MXPA99000844A - Recombinant swinepox virus - Google Patents

Abstract

This invention provides a recombinant swinepox virus comprising a foreign DNA inserted into a swinepox virus genome, wherein the foreign DNA is inserted into a) an AccI site within a region corresponding to a 3.2 Kb HindIII to BglII subfragment of the HindII M fragment and b) an EcoRI site within a region corresponding to a 3.2 Kb subfragment of the HindIII K fragment which contains both a HindIII and EcoRI site, of the swinepox virus genome and is capable of being expressed in a host cell into which the virus is introduced. The invention further provides vaccines and methods of immunization of the recombinant swinepox virus.

Description

VIRUSES OF ERUPTIVE OR PULMONARY DISEASE OF RECOMBINANT PIG Within this application several publications have been mentioned by means of Arabic numerals in parentheses. Full citations for these publications can be found at the end of the description immediately before the claims. The descriptions of these publications are incorporated herein by reference in this application.

BACKGROUND OF THE INVENTION The virus of eruptive or pig pustular disease (SPV) belongs to the family of Poxviridae. The viruses that belong to this group are virus. BNA of large double strain that characteristically develop in the cytoplasm of the host cell. The SPV is the only member of the genus Suipoxvirus. Several characteristics distinguish the SPV from other eruptive or pustular viruses. The SPV exhibits species specification (18) in comparison to other pustular viruses such as vaccinia which exhibits a broad host range. The SPV infection of tissue culture cell lines also differs dramatically from other pustular viruses (24). it has also been shown that SPV does not exhibit an antigenic cross-reaction with the vaccinia virus and does not show a large detectable homology at the DNA level with the ortho, lepori, avi or entomopox virus groups (24). Therefore, what is known and described in the prior art in relation to pustular viruses does not belong a priori to the pig pustular disease virus.

The SPV is only mildly pathogenic, characterized by a self-limiting infection with lesions detected only in the regional lymphatic and skin nodes. Even when the SPV infection is very limited, pigs that have recovered from SPV are refractory to the challenge with SPV, indicating the development of an active immunity (18).

The present invention relates to the use of SPV as a vector for delivery of vaccine antigens and therapeutic agents for "pigs." The following properties of SPV support this reasoning: SPV is only mildly pathogenic in pigs, SPV is a specific species, and SPV promotes a protective immune response, therefore, the SPV is an excellent candidate for a viral vector delivery system, having little intrinsic risk which must be balanced against the benefit contributed by the vector vaccine and the therapeutic properties.

The prior art for this invention comes first from the ability to clone and analyze DNA while it is in bacterial plasmids. The techniques that are available are detailed in most of the work by Maniatis and others, from 1983 and in Sambrook and others from 1989. These publications teach the state of the art in general of recombinant DNA techniques.

Among the viruses of pustular disease, five have been identified (vaccinia, bird pustular disease, pustular disease of canaries, chicks and raccoon), prior to this description to contain foreign DNA sequences. Vaccinia virus has been extensively used for foreign vector genes (25) and is the subject of US Pat. Nos. 4,603,112 and 4,722,848. Similarly, bird pustular disease has been used for foreign vector genes and is the subject of several patent applications EPA 0 284 416, PCT WO 89 / 034.2.9, and PCT WO 89/12684. The raccoon pustular disease. (10) and canary pustular disease (31) have been used to express rabies virus antigens. These examples of inserts of foreign genes within pustular disease viruses do not include an example of Suipoxvirus. Therefore, methods for genetically engineering pig pustular disease virus are not taught, that is where inserts are made and how to obtain expression in the pig pustular disease virus.

The idea of using live virus as delivery systems for antigens has a long history of going to the first live virus vaccines. The delivered antigens were not foreign but were naturally expressed by the live virus in the vaccine. The use of viruses to deliver foreign antigens in the modern sense becomes obvious with recombinant vaccinia virus studies. The vaccinia virus was the vector and several antigens of other viruses that cause diseases were the foreign antigens, and the vaccine was created through genetic engineering. While the concept became obvious with these descriptions, what was not obvious was the answer to a more practical question of how to make the best "candidate" virus vector In the answer to this question, the details of the virus's pathogenicity, its site of duplication, the kind of immune response it proposes, the potential it has to express foreign antigens, its suitability for genetic engineering, its probabilities of being licensed by regulatory agencies, etc., are all factors in the selection. teach these issues of usefulness.

The prior art in relation to the use of pustular disease viruses to deliver therapeutic agents refers to the use of a vaccinia virus to deliver interleukin-2 (12). In this case, even when interleukin-2 has an attenuating effect on the vaccinia vector, the host showed no therapeutic benefit.

The therapeutic agent that was delivered by the viral vector of the present invention must be a biological molecule that is a byproduct of the replication of the pig pustular disease virus. This limits the therapeutic agent in the first analysis to either DNA, RNA or protein. These are examples of the therapeutic agents of each of these classes of compounds in the form of antisense DNA, antisense RNA, (16), ribozymes (34), suppressors of tRNAs (2), double interferon-inducing strain RNA and examples numerous of therapeutic proteins from hormones, for example insulin to lymphokines, for example interferons and interleukins, for opioid. The discovery of these therapeutic agents and the elucidation of their structure and function does not make obvious the ability to use them in the viral vector delivery system.

SYNTHESIS OF THE INVENTION This invention provides a "recombinant pig pustular disease virus" comprising a DNA inserted into a pig pustular disease virus genome wherein the foreign DNA is inserted into the EcoRI site within a region corresponding to a subfragment of 3.2 Kb of the HindIII K fragment which contains both the HindIII site and an EcoRI of the pig pustular disease virus genome, and is capable of being expressed in the host cell in which the virus is introduced.

This invention provides a recombinant pig pustular disease virus comprising foreign DNA inserted into a pig pustular disease virus genome, wherein the foreign DNA is inserted into a) an Acccl site within a region corresponding to HindIII to a BglII subfragment of the fragment hereinafter the HindIII M and b) a hereinafter EcoRI site within the region corresponding to a 3.