GAGCC AGATCT GCTCTTTTTACTTTCCCC-3 ′; 11 / 94.10) (SEQ ID NO :) is synthesized from the 3 ′ end of the FIV gag gene. The PCR product was digested with EcoRI and BglII to generate a 1878 base pair fragment of chain length corresponding to the FIV gag gene. Fragment 4 is an approximately 1113 base pair subfragment of SPV HindIII fragment M. Specifically, a polymerase chain reaction using DNA primers 5'-CCGTTAGTCGACAAAGATCGACTACTTAATATATGTATGGGATT-3 '(SEQ ID NO: 187) and 5'-GCCTGAAGCTTCTAGTACAGTATTTACGAACTTTTTGAAAT-3' (SEQ ID NO: 188) was performed to make a SalI and HindIII base pair having SalI and HindIII base pair Was synthesized.

Homology vector 781-84. C11
Plasmid 781-84. For inserting foreign DNA into SPV. C11 was used. This incorporates the feline immunodeficiency virus (FIV) envelope (env) gene and E. coli β-galactosidase (lacZ) marker gene flanked by SPV DNA. By using this plasmid in accordance with the “homologous recombination procedure for generating recombinant SPV”, a virus containing the DNA encoding the foreign gene can be obtained. It is noted that the β-galactosidase (lacZ) marker gene is under the control of the synthetic late heel promoter (LP1) and the FIV env gene is under the control of the synthetic late / early heel promoter (LP2EP2). This homology vector was constructed using the standard recombinant DNA technique (22, 30) and ligating restriction fragments derived from the following sources having appropriate synthetic DNA base sequences to each other. The plasmid vector was derived from an approximately 2972 base pair HindIII-BamHI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1484 base pair BglII-AccI restriction subfragment of SPV HindIII fragment M (23). Fragment 3 is an approximately 2564 base pair BamHI-BamHI fragment of the FIV env gene (61) synthesized according to “cloning by polymerase chain reaction”. FIV PPR strain genomic cDNA (61) was used as a template for this PCR reaction. An upstream primer 10 / 93.21 (5′-GCCCGGATCCTATGGCAGAGGGTTTGCAGC-3 ′; SEQ ID NO :) corresponding to the 5 ′ end of the FIV env gene starting at nucleotide 6263 of the FIV PPR strain genomic cDNA was synthesized. In this method, a BamHI site was introduced at the 5 ′ end. This BamHI site was destroyed during cloning of the PCR fragment. A downstream primer 10 / 93.20 (5′-CCGTGGATCCGGCACTCCCATCATTCCTCCTC-3 ′; SEQ ID NO :) corresponding to the 3 ′ end of the FIV env gene starting at nucleotide 8827 of the FIV PPR genomic cDNA was synthesized. In this method, a BamHI site was introduced at the 3 ′ end. Fragment 3 is an approximately 3010 base pair BamHI-PvuII restriction fragment of plasmid pJF751 (11). Fragment 4 is an approximately 2149 base pair AccI-HindIII restriction subfragment of SPV HindIII restriction fragment M (23). The AccI site of this SPV homology vector was converted to a non-repetitive NotI site.

Example 1
Homology vector 515-85.1
Homology vector 515-85.1 is a plasmid useful for the insertion of foreign DNA into SPV. Plasmid 515-85.1 contains a unique AccI restriction site into which foreign DNA can be cloned. An SPV containing exogenous DNA can be obtained by using such a plasmid containing the exogenous DNA insert according to the “homologous recombination method for creating recombinant SPV”. To successfully perform this method, the insertion site (AccI) is in a region that is not essential for SPV replication and is suitable for mediating homologous recombination between the virus and plasmid DNA. It is important that the swinepox virus DNA is adjacent to its end. Exogenous DNA is inserted into at least three recombinant SPVs using the AccI site in homology vector 515-85.1 (see Example 2-4).

In order to define a suitable insertion site, a library of SPV HindIII restriction fragments was created. Some of these restriction fragments (HindIII fragments G, J and M, see FIGS. 1A-1B) were subjected to restriction mapping analysis. Two restriction sites were identified in each fragment as possible insertion sites. These sites included NruI in fragment G, BalI and XbaI in fragment J, and AccI and PstI in fragment M. A β-galactosidase (lacZ) marker gene was inserted at each possible site. The obtained plasmid was used in “a homologous recombination method for creating a recombinant SPV”. The creation of the recombinant virus was judged by “assay for screening recombinant SPV expressing β-galactosidase”. Although four of the six sites were found to give rise to recombinant viruses, the ability of each of these viruses to be purified away from the parent SPV varied greatly. In one case, the virus could not be purified above a level of 1%, in another case the virus could be purified above a level of 50%, and in the third case the virus was at a level of 90% Could not be purified beyond. The inability to purify these viruses indicates instability at the insertion site. This makes the corresponding site inappropriate for the insertion of foreign DNA. However, insertion at one site ( Acc I site of homology vector 515-85.1) resulted in a virus that could be easily purified to 100% (see Example 2), which was the insertion of foreign DNA. Define the appropriate site for

  Homology vector 515-85.1 was further characterized by DNA sequence analysis. Two regions of the homology vector were sequenced. The first region covers the 599 base pair sequence adjacent to the unique AccI site (see FIGS. 2A and 2B). The second region covers 899 base pairs upstream of the unique HindIII site (see FIGS. 2A and 2B). The sequence of the first region encodes an open reading frame (ORF) showing homology to amino acids 1-115 of the vaccinia virus (VV) OIL open reading frame identified by Goebel et al., 1990 (FIGS. 3A-3C). reference). The sequence of the second region codes for an open reading frame showing homology to amino acids 568 to 666 of the vaccinia virus OIL open reading frame (see FIGS. 3A-3C). These data indicate that the AccI site interrupts the putative VV OIL-like ORF at approximately amino acid 41, suggesting that this ORF encodes a gene that is not essential for SPV replication. Goebel et al. Have proposed that the VV OIL ORF contains a leucine zipper motif characteristic of certain eukaryotic transcriptional regulatory proteins, but they know whether this gene is essential for viral replication. It indicates that it has not been done. The DNA sequence located upstream of the VV OIL-like ORF (see FIG. 2A) would be expected to contain a swinepox virus promoter. This swinepox virus promoter would be useful as a foreign DNA control element introduced into the swinepox genome.

Example 2
S-SPV-003
S-SPV-003 is a swinepox virus that expresses a foreign gene. The gene for E. coli β-galactosidase (lacZ gene) was introduced into the SPV 515-85.1 ORF. The foreign gene (lacZ) is under the control of a synthetic early / late promoter (EP1LP2).

S-SPV-003 was derived from S-SPV-100 (Kasza strain). This was accomplished using homology vector 520-17.5 ( see Materials and Methods ) and virus S-SPV-001 in “Homologous Recombination Methods to Create Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-003. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods . After the first three rounds of purification, all observed plaques were blue, indicating that the virus was pure, stable and expressed foreign genes. The assay described here is performed on VERO cells as well as EMSK cells, indicating that VERO cells will be a suitable basis for the production of SPV recombinant vaccines. S-SPV-003 has been deposited with the ATCC under accession number 2335.

Example 3
S-SPV-008
S-SPV-008 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for pseudorabies virus (PRV) g50 (gD) (26) were inserted into the SPV 515-85.1 ORF. The lacZ gene is under the control of the synthetic late promoter (LP1), and the g50 (gD) gene is under the control of the synthetic early / late promoter (EP1LP2).

S-SPV-008 was derived from S-SPV-100 (Kasza strain). This was accomplished using homology vector 538-46.16 (see Materials and Methods ) and virus S-SPV-001 in “Homologous Recombination Methods to Create Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-008. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods . After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-008 was assayed for expression of PRV-specific antigens using “black plaque screening for foreign gene expression in recombinant SPV”. Porcine anti-PRV serum was shown to react specifically with S-SPV-008 plaques but not with S-SPV-009 negative control plaques. All S-SPV-008 observed plaques reacted with porcine antiserum, indicating that the virus stably expressed the PRV foreign gene. The black plaque assay was also performed on an unfixed monolayer. SPV plaques on unfixed monolayers also show specific reactivity with porcine anti-PRV serum, indicating that PRV antigen is expressed on the surface of infected cells.

  To confirm the expression of the PRV g50 (gD) gene product, cells were infected with SPV and samples of infected cell lysates were subjected to SDS-polyacrylamide gel electrophoresis. The gel was blotted and analyzed using “Western blotting”. The expression of PRV specific protein was detected using porcine anti-PRV serum. As shown in FIG. 6, lysates from S-SPV-008 infected cells show a reported size of a specific band of approximately 48 kd, PRV g50 (gD) (35).

  PRV g50 (gD) is the g50 (gD) homologue of HSV-1 (26). Several investigators have shown that VV expressing HSV-1 g50 (gD) protects mice from attack with HSV-1 (6 and 34). Therefore, S-SPV-008 should be valuable as a vaccine to protect pigs from PRV disease.

It is anticipated that several other PRV glycoproteins will be useful in the creation of recombinant swinepox vaccines to protect against PRV disease. These PRV glycoproteins include gII (28), gIII (27), and gH (19). The PRV gIII coding region was created after several synthetic pox promoters. The technology utilized in the creation of S-SPV-008 will be used to create a recombinant swinepox virus that expresses all four of these PRV glycoprotein genes. Such recombinant swinepox virus would be useful as a vaccine against PRV disease. Since the PRV vaccines described herein do not express PRV gX or gI, they are not compatible with current PRV diagnostic tests (gX HerdChek ^R , gI HerdChek ^R and ClinEase ^R ) that are used to distinguish vaccinated animals from infected animals. Will fit. S-SPV-008 has been deposited with the ATCC under the deposit number VR2339.

Example 4
S-SPV-011
S-SPV-011 is a swinepox virus that expresses at least two foreign genes. The unique PstI restriction site (PstI linker inserted into the unique AccI site) of homology vector 570-33.32 with the gene for E. coli β-galactosidase (lacZ) and the gene for pseudorabies virus gIII (gC) Inserted into. The lacZ gene is under the control of the synthetic late promoter (LP1), and the PRV gIII (gC) gene is under the control of the synthetic early promoter (EP2).

  S-SPV-001 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 579-91.21 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods to Create Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-011. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-011 was assayed for expression of PRV-specific antigens using “black plaque screening for foreign gene expression in recombinant SPV”. Goat anti-PRV gIII (gC) polyclonal antibody was shown to react specifically with S-SPV-011 plaques but not with S-SPV-001 negative control plaques. All S-SPV-011 observed plaques reacted with porcine anti-PRV serum, indicating that the virus stably expressed the PRV foreign gene. The assay described here is performed on EMSK cells, indicating that EMSK cells will be a suitable basis for the production of SPV recombinant vaccines.

  To confirm the expression of the PRV gIII (gC) gene product, cells were infected with SPV and samples of infected cell lysates were subjected to SDS-polyacrylamide gel electrophoresis. The gel was blotted and analyzed using “Western blotting”. PRV specific protein expression was detected using a goat anti-PRV gIII (gC) polyclonal antibody. As shown in FIG. 16, the lysate from S-SPV-011 infected cells shows a reported size of a specific band of approximately 92 kd, PRV gIII (gC) (37).

Recombinantly expressed PRV gIII (gC) has been shown to induce significant immune responses in mice and pigs (37, 38). In addition, when gIII (gC) is expressed with gII (gB) or g50 (gD), significant protection from attack with virulent PRV is obtained (39). Therefore, S-SPV-011 should be valuable as a vaccine to protect pigs from PRV disease. Since the PRV vaccines described herein do not express PRV gX or gI, they are not compatible with current PRV diagnostic tests (gX HerdChek ^R , gI HerdChek ^R and ClinEase ^R ) that are used to distinguish vaccinated animals from infected animals. Will fit.

Example 5
S-SPV-012
S-SPV-012 is a swinepox virus that expresses at least two foreign genes. The unique PstI restriction site (PstI linker inserted into the unique AccI site) of homology vector 570-33.32 with the gene for E. coli β-galactosidase (lacZ) and the gene for pseudorabies virus gIII (gC) Inserted into. The lacZ gene is under the control of the synthetic late promoter (LP1), and the PRV gIII (gC) gene is under the control of the synthetic late promoter (EP1LP2).

  S-SPV-012 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 570-91.41 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-012. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-012 was assayed for expression of PRV-specific antigens using “black plaque screening for foreign gene expression in recombinant SPV”. Goat anti-PRV gIII (gC) polyclonal antibody was shown to react specifically with S-SPV-012 plaques but not with S-SPV-001 negative control plaques. All S-SPV-012 observed plaques reacted with porcine anti-PRV serum, indicating that the virus stably expressed the PRV foreign gene. The assay described here is performed on EMSK and VERO cells, indicating that EMSK cells will be a suitable basis for the production of SPV recombinant vaccines.

  To confirm expression of the PRV gIII (gC) gene product, cells were infected with S-SPV-012, and samples of infected cell lysates were subjected to SDS-polyacrylamide gel electrophoresis. The gel was blotted and analyzed using “Western blotting”. PRV specific protein expression was detected using a goat anti-PRV gIII (gC) polyclonal antibody. As shown in FIG. 16, lysates from S-SPV-012 infected cells show two specific bands, the reported size of PRV gIII (gC) (37) -92 kd mature form and 74 kd pre-Golgi form. Show.

Recombinantly expressed PRV gIII (gC) has been shown to induce significant immune responses in mice and pigs (37, 38). In addition, when gIII (gC) is expressed with gII (gB) or g50 (gD), significant protection from attack with virulent PRV is obtained (39). Therefore, S-SPV-012 should be valuable as a vaccine to protect pigs from PRV disease. Since the PRV vaccines described herein do not express PRV gX or gI, they are not compatible with current PRV diagnostic tests (gX HerdChek ^R , gI HerdChek ^R and ClinEase ^R ) that are used to distinguish vaccinated animals from infected animals. Will fit.

Example 6
S-SPV-013
S-SPV-013 is a swinepox virus that expresses at least two foreign genes. The unique PstI restriction site (PstI linker inserted into the unique AccI site) of homology vector 570-33.32 with the gene for E. coli β-galactosidase (lacZ) and the gene for pseudorabies virus gIII (gC) Inserted into. The lacZ gene is under the control of the synthetic late promoter (LP1), and the PRV gIII (gC) gene is under the control of the synthetic late promoter (LP2EP2).

  S-SPV-013 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 570-91.64 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods to Create Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-013. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-013 was assayed for expression of PRV-specific antigens using “black plaque screening for foreign gene expression in recombinant SPV”. Goat anti-PRV gIII (gC) polyclonal antibody was shown to react specifically with S-SPV-013 plaques but not with S-SPV-001 negative control plaques. All S-SPV-012 observed plaques reacted with porcine anti-PRV serum, indicating that the virus stably expressed the PRV foreign gene. The assay described here is performed on EMSK and VERO cells, indicating that EMSK cells will be a suitable basis for the production of SPV recombinant vaccines.

  To confirm the expression of the PRV gIII (gC) gene product, cells were infected with SPV and samples of infected cell lysates were subjected to SDS-polyacrylamide gel electrophoresis. The gel was blotted and analyzed using “Western blotting”. PRV specific protein expression was detected using a goat anti-PRV gIII (gC) polyclonal antibody. As shown in FIG. 16, lysates from S-SPV-013 infected cells showed two specific bands, the reported size of PRV gIII (gC) (37) -92 kd mature form and 74 kd pre-Golgi form. Show.

Recombinantly expressed PRV gIII (gC) has been shown to induce significant immune responses in mice and pigs (37, 38). In addition, when gIII (gC) is expressed with gII (gB) or g50 (gD), significant protection from attack with virulent PRV is obtained (39). Therefore, S-SPV-013 should be valuable as a vaccine to protect pigs from PRV disease. Since the PRV vaccines described herein do not express PRV gX or gI, they are not compatible with current PRV diagnostic tests (gX HerdChek ^R , gI HerdChek ^R and ClinEase ^R ) that are used to distinguish vaccinated animals from infected animals. Will fit. S-SPV-013 has been deposited with the ATCC under accession number 2418.

Protection against Auesky disease using recombinant swinepox virus vaccines S-SPV-008 and S-SPV-013 Vaccine containing S-SPV-008 and S-SPV-013 (1 × 10 6 PFU / ml) (2 viruses 2 ml of a 1: 1 mixture) was administered to two groups of pigs (5 pigs per group) by intradermal inoculation or oral / pharyngeal spray. A control group of 5 pigs received S-SPV-001 by intradermal and oral / pharyngeal inoculation. Three weeks after vaccination, pigs were challenged with virulent PRV strain 4982 by intranasal inoculation. The table gives a summary of clinical responses. The data support increased protection from Auesky disease in S-SPV-008 / S-SPV-013 vaccinated as compared to S-SPV-001 vaccinated controls.

Vaccination route Post-attack post-attack post-attack post-attack
Respiratory signs CNS signs Group average
(Number of signs / (number of signs / (clinical signs
Total number) total number) days)
S-SPV-008 + Intradermal 3/5 0/5 2.6
S-SPV-013
S-SPV-008 + Oral / 3/5 0/5 2.2
S-SPV-013 Pharynx
S-SPV-001 Intradermal + 5/5 2/5 7.8
(Control) Fluorescence /
Pharynx
Example 7
S-SPV-015
S-SPV-015 is a swinepox virus that expresses at least two foreign genes. The SPV 617-48.1 ORF (the unique AccI restriction site was replaced with the unique NcotI restriction site) the gene for E. coli β-galactosidase (lacZ) and the gene for pseudorabies virus (PRV) gII (gB) Inserted into. The lacZ gene is under the control of the synthetic late promoter (LP1) and the PRV gB gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-015 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 727-54.60 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-015. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-015 was assayed for expression of PRV-specific antigens using "black plaque screening for foreign gene expression in recombinant SPV". Porcine anti-PRV polyclonal serum was shown to react specifically with S-SPV-015 plaques but not with S-SPV-001 negative control plaques. All S-SPV-015 observed plaques reacted with the antiserum, indicating that the virus stably expressed the PRV foreign gene. The assay described here is performed on ESK-4 cells, indicating that ESK-4 cells will be a suitable basis for the production of SPV recombinant vaccines.

  To confirm expression of the PRV gII gene product, cells were infected with SPV-015 and samples of infected cell lysates were subjected to SDS-polyacrylamide gel electrophoresis. The gel was blotted and analyzed using “Western blotting”. The expression of PRV-specific protein was detected using porcine anti-PRV polyclonal serum. Lysates from S-SPV-015 infected cells exhibited bands corresponding to the predicted sizes of PRV gII glycoprotein, 120 kd, 67 kd and 58 kd.

  S-SPV-015 is useful as a vaccine against pseudorabies virus in pigs. A superior vaccine is prescribed by fighting S-SPV-008 (PRV g50), S-SPV-013 (PRV gIII) for protection against pseudorabies in pigs.

Therefore, S-SPV-015 should be valuable as a vaccine to protect pigs from PRV disease. Since the PRV vaccines described herein do not express PRV gX or gI, they are not compatible with current PRV diagnostic tests (gX HerdChek ^R , gI HerdChek ^R and ClinEase ^R ) that are used to distinguish vaccinated animals from infected animals. Will fit. S-SPV-015 has been deposited with the ATCC under accession number 2466.

Example 8
To obtain a recombinant swinepox virus with enhanced ability to protect against PRV infection over that which can be obtained by using a recombinant swinepox virus that expresses only one of the PRV glycoproteins, A recombinant swinepox virus expressing more than one pseudorabies glycoprotein capable of inducing the production of neutralizing antibodies against rabies virus (PRV) is constructed.

  There are several examples of such recombinant swinepox viruses that express more than one PRV glycoprotein: recombinant swinepox virus expressing PRV g50 (gD) and gIII (gD), PRV g50 (gD) and gII A recombinant swinepox virus expressing (gB); a recombinant swinepox virus expressing PRV gII (gB) and gIII (gC); and a set expressing g50 (gD), gIII (gC) and gII (gB) A recombinant swinepox virus that expresses a swinepox virus. Each of the cited viruses is also designed to contain and express an E. coli β-galactosidase (lacZ) gene that will facilitate the cloning of recombinant swinepox virus.

  Listed below are three examples of recombinant swinepox viruses that express PRV g50 (gD), PRV gIII (gC), PRV gII (gB) and E. coli β-galactosidase (lacZ).

  a) Swinepox virus containing PRV g50 (gD) gene, PRV gIII (gC) gene, PRV gII (gB) gene and lacZ gene. All four genes insert into a unique AccI restriction endonuclease site within the HindIII M fragment of the swinepox virus genome. The PRV g50 (gD) gene is under the control of the synthetic early / late promoter (EP1LP2), the PRV gIII (gC) gene is under the control of the synthetic early promoter (EP2), and the PRV gII (gB) gene is It is under the control of the early promoter (LP2EP2) and the lacZ gene is under the control of the synthetic late promoter (LP1).

  b) Swinepox virus containing PRV g50 (gD) gene, PRV gIII (gC) gene, PRV gII (gB) gene and lacZ gene. All four genes insert into a unique AccI restriction endonuclease site within the HindIII M fragment of the swinepox virus genome. The PRV g50 (gD) gene is under the control of the synthetic early / late promoter (EP1LP2), the PRV gIII (gC) gene is under the control of the synthetic early / late promoter (EP1LP2), and the PRV gII (gB) gene is synthesized. The late / early promoter (LP2EP2) is under control and the lacZ gene is under the control of the synthetic late promoter (LP1).

  c) Swinepox virus containing PRV g50 (gD) gene, PRV gIII (gC) gene, PRV gII (gB) gene and lacZ gene. All four genes insert into a unique AccI restriction endonuclease site within the HindIII M fragment of the swinepox virus genome. The PRV g50 (gD) gene is under the control of the synthetic early / late promoter (EP1LP2), the PRV gIII (gC) gene is under the control of the synthetic late / early promoter (EP2LP2), and the PRV gII (gB) gene is synthesized The late / early promoter (LP2EP2) is under control and the lacZ gene is under the control of the synthetic late promoter (LP1).

Protection against Auesky's disease using recombinant swinepox virus vaccines S-SPV-008, S-SPV-013 and S-SPV-015 Contains S-SPV-008, S-SPV-013, or S-SPV-015 Vaccine (2 ml of 1 × 10 7 PFU / ml virus) or a mixture of S-SPV-008, S-SPV-013, and S-SPV-015 (2 ml of a 1: 1: 1 mixture of 3 viruses; 1 × 10 7 PFU / ml) was administered to 4 groups of pigs (5 pigs per group) by intramuscular inoculation. A control group of 5 pigs received S-SPV-001 by intramuscular inoculation. Four weeks after vaccination, pigs were challenged with virulent PRV strain 4982 by intranasal inoculation. Pigs are observed daily for 14 days for clinical signs of pseudorabies and the table gives a summary of clinical responses. The data show that pigs vaccinated with S-SPV-008, S-SPV-013, or S-SPV-015 were compared to the S-SPV-001 vaccinated control in the Auesky caused by pseudorabies virus. Pigs with partial protection against disease and vaccinated with the combination vaccine S-SPV-008 / S-SPV-013 / S-SPV-015 showed complete protection.

Vaccination route Post-attack post-attack post-attack post-attack
Respiratory signs CNS signs Group average
(Number of signs / (number of signs / (clinical signs
Total number) total number) days)
S-SPV-008 Intramuscular 2/5 2/5 2.0
S-SPV-013 Intramuscular 1/5 0/5 0.4
S-SPV-015 Intramuscular 3/5 0/5 1.0
S-SPV-008 + Intramuscular 0/5 0/5 0.0
S-SPV-013 +
S-SPV-015
S-SPV-001 Intramuscular 5/5 2/5 3.6
(Control)
Example 9
S-SPV-009
S-SPV-009 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ gene) and the gene for Newcastle disease virus hemagglutinin (HN gene) were inserted into the SPV 515-85.1 ORF. The lacZ gene is under the control of the synthetic late promoter (LP1) and the HN gene is under the control of the synthetic early / late promoter (EP1LP2).

S-SPV-009 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 538-46.26 (see Materials and Methods ) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-009. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods . After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-009 was assayed for expression of PRV-specific antigens using “black plaque screening for foreign gene expression in recombinant SPV”. Rabbit anti-NDV HN antiserum was shown to react specifically with S-SPV-009 plaques but not with S-SPV-008 negative control plaques. All S-SPV-009 observed plaques reacted with porcine antiserum, indicating that the virus stably expressed the PRV foreign gene. S-SPV-009 has been deposited with the ATCC under accession number VR2344.

  To confirm the expression of the NDV HN gene product, cells were infected with SPV and samples of infected cell lysates were subjected to SDS-polyacrylamide gel electrophoresis. The gel was blotted and analyzed using “Western blotting”. Rabbit anti-NDV HN serum was used to detect HN protein expression. Lysates from S-SPV-009 infected cells exhibited a specific band of approximately 74 kd, the reported size of NDV HN (29).

Example 10
S-SPV-014
S-SPV-014 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for infectious laryngotracheitis virus glycoprotein G (ILT gG) were inserted into the SPV 570-33.32 ORF (the only AccI site is the only PstI site) Replaced). The lacZ gene is under the control of the synthetic late promoter (LP1) and the ILT gG gene is under the control of the synthetic early / late promoter (EP1LP2).

  S-SPV-014 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 599-65.25 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-014. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes. The assay described here was performed on ESK-4 cells, indicating that ESK-4 cells would be a suitable basis for the production of SPV recombinant vaccines.

  To confirm the expression of the ILT gG gene product, cells were infected with SPV-014 and samples of infected cell lysates were subjected to SDS-polyacrylamide gel electrophoresis. The gel was blotted and analyzed using “Western blotting”. Expression of ILT-specific proteins was detected using peptide antisera against ILT gG. The lysate from S-SPV-014 infected cells is a high molecular weight representing a glycosylated form of the protein that is not present in a band at 43 kd, the expected size of the ILT gG protein, and a deletion mutant for ILT gG. Of additional bands.

This virus is used as an expression vector for expressing ILT glycoprotein G (gG). Such ILT gG is used as an antigen to identify antibodies directed against wild-type ILT virus as opposed to antibodies directed against gG-deficient ILT virus. This virus is also used as an antigen for the production of ILT gG specific monoclonal antibodies. Such antibodies are useful in developing diagnostic tests specific for the ILT gG protein. Monoclonal antibodies are created in mice using this virus according to the “purification method of viral glycoprotein used as a diagnostic agent” ( materials and methods ).

Example 11
S-SPV-016
S-SPV-016 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for infectious laryngotracheitis virus glycoprotein I (ILT gI) were inserted into the SPV 617-48.1 ORF (the only AccI restriction site is the only NotI). Replaced with restriction sites). The lacZ gene is under the control of the synthetic late promoter (LP1) and the ILT gI gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-016 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 624-20.1C (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-016. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-016 was assayed for expression of ILT gI- and β-galactosidase-specific antigens using “black plaque screening for foreign gene expression in recombinant SPV”. The chicken anti-ILT polyclonal antibody was shown to react specifically with S-SPV-016 plaques but not with S-SPV-017 negative control plaques. All S-SPV-016 observed plaques reacted with chicken antiserum, indicating that the virus stably expressed the ILT foreign gene. The assay described here was performed on ESK-4 cells, indicating that ESK-4 cells would be a suitable basis for the production of SPV recombinant vaccines.

  To confirm the expression of the ILT gI gene product, cells were infected with SPV-016 and samples of infected cell lysates were subjected to SDS-polyacrylamide gel electrophoresis. The gel was blotted and analyzed using “Western blotting”. Expression of ILT-specific protein was detected using a chicken anti-ILT polyclonal antibody. Lysates from S-SPV-016 infected cells exhibit a range of bands that are reactive to 40-200 kd anti-ILT antibody, indicating that ILT gI appears to be significantly modified.

This virus is used as an expression vector for expressing ILT glycoprotein I (gI). Such ILT gI is used as an antigen to identify antibodies directed against wild-type ILT virus as opposed to antibodies directed against gI-deficient ILT virus. This virus is also used as an antigen for the production of ILT gI specific monoclonal antibodies. Such antibodies are useful in the development of diagnostic tests specific for the ILT gI protein. Monoclonal antibodies are created in mice using this virus according to the “purification method of viral glycoprotein used as a diagnostic agent” ( materials and methods ).

Example 12
S-SPV-017
S-SPV-017 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for infectious bovine rhinotracheitis virus glycoprotein G (IBR gG) were inserted into the SPV 617-48.1 ORF (the only AccI restriction site is the only one). Replaced with NotI restriction site). The lacZ gene is under the control of the synthetic late promoter (LP1) and the IBR gG gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-017 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 614-83.18 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-017. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-017 was assayed for expression of IBR-specific antigens using "black plaque screening for foreign gene expression in recombinant SPV". Monoclonal antibodies and peptide antisera against IBR gG were shown to react specifically with S-SPV-017 plaques but not with S-SPV-016 negative control plaques. All S-SPV-017 observed plaques reacted with antiserum, indicating that the virus stably expressed the IBR foreign gene. The assay described here was performed on ESK-4 cells, indicating that ESK-4 cells would be a suitable basis for the production of SPV recombinant vaccines.

  To confirm the expression of the IBR gG gene product, cells were infected with SPV-017 and samples of infected cell lysates were subjected to SDS-polyacrylamide gel electrophoresis. The gel was blotted and analyzed using “Western blotting”. The expression of IBR-specific protein was detected using an antiserum against IBR gG. The lysate from S-SPV-017 infected cells is a high molecular weight representing a glycosylated form of the protein that is not present in the predicted size of the IBR gG protein at 43 kd and a deletion mutant for IBR gG. An additional band was presented.

This virus is used as an expression vector for expressing IBR glycoprotein I (gG). Such IBR gG is used as an antigen to identify antibodies directed against wild-type IBR virus as opposed to antibodies directed against gG-deficient IBR virus. This virus is also used as an antigen for the production of IBR gG specific monoclonal antibodies. Such antibodies are useful in the development of diagnostic tests specific for the IBR gG protein. Monoclonal antibodies are created in mice using this virus according to the “purification method of viral glycoprotein used as a diagnostic agent” ( materials and methods ).

Example 13
S-SPV-019
S-SPV-019 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for infectious bovine rhinotracheitis virus (IBRV) gE were inserted into the SPV 617-48.1 ORF (the only AccI restriction site is the only NotI restriction site). Replaced). The lacZ gene is under the control of the synthetic late promoter (LP1) and the IBRV gE gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-019 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 708-78.9 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-019. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

This virus is used as an expression vector for expressing IBR glycoprotein E (gE). Such IBR gE is used as an antigen to identify antibodies directed against wild-type IBR virus as opposed to antibodies directed against gE-deficient IBR virus. This virus is also used as an antigen for the production of IBR gE specific monoclonal antibodies. Such antibodies are useful in the development of diagnostic tests specific for the IBR gE protein. Monoclonal antibodies are created in mice using this virus according to the “purification method of viral glycoprotein used as a diagnostic agent” ( materials and methods ).

Example 14
S-SPV-018
S-SPV-018 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for pseudorabies virus glycoprotein E (PRV gE) were inserted into the SPV 570-33.32 ORF (the unique AccI site was replaced with a unique PstI site) ). The lacZ gene is under the control of the synthetic late promoter (LP1) and the PRV gE gene is under the control of the synthetic early / late promoter (EP1LP2).

  S-SPV-018 was derived from S-SPV-001 (Kasza strain). This was accomplished using the final homology vector and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks are screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The red plaque purification of the recombinant virus is designated S-SPV-018. The virus is assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

This virus is used as an expression vector for expressing PRV glycoprotein E (gE). Such PRV gE is used as an antigen to identify antibodies directed against wild-type PRV virus as opposed to antibodies directed against gE-deleted PRV virus. This virus is also used as an antigen for the production of PRV gE specific monoclonal antibodies. Such antibodies are useful in the development of diagnostic tests specific for PRV gE protein. Monoclonal antibodies are created in mice using this virus according to the “purification method of viral glycoprotein used as a diagnostic agent” ( materials and methods ).

Example 15
Homology vector 520-90.15
Homology vector 520-90.15 is a plasmid useful for the insertion of foreign DNA into SPV. Plasmid 520-90.15 contains a unique NdeI restriction site into which foreign DNA can be cloned. A plasmid containing such exogenous DNA insert is used in accordance with "Homologous recombination method for creating recombinant SPV" to obtain SPV containing exogenous DNA. To carry out this method successfully, the swinepox virus is suitable for mediating homologous recombination between the virus and plasmid DNA in the region where the insertion site is not essential for SPV replication. It is important that the DNA is adjacent to its end. The only NdeI restriction site in plasmid 520-90.15 is located within the coding region of the SPV thymidine kinase gene (32). Therefore, it was shown that the thymidine kinase gene of swinepox virus is not essential for DNA replication but is an appropriate insertion site.

Example 16
S-PRV-010
S-SPV-010 is a swinepox virus that expresses a foreign gene. The E. coli β-galactosidase (lacZ) gene is inserted into a unique NdeI restriction site within the thymidine kinase gene. The foreign gene (lacZ) is under the control of the synthetic late promoter, LP1. Thus, it was shown that the swinepox virus thymidine kinase gene is a region that is not essential for the replication of the virus and is an appropriate site to tie along.

  The 1739 base pair HindIII-BamHI fragment subcloned from the HindIII G fragment contains the swinepox virus thymidine kinase gene and is the named homology vector 520-90.15. The homology vector 520-90.15 was digested with NdeI and an AscI linker was inserted at this unique site within the thymidine kinase gene. An LP1 promoter-lacZ cassette with an AscI linker was ligated to the AscI site in the thymidine kinase gene. Recombinant homology vector 561-36.26 was co-transfected with virus S-SPV-001 by “Homologous Recombination Method to Create Recombinant SPV” and virus plaques expressing β-galactosidase were “ Selected by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of blue and red plaque purification was a recombinant virus designated S-SPV1-010. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes. The assay described here was performed on ESK-4 cells, indicating that ESK-4 cells would be a suitable basis for the production of SPV recombinant vaccines.

Example 17
Development of vaccines utilizing swinepox virus for expressing antigens from microorganisms causing various diseases can be planned.

Infectious gastroenteritis virus The main neutralizing antigen of infectious gastroenteritis virus (TGE) used in the swinepox virus vector, glycoprotein 195, was cloned. The neutralizing antigen clone is disclosed in US patent application Ser. No. 078,519 filed Jul. 27, 1987. The techniques used to express PRV g50 (gD) in SPV and disclosed herein are considered applicable to TGE.

Porcine parvovirus The major capsid protein of porcine parvovirus (PPV) was cloned for use in the swinepox virus vector. The capsid protein is disclosed in US Pat. No. 5,068,192 issued Nov. 26, 1991. It is believed that the techniques used to express PRV g50 (gD) in SPV and disclosed herein are applicable to PPV.

Porcine rotavirus Porcine rotavirus major neutralizing antigen, glycoprotein 38, was cloned for use in the swinepox virus vector. A clone of glycoprotein 38 is disclosed in US Pat. No. 5,068,192 issued Nov. 26, 1991. The approach used to express PRV g50 (gD) in SPV and disclosed herein is considered applicable to SRV.

Porcine cholera virus The major neutralizing antigen of bovine viral diarrhea (BVD) virus was cloned as disclosed in U.S. Patent Application No. 225,032, filed July 27, 1988. Since BVD and swine cholera virus are cross-protective (31), BVD virus antigens have been targeted for use in swinepox virus vectors. It is believed that the techniques used to express PRV g50 (gD) in SPV and disclosed herein can be applied to BVD.

Serpulina Hyodysenteriae
The protective antigen of Serpulina Hyodysenteriae (3) for use in swinepox virus vectors has been cloned. The procedure used to express PRV g50 (gD) in SPV and disclosed herein would be applicable to Serpulina Hyodysenteriae.

  Antigens from the following microorganisms can also be used to develop animal vaccines: swine influenza virus, foot-and-mouth disease virus, African swine fever virus, swine cholera virus, Mycoplasma hyopneumoniae, swine reproductive system and respiratory tract Syndrome / pig infertility and respiratory syndrome (PRRS / SIRS).

  Antigens from the following microorganisms can also be used in animal vaccines: canine-herpesvirus, canine distemper, canine adenovirus type 1 (hepatitis), adenovirus type 2 (respiratory disease), parainfluenza, leptospira canicola ( Leptospira canicola, icterohemorragia, parvovirus, coronavirus, Borrelia burgdorferi, canine herpesvirus, Bordetella bronshiseptica, Dirofilae imimitis (Dirofilaria) ) (Canine filamentous) and rabies virus, 2) cat-Fiv gag and env, feline leukemia virus, feline immunodeficiency virus, feline herpes virus, feline infectious peritonitis virus, canine herpes virus, canine coronavirus, dog・ Pa Rubovirus, parasitic diseases in animals (including Dirofilaria immitis in dogs and cats), equine infectious anemia, Streptococcus equi, coccidia, emeria, chicken anemia virus Borrelia burgdorferi, bovine coronavirus, Pasteurella haemolytica.

Example 17A
Vaccines containing swine cholera virus, swine influenza virus and recombinant swinepox virus expressing antigens from (pig reproductive and respiratory syndrome) PRRS virus against swine cholera virus, swine influenza virus and PRRS virus Recombinant swinepox virus expressing genes for neutralizing antigens is useful for preventing disease in pigs. Genes expressed in recombinant SPV include, but are not limited to, swine cholera virus gE1 and gE2 genes, swine influenza virus hemagglutinin, neuraminidase, matrix and nucleoprotein, and PRRS virus ORF7.

Example 18
The recombinant swinepox virus expresses the equine influenza virus type A / Alaska 91, equine influenza virus type A / plug 56, equine herpesvirus type 1 gB, or equine herpesvirus type 1 gD gene. S-SPV-033 and S-SPV-034 are useful as vaccines against equine influenza infections, S-SPV-038 and S-SPV-039 are against equine herpesvirus infections causing equine rhinotracheitis and equine abortion Useful as a vaccine. These equine influenza and equine herpesvirus antigens are key to generating a protective immune response in animals. Recombinant viruses are useful alone or in combination as an effective vaccine. Swinepox virus has cloned other subtypes of equine influenza viruses (including equine influenza virus type A / Miami / 63 and equine influenza virus type A / Kentucky / 81) and variants in this disease Useful to protect against the rapid evolution of S-SPV-033, S-SPV-034, S-SPV-038, and S-SPV-039 are useful as expression vectors for expressing equine influenza or equine herpesvirus antigens. Such equine influenza or equine herpesvirus antigens are useful for identifying antibodies directed against wild-type equine influenza or equine herpesviruses. The virus is also useful in producing antigens for the production of monospecific polyclonal or monoclonal antibodies. Such antibodies are useful in the development of diagnostic tests specific for viral proteins. Monoclonal or polyclonal antibodies are created in mice using these viruses in accordance with “Purification of viral glycoproteins used as diagnostic agents” (materials and methods).

Example 18A
S-SPV-033:
S-SPV-033 is a recombinant swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for equine influenza virus type A / Alaska 91 neuraminidase were inserted into the SPV 617-48.1 ORF (the only AccI restriction site is the only NotI restriction site). Replaced). The lacZ gene is under the control of the synthetic late promoter (LP1) and the EIV Ak / 91 NA gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-033 was derived from S-SPV-001 (Kasza strain). This was accomplished using the homology vector 732-18.4 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-033. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

Example 18B
S-SPV-034:
S-SPV-034 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for equine influenza virus type A / plug 56 neuraminidase were inserted into the SPV 617-48.1 ORF (the only AccI restriction site is the only NotI restriction site). Replaced). The lacZ gene is under the control of the synthetic late promoter (LP1), and the EIV PR / 56 NA gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-034 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 732-59A9.22 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods to Create Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-034. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-034 was assayed for expression of EIV-specific antigen using "black plaque screening for foreign gene expression in recombinant SPV". A monospecific polyclonal antibody against EIV PR / 56 NA was shown to react specifically with S-SPV-034 plaques but not with S-SPV-034 negative control plaques. All S-SPV-034 observed plaques reacted with antisera, indicating that the virus was stably expressing the EIV PR / 56 NA sex gene. The assay described here was performed on ESK-4 cells, indicating that ESK-4 cells would be a suitable basis for the production of SPV recombinant vaccines.

Example 18C
S-SPV-038:
S-SPV-038 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for equine herpesvirus type 1 glycoprotein B were inserted into the SPV 617-48.1 ORF (the unique AccI restriction site was replaced with a unique NotI restriction site). ) The lacZ gene is under the control of the synthetic late promoter (LP1) and the EHV-1 gG gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-038 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 744-34 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-038. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

Example 18D
S-SPV-039:
S-SPV-039 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for equine herpesvirus type 1 glycoprotein D were inserted into the SPV 617-48.1 ORF (the unique AccI restriction site was replaced with a unique NotI restriction site). ) The lacZ gene is under the control of the synthetic late promoter (LP1) and the EHV-1 gD gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-039 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 744-38 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods to Create Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-039. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

Example 19
Recombinant swinepox virus is bovine respiratory tract syncytium virus attachment protein (BRSV G), BRSV fusion protein (BRSV F), BRSV nucleocapsid protein (BRSV N), bovine viral diarrhea virus (BVDV) g48, BVDVg53 Bovine parainfluenza virus type 3 (BPI-3) F, or BPI-3 HN. S-SPV-020, S-SPV-029, S-SPV-030 and S-SPV-032, S-SPV-028 are useful as vaccines against bovine diseases. These BRSV, BVDV, and BPI-3 antigens are key to generating a protective immune response in animals. Recombinant viruses are useful alone or in combination as an effective vaccine. Swinepox virus is useful for cloning BRSV, BVDV, and other subtypes of BPI-3 to protect against the rapid evolution of mutants in this disease. S-SPV-020, S-SPV-029, S-SPV-03, and S-SPV-032 and S-SPV-028 are expression vectors for expressing BRSV, BVDV, and BPI-3 antigens. Useful. Such BRSV, BVDV, and BPI-3 antigens are useful for identifying antibodies directed against wild-type BRSV, BVDV, and BPI-3. The virus is also useful as an antigen for the production of monospecific polyclonal or monoclonal antibodies. Such antibodies are useful in the development of diagnostic tests specific for viral proteins. Monoclonal or polyclonal antibodies are created in mice using these viruses in accordance with “Purification of viral glycoproteins used as diagnostic agents” (materials and methods).

Example 19A
S-SPV-020
S-SPV-020 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for bovine respiratory syncytial virus (BRSV) G were inserted into the SPV 617-48.1 ORF (the only AccI restriction site is the only NotI restriction site) Replaced). The lacZ gene is under the control of the synthetic late promoter (LP1) and the BRSV G gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-020 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 727-20.5 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-020. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-020 was assayed for expression of PRV-specific antigens using “black plaque screening for foreign gene expression in recombinant SPV”. Bovine anti-BRSV FITC (Accurate Chemicals) was shown to react specifically with S-SPV-020 plaques but not with S-SPV-003 negative control plaques. All S-SPV-020 observed plaques reacted with antiserum, indicating that the virus stably expressed the PRV foreign gene. The assay described here was performed on ESK-4 cells, indicating that ESK-4 cells would be a suitable basis for the production of SPV recombinant vaccines.

  To confirm the expression of the BRSV G gene product, cells were infected with SPV-020 and samples of infected cell lysates were subjected to SDS-polyacrylamide gel electrophoresis. The gel was blotted and analyzed using “Western blotting”. The expression of BRSV-specific protein was detected using bovine anti-BRSV FITC (Accurate Chemicals). Lysates from S-SPV-020 infected cells have a band at 36 kd which is the expected size of the non-glycosylated form of BRSV G protein and the expected size of the glycosylated form of BRSV G protein 53 to Bands at 45 kd and 80-90 kd were exhibited.

Example 19B
S-SPV-029:
S-SPV-029 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for bovine respiratory syncytial virus (BRSV) F were inserted into the SPV 617-48.1 ORF (the only AccI restriction site is the only NotI restriction site) Replaced). The lacZ gene is under the control of the late synthetic promoter (LP1) and the BRSV F gene is under the control of the late synthetic / early promoter (LP2EP2).

  S-SPV-029 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 727-20.10 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-029. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-029 was assayed for expression of PRV-specific antigens using “black plaque screening for foreign gene expression in recombinant SPV”. Bovine anti-BRSV FITC (Accurate Chemicals) was shown to react specifically with S-SPV-029 plaques but not with S-SPV-003 negative control plaques. All S-SPV-029 observed plaques reacted with antisera, indicating that the virus stably expressed the PRV foreign gene. The assay described here was performed on ESK-4 cells, indicating that ESK-4 cells would be a suitable basis for the production of SPV recombinant vaccines.

Example 19C
S-SPV-030:
S-SPV-030 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for bovine respiratory syncytial virus (BRSV) N were inserted into the SPV 617-48.1 ORF (the only AccI restriction site is the only NotI restriction site). Replaced). The lacZ gene is under the control of the synthetic late promoter (LP1) and the BRSV N gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-030 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 713-55.37 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-030. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-030 was assayed for the expression of BRSV-specific antigens using “black plaque screening for foreign gene expression in recombinant SPV”. Bovine anti-BRSV FITC (Accurate Chemicals) was shown to react specifically with S-SPV-030 plaques but not with S-SPV-003 negative control plaques. All S-SPV-030 observed plaques reacted with antisera, indicating that the virus stably expressed the PRV foreign gene. The assay described here was performed on ESK-4 cells, indicating that ESK-4 cells would be a suitable basis for the production of SPV recombinant vaccines.

  To confirm the expression of the BRSV N gene product, cells were infected with SPV-030 and samples of infected cell lysates were subjected to SDS-polyacrylamide gel electrophoresis. The gel was blotted and analyzed using “Western blotting”. The expression of BRSV-specific protein was detected using bovine anti-BRSV FITC (Accurate Chemicals). Lysates from S-SPV-030 infected cells exhibited a band at 43 kd, the expected size of BRSV N protein.

Example 19D
S-SPV-028:
S-SPV-028 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for bovine parainfluenza virus type 3 (BPI-3) F were inserted into the SPV 617-48.1 ORF (the only AccI restriction site is the only NotI Replaced with restriction sites). The lacZ gene is under the control of the synthetic late promoter (LP1), and the BPI-3 F gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-028 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 713-55.10 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-028. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-028 was assayed for expression of BPI-3-specific antigens using "black plaque screening for foreign gene expression in recombinant SPV". Bovine anti-BPI-3 FITC (Accurate Chemicals) was shown to react specifically with S-SPV-028 plaques but not with S-SPV-003 negative control plaques. All S-SPV-028 observed plaques reacted with antisera, indicating that the virus stably expressed the BPI-3 foreign gene. The assay described here was performed on ESK-4 cells, indicating that ESK-4 cells would be a suitable basis for the production of SPV recombinant vaccines.

  To confirm the expression of the BPI-3 F gene product, cells were infected with SPV-028 and samples of infected cell lysates were subjected to SDS-polyacrylamide gel electrophoresis. The gel was blotted and analyzed using “Western blotting”. Bovine anti-BPI-3 FITC (Accurate Chemicals) was used to detect the expression of BPI-3-specific proteins. Lysates from S-SPV-028 infected cells exhibited bands at 43 kd and 70 kd, the expected size of the BPI-3 F protein.

Example 19E
S-SPV-032:
S-SPV-032 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for bovine viral diarrhea virus (BVDV) g48 were inserted into the SPV 617-48.1 ORF (the only AccI restriction site is the only NotI restriction site). Replaced). The lacZ gene is under the control of the synthetic late promoter (LP1) and the BVDV g48 gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-032 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 727-78.1 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-032. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

Example 19F
S-SPV-040:
S-SPV-040 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for bovine viral diarrhea virus (BVDV) g53 were inserted into the SPV 617-48.1 ORF (the only AccI restriction site is the only NotI restriction site) Replaced). The lacZ gene is under the control of the synthetic late promoter (LP1) and the BVDV g48 gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-040 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 738-96 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-040. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

Example 19G
Ship fever vaccine Ship fever or bovine respiratory disease (BRD) complications are manifested as a result of a combination of bovine infectious diseases and additional stress-related factors (52). Respiratory viral infections augmented by the pathophysiological effects of stress alter bovine susceptibility to Pasteurella organisms by a number of mechanisms. Control of viral infection that initiates BRD is essential to prevent the disease syndrome (53).

  The major infectious disease pathogens contributing to BRD include, but are not limited to, rhinotracheitis virus (IBRV), parainfluenza virus type 3 (PI-3), bovine respiratory syncytial virus (BRSV), and Includes Paeteurella haemolytica (53). Recombinant swinepox virus expressing a protective antigen against organisms causing BRD is useful as a vaccine. S-SPV-020, S-SPV-029, S-SPV-030, and S-SPV-028 are useful components of such vaccines.

Example 20
Recombinant swinepox viruses S-SPV-031 and S-SPV-035 are useful as vaccines against human diseases. S-SPV-031 expresses the core antigen of hepatitis B virus. S-SPV-031 is useful against hepatitis B infection in humans. S-SPV-035 expresses a cytokine, interleukin-2, and is useful as an immune modulator to enhance the immune response in humans. Combining S-SPV-031 and S-SPV-035 produces an excellent vaccine against hepatitis B.

Example 20A
S-SPV-031:
S-SPV-031 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for hepatitis B core antigen were inserted into the SPV 617-48.1 ORF (the unique AccI restriction site was replaced with a unique NotI restriction site). The lacZ gene is under the control of the synthetic late promoter (LP1), and the hepatitis B core antigen gene is under the control of the synthetic early / late promoter (EP1LP2).

  S-SPV-031 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 727-67.18 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods to Create Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-031. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-031 was assayed for expression of hepatitis B core antigen-specific antigen using "black plaque screening for foreign gene expression in recombinant SPV". Rabbit antiserum against hepatitis B core antigen was shown to react specifically with S-SPV-031 plaques but not with S-SPV-001 negative control plaques. All S-SPV-031 observed plaques reacted with antisera, indicating that the virus stably expressed the hepatitis B core antigen gene. The assay described here was performed on ESK-4 cells, indicating that ESK-4 cells would be a suitable basis for the production of SPV recombinant vaccines.

  To confirm the expression of the hepatitis B core antigen gene product, cells were infected with SPV-031, and samples of infected cell lysates were subjected to SDS-polyacrylamide gel electrophoresis. The gel was blotted and analyzed using “Western blotting”. Expression of hepatitis B specific protein was detected using rabbit antiserum against hepatitis B core antigen. Lysates from S-SPV-031 infected cells exhibited a band at 21 kd, the expected size of hepatitis B core antigen.

Example 20B:
S-SPV-035:
S-SPV-035 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for human IL-2 were inserted into the SPV 617-48.1 ORF (the unique AccI restriction site was replaced with a unique NotI restriction site). The lacZ gene is under the control of the synthetic late promoter (LP1), and the human IL-2 gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-035 was derived from S-SPV-001 (Kasza strain). This was accomplished using the homology vector 741-84.14 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-035. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

Example 21
Human vaccine using recombinant swinepox virus as a vector Recombinant swinepox virus is useful as a vaccine against human diseases. For example, human influenza virus is a rapidly evolving virus whose neutralizing virus epitopes change rapidly. Useful recombinant swinepox vaccines are those that are rapidly adapted by recombinant DNA technology to protect the influenza virus neutralizing epitope against new strains of influenza virus. The human influenza virus hemagglutinin (HN) and neuraminidase (NA) genes are used in swine as described in "Cloning of equine influenza virus hemagglutinin and neuraminidase genes" (see Materials and Methods and Example 17). It is cloned into a virus.

  Recombinant swinepox virus is useful as a vaccine against other human illnesses when foreign antigens from the following diseases or diseased microorganisms are expressed in swinepox virus vectors: Hepatitis B virus surface and core antigens , Hepatitis C virus, human immunodeficiency virus, human herpes virus, herpes simplex virus-1, herpes simplex virus-2, human cytomegalovirus, Epstanvar virus, Varicella-Zoster virus, human Herpesvirus-6, human herpesvirus-7, human influenza, measles virus, hantaan virus, pneumonia virus, rhinovirus, poliovirus, human respiratory syncytial virus, retrovirus, human T-cell leukemia Virus, rabies virus, epidemic parotid gland Virus, malaria (Plasmodium falciparum (Plasmodium falciparum)), Borudeteria-Perutusushisu (Bordetelia pertussis), diphtheria, Rickettsia Purowazekkyi (Rickettsia prowazekki), Borrelia burgdorferi Berg (Borrelia bergdorferi), tetanus toxoid, malignant tumor antigen.

  Furthermore, S-SPV-035 (Example 20) is useful in enhancing immune responses in humans when combined with swinepox virus interleukin-2. Additional cytokines including, but not limited to, interleukin-2, interleukin-6, interleukin-12, interferon, granulocyte-macrophage colony stimulating factor, interleukin receptor from humans and other animals include When put into a non-essential site in the swinepox virus genome by a vector and subsequently expressed, it has an immunostimulatory effect.

  Recombinant swinepox virus expresses foreign genes in human cell lines. S-SPV-003 (EP1LP2 promoter that expresses the lacZ gene) expressed the lacZ gene in the THP human monocyte cell line by measuring β-galactosidase activity. Cytotoxic effects of swinepox virus are observed in THP human monocytes, which means that recombinant swinepox virus expresses foreign genes in human cell lines, but does not infect or replicate in human cell lines with good reproducibility Indicates. Swinepox virus has been shown to replicate well in ESK-4 cells (embryonic porcine kidney), indicating that ESK-4 cells will be a suitable basis for the production of SPV recombinant vaccines.

Example 22
Avian vaccine using recombinant swinepox virus as vector
Example 22A
S-SPV-026
S-SPV-026 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for infectious disease virus (IBDV) polyprotein were inserted into the SPV 617-48.1 ORF (the only AccI restriction site is the only NotI restriction site). Replaced). The lacZ gene is under the control of the synthetic late promoter (LP1) and the IBDV polyprotein gene is under the control of the synthetic early / late promoter (EP1LP2).

  S-SPV-026 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 689-50.4 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods to Create Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-026. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-026 was assayed for expression of IBDV polyprotein-specific antigen using “black plaque screening for foreign gene expression in recombinant SPV”. Rat antiserum to IBDV polyprotein was shown to react specifically with S-SPV-026 plaques but not with S-SPV-001 negative control plaques. All S-SPV-026 observed plaques reacted with antisera, indicating that the virus was stably expressing the IBDV polyprotein gene. The assay described here was performed on ESK-4 cells, indicating that ESK-4 cells would be a suitable basis for the production of SPV recombinant vaccines.

  To confirm expression of the IBDV polyprotein gene product, cells were infected with SPV-026 and samples of infected cell lysates were subjected to SDS-polyacrylamide gel electrophoresis. The gel was blotted and analyzed using “Western blotting”. Expression of IBDV protein was detected using rat antisera against IBDV proteins VP2, VP3, and VP4 and a monoclonal antibody against IBDV VP2. Lysates from S-SPV-026 infected cells exhibited a band at 32-40 kd, the expected size of IBDV protein.

Example 22B
S-SPV-027
S-SPV-027 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for infectious disease virus (IBDV) VP2 (40 kd) were inserted into the SPV 617-48.1 ORF (the only AccI restriction site is the only NotI restriction site). Replaced by site). The lacZ gene is under the control of the synthetic late promoter (LP1) and the IBDV VP2 gene is under the control of the synthetic early / late promoter (EP1LP2).

  S-SPV-027 was derived from S-SPV-001 (Kasza strain). This was accomplished using the homology vector 689-50.7 (see Materials and Methods) and the virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-027. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-027 was assayed for expression of IBDV VP2-specific antigen using “black plaque screening for foreign gene expression in recombinant SPV”. Rat antiserum to IBDV protein was shown to react specifically with S-SPV-027 plaques but not with S-SPV-001 negative control plaques. All S-SPV-027 observed plaques reacted with antiserum, indicating that the virus was stably expressing the IBDV VP2 gene. The assay described here was performed on ESK-4 cells, indicating that ESK-4 cells would be a suitable basis for the production of SPV recombinant vaccines.

  To confirm the expression of the IBDV VP2 gene product, cells were infected with SPV-027 and samples of infected cell lysates were subjected to SDS-polyacrylamide gel electrophoresis. The gel was blotted and analyzed using “Western blotting”. Expression of IBDV VP2 protein was detected using rat antiserum against IBDV protein and monoclonal antibody R63 against IBDV VP2. Lysates from S-SPV-027 infected cells exhibited a band at 40 kd, the expected size of IBDV VP2 protein.

  S-SPV-026 and S-SPV-027 are also useful as vaccines against infectious disease in chickens and as expression vectors for IBDV protein. Recombinant swinepox virus is useful as a vaccine against other avian diseases when foreign antigens from the following diseases or diseased microorganisms are expressed in swinepox virus vectors: Marek's disease virus, infectious pharyngeal tracheitis Virus, Newcastle disease virus, infectious bronchitis virus, and chicken anemia virus, chick anemia virus, avian encephalomyelitis virus, avian reovirus, avian paramyxovirus, avian influenza virus, avian adenovirus, fowlpox virus, avian Coronavirus, avian rotavirus, Salmonella species E. coli, Pasteurella species, Haemophilus species, Chlamydia species, Mycoplasma species, Campylobacter species, Bordetella Species, poultry nematode, tapeworm, sucking , Poultry mites / lice, poultry protozoa (Eimeria (Eimeria) species, Histomonas (Histomona) species, trichomoniasis (Trichomonas) species).

Example 23
SPV-036
S-SPV-036 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) was inserted into the SPV 617-48.1 ORF (the unique AccI restriction site was replaced with a unique NotI restriction site). The lacZ gene is under the control of the human cytomegalovirus immediate type (HCMV IE) promoter.

  S-SPV-036 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vectors 741-80.3 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods to Create Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-036. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  Expression of lacZ from the HCMV IE promoter provides a strong promoter for the expression of foreign genes in swinepox. S-SPV-036 is a novel and unexpected proof of the herpesvirus promoter that drives the expression of foreign genes in poxviruses. S-SPV-036 is useful for formulating human vaccines and recombinant swinepox virus is useful for the expression of neutralization of antigens from human pathogens. Recombinant swinepox virus is exogenous in human cell lines as shown by the fact that S-SPV-003 (promoter expressing lacZ gene (EP1LP2)) expressed β-galactosidase in the THP human monocyte cell line. The gene was expressed. No cytotoxic effect of swinepox virus on THP human monocytic cells was observed, which is that recombinant swinepox virus can express foreign genes in human cell lines, but does not reproducibly replicate or replicate in human cell lines It shows that.

Example 24
Homology vector 738-94.4
Homology vector 738-94.4 is a swinepox virus vector that expresses one foreign gene. The gene for E. coli β-galactosidase (lacZ) was inserted into the O1L open reading frame (SEQ ID NO: 115). The lacZ gene is under the control of the O1L promoter. The homology vector 738-94.4 contains a deletion of SPV DNA from nucleotides 1679 to 2452 (SEQ ID NO: 189; FIG. 17) representing a portion of the O1L ORF.

  The upstream SPV sequence is synthesized by polymerase chain reaction with DNA primer 5'-GAAGCATGCCCGTTCTTATCAATAGTTTTAGTCGAAAATA-3 '(SEQ ID NO: 185) and 5'-CATAAGATCTGCATTTGTATATACAAAAAAATAAG-3' (SEQ ID NO: 186) to form an upstream SPV sequence 55Gl Paired fragments were obtained. The O1L promoter is present on this fragment. A downstream SPV sequence is synthesized by polymerase chain reaction using DNA primers 5'-CCGTTAGTCGACAAAGATCTCACTATTATAATATGTATGGGATT-3 '(SEQ ID NO: 187) and 5'-GCCTGAAGCTTCTAGTACAGTATTTACGAACTTTGAAAT-3' (SEQ ID NO: 188) to generate Sal11 and III Paired fragments were obtained. Recombinant swinepox virus was derived using homology vector 738-94.4 and virus S-SPV-001 (Kansza strain) in "Homologous Recombination Method for Creating Recombinant SPV". Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was the recombinant virus. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes. Recombinant swinepox virus derived from homology vector 738-94.4 is protected in animals as an expression vector for expressing foreign antigens and against foreign genes expressed by recombinant swinepox virus It is used as a vaccine for raising an immune response. In addition to the O1L promoter, other promoters including LP1, EP1LP2, LP2EP2, HCMV immediate type are inserted into the deletion region, and one or more foreign genes are expressed from these promoters.

Example 24B
Homology vector 752-22.1 is a swinepox virus vector used to express two foreign genes. The gene for E. coli β-galactosidase (lacZ) was inserted into the O1L open reading frame (SEQ ID NO: 115). The lacZ gene is under the control of the O1L promoter. The second exogenous gene is expressed from the LP2EP2 promoter inserted in the EcoRI or BamHI site according to the LP2EP2 promoter sequence. Homology vector 752-22.1 contains a deletion of SPV DNA from nucleotides 1679 to 2452 (SEQ ID NO: 189; FIG. 17), which lacks a portion of the O1L ORF. Homology vector 752-22.1 was derived from homology vector 738-94.4 by insertion of the LP2EP2 promoter fragment (see Materials and Methods). Homology vector 752-22.1 is further improved by inclusion of the lacZ gene under the control of the synthetic LP1 promoter. The LP1 promoter results in a higher level of lacZ expression compared to the SPV O1L promoter.

Example 25
S-SPV-041:
S-SPV-041 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for equine herpesvirus type 1 glycoprotein B (gB) were 738-94.4 ORF (773 base pair deletion of SPV OLL ORF; nucleotides 1679 to 2452) Deletion, SEQ ID NO: 189). The lacZ gene is under the control of the swinepox OLL promoter, and the EHV-1 gB gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-041 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 752-29.33 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-041. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-041 is useful as a vaccine against EHV-1 infection in horses and is useful for the expression of EHV-1 glycoprotein B.

S-SPV-045:
S-SPV-045 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for infectious bovine rhinotracheitis virus glycoprotein E (gE) 738-94.4 ORF (773 base pair deletion of SPV OLL ORF; nucleotides 1679 to 2452) Of SEQ ID NO: 189). The lacZ gene is under the control of the swinepox OLL promoter and the IBRV gE gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-045 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 746-94.1 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-045. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-045 is useful for the expression of IBRV glycoprotein E.

S-SPV-049:
S-SPV-049 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for bovine viral diarrhea virus glycoprotein 48 (gp48) are 738-94.4 ORF (773 base pair deletion of SPV OLL ORF; nucleotides 1679 to 2452) Of SEQ ID NO: 189). The lacZ gene is under the control of the swinepox OLL promoter and the BVDV gp48 gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-049 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vectors 771-55.11 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-049. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-049 is useful as a vaccine against BVDV infection in cattle and is useful for the expression of BVDV glycoprotein 48.

S-SPV-050:
S-SPV-050 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for bovine viral diarrhea virus glycoprotein 53 (gp53) are 738-94.4 ORF (773 base pair deletion of SPV OLL ORF; nucleotides 1679 to 2452) Of SEQ ID NO: 189). The lacZ gene is under the control of the swinepox OLL promoter and the BVDV gE gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-050 was derived from S-SPV-001 (Kasza strain). This was accomplished using the homology vector 767-67.3 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-050. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-050 is useful as a vaccine against BVDV infection in cattle and is useful for the expression of BVDV glycoprotein 53.

Example 26
Recombinant swinepox virus S-SPV-042 or S-SPV-043, respectively expressing chicken interferon (cIFN) or chicken bone marrow monocyte growth factor (cMGF), is added to vaccines against poultry disease and produces an immune response. Useful for augmentation. Chicken bone marrow monocyte growth factor (cMGF) is homologous to mammalian interleukin-6 protein, and chicken interferon (cIFN) is homologous to mammalian interferon. When used in combination with a vaccine against specific avian diseases, S-SPV-042 and S-SPV-043 include, but are not limited to, Marek's disease virus, Newcastle disease virus, infectious pharyngeal tracheitis virus, infectiousness Provides enhanced mucous, humoral, or cell-mediated immunity against viruses that cause bronchitis, birds, including infectious scab virus.

Example 26A
S-SPV-042:
S-SPV-042 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for chicken interferon (cIFN) were inserted into the SPV617-48.1 ORF (the unique AccI restriction site was replaced with a unique NcoI restriction site). The lacZ gene is under the control of the synthetic postscript promoter (LP1), and the cIFN gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-042 was derived from S-SPV-001 (Kasza strain). This is based on the homologous vector 751-07. In “Homologous recombination method for creating recombinant SPV”. A1 (see Materials and Methods) and virus S-SPV-001 were achieved. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-042. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-042 has interferon activity in cell culture. Addition of S-SPV-042 conditioned medium to chicken embryo fibroblast (CEF) cell culture inhibits infection of CEF cells by vesicular stomatitis virus or by turkey herpesvirus. S-SPV-042 is useful to enhance the immune response when added to a vaccine against poultry disease.

Example 26B
S-SPV-043:
S-SPV-043 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for chicken bone marrow monocyte growth factor (cMGF) were inserted into the SPV617-48.1 ORF (the unique AccI restriction site was replaced with a unique NcoI restriction site). did. The lacZ gene is under the control of the synthetic postscript promoter (LP1), and the cMGF gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-043 was derived from S-SPV-001 (Kasza strain). This is based on the homology vector 751-56. A1 (see Materials and Methods) and virus S-SPV-001 were achieved. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-043. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-043 is useful to enhance the immune response when added to a vaccine against poultry disease.

Example 27
Of the non-essential site of the swinepox virus HindIII M fragment
Insertion into the 2.0 kb HindIII to BglII Region The 2.0 kb HindIII to BglII region of the swinepox virus HindIII M fragment is useful for the insertion of foreign DNA into the SPV. Exogenous DNA is inserted into the unique BglII restriction site in the region (FIG. 17; nucleotide 540 of SEQ ID NO: 195). According to the “homologous recombination method for creating a recombinant SPV”, an SPV containing foreign DNA is obtained using a plasmid containing the foreign DNA insert. For this procedure to be successful, the swinepox virus is suitable for mediating homologous recombination between the virus and plasmid DNA where the insertion site is in a region not essential for SPV replication. It is important that the DNA is adjacent to its end. The only BglII restriction site in the 2.0 kb HindIII to BglII region of the swinepox virus HindIII M fragment is located within the coding region of the SPV I4L oven reading frame. The I4L ORF has sequence similarity to the vaccinia virus and smallpox virus ribonucleotide reductase (large subunit) gene (56-58). The ribonucleotide reductase (large subunit) gene is non-essential for DNA replication of vaccinia virus and is an appropriate insertion site in swinepox virus.

Example 28
S-SPV-047
S-SPV-047 is a swinepox virus that expresses two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for pseudorabies virus gB (gII) are transferred to a unique HindIII site (a 2.0 kb BglII to HindIII subfragment of the HindIII M fragment). Inserted into the inserted HindIII linker). The BglII insertion site is in the SPV 14L open reading frame with significant homology to the vaccinia virus ribonucleoside diphosphate reductase gene. The lacZ gene is under the control of the synthetic late promoter (LP1), and the PRV gB (gII) gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-047 was derived from S-SPV-001 (Kasza strain). This was accomplished using the homology vector 799-94.31 (see Materials and Methods) and the virus S-SPV-001 in “Homologous Recombination Methods to Create Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-047. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-047 was assayed for expression of PRV-specific antigens using “black plaque screening for foreign gene expression in recombinant SPV”. Porcine anti-PRV polyclonal serum was shown to react specifically with S-SPV-047 plaques but not with S-SPV-001 negative control plaques. All S-SPV-047 observed plaques reacted with porcine anti-PRV serum indicating that the virus stably expressed the PRV foreign gene. The assay described here was performed on ESK-4 cells, indicating that ESK-4 cells would be a suitable basis for the production of SPV recombinant vaccines.

  To confirm the expression of the PRV gB gene product, cells were infected with SPV-047, and samples of infected cell lysates and culture supernatants were subjected to SDS-polyacrylamide gel electrophoresis. The gel was blotted and analyzed using “Western blotting”. The expression of PRV-specific protein was detected using porcine anti-PRV polyclonal serum. Lysates from S-SPV-047 infected cells exhibited bands corresponding to the expected sizes of PRV glycoprotein B, 120 kD, 67 kD and 58 kD.

  PRV gB expressed in SPV recombinants has been shown to stimulate a significant immune response in pigs (37, 38; see Example 8). In addition, PRV gB is expressed in recombinant SPV and provides significant protection from attack with virulent PRV (see Examples 6 and 8). Therefore, S-SPV-047 is valuable as a vaccine to protect pigs against PRV disease. Since the PRV vaccines described here do not express PRV gX or gI, they are compatible with current PRV diagnostic tests (gX HerdChekR, gI HerdChekR and ClinEaseR) used to distinguish vaccinated animals from infected animals. Let's go.

S-SPV-052
S-SPV-052 is a swinepox virus that expresses three foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for pseudorabies virus gB (gII) with a unique HindIII restriction site (a HindIII linker inserted into a unique NdeI site in the SPV OLL open reading frame; SPV HindIII An approximately 545 base pair NdeI to NdeI subfragment of the M fragment (nucleotides 1560 to 2104; SEQ ID NO) has been deleted). The gene for PRV gD (g50) was inserted into a unique PstI restriction site (PstI linker inserted into the unique AccI site in the SPV OLL open reading frame). The lacZ gene is under the control of the synthetic late promoter (LP1), the PRV gB (gII) gene is under the control of the synthetic late / early promoter (LP2EP2), and the PRV gD (g50) gene is under the synthetic early / late promoter (LP EP1LP2).

  S-SPV-052 was derived from S-SPV-001 (Kasza strain). This was accomplished using the homology vector 789-41.7 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods to Create Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-052. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-052 was assayed for expression of PRV-specific antigens using "black plaque screening for foreign gene expression in recombinant SPV". Porcine anti-PRV polyclonal serum was shown to react specifically with S-SPV-052 plaques but not with S-SPV-001 negative control plaques. All S-SPV-052 observed plaques reacted with porcine anti-PRV serum, indicating that the virus stably expressed the PRV foreign gene. The assay described here was performed on ESK-4 cells, indicating that ESK-4 cells would be a suitable basis for the production of SPV recombinant vaccines.

  To confirm the expression of PRV gB and gD gene products, cells were infected with SPV-052, and samples of infected cell lysates and culture supernatants were subjected to SDS-polyacrylamide gel electrophoresis. The gel was blotted and analyzed using “Western blotting”. The expression of PRV-specific protein was detected using porcine anti-PRV polyclonal serum. Lysates and supernatants from S-SPV-052 infected cells are bands corresponding to the predicted sizes of 120 kD, 67 kD and 58 kD of PRV glycoprotein B, and 48 kD of the predicted size of PRV glycoprotein D A band corresponding to was presented.

PRV gB and gD expressed in SPV recombinants have been shown to stimulate significant immune responses in pigs (37, 38; see Example 8). Furthermore, PRV gB and gD are expressed in recombinant SPV, resulting in significant protection from attack with virulent PRV (see Examples 6 and 8). Therefore, S-SPV-052 is valuable as a vaccine to protect pigs against PRV disease. Since the PRV vaccines described herein do not express PRV gX or gI, they are compatible with current PRV diagnostic tests (gX HerdChek ^R , gI HerdChek ^R and ClinEase ^R ) used to distinguish vaccinated animals from infected animals Will do.

S-SPV-053
S-SPV-053 is a swinepox virus that expresses three foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for pseudorabies virus gB (gII) with a unique HindIII restriction site (HindIII linker inserted at the unique NeI site in the SPV OLL open reading frame; SPV HindIII An approximately 545 base pair NdeI to NdeI subfragment of the M fragment (nucleotides 1560 to 2104; SEQ ID NO) has been deleted). The gene for PRV gC (gIII) was inserted into a unique PstI restriction site (PstI linker inserted into a unique AccI site in the SPV OIL open reading frame). The lacZ gene is under the control of the synthetic late promoter (LP1), the PRV gB (gII) gene is under the control of the synthetic late / early promoter (LP2EP2), and the PRV gC (gIII) gene is under the synthetic early / late promoter (LP EP1LP2).

  S-SPV-053 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 789-41.27 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-053. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-053 was assayed for expression of PRV-specific antigens using “black plaque screening for foreign gene expression in recombinant SPV”. Porcine anti-PRV polyclonal serum was shown to react specifically with S-SPV-053 plaques but not with S-SPV-001 negative control plaques. All S-SPV-053 observed plaques reacted with porcine anti-PRV serum indicating that the virus stably expressed the PRV foreign gene. The assay described here was performed on ESK-4 cells, indicating that ESK-4 cells would be a suitable basis for the production of SPV recombinant vaccines.

  To confirm expression of PRV gB and gC gene products, cells were infected with SPV-053, and samples of infected cell lysates and culture supernatants were subjected to SDS-polyacrylamide gel electrophoresis. The gel was blotted and analyzed using “Western blotting”. The expression of PRV-specific protein was detected using porcine anti-PRV polyclonal serum. Lysates and supernatants from S-SPV-053 infected cells were bands corresponding to the expected sizes of PRV glycoprotein B 120 kD, 67 kD and 58 kD, and PRV glycoprotein C predicted size 92 kD A band corresponding to was presented.

PRV gB and gC expressed in SPV recombinants have been shown to stimulate significant immune responses in pigs (37, 38; see Example 8). Furthermore, PRV gB and gC are expressed in recombinant SPV, resulting in significant protection from attack with virulent PRV (see Examples 6 and 8). S-SPV-053 is therefore valuable as a vaccine to protect pigs against PRV disease. Since the PRV vaccines described herein do not express PRV gX or gI, they are compatible with current PRV diagnostic tests (gX HerdChek ^R , gI HerdChek ^R and ClinEase ^R ) used to distinguish vaccinated animals from infected animals Will do.

S-SPV-054
S-SPV-054 is a swinepox virus that expresses three foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for pseudorabies virus gC (gIII) with a unique HindIII restriction site (HindIII linker inserted into a unique NeI site in the SPV OLL open reading frame; SPV HindIII; An approximately 545 base pair NdeI to NdeI subfragment of the M fragment (nucleotides 1560 to 2104; SEQ ID NO) has been deleted). The gene for PRV gD (g50) was inserted into a unique PstI restriction site (PstI linker inserted into the unique AccI site in the SPV OLL open reading frame). The lacZ gene is under the control of the synthetic late promoter (LP1), the PRV gC (gIII) gene is under the control of the synthetic early / late promoter (EP1LP2), and the PRV gD (g50) gene is under the synthetic early / late promoter ( EP1LP2).

  S-SPV-054 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 789-41.27 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-054. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-054 was assayed for expression of PRV-specific antigens using “black plaque screening for foreign gene expression in recombinant SPV”. Porcine anti-PRV polyclonal serum was shown to react specifically with S-SPV-054 plaques but not with S-SPV-001 negative control plaques. All S-SPV-054 observed plaques reacted with porcine anti-PRV serum indicating that the virus stably expressed the PRV foreign gene. The assay described here was performed on ESK-4 cells, indicating that ESK-4 cells would be a suitable basis for the production of SPV recombinant vaccines.

  To confirm the expression of PRV gC and gD gene products, cells were infected with SPV-054, and samples of infected cell lysates and culture supernatants were subjected to SDS-polyacrylamide gel electrophoresis. The gel was blotted and analyzed using “Western blotting”. The expression of PRV-specific protein was detected using porcine anti-PRV polyclonal serum. Lysates and supernatants from S-SPV-054 infected cells correspond to a band corresponding to the predicted size of PRV glycoprotein C, 92 kD, and a band corresponding to the predicted size of PRV glycoprotein D, 48 kD. Was presented.

PRV gC and gD expressed in SPV recombinants have been shown to stimulate significant immune responses in pigs (37, 38; see Example 8). In addition, PRV gC and gD are expressed in recombinant SPV, resulting in significant protection from attack with virulent PRV (see Examples 6 and 8). S-SPV-054 is therefore valuable as a vaccine to protect pigs against PRV disease. Since the PRV vaccines described herein do not express PRV gX or gI, they are compatible with current PRV diagnostic tests (gX HerdChek ^R , gI HerdChek ^R and ClinEase ^R ) used to distinguish vaccinated animals from infected animals Will do.

S-SPV-055
S-SPV-055 is a swinepox virus that expresses four foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for pseudorabies virus gB (gII) with a unique HindIII restriction site (HindIII linker inserted at the unique NeI site in the SPV OLL open reading frame; SPV HindIII An approximately 545 base pair NdeI to NdeI subfragment of the M fragment (nucleotides 1560 to 2104; SEQ ID NO) has been deleted). The genes for PRV gD (g50) and PRV gC (gIII) were inserted into a unique PstI restriction site (PstI linker inserted into a unique AccI site in the SPV OLL open reading frame). The lacZ gene is under the control of the synthetic late promoter (LP1), the PRV gB (gII) gene is under the control of the synthetic late / early promoter (LP2EP2), and the PRV gD (g50) gene is under the late synthetic / early promoter (LP2EP2) ) And the PRV gC (gIII) gene is under the control of the early synthesis / postscript promoter (EP1LP2).

  S-SPV-055 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 789-41.73 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-055. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-055 was assayed for expression of PRV-specific antigens using “black plaque screening for foreign gene expression in recombinant SPV”. Porcine anti-PRV polyclonal serum was shown to react specifically with S-SPV-055 plaques but not with S-SPV-001 negative control plaques. All S-SPV-055 observed plaques reacted with porcine anti-PRV serum, indicating that the virus stably expressed the PRV foreign gene. The assay described here was performed on ESK-4 cells, indicating that ESK-4 cells would be a suitable basis for the production of SPV recombinant vaccines.

  To confirm expression of the PRV gB, gC and gD gene products, cells were infected with SPV-055, and samples of infected cell lysates and culture supernatants were subjected to SDS-polyacrylamide gel electrophoresis. The gel was blotted and analyzed using “Western blotting”. The expression of PRV-specific protein was detected using porcine anti-PRV polyclonal serum. Lysates and supernatants from S-SPV-055 infected cells are at bands corresponding to the predicted sizes of PRV glycoprotein B of 120 kD, 67 kD and 58 kD; PRV glycoprotein C is predicted to be 92 kD A corresponding band; and a band corresponding to the expected size of PRV glycoprotein D, 48 kD.

PRV gB, gC and gD expressed in SPV recombinants have been shown to elicit significant immune responses in pigs (37, 38; see Example 8). In addition, PRV gB, gC and gD are expressed in recombinant SPV, resulting in significant protection from attack with virulent PRV (see Examples 6 and 8). S-SPV-055 is therefore valuable as a vaccine to protect pigs against PRV disease. Since the PRV vaccines described herein do not express PRV gX or gI, they are compatible with current PRV diagnostic tests (gX HerdChek ^R , gI HerdChek ^R and ClinEase ^R ) used to distinguish vaccinated animals from infected animals Will do.

Example 29
SPV-059
S-SPV-059 is a swinepox virus that expresses one foreign gene. The gene for E. coli β-glucuronidase (uidA) was inserted into the unique EcoRI restriction site in the SPV B18R open reading frame within the SPV HindIII K genomic fragment. The uidA gene is under the control of the late / early promoter (LP2EP2). The partial sequence from the 3.2 kb region of the SPV 6.5 kb HindIII K fragment (SEQ ID NO :) shows three possible open reading frames. The SPV B18R ORF shows sequences homologous to the vaccinia virus B18R gene, the 77.2K protein from rabbit fibroma virus, the vaccinia virus C19L / B25R ORF and the ankyrin repeat region from human brain variants. The B18R gene encodes a soluble interferon receptor with high affinity and broad specificity. The SPV B4R open reading frame shows a sequence homologous to the T5 protein of rabbit fibroma virus.

  S-SPV-059 was derived from S-SPV-001 (Kasza strain). This was accomplished using the homology vector 796-50.31 and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Homology vector 794-50.31 is the only EcoRI in the SPV 6.5 kb HindIII K fragment of the blunt-ended NcoI fragment containing the LP2EP2 promoter uidA cassette from plasmid 551-47.23 (see materials and methods). Created by insertion at the site (blunted). Transfection stocks were screened by “screening for recombinant herpesviruses expressing the enzyme marker gene”. The final result of blue plaque purification was a recombinant virus designated S-SPV-059. The virus was assayed for β-glucuronidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, the observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-059 was purified and expressed a foreign gene, E. coli uidA, indicating that the EcoRI site in the 7.5 kb HindIII K fragment is a stable insertion site for the foreign gene. Show. Recombinant swinepox virus using this insertion site is useful for expressing foreign genes, as a vaccine against diseases, or as an expression vector for raising antibodies against the expressed foreign genes.

SPV-060
S-SPV-060 is a swinepox virus that expresses one foreign gene. The gene for E. coli β-glucuronidase (uidA) was inserted into a unique EcoRV restriction site within the SPV HindIII N genomic fragment. The uidA gene is under the control of the late / early promoter (LP2EP2). The partial sequence of the SPV 3.2 kb HindIII N fragment (SEQ ID NO :) shows two possible open reading frames. SPV I7L ORF shows a sequence homologous to protein I7 of vaccinia virus. The SPV I4L open reading frame shows a sequence homologous to the ribonucleoside diphosphate reductase gene of vaccinia virus. The two possible open reading frames I5L and I6L between the I4L ORF and the I7L ORF are of unknown function.

  S-SPV-060 was derived from S-SPV-001 (Kasza strain). This was accomplished using the homology vector 796-71.31 and the virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Homology vector 79-71.31 is in the SPV 3.2 kb HindIII N fragment (FIG. 29A) of a blunt-ended NcoI fragment containing the LP2EP2 promoter uidA cassette from plasmid 551-47.23 (see Materials and Methods). Was created by insertion into the only EcoRV site. Transfection stocks were screened by “screening for recombinant herpesviruses expressing the enzyme marker gene”. The final result of blue plaque purification was a recombinant virus designated S-SPV-060. The virus was assayed for β-glucuronidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, the observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-060 was purified and expressed a foreign gene, E. coli uidA, indicating that the EcoRI site in the 3.2 kb HindIII N fragment is a stable insertion site for the foreign gene. Show. Recombinant swinepox virus using this insertion site is useful for expressing foreign genes, as a vaccine against diseases, or as an expression vector for raising antibodies against the expressed foreign genes.

S-SPV-061
S-SPV-061 is a swinepox virus that expresses one foreign gene. The gene for E. coli β-glucuronidase (uidA) was inserted into a unique SnaBI restriction site within the SPV HindIII N genomic fragment. The uidA gene is under the control of the late / early promoter (LP2EP2). The partial sequence of the SPV 3.2 kb HindIII N fragment (SEQ ID NO :) shows two possible open reading frames. SPV I7L ORF shows a sequence homologous to protein I7 of vaccinia virus. The SPV I4L open reading frame shows a sequence homologous to the ribonucleoside diphosphate reductase gene of vaccinia virus. The two possible open reading frames I5L and I6L between the I4L ORF and the I7L ORF are of unknown function.

  S-SPV-061 was derived from S-SPV-001 (Kasza strain). This was accomplished using the homology vector 794-71.41 and the virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Homology vector 794-71.41 is the only SnaBI in the SPV 3.2 kb HindIII N fragment of the blunt-ended NcoI fragment containing the LP2EP2 promoter uidA cassette from plasmid 551-47.23 (see materials and methods). Created by insertion into the site. Transfection stocks were screened by “screening for recombinant herpesviruses expressing the enzyme marker gene”. The final result of blue plaque purification was a recombinant virus designated S-SPV-061. The virus was assayed for β-glucuronidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, the observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-061 was purified and expressed a foreign gene, E. coli uidA, indicating that the SnaBI site in the 3.2 kb HindIII N fragment is a stable insertion site for the foreign gene. Show. Recombinant swinepox virus using this insertion site is useful for expressing foreign genes, as a vaccine against diseases, or as an expression vector for raising antibodies against the expressed foreign genes.

S-SPV-062
S-SPV-062 is a swinepox virus that expresses one foreign gene. The gene for E. coli β-glucuronidase (uidA) was inserted into a unique BglII restriction site within the SPV HindIII N genomic fragment. The uidA gene is under the control of the late / early promoter (LP2EP2). The partial sequence of the SPV 3.2 kb HindIII N fragment (SEQ ID NO :) shows two possible open reading frames. SPV I7L ORF shows a sequence homologous to protein I7 of vaccinia virus. The SPV I4L open reading frame shows a sequence homologous to the ribonucleoside diphosphate reductase gene of vaccinia virus. The two possible open reading frames I5L and I6L between the I4L ORF and the I7L ORF are of unknown function.

  S-SPV-062 was derived from S-SPV-001 (Kasza strain). This was accomplished using the homology vector 79-71.51 and the virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Homology vector 79-71.51 is the only BglII in the SPV 3.2 kb HindIII N fragment of the blunt-ended NcoI fragment containing the LP2EP2 promoter uidA cassette from plasmid 551-47.23 (see materials and methods). Created by insertion into the site. Transfection stocks were screened by “screening for recombinant herpesviruses expressing the enzyme marker gene”. The final result of blue plaque purification was a recombinant virus designated S-SPV-062. The virus was assayed for β-glucuronidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, the observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-062 was purified and expressed a foreign gene, E. coli uidA, indicating that the BglII site in the 3.2 kb HindIII N fragment is a stable insertion site for the foreign gene. Show. Recombinant swinepox virus using this insertion site is useful for expressing foreign genes, as a vaccine against diseases, or as an expression vector for raising antibodies against the expressed foreign genes.

Example 30:
Recombinant swinepox virus that expresses E. coli β-galactosidase (lacZ) under the control of the synthetic early or synthetic sputum promoter, respectively Three recombinant swinepox viruses S-SPV-056, S-SPV-057, and S-SPV-058 expressing (lacZ) were constructed.

  S-SPV-056 was derived from S-SPV-001 (Kasza strain). This was accomplished using the homology vector 791-63.19 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). S-SPV-057 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 791-63.41 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). S-SPV-058 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 796-18.9 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was the recombinant viruses designated S-SPV-056, S-SPV-057 and S-SPV-058. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  Recombinant swinepox virus expresses foreign genes such as E. coli β-galactosidase in human cell lines, but does not replicate in human cell lines. To optimize the expression of foreign genes, S-SPV-056, S-SPV-057 and S-SPV-058 were used to control E. coli β under the control of an early or late synthetic poxvirus promoter. -Compare the optimal expression level of galactosidase. Human cell lines in which the expression of recombinant swinepox virus is deleted include, but are not limited to, 143B (osteosarcoma), A431 (epidermoid carcinoma), A549 (lung cancer), Capan-1 (liver cancer) ), CF500 (foreskin fibroblasts), Chang Liver (liver), Detroit (down foreskin fibroblasts), HEL-199 (embryonic lung), HeLa (cervical cancer), HEp-2 (epidermal pharyngeal cancer) HISM (intestinal smooth muscle), HNK (neonatal kidney), MRC-5 (embryonic lung), NCI-H292 (pulmonary mucosal epidermoid carcinoma), OVCAR-3 (ovarian cancer), RD (rhabdomyosarcoma), THF (Monocyte leukocytes), WIL2-NS (B lymphocyte system, non-secretory), WISH (amniotic membrane).

Example 31
S-SPV-051
S-SPV-051 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for bovine viral diarrhea virus glycoprotein 53 (g53) were inserted into the SPV 617-48.1 ORF (the only AccI restriction site is the only NotI restriction site). Replaced by site). The lacZ gene is under the control of the synthetic late promoter (LP1) and the BVDV g53 gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-051 was derived from S-SPV-001 (Kasza strain). This was accomplished using the homology vector 783-39.2 (see Materials and Methods) and the virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-051. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-051 was assayed for expression of PRV-specific antigens using “black plaque screening for foreign gene expression in recombinant SPV”. The mouse monoclonal antibody against BVDV g53 was shown to react specifically with S-SPV-051 plaques but not with S-SPV-001 negative control plaques. All S-SPV-051 observed plaques reacted with a monoclonal antibody against BVDV g53, indicating that the virus stably expressed the PRV foreign gene. The assay described here was performed on ESK-4 cells, indicating that ESK-4 cells would be a suitable basis for the production of SPV recombinant vaccines.

  To confirm the expression of the BVDV g53 gene product, cells were infected with SPV-051 and samples of infected cell lysates were subjected to SDS-polyacrylamide gel electrophoresis. The gel was blotted and analyzed using “Western blotting”. BVDV specific protein expression was detected using a monoclonal antibody against BVDV g53. Lysates and supernatants from S-SPV-051 infected cells exhibited a band of 53 kd and above indicating glycosylated and non-glycosylated forms of BVDV g53 protein.

  S-SPV-051 is useful as a vaccine against BVDV infection in cattle and is useful for the expression of BVDV glycoprotein 53.

Example 32:
S-SPV-044:
S-SPV-044 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for infectious disease virus (IBDV) polymerase protein were inserted into the 617-48.1 ORF (the unique AccI restriction site was replaced with a unique NotI restriction site). ) The lacZ gene is under the control of the synthetic late promoter (LP1) and the IBDV polymerase gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-044 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 749-75.78 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-044. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-044 is useful for the expression of IBDV polymerase protein. S-SPV-044 is useful in an in vitro approach to a recombinant IBDV attenuated vaccine. RNA strands from attenuated IBDV strains are synthesized in a bacterial expression system using the T3 or T7 promoter (pBlueScript plasmid; Stratagene, Inc.) to synthesize the double-stranded short and long segments of the IBDV genome. Swinepox virus expresses IBDV polymerase but does not replicate in CEF cells. IBDV polymerase produced from S-SPV-044 synthesizes infectious attenuated IBDV virus from a double stranded RNA genomic template. The resulting attenuated IBDV virus is useful as a vaccine against infectious disease in chickens.

Example 33:
S-SPV-046
S-SPV-046 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for feline immunodeficiency virus (FIV) gag protease (gag) were deleted from 738-94.4 ORF (773 base pair deletion of SPV OLL ORF; nucleotides 1669 to 2452) Of SEQ ID NO: 189). The lacZ gene is under the control of the swinepox OLL promoter and the FIV gag gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-046 was derived from S-SPV-001 (Kasza strain). This is based on the homology vector 761-75. Achieved using B18 (see Materials and Methods) and virus S-SPV-001. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-046. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  To confirm the expression of the FIV gag gene product, cells were infected with SPV-046 and samples of infected cell lysates and culture supernatants were subjected to SDS-polyacrylamide gel electrophoresis. The gel was blotted and analyzed using “Western blotting”. Feline anti-FIV (PPR strain) serum was used to detect the expression of FIV specific proteins. Lysates and supernatants from S-SPV-046 infected cells exhibited bands at 26 kd and 17 kd, the expected size of FIV gag protein. The FIV gag protein expressed by the recombinant swinepox virus was appropriately processed and secreted into the medium.

S-SPV-048
S-SPV-048 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for feline immunodeficiency virus (FIV) envelope (env) were inserted into the SPV 617-48.1 ORF (the only AccI restriction site is the only NctI restriction site). Replaced). The lacZ gene is under the control of the late synthetic promoter (LP1) and the FIV env gene is under the control of the late synthetic / early promoter (LP2EP2).

  S-SPV-048 was derived from S-SPV-001 (Kasza strain). This is based on the homology vector 781-84. Achieved using C11 (see Materials and Methods) and virus S-SPV-001. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-048. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-046 and S-SPV-048 are useful alone or in combination as a vaccine against FIV infection in cats and are useful for the expression of FIV env and gag proteins. Recombinant swinepox virus expressing both FIV env and gag proteins is useful as a vaccine against FIV infection in cats.

  Recombinant swinepox virus expressing human respiratory syncytial virus F and G proteins is useful as a vaccine against human diseases.

Example 34
In vitro characteristics of chicken IFN expressed in recombinant poxvirus Proliferation characteristics of recombinant virus in cell culture. Compared to wild type swinepox virus, S-SPV-042 did not grow in embryonic porcine kidney cells (ESK-4).

  Western blot analysis was performed on supernatants from cells infected with SPV / cIFN recombinant virus. Rabbit and mouse antisera were raised against cIFN from concentrated SPV / cIFN infected disciplines and precleared against ESK-4 cells infected with wild type SPV in preparation for Western analysis. . Rabbit and mouse anti-cIFN antisera reacted with denatured proteins on nitrocellulose from recombinant SPV / cIFN and SPV wild type virus infection supernatants. A reactive band with an estimated molecular weight size range of 17-20 kilodaltons was present in the SPV / cIFN lane and not in the SPV wild type control lane.

Effect of cIFN expressed in supernatants from SPV / cIFN (S-SPV-042), FPV / cIFN, and FPV / cIFN / NDV infected cells on the growth of vesicular stomatitis virus SPV / cIFN, FPV / cIFN / cIFN Virion clarified supernatants from infected cells were tested for the presence of virus inhibitory activity and the results are shown in Table 1. Briefly, CEF cells were incubated with serially diluted virus supernatant. Subsequently, 40,000 plaque forming units (pfu) / well of vesicular stomatitis virus (VSV) were added and the wells scored for VSV cytotoxic effect (CPE) 48 hours later. Recombinant virus supernatant containing cIFN was shown to inhibit VSV-induced CPE, while control virus supernatant did not. The VSV-induced cytotoxic effect would have been reversed in the presence of rabbit anti-cIFN serum.

The supernatant containing the recombinant cIFN from ESK-4 cells infected with turkey cIFN effect SPV / cIFN virus expressed from supernatants of SPV / cIFN infected cells to herpes virus, herpesvirus turkeys in CEF cells The activity of inhibiting the growth of (HVT) was tested and the results are shown in Table 2. Briefly, serially diluted supernatants were incubated with CEF cells and then infected with 100 pfu / well of wild type HVT. Plaques were counted in all wells after 48 hours. 10-100 units of cIFN activity inhibited plaque formation in HVT (100 pfu / well). Supernatants from wild type SPV did not inhibit HVT plaque formation.

Induction of NO by chicken macrophages after treatment with cIFN expressed in supernatant from SPV / cIFN-infected cells HD11 cells or bone marrow adherent cells were treated with 1000 units / ml cIFN, lipo from SPV / cIFN supernatant. Incubation with polysaccharide (LPS) (9 ng / ml) or both cIFN and LPS, the results are shown in Table 3. After 24 hours, supernatant fluid was collected and nitrite levels were measured. These data indicate that cIFN expressed from SPV / cIFN supernatant has the ability to activate chicken macrophages in the presence of LPS.

Conclusion:
1. Recombinant swinepox virus expresses biologically active chicken interferon in the supernatant of infected cells as measured by protection of CEF cells from VSV infection.

  2. Chicken interferon expressed in supernatants from recombinant SPV / cIFN infected cells was shown to protect CEF cells against infection with HVT in a dose-dependent manner.

  3. Chicken interferon expressed from SPV / cIFN acts synergistically with PLS to detect by nitric oxide induction and activate chicken macrophages.

  4). The data show that recombinant swinepox virus expressing chicken IFN can have free application as an immunomodulator in vitro, in vivo and in ovo.

Example 35
As an alternative to constructing an IBD vaccine using a viral vector delivery system and / or subunit approach, both the large (segment A) and small (segment B) double-stranded RNA subunits can be manipulated directly by direct manipulation of the IBD viral RNA. The virus is reconstructed using full-length RNA derived from a cDNA clone representing Generation of IBD virus thus provides several advantages over the first two approaches. First, if the IBD virus is regenerated using an RNA template, a cloned cDNA copy of the viral genome can be manipulated prior to transcription (RMA generation). Using this approach, the virulent IBD strain can be attenuated or the V2 variable region of the attenuated vaccine backbone can be replaced with that of the virulent strain. In doing so, the present invention provides protection against virulent IBD strains while providing the safety and efficiency of vaccine strains. Furthermore, using this approach, the present invention has constructed and tested a temperature sensitive IBD virus generated using RNA polymerase derived from the related birnavirus infectious pancreatic necrosis virus (IPNV) and polyprotein derived from IPNV. Is done. IPNV polymerase has optimal activity at temperatures lower than that of IBDV. If IPNV polymerase recognizes a regulatory signal present on IBDV, the hybrid virus is expected to be attenuated at the high temperatures present in chickens. Alternatively, IBD viruses produced using RNA polymerase derived from IBDV serotype 2 virus and polyproteins derived from IBDV serotype 1 virus can be constructed and tested.

  First, a BursaVac vaccine strain (Sterwin Labs) is used to construct a cDNA clone representing the complete genome of IBDV (double stranded RNA segments A and B). Once a cDNA clone representing the full length copy of segments A and B has been constructed, template RNA is prepared. Since IBDV exists as a two-segmented double-stranded RNA virus, the pBlueScript plasmid (Stratagene, Inc.) is used to obtain both sense and antisense RNA strands for each segment. These vectors utilize highly specific phage promoters to obtain substantial amounts of RNA in vitro. A unique restriction endonuclease site is created in the 3 'PCR primer to linearize the DNA for the generation of run-off transcripts during transcription.

  The purified RNA transcript (4 strands) is transfected into chicken embryo fibroblasts (CEF) to determine whether the RNA is infectious. If an IBD virus is generated, as determined by a black plaque assay using IBDV-specific Mabs, no further manipulation is necessary and vaccine strain generation can begin. The advantage of this method is that the IBD virus generated in this way is pure and requires little / no purification, greatly reducing the time required to create a new vaccine. If purified results are obtained with purified RNA, a functional viral RNA polymerase by use of helper virus is required. Birnavirus replicates its nucleic acid by a strand displacement (semi-conservative) mechanism, and RNA polymerase binds to the ends of double-stranded RNA molecules to form a circular ring structure (Muller & Nitschke, Virology 159, 174-177, 1987). An approximately 878 amino acid RNA polymerase open reading frame in swinepox virus is expressed and this recombinant virus (S-SPV-044) is used to obtain functional IBDV RNA in-transit. In the absence of signs of productive replication of the viral vector, swinepox virus expressed an immunologically recognizable foreign antigen in avian cells (CEF cells). In the present invention, the IBDV polymerase protein is expressed in the same cell as the RNA transfected with the IBDV polymerase protein using the swinepox vector without contaminating the cells with SPV replication.

  Once it has been demonstrated that IBD virus is generated in vitro using genomic RNA, an improved live attenuated virus vaccine against infectious disease is developed. Using recombinant DNA technology together with a newly defined system of IBD virus to generate, specific deletions in the viral genome are made that facilitate the construction of attenuated viruses. Using this technique, the region of IBDV responsible for pathogenicity and an attenuated immunogenic IBDV vaccine are identified. The present invention provides a replacement of the virulent IBD strain or the VP2 variable region of the attenuated vaccine backbone with that of the virulent strain, thus protecting against the virulent strain while providing the safety and efficacy of the vaccine strain.

Example 36
Effect of rabbit anti-chicken interferon (cIFN) antibody on turkey herpesvirus growth Supernatants from SPV / cIPN (SPV041) infected ESK-4 cells were harvested 48 hours post infection and then Centricon 10 column (Amicon) Concentrated 5-10 times. 1 ml of concentrated supernatant was injected into rabbits three times at 3-week intervals, and then blood was collected. This rabbit antiserum was then used in culture to examine the effect of interferon on HVT growth. Anti-cIFN was shown to reverse the block against HVT (1: 200) and VSV (1:80) induced by the addition of cIFN in the plaque assay. Furthermore, the addition of anti-cIFN (1: 100) into the medium of CEF transiently transfected at the sub-plaque level of HVT viral DNA enhances the formation of HVT plaques (200 plaques / well) It was shown that. CEF transfected with HVT DNA in the absence of anti-cIFN produced no plaques.

  HVT was highly sensitive to interferon produced from CEF, and HVT proliferation was enhanced when cIFN was blocked.

  Applicants have (1) the use of antibodies against cIFN as an additive to increase HVT titers in vaccine stocks; (2) to facilitate the formation of new recombinant HVT viruses via cosmid reconstruction. Include the use of antibodies against cIFN as an additive.

Example 37
S-SPV-063
S-SPV-063 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for swine influenza virus (SIV) NP (H1N1) were inserted into the SPV 617-48.1 ORF (the only AccI restriction site is the only NotI restriction site) Replaced). The lacZ gene is under the control of the synthetic late promoter (LP1), and the SIV NP gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-063 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 807-41.3 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-063. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-063 was assayed for expression of SIV-specific antigens using “black plaque screening for foreign gene expression in recombinant SPV”. It was shown that porcine anti-SIV polyclonal sera or goat anti-NP polyclonal sera react specifically with S-SPV-063 plaques but not with S-SPV-001 negative control plaques. All S-SPV-063 observed plaques reacted with porcine anti-SIV serum or goat anti-NP serum, indicating that the virus was stably expressing SIV foreign genes. The assay described here was performed on ESK-4 cells, indicating that ESK-4 cells would be a suitable basis for the production of SPV recombinant vaccines.

  To confirm expression of the SIV NP gene product, cells were infected with SPV-063, and samples of infected cell lysates and culture supernatants were subjected to SDS-polyacrylamide gel electrophoresis. The gel was blotted and analyzed using “Western blotting”. SIV-specific protein expression was detected using porcine anti-SIV polyclonal serum or goat anti-NP polyclonal serum. Lysates and supernatants from S-SPV-063 infected cells exhibited a band corresponding to the expected size of SIV NP protein, 56 kd.

  S-SPV-063 is useful as a vaccine against SIV infection in pigs and is useful in the expression of SIV NP. S-SPV-063 is useful as a vaccine in combination with S-SPV-066 expressing NA and S-SPV-065 expressing SIV HA.

S-SPV-064
S-SPV-064 is a swinepox virus that expresses one foreign gene. The gene for E. coli β-glucuronidase (uidA) was inserted into a unique XhoI restriction site within the 6.9 kb SPV HindIII J genomic fragment. The uidA gene is under the control of the synthetic late / early promoter (LP2EP2). The HindIII J genomic fragment contains part of the A50R ORF (aa 227 to 552). There is no unique XhoI site in the A50R ORF. The XhoI site is 25 kb from the 3 'end of the swinepox virus genome.

  S-SPV-064 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 807-42.28 and virus S-SPV-001 in "Homologous Recombination Methods for Creating Recombinant SPV". Homology vector 807-42.28 is a NotI site in the 6.9 kb HindIII J fragment of the NotI fragment (see Materials and Methods) containing the LP2EP2 promoter uidA gene cassette from plasmid 551-47.23 (via the DNA linker). The only XhoI site was generated by insertion into (converted to NotI). Transfection stocks were screened by “screening screening for recombinant herpesviruses expressing enzymatic marker genes”. The final result of blue plaque purification was a recombinant virus designated S-SPV-064. The virus was assayed for β-glucuronidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, the observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-064 was purified and expressed a foreign gene, E. coli uidA, because the XhoI site in the 6.9 kb HindIII J fragment is a site that is not essential for viral growth and is a foreign gene. It shows that it is a stable insertion site. Recombinant swinepox virus using this insertion site is useful for expression of foreign genes, as a vaccine against disease, or as an expression vector for raising antibodies against the expressed foreign genes.

S-SPV-065
S-SPV-065 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for swine influenza virus (SIV) HA (H1N1) were inserted into the SPV 617-48.1 ORF (the only AccI restriction site is the only NotI restriction site) Replaced). The lacZ gene is under the control of the late synthetic promoter (LP1) and the SIV HA gene is under the control of the late synthetic / early promoter (LP2EP2).

  S-SPV-065 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 807-84.3 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods to Create Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-065. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-065 was assayed for expression of SIV-specific antigens using “black plaque screening for foreign gene expression in recombinant SPV”. It was shown that porcine anti-SIV polyclonal serum or goat anti-HA polyclonal serum reacts specifically with S-SPV-065 plaques but not with S-SPV-001 negative control plaques. All S-SPV-065 observed plaques reacted with porcine anti-SIV serum. SIV exogenous gene. The assay described here was performed on ESK-4 cells, indicating that ESK-4 cells would be a suitable basis for the production of SPV recombinant vaccines.

  To confirm expression of the SIV NP gene product, cells were infected with SPV-065, and samples of infected cell lysates and culture supernatants were subjected to SDS-polyacrylamide gel electrophoresis. The gel was blotted and analyzed using “Western blotting”. SIV-specific protein expression was detected using porcine anti-SIV polyclonal serum or goat anti-HA polyclonal serum. Cell lysates and supernatants from S-SPV-065 infected cells exhibited a band corresponding to the expected size of SIV HA protein, 64 kd.

  S-SPV-065 is useful as a vaccine against SIV infection in pigs and is useful in the expression of SIV NP. S-SPV-065 is useful as a vaccine in combination with S-SPV-066 expressing NA and S-SPV-063 expressing SIV NP.

S-SPV-066
S-SPV-066 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for swine influenza virus (SIV) NA (H1N1) were inserted into the SPV 617-48.1 ORF (the only AccI restriction site is the only NotI restriction site) Replaced). The lacZ gene is under the control of the late synthetic promoter (LP1) and the SIV NA gene is under the control of the late synthetic / early promoter (LP2EP2).

  S-SPV-066 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 807-84.35 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-066. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  To confirm expression of the SIV NA gene product, cells were infected with SPV-066 and samples of infected cell lysates and culture supernatants were subjected to SDS-polyacrylamide gel electrophoresis. The gel was blotted and analyzed using “Western blotting”. SIV-specific protein expression was detected using porcine anti-SIV polyclonal serum or goat anti-NA polyclonal serum. Cell lysates and supernatants from S-SPV-066 infected cells exhibited a band corresponding to the expected size of SIV HA protein, 64 kd.

  S-SPV-066 is useful as a vaccine against SIV infection in pigs and is useful in the expression of SIV NA. S-SPV-066 is useful as a vaccine in combination with S-SPV-065 expressing HA and S-SPV-063 expressing SIV NP.

S-SPV-071
S-SPV-071 is a swinepox virus that expresses at least four foreign genes. The genes for E. coli β-galactosidase (lacZ) and swine influenza virus (SIV) HA (H1N1) and NA (H1N1) were inserted into the SPV 617-48.1 ORF (the only AccI restriction site is Replaced with a unique NotI restriction site). The lacZ gene is under the control of the synthetic late promoter (LP1), and the SIV HA and NA genes are under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-071 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 817-86.35 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-071. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-071 was assayed for expression of SIV-specific antigens using “black plaque screening for foreign gene expression in recombinant SPV”. Goat anti-HA polyclonal serum was shown to react specifically with S-SPV-071 plaques but not with S-SPV-001 negative control plaques. All S-SPV-071 observed plaques reacted with goat anti-HA serum, indicating that the virus was stably expressing the SIV foreign gene. The assay described here was performed on ESK-4 cells, indicating that ESK-4 cells would be a suitable basis for the production of SPV recombinant vaccines.

  To confirm expression of SIV HA and NA gene products, cells were infected with SPV-071, and samples of infected cell lysates and culture supernatants were subjected to SDS-polyacrylamide gel electrophoresis. The gel was blotted and analyzed using “Western blotting”. SIV-specific protein expression was detected using porcine anti-SIV polyclonal serum or goat anti-HA polyclonal serum. Cell lysates and supernatants from S-SPV-071 infected cells exhibited bands corresponding to the expected sizes of SIV HA and NA proteins, 64 kd and 52 kd.

  S-SPV-071 is useful as a vaccine against SIV infection in pigs and is useful in the expression of SIV HA and NA. S-SPV-071 is useful as a vaccine in combination with S-SPV-063 expressing SIV NP.

S-SPV-074
S-SPV-074 is a swinepox virus that expresses at least four foreign genes. The gene for E. coli β-glucuronidase (uidA) and the genes for swine influenza virus (SIV) HA (H1N1) and NA (H1N1) were inserted into the SPV 617-48.1 ORF (the only AccI restriction site is Replaced with a unique NotI restriction site). The uidA gene is under the control of the synthetic late / early promoter (LP2EP2), and the SIV HA and NA genes are under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-074 was derived from S-SPV-001 (Kasza strain). This was accomplished using homology vector 817-14.2 (see Materials and Methods) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-074. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-074 was assayed for expression of SIV-specific antigens using “black plaque screening for foreign gene expression in recombinant SPV”. Porcine anti-SIV serum was shown to react specifically with S-SPV-074 plaques but not with S-SPV-001 negative control plaques. All S-SPV-074 observed plaques reacted with goat anti-HA serum indicating that the virus stably expressed the SIV foreign gene. The assay described here was performed on ESK-4 cells, indicating that ESK-4 cells would be a suitable basis for the production of SPV recombinant vaccines.

  S-SPV-074 is useful as a vaccine against SIV infection in pigs and is useful in the expression of SIV HA and NA. S-SPV-074 is useful as a vaccine in combination with S-SPV-063 expressing SIV NP.

S-SPV-069
S-SPV-069 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for the human respiratory syncytial virus (HRSV) fusion (F) protein were deleted from SPV 728-94.4 ORF (773 base pair deletion of SPV OLL ORF; nucleotides) 1669 to 2452, SEQ ID NO: 189). The lacZ gene is under the control of the swinepox POIL promoter, and the HRSV F gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-069 was derived from S-SPV-001 (Kasza strain). This is described in “Homologous Recombination Method for Creating Recombinant SPV”. A1 (see Materials and Methods) and virus S-SPV-001 were achieved. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-069. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-069 was assayed for expression of SIV-specific antigens using “black plaque screening for foreign gene expression in recombinant SPV”. Monoclonal antibody 621 against HRSV F (Biodesign, Inc.) was shown to react specifically with S-SPV-069 plaques but not with S-SPV-001 negative control plaques. All S-SPV-069 observed plaques reacted with monoclonal antibody 621, indicating that the virus stably expressed the PRV foreign gene. The assay described here was performed on ESK-4 cells, indicating that ESK-4 cells would be a suitable basis for the production of SPV recombinant vaccines.

S-SPV-078
S-SPV-078 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for human respiratory syncytial virus (HRSV) attachment (G) protein were inserted into the SPV 617-48.1 ORF (the only AccI restriction site is the only one) Replaced with NotI restriction site). The lacZ gene is under the control of the late synthetic / early promoter (LP2EP2) and the HRSV G gene is under the control of the late synthetic / early promoter (LP2EP2).

  S-SPV-078 was derived from S-SPV-001 (Kasza strain). This is based on the homology vector 822-52G. 7 (see Materials and Methods) and virus S-SPV-001. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was a recombinant virus designated S-SPV-078. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-069 and S-SPV-078 are useful individually or in combination as vaccines against human respiratory syncytial virus infection in pigs and are useful for the expression of HRSV F and G genes.

Homology vector 810-29. A2
Plasmid 810-29. A2 was constructed for the purpose of inserting foreign DNA into SPV. It incorporates an E. coli β-galactosidase (lacZ) marker gene and a human respiratory syncytial virus (HRSV) fusion (F) gene with SPV DNA adjacent to it. Upstream of the foreign gene is an approximately 855 base pair fragment of SPV DNA. Downstream of the foreign gene is an approximately 1113 base pair fragment of SPV DNA. When the plasmid is used according to the “homologous recombination method for creating a recombinant SPV”, a virus containing DNA encoding a foreign gene will be obtained. Note that the β-galactosidase (lacZ) marker gene is under the control of the swinepox virus 01L marker gene promoter and the HRSV F gene is under the control of the late / early promoter (LP2EP2). The homology vector was constructed utilizing standard recombinant DNA techniques (22, 30) by ligating restriction fragments from the following sources to a synthetic DNA sequence. The plasmid vector was derived from an approximately 2519 base pair HindIII to SphI restriction fragment of pSP65 (Promega). Fragment 1 uses the DNA primers 5'-GAAGCATGCCCGTTCTTATCAATAGTTTTAGTCGAAAATA-3 '(SEQ ID NO: 185) and 5'-CATAAGATCTGGCATTGGTGTATTATATACAAAAAAATA' (DNA sequence 5) to obtain an 855 base pair fragment with SphI and BglII ends. An approximately 855 base pair subfragment of SPV HindIII restriction fragment M (23) synthesized by the polymerase chain reaction. Fragment 2 is a 3002 base pair BamHI to PvuII fragment derived from plasmid pJF751 (49) containing the E. coli lacZ gene. Fragment 3 is an approximately 1728 base pair EcoRI restriction fragment synthesized by reverse transcriptase and polymerase chain reaction (PCR) (15, 42) using RNA from HRSV strain A2 (ATCC VR-1302). The primer (5′-GCCGAATTCGCTAATCTCCAAAGCAAAATGCAAT-3 ′; 4 / 95.23) (SEQ ID NO :) is synthesized from the 5 ′ end of the HRSV F gene and introduces an EcoRI site and an ATG start codon at the 5 ′ end of the gene. A primer (5′-GGTGAATTCTTTATTTAGTTTACTAAATGCAATTATTTT-3 ′; 4 / 95.24) (SEQ ID NO) was synthesized from the 3 ′ end of the F gene and used for reverse transcription and polymerase chain reaction. The PCR product was digested with EcoRI to obtain a fragment 1728 base pairs in length corresponding to the HRSV F gene. Fragment 4 uses primers 5'-CCGTTAGTCGACAAAGATCCGACTTATAATATGGTATGGATT-3 '(SEQ ID NO: 187) and 5'-GCCTGAAGCTTCTAGTACAGATTTTTACGAACTTTTTGAAAT-3' (SEQ ID NO: 1) to obtain a 1113 base pair fragment with SalI and HindIII ends An approximately 1113 base pair subfragment of SPV HindIII fragment M synthesized by chain reaction.

Homology vector 822-52G. 7).
Plasmid 822-52G. 7 was constructed for the purpose of inserting foreign DNA into SPV. It incorporates the E. coli β-galactosidase (lacZ) marker gene and the human respiratory syncytial virus (HRSV) adhesion (G) gene, with SPV DNA adjacent to it. Upstream of the foreign gene is an approximately 1484 base pair fragment of SPV DNA. Downstream of the foreign gene is an approximately 2149 base pair fragment of SPV DNA. When the plasmid is used according to the “homologous recombination method for creating a recombinant SPV”, a virus containing DNA encoding a foreign gene will be obtained. Note that the β-galactosidase (lacZ) marker gene is under the control of the late / early promoter (LP2EP2) and the HRSV G gene is under the control of the late / early promoter (LP2EP2). It was constructed utilizing standard recombinant DNA techniques (22 and 30) by ligating restriction fragments from the following sources: The plasmid vector was derived from an approximately 2972 base pair HindIII to BamHI restriction fragment of pSP65 (Promega). Fragment 1 is an approximately 1484 base pair AccI to BglII restriction subfragment of SPV HindIII fragment M (23). Fragment 2 is an approximately 3006 base pair BamHI to PvuII restriction fragment of plasmid pJF751 (11). Fragment 3 is an approximately 899 base pair EcoRI restriction fragment synthesized by reverse transcription and polymerase chain reaction (PCR) (15, 42) using RNA from HRSV strain A2 (ATCC VR-1302). The primer (5′-GCCCGAATTCCAAAACAAGGACCAACGCAC-3 ′; 4 / 95.25) (SEQ ID NO :) is synthesized from the 5 ′ end of the HRSV F gene and introduces an EcoRI site and an ATG stop codon at the 5 ′ end of the gene. A primer (5′-GCCGAATTCACTACTGGCGGTGGTGTGTGTG-3 ′; 4 / 95.26) (SEQ ID NO) was synthesized from the 3 ′ end of the HRSV G gene and used for reverse transcription and polymerase chain reaction. The PCR product was digested with EcoRI to obtain a fragment 899 base pairs in length corresponding to the HRSV G gene. Fragment 4 is an approximately 2149 base pair HindIII to AccI restriction site subfragment of SPV HindIII restriction fragment M (23).

Homology vector 807-41.3
Plasmid 807-41.3 was constructed for the purpose of inserting foreign DNA into SPV. It incorporates an E. coli β-galactosidase (lacZ) marker gene and a swine influenza virus (SIV) nucleoprotein (NP) gene with SPV DNA adjacent to it. When the plasmid is used according to the “homologous recombination method for creating a recombinant SPV”, a virus containing DNA encoding a foreign gene will be obtained. Note that the β-galactosidase (lacZ) marker gene is under the control of the synthetic late heel promoter (LP1) and the SIV NP gene is under the control of the synthetic late heel promoter (LP2EP2). The homology vector was constructed utilizing standard recombinant DNA techniques (22 and 30) by ligating restriction fragments from the following sources with the appropriate synthetic DNA sequences. The plasmid vector was derived from an approximately 2972 base pair HindIII to BamHI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1484 base pair BglII to AccI restriction subfragment of SPV HindIII fragment M (23). Fragment 2 is an approximately 1501 base pair EcoRI to EcoRI fragment of the SIV NP gene synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) (15, 42) using RNA from the SIV HIN1 strain (NVSL). . Primer (5′-CATGAATTCTCAAGGCACCAAACGATCCATATGAAC-3 ′; 6 / 95.13) (SEQ ID NO :) was synthesized from the 5 ′ end of the SIV NP gene, introduced an EcoRI site at the 5 ′ end of the gene, and reverse transcription and polymerase chain reaction Used for. The PCR product was brominated with EcoRI to obtain a fragment 1501 base pairs in length corresponding to the SIV NP gene. Fragment 3 is an approximately 3010 base pair BamHI to PuvII restriction fragment of plasmid pJF751 (11). Fragment 4 is an approximately 2149 base pair AccI to HindIII restriction subfragment of SPV HindIII restriction fragment N (23).

Homology vector 807-84.8
Plasmid 807-84.8 was used to insert foreign DNA into SPV. It incorporates an E. coli β-galactosidase (lacZ) marker gene and a swine influenza virus (SIV) hemagglutinin (HA) gene, with SPV DNA adjacent to it. When the plasmid is used according to the “homologous recombination method for creating a recombinant SPV”, a virus containing a DNA encoding a foreign gene is obtained. Note that the β-galactosidase (lacZ) marker gene is under the control of the late synthetic epilepsy promoter (LP1) and the SIV HA gene is under the control of the late synthetic / early promoter (LP2EP2). The homology vector was constructed utilizing standard recombinant DNA techniques (22 and 30) by ligating restriction fragments from the following sources with the appropriate synthetic DNA sequences. The plasmid vector was derived from an approximately 2972 base pair HindIII to BamHI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1484 base pair BglII to AccI restriction subfragment of SPV HindIII fragment M (23). Fragment 2 is an approximately 1721 base pair BamHI to BamHI fragment of the SIV HA gene synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) (15, 42) using RNA from the SIV HIN1 strain (NVSL). . The primer (5′-CCGAGGATCCGGCAATACTATTTAGTCCTGCTATGTACAT-3 ′; 6 / 95.5) (SEQ ID NO :) is synthesized from the 5 ′ end of the SIV HA gene and introduces a BamHI site at the 5 ′ end of the gene. A primer (5′-CTCTGGACCTAATTTAAATACATATTCTGCACTTGTS-3 ′; 6 / 95.6) (SEQ ID NO :) was synthesized from the 3 ′ end of the SIV HA gene and used for reverse transcription and polymerase chain reaction. The PCR product was digested with EcoRI to obtain a fragment 1721 bases in length corresponding to the SIV HA gene. Fragment 3 is an approximately 3010 base pair BamHI to PvuII restriction fragment of plasmid pJF751 (11). Fragment 4 is approximately 2149 base pairs AccI to Fragment M (23).

Homology vector 807-84.35
Plasmid 807-84.35 was used to insert foreign DNA into SPV. It incorporates an E. coli β-galactosidase (lacZ) marker gene and a swine influenza virus (SIV) neuraminidase (NA) gene with SPV DNA adjacent to it. When this plasmid is used according to the “technique for creating recombinant SPV”, a virus containing a DNA encoding a foreign gene is obtained. Note that the β-galactosidase (lacZ) marker gene is under the control of the synthetic late heel promoter (LP1) and the SIV NA gene is under the control of the synthetic late heel promoter (LP2EP2). The homology vector was constructed utilizing standard recombinant DNA techniques (22 and 30) by ligating restriction fragments from the following sources with the appropriate synthetic DNA sequences. The plasmid vector was derived from an approximately 2972 base pair HindIII to BamHI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1484 base pair BglII to AccI restriction subfragment of SPV HindIII fragment M (23). Fragment 2 is an approximately 1414 base pair EcoRI to BglII fragment of the SIV NA gene synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) (15, 42) using RNA from the SIV HIN1 strain (NVSL). . A primer (5′-AATGAATTCAAATCAAAAAATAATAACCACTTGGGTCAAT-3 ′; 6 / 95.12) (SEQ ID NO :) is synthesized from the 5 ′ end of the SIV NA gene and introduces an EcoRI site at the 5 ′ end of the gene. Primer (5′-GGAAGATCTACTTGTCAATTHTHAAATGGCAGATCAG-3 ′; 6 / 95.13) (SEQ ID NO :) was synthesized from the 3 ′ end of the SIV NA gene, introduced a BglII site at the 3 ′ end of the gene, reverse transcription and polymerase chain Used for reaction. The PCR product was digested with EcoRI to obtain a fragment 1414 bases in length corresponding to the SIV NA gene. Fragment 3 is an approximately 3010 base pair BamHI to PvuII restriction fragment of plasmid pJF751 (11). Fragment 4 is an approximately 2149 base pair AccI to HindIII restriction subfragment of SPV HindIII restriction fragment M (23).

Homology vector 807-86, 35
Plasmid 807-86.35 was used to insert foreign DNA into SPV. It incorporates an E. coli β-galactosidase (lacZ) marker gene and a swine influenza virus (SIV) hemagglutinin (HA) gene and a neuramiradase (NA) gene, adjacent to it by SPV DNA There is. When this plasmid is used according to the “homologous recombination method for creating a recombinant SPV”, a virus containing DNA encoding a foreign gene is obtained. Note that the β-galactosidase (lacZ) marker gene is under the control of the synthetic late epilepsy promoter (LP1), and the SIV NA and HA genes are each under the control of the synthetic late / early epilepsy promoter (LP2EP2). The homology vector was constructed utilizing standard recombinant DNA techniques (22 and 30) by ligating restriction fragments from the following sources with the appropriate synthetic DNA sequences. The plasmid vector was derived from an approximately 2972 base pair HindIII to BamHI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1484 base pair BglII to AccI restriction subfragment of SPV HindIII fragment M (23). Fragment 2 is an approximately 1721 base pair BamHI to BamHI fragment of the SIV HA gene synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) (15, 42) using RNA from the SIV HIN1 strain (NVSL). . The primer (5′-CCGAGGATCCGGCAATACTATTTAGTCCTGCTATGTACAT-3 ′; 6 / 95.5) (SEQ ID NO :) is synthesized from the 5 ′ end of the SIV HA gene and introduces a BamHI site at the 5 ′ end of the gene. Primer (5′-CTCTGGGATCCTAATTTTTAAAATACATATTCTGCACTACTA-3 ′; 6 / 95.6) (SEQ ID NO :) was synthesized from the 3 ′ end of the SIV HA gene, introduced a BamHI site at the 3 ′ end of the gene, reverse transcription and polymerase chain Used for reaction. The PCR product was digested with EcoRI to obtain a fragment 1721 bases in length corresponding to the SIV HA gene. Fragment 3 is an approximately 1414 base pair EcoRI to BglII fragment of the SIV NA gene synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) (15, 42) using RNA from the SIV H1N1 strain (NVSL). . The primer (5'-AATGAATTCAAATCAAAAAATAATAACCACTTGGGTCAAT-3 '; 6 / 95.12) (SEQ ID NO :) is synthesized from the 5' end of the SIV NA gene and introduces an EcoRI site at the 5 'end of the gene. Primer (5′-GGAAGATCTACTTGTCAATGGTGAATGGCAGATCAG-3 ′; 6 / 95.13) (SEQ ID NO :) was synthesized from the 3 ′ end of the SIV NA gene, introduced a BglII site at the 3 ′ end of the gene, reverse transcription and polymerase chain Used for reaction. The PCR product was digested with EcoRI to obtain a fragment 1414 base pairs in length corresponding to the SIV NA gene. Fragment 4 is an approximately 3010 base pair BamHI to PvuII restriction fragment of plasmid pJF751 (11). Fragment 5 is an approximately 2149 base pair AccI to HindIII restriction subfragment of SPV HindIII restriction fragment M (23).

Homology vector 817-14.2
Plasmid 817-14.2 was used to insert foreign DNA into SPV. It incorporates the E. coli β-glucuronidase (uidA) marker gene and the swine influenza virus (SIV) hemagglutinin (HA) and neuramiradase (NA) genes, which are adjacent to the SPV DNA. is there. When this plasmid is used according to the “homologous recombination method for creating a recombinant SPV”, a virus containing DNA encoding a foreign gene is obtained. Note that the β-glucuronidase (uidA) marker gene is under the control of the synthetic late / early heel promoter (LP2EP2), and the SIV NA and HA genes are each under the control of the synthetic late / early heel promoter (LP2EP2). I want. The homology vector was constructed utilizing standard recombinant DNA techniques (22 and 30) by ligating restriction fragments from the following sources to the appropriate synthetic DNA sequences. The plasmid vector was derived from an approximately 2972 base pair HindIII to BamHI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1484 base pair BglII to AccI restriction subfragment of SPV HindIII fragment M (23). Fragment 2 is an approximately 1721 base pair BamHI to BamHI fragment of the SIV HA gene synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) (15, 42) using RNA from the SIV HIN1 strain (NVSL). . The primer (5′-CCGAGGATCCGGCAATACTATTTAGTCCTGCTATGTACAT-3 ′; 6 / 95.5) (SEQ ID NO :) is synthesized from the 5 ′ end of the SIV HA gene and introduces a BamHI site at the 5 ′ end of the gene. Primer (5′-CTCTGGGATCCTAATTTTTAAAATACATATTCTGCACTACTA-3 ′; 6 / 95.6) (SEQ ID NO :) was synthesized from the 3 ′ end of the SIV HA gene, introduced a BamHI site at the 3 ′ end of the gene, reverse transcription and polymerase chain Used for reaction. The PCR product was digested with EcoRI to obtain a fragment 1721 bases in length corresponding to the SIV HA gene. Fragment 3 is an approximately 1414 base pair EcoRI to BglII fragment of the SIV NA gene synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) (15, 42) using RNA from the SIV H1N1 strain (NVSL). . The primer (5′-AATGAATTCAAATCAAAAAATAATAATACATGGGTCAAT-3 ′; 6 / 95.12) (SEQ ID NO :) is synthesized from the 5 ′ end of the SIV NA gene and introduces an EcoRI site at the 5 ′ end of the gene. Primer (5′-GGAAGATCTACTTGTCAATGGTGAATGGCAGATCAG-3 ′; 6 / 95.13) (SEQ ID NO :) was synthesized from the 3 ′ end of the SIV NA gene, introduced a BglII site at the 3 ′ end of the gene, reverse transcription and polymerase chain Used for reaction. The PCR product was digested with EcoRI to obtain a fragment 1414 base pairs in length corresponding to the SIV NA gene. Fragment 4 is an approximately 1823 base pair NcoI restriction fragment of plasmid pRAJ260 (Clonetech). Fragment 5 is an approximately 2149 base pair AccI to HindIII restriction subfragment of SPV HindIII restriction fragment M (23).

PRRS homology vectors containing single or multiple PRRS genes (ORF2, ORF3, ORF4, ORF5, ORF6, or ORF7) PRRS homology vectors were used to insert foreign DNA into SPV. Incorporates the E. coli β-galactosidase (lacZ) marker gene and the porcine reproductive and respiratory syndrome virus (PRRS) ORF2, ORF3, ORF4, ORF5, ORF6, or ORF7 gene adjacent to and adjacent to SPV DNA Upstream of the foreign gene is an approximately 855 base pair fragment of SPV DNA, downstream of the foreign gene is an approximately 1113 base pair fragment of SPV DNA. If this plasmid is used according to the A virus is obtained containing the DNA encoding the pups, the β-galactosidase (lacZ) marker gene is under the control of the swinepox virus OLL gene promoter and the PRRS gene is under the control of the late / early promoter (LP2EP2) Note that the homology vector was constructed utilizing standard recombinant DNA techniques (22 and 30) by ligating restriction fragments from the following sources to the appropriate synthetic DNA sequences. The vector was derived from an approximately 2519 base pair HindIII to SphI restriction fragment of pSP64 (Promega) Fragment 1 was the DNA primer 5'-GAAGCATGCCCGTTCTTATTCAATAGTTTTAGTCGAA to generate an 855 base pair fragment with SphI and BglII ends. It is an approximately 855 base pair sub-fragment of SPV HindIII restriction fragment M (23) synthesized by a polymerase chain reaction using ATA-3 '(SEQ ID NO: 185) and 5'-CATAAGATCTGGCATTGTGTTATTATATACAAAAAATAAG-3' (SEQ ID NO: 186) Fragment 2 is a 3002 base pair BamHI to PvuII fragment derived from plasmid pJF751 (49) containing the E. coli lacZ gene Fragment 3 is a PRRS US strain obtained from NVSL (reference strain). EcoRI to BamHI restriction fragments synthesized by reverse transcription and polymerase chain reaction (PCR) using genomic RNA from the isolate, each homologous vector containing one or more PRRS virus ORFs 2-7. In order to synthesize PRRS ORF2, a primer (5′-AAT GAATTC GAAATGGGGTCCCATGCAAAGCCCTTTTTG-3 ′; 1 / 96.15) (SEQ ID NO :) was synthesized from the 5 ′ end of the PRRS ORF2 gene, and EcoRI at the 5 ′ end of the gene. Introduce the site. A primer (5'-CAA GGATCC CACACCGTGTTAATTCACTGTGAGTTCG-3 '; 1 / 96.16) (SEQ ID NO) is used for reverse transcription and PCR and is synthesized from the 3' end of the PRRS ORF2 gene. The PCR product was digested with EcoRI and BamHI to obtain a fragment 771 base pairs in length corresponding to the PRRS ORF2 gene. In order to synthesize ORF3, a primer (TTCGAATTCGCGCTATAATATGCTTACCATTCCTCCCATATTTT-3 ′; 1 / 96.7) (SEQ ID NO :) is synthesized from the 5 ′ end of the PRRS ORF3 gene and an EcoRI site is introduced at the 5 ′ end of the gene. A primer (5′-GG GGATCC TATCGCCGTACGCGCACTGAGGG-3 ′; 1 / 96.8) (SEQ ID NO :) is used for reverse transcription and PCR and is synthesized from the 3 ′ end of the PRRS ORF3 gene. In order to synthesize PRRS ORF4, a primer (5′-CC GAATTC GGCTGCGTCCCTCTTTTTCCTCATGG-3 ′; 1 / 96.11) (SEQ ID NO :) was synthesized from the 5 ′ end of the PRRS ORF4 gene and an EcoRI site at the 5 ′ end. Introduce. Primers (5′-CT GGATCC TTCAAATTGCCAACAGAATGGCAAAAAGAC-3 ′; 1 / 96.12) (SEQ ID NO :) are used for reverse transcription and PCR and synthesized from the 3 ′ end of the PRRS ORF4 gene. The PCR product is digested with EcoRI and NamHI to obtain a fragment 537 base pairs in length corresponding to the PRRS ORF4 gene. In order to synthesize PRRS ORF5, a primer (5′-TT GAATTC GTTGGAGAAATGCTTGAACCGCGGGC-3 ′; 1 / 96.13) (SEQ ID NO :) was synthesized from the 5 ′ end of the PRRS ORF5 gene, and EcoRI at the 5 ′ end of the gene. Introduce the site. A primer (5'-GAA GGATCC TAAGGACGACCCCATTGTTCCCGCTG-3 '; 1 / 96.14) (SEQ ID NO :) is used for reverse transcription and PCR and is synthesized from the 3' end of the PRRS ORF5 gene. The PCR product is digested with EcoRI and BamHI to obtain a fragment 603 base pairs in length corresponding to the PRRS ORF5 gene. In order to synthesize PRRS ORF6, a primer (5′-CGG GAATTC GGGGTCGTCCTTAGATGAACTTCTGCC-3 ′; 1 / 96.17) (SEQ ID NO :) synthesized the PRRS ORF6 gene from the 5 ′ end, and EcoRI at the 5 ′ end of the gene. Introduce the site. The primer (5′-GC GGATCC TTGTTATGTGGCATATTTTGACAAGGTTTTAC-3 ′; 1 / 96.18) (SEQ ID NO :) is used for reverse transcription and PCR and is synthesized from the 3 ′ end of the PRRS ORF6 gene. The PCR product is digested with EcoRI and BamHI to obtain a length of 525 base pairs corresponding to PRRS ORF6. To synthesize PRRS ORF7, a primer (5′-GTC GAATTC GCCAAAATAACAACGCGCAAGCAGCAGAAG-3 ′: 1 / 96.19) (SEQ ID NO :) was synthesized from the 5 ′ end of PRRS ORF7 and an EcoRI site at the 5 ′ end of the gene. Is introduced. A primer (5′-CAA GGATCC CAGCCCCATCATGCTGAGGGGTGATG-3 ′; 1 / 96.20) (SEQ ID NO :) is synthesized for reverse transcription and PCR and synthesized from the 3 ′ end of the PRRS ORF7 gene. Fragment 4 comprises the DNA primers 5'-CCGTTAGTCGACAAGATGCGACTTATAATATGTGATGGGATT-3 '(SEQ ID NO: 187) and 5'-GCCTGAAGCTTCTAGTACAGTTTTTACGAACTTTTTGAAT-3') to generate 1113 base pairs with SalI and HindIII ends. It is an approximately 1113 base pair subfragment of SPV HindIII fragment M synthesized by the polymerase chain reaction used.

Recombinant swinepox virus S-SPV-086 that expresses a pseudorabies gene is a swinepox virus that expresses at least three foreign genes. The genes for E. coli β-galactosidase (lacZ) and pseudorabies virus (PRV) gD and gI were inserted into the SPV 617-68.1 ORF (the unique AccI restriction site was replaced with a unique NotI restriction site). ). The lacZ gene is under the control of the synthetic late promoter (LP1), and the PRV gD and gI genes are under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-077 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for pseudorabies virus (PRV) gI were inserted into the SPV 617 48.1 ORF (the unique AccI restriction site was replaced with a unique NotI restriction site). The lacZ gene is under the control of the late synthetic promoter (LP1) and the PRV gI gene is under the control of the late synthetic / early promoter (LP2EP2).

  S-SPV-079 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for pseudorabies virus (PRV) gB were inserted into the SPV 617 48.1 ORF (the unique AccI restriction site was replaced with a unique NotI restriction site). The lacZ gene is under the control of the synthetic late promoter (LP1) and the PRV gB gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-076, S-SPV-077, and S-SPV-079 were derived from S-SPV-001 (Kasza strain). This was accomplished using the homology vector and virus S-SPV-001 in “Homologous Recombination Methods to Create Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was recombinant viruses designated S-SPV-076, S-SPV-077, and S-SPV-079. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-076, S-SPV-077, and S-SPV-079 were tested for PRV glycoprotein expression by "black plaque assay" and "Western blot".

  S-SPV-076, S-SPV-077, and S-SPV-079 are useful as vaccines against PRV infection in pigs and are useful for the expression of PRV gD, gI or gB. S-SPV-071 is useful as a vaccine in combination with a recombinant swinepox virus expressing PRV gC such as S-SPV-011, S-SPV-012, or S-SPV-013.

143B Osteosarcoma *
A431 Epidermoid cancer *
A549 Lung cancer *
Capan-1 liver cancer *
CF500 Foreskin fibroblasts Chang liver Liver Detroit Down foreskin fibroblasts HEL-198 Embryonic lung HeLa Cervical cancer *
Hep-2 epidermal pharyngeal cancer *
HISM Intestinal smooth muscle HNK Neonatal kidney MRC-5 Embryonic lung NCI-H292 Lung myxoid epidermoid cancer +
OVCAR-3 ovarian cancer *
RD Rhabdomyosarcoma +
THP monocytes (leukemia) *
WIL2-NS B lymphocyte system, non-secretory WISH amniotic membrane PBL peripheral blood lymphocytes
Example 38
Recombinant swinepox virus expressing PRRS genes ORF2, ORF3, ORF4, ORF5, and ORF6 S-SPV-080 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for porcine reproductive and respiratory syndrome virus (PRRS) ORF2 were inserted into the SPV 738-94.4 ORF (773 base pair deletion of SPV OLL ORF) A deletion of 1669 to 2452, SEQ ID NO: 189). The lacZ gene is under the control of the swinepox POIL promoter and the PRV ORF2 gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-081 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for porcine reproductive and respiratory syndrome virus (PRRS) ORF3 were inserted into the SPV 738-94.4 ORF (773 base pair deletion of SPV OLL ORF) A deletion of 1669 to 2452, SEQ ID NO: 189). The lacZ gene is under the control of the swinepox POIL promoter, and the PRV ORF3 gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-082 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for porcine reproductive and respiratory syndrome virus (PRRS) ORF4 were inserted into the SPV 738-94.4 ORF (773 base pair deletion of SPV OLL ORF) A deletion of 1669 to 2452, SEQ ID NO: 189). The lacZ gene is under the control of the swinepox POIL promoter, and the PRV ORF4 gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-083 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for porcine reproductive and respiratory syndrome virus (PRRS) ORF5 were inserted into the SPV 738-94.4 ORF (773 base pair deletion of SPV OLL ORF) A deletion of 1669 to 2452, SEQ ID NO: 189). The lacZ gene is under the control of the swinepox POIL promoter, and the PRV ORF5 gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-084 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for porcine reproductive and respiratory syndrome virus (PRRS) ORF6 were inserted into the SPV 738-94.4 ORF (773 base pair deletion of SPV OLL ORF) A deletion of 1669 to 2452, SEQ ID NO: 189). The lacZ gene is under the control of the swinepox POIL promoter, and the PRV ORF6 gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-085 is a swinepox virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for porcine reproductive and respiratory syndrome virus (PRRS) ORF7 were inserted into the SPV 738-94.4 ORF (773 base pair deletion of SPV OLL ORF) A deletion of 1669 to 2452, SEQ ID NO: 189). The lacZ gene is under the control of the swinepox POIL promoter, and the PRV ORF7 gene is under the control of the synthetic late / early promoter (LP2EP2).

  S-SPV-080, S-SPV-081, S-SPV-083, S-SPV-084 and S-SPV-085 were derived from S-SPV-001 (Kasza strain). This was accomplished using the homology vector material and method (PRRS homology vector) and virus S-SPV-001 in “Homologous Recombination Methods for Creating Recombinant SPV”. Transfection stocks were screened by “screening for recombinant SPV expressing β-galactosidase” (BLUOGAL and CPRG assays). The final result of red plaque purification was the recombinant viruses designated S-SPV-080, S-SPV-081, S-SPV-083, S-SPV-084 and S-SPV-085. The virus was assayed for β-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay described in Materials and Methods. After the first three rounds of purification, all observed plaques are blue, indicating that the virus is pure, stable and expresses foreign genes.

  S-SPV-080, S-SPV-081, S-SPV-083, S-SPV-084 and S-SPV-085 are useful individually or in combination as vaccines against PRRS infections in pigs, and include PRRS ORF2, Useful for expression of ORF3, ORF4, ORF5, ORF6 and ORF7.

Example 39
The following experiments were performed to determine the ability of swinepox virus to infect human cells in culture and to express foreign DNA such as lacZ.

  S-SPV-003 was adsorbed at MOI = 0.1 for 2 to 3 hours on human cell lines listed in the title below. Cells were rinsed 3 times with PBS, growth medium was added and cells were incubated at 37 ° C. for 4 days. Cells were harvested and lysates were prepared in 200 microliters PBS by 3 freeze / thaw cycles. Cell contaminants were pelleted and 10 microliters of supernatant was assayed for 1/2 hour for galactosidase activity by ONPG assay at 37 ° C. The table shows the results of the relative levels of infection and cytotoxic effects of various human cell lines with S-SPV-003 and the expression of lacZ.

  The results show that various cell lines take S-SPV-003 and the ability to express lacZ changes. CPE was minimal in all cases and did not result in virus replication. One exception is A549 cells, which in one example does not show several rounds of cell cycle and detachment from the plate, another example is a 10-fold increase in titer during passage, This suggested limited viral replication. Some cell lines show significant lacZ activity with no cytotoxic effect.

  Different spider promoters express lacZ from recombinant swinepox virus in a number of human cell lines. Six different swinepox viruses were constructed that expressed lacZ from the EP1, LP1, LP2, EP1LP2, LP2EP2, or SPV POILL promoter. Each virus was used to infect A549, Chang liver, or 143B cells at 0.1 moi, cells were rinsed after 2 and 3 hours, and then incubated at 37 ° C. for 4 days. Each cell line maintained a different hierarchy of promoter activity, which was reproducible in the following experiments. For example, the EP1, LP2EP2, and POIL promoters gave the greatest expression in 143B cells, while LP2 was the most potent in Chang liver cells and EP1LP2 was the most potent in A549. In Chang liver and A549 cells, expression from the POIL promoter was poorest, whereas in 143B, expression from LP2 was poor. Thus, different human cell lines utilize the sputum promoter in different ways. This may reflect how far the swinepox virus can progress along the replication pathway in different cell lines.

  These early and late promoters exhibited lower or higher lacZ activity depending on the human cell type infected by the recombinant swinepox virus. By selecting different promoters for different target tissues, the amount of foreign gene product delivered from swinepox virus to the target tissue can be regulated.

  Recombinant swinepox virus is useful as a vaccine against human infectious diseases and for delivering therapeutic agents to humans. Recombinant swinepox virus is a therapeutic agent for cancer or genetic diseases as a vaccine against viral or bacterial infections in humans and to deliver immune modulatory molecules such as antibiotics, tumor antigens, cell surface ligands and receptors, cytokines Useful as.

Example 40
S-SPV-003 expression of lacZ in human cell lines
Cytotoxic effect and measurement of lacZ expression Cell type Cytotoxic effect * lacZ expression **
A431 − −
Epidermoid cancer *
A549 ++ ++++
lung cancer*
Capan-1 − −
lung cancer*
CF500 + +
Foreskin fibroblasts Chang liver + +++
Detroit +/--
Gown foreskin fibroblasts HEL-199 +/- +++
Embryonic lung HEp-2- −
Epidermal pharyngeal cancer *
HISN + +
Intestinal smooth muscle HNK-++
Neonatal kidney MRC-5 +/- +
Embryonic lung NCI-H292-+++
Lung myxoid epidermoid cancer *
OVCAR-3-+++
Ovarian cancer *
RD − +
Rhabdomyosarcoma +
THP-+
Monocytes (leukemia) *
WIL2-NS-----
B lymphocyte system, non-secretory WISH +/-
Amnion HeLa − ++++
PBL − −
Peripheral blood lymphocytes * When human cells are infected with SPV, cytotoxic effects are sometimes observed. In most cell lines, this cytotoxic effect is indicated by a change in the appearance of the cell, the cell becomes thinner and more uneven along the edge; the cell appears to be tense. This phenomenon is evaluated as follows.

      -Indicates no difference between infected and uninfected cells.

      +/- indicates that the monolayer is visually different from that of the non-infected, although most cells appear normal.

      + Indicates that the monolayer is clearly affected and most cells appear to be tense. It should be noted that there was no evidence of SPV replication in certain cells (HeLa, CF500, 143B) in which titers were obtained after serial passage, with one exception.

      A549 gave ++ for cytotoxic effects in one example when cells were rounded and detached from the plate during infection, but this observation was not repeated. A549 also shows evidence of a 10-fold increased titer during passage in another example, indicating that it can support limited viral replication.

** β-galactosidase activity expressed in A260 units per cell lysate from 1/20 of a 35 mm dish-no activity + 0.2-0.9 A260 units ++ 0.9-1.6 A260 units ++ 1.6 A260 units Greater

References

Detailed view of SPV genomic DNA (kasza strain) containing the characteristic long terminal repeat (TR) region Detailed view of SPV genomic DNA (kasza strain) containing the characteristic long terminal repeat (TR) region DNA sequence originating from homology vector 515-85.1 DNA sequence originating from homology vector 515-85.1 515-85.1 Homology between ORF and vaccinia virus 01LORF 515-85.1 Homology between ORF and vaccinia virus 01LORF 515-85.1 Homology between ORF and vaccinia virus 01LORF DNA insert in homology vector 520-17.5 DNA insert in homology vector 520-17.5 DNA insert in homology vector 520-17.5 DNA insert at 538-46.16 in homology vector DNA insert at 538-46.16 in homology vector DNA insert at 538-46.16 in homology vector DNA insert at 538-46.16 in homology vector Western Blot of Melt of Cells Infected with Recombinant SPV with Antisera Against PRV DNA sequence of NDV hemagglutinin neuramidase gene (HN) DNA insert in homology vector 538-46.26 DNA insert in homology vector 538-46.26 DNA insert in homology vector 538-46.26 DNA insert in homology vector 538-46.26 DNA inserts in swinepox virus S-SPV-010 and homology vector 561-36.26 DNA inserts in swinepox virus S-SPV-010 and homology vector 561-36.26 DNA inserts in swinepox virus S-SPV-010 and homology vector 561-36.26 DNA inserts in swinepox virus S-SPV-011 and homology vector 570-91.21 DNA inserts in swinepox virus S-SPV-011 and homology vector 570-91.21 DNA inserts in swinepox virus S-SPV-011 and homology vector 570-91.21 DNA inserts in swinepox virus S-SPV-011 and homology vector 570-91.21 DNA inserts in swinepox virus S-SPV-012 and homology vector 570-91.41 DNA inserts in swinepox virus S-SPV-012 and homology vector 570-91.41 DNA inserts in swinepox virus S-SPV-012 and homology vector 570-91.41 DNA inserts in swinepox virus S-SPV-012 and homology vector 570-91.41 DNA inserts in swinepox virus S-SPV-013 and vector 570-91.64 DNA inserts in swinepox virus S-SPV-013 and vector 570-91.64 DNA inserts in swinepox virus S-SPV-013 and vector 570-91.64 DNA inserts in swinepox virus S-SPV-013 and vector 570-91.64 DNA inserts in swinepox virus S-SPV-014 and the same vector 599-65.25 DNA inserts in swinepox virus S-SPV-014 and the same vector 599-65.25 DNA inserts in swinepox virus S-SPV-014 and the same vector 599-65.25 DNA inserts in swinepox virus S-SPV-014 and the same vector 599-65.25 DNA inserts in swinepox virus S-SPV-016 and vector 624-20.1C DNA inserts in swinepox virus S-SPV-016 and vector 624-20.1C DNA inserts in swinepox virus S-SPV-016 and vector 624-20.1C DNA inserts in swinepox virus S-SPV-016 and vector 624-20.1C DNA inserts in swinepox virus S-SPV-017 and homology vector 614-83.18 DNA inserts in swinepox virus S-SPV-017 and homology vector 614-83.18 DNA inserts in swinepox virus S-SPV-017 and homology vector 614-83.18 DNA inserts in swinepox virus S-SPV-017 and homology vector 614-83.18 Western blot with polyclonal goat anti-PRVgIII (gC) of a melt of cells infected with recombinant SPV Map showing 5.6 kilobase pairs Hind III M swinepox virus genomic DNA fragment DNA inserts in swinepox virus S-SPV-034 and homology vector 723-59A9.22 DNA inserts in swinepox virus S-SPV-034 and homology vector 723-59A9.22 DNA inserts in swinepox virus S-SPV-034 and homology vector 723-59A9.22 DNA inserts in swinepox virus S-SPV-034 and homology vector 723-59A9.22 DNA inserts in swinepox virus S-SPV-015 and homology vector 727-54.60 DNA inserts in swinepox virus S-SPV-015 and homology vector 727-54.60 DNA inserts in swinepox virus S-SPV-015 and homology vector 727-54.60 DNA inserts in swinepox virus S-SPV-015 and homology vector 727-54.60 DNA inserts in swinepox virus S-SPV-031 and homology vector 727-67.18 DNA inserts in swinepox virus S-SPV-031 and homology vector 727-67.18 DNA inserts in swinepox virus S-SPV-031 and homology vector 727-67.18 DNA inserts in swinepox virus S-SPV-031 and homology vector 727-67.18 DNA inserts in swinepox virus S-SPV-033 and homology vector 732-18.4 DNA inserts in swinepox virus S-SPV-033 and homology vector 732-18.4 DNA inserts in swinepox virus S-SPV-033 and homology vector 732-18.4 DNA inserts in swinepox virus S-SPV-033 and homology vector 732-18.4 DNA inserts in swinepox virus S-SPV-036 and homology vector 741-80.3 DNA inserts in swinepox virus S-SPV-036 and homology vector 741-80.3 DNA inserts in swinepox virus S-SPV-036 and homology vector 741-80.3 DNA inserts in swinepox virus S-SPV-035 and homology vector 741-84.14 DNA inserts in swinepox virus S-SPV-035 and homology vector 741-84.14 DNA inserts in swinepox virus S-SPV-035 and homology vector 741-84.14 DNA inserts in swinepox virus S-SPV-035 and homology vector 741-84.14 DNA insert in swinepox virus S-SPV-038 and homology vector 744-34. DNA insert in swinepox virus S-SPV-038 and homology vector 744-34. DNA insert in swinepox virus S-SPV-038 and homology vector 744-34. DNA insert in swinepox virus S-SPV-038 and homology vector 744-34. DNA inserts in swinepox virus S-SPV-039 and homology vector 744-38 DNA inserts in swinepox virus S-SPV-039 and homology vector 744-38 DNA inserts in swinepox virus S-SPV-039 and homology vector 744-38 DNA inserts in swinepox virus S-SPV-039 and homology vector 744-38 DNA inserts in swinepox virus S-SPV-042 and homology vector 751-07A1 DNA inserts in swinepox virus S-SPV-042 and homology vector 751-07A1 DNA inserts in swinepox virus S-SPV-042 and homology vector 751-07A1 DNA inserts in swinepox virus S-SPV-042 and homology vector 751-07A1 DNA insert in swinepox virus S-SPV-043 and homology vector 751-56A1 DNA insert in swinepox virus S-SPV-043 and homology vector 751-56A1 DNA insert in swinepox virus S-SPV-043 and homology vector 751-56A1 DNA insert in swinepox virus S-SPV-043 and homology vector 751-56A1 DNA insert in swinepox virus S-SPV-043 and homology vector 752-22.1 DNA insert in swinepox virus S-SPV-043 and homology vector 752-22.1 DNA insert in swinepox virus S-SPV-043 and homology vector 752-22.1 DNA insert in swinepox virus S-SPV-043 and homology vector 752-22.1 Restriction endonuclease map and open reading frame in SPV HindIII N fragment and part of SPV HindIIIM fragment Restriction endonuclease map and open reading frame in SPV HindIII N fragment and part of SPV HindIIIM fragment DNA inserts in swinepox virus S-SPV-047 and homology vector 779-94.31 DNA inserts in swinepox virus S-SPV-047 and homology vector 779-94.31 DNA inserts in swinepox virus S-SPV-047 and homology vector 779-94.31 DNA inserts in swinepox virus S-SPV-052 and homology vector 789-41.7 DNA inserts in swinepox virus S-SPV-052 and homology vector 789-41.7 DNA inserts in swinepox virus S-SPV-052 and homology vector 789-41.7 DNA inserts in swinepox virus S-SPV-052 and homology vector 789-41.7 DNA inserts in swinepox virus S-SPV-053 and homology vector 789-41.27 DNA inserts in swinepox virus S-SPV-053 and homology vector 789-41.27 DNA inserts in swinepox virus S-SPV-053 and homology vector 789-41.27 DNA inserts in swinepox virus S-SPV-053 and homology vector 789-41.27 DNA inserts in swinepox virus S-SPV-054 and homology vector 789-41.47 DNA inserts in swinepox virus S-SPV-054 and homology vector 789-41.47 DNA inserts in swinepox virus S-SPV-054 and homology vector 789-41.47 DNA inserts in swinepox virus S-SPV-054 and homology vector 789-41.47 DNA inserts in swinepox virus S-SPV-055 and homology vector 789-41.73 DNA inserts in swinepox virus S-SPV-055 and homology vector 789-41.73 DNA inserts in swinepox virus S-SPV-055 and homology vector 789-41.73 DNA inserts in swinepox virus S-SPV-055 and homology vector 789-41.73 DNA inserts in swinepox virus S-SPV-055 and homology vector 789-41.73

Claims (1)

A recombinant swinepox virus containing a foreign DNA sequence inserted into swinepox virus genomic DNA, wherein the foreign DNA sequence is inserted into the EcoRI site in the B18R ORF in the HindIIIK fragment of swinepox virus genomic DNA A recombinant swinepox virus that can be expressed in host cells infected with swinepox virus.

Images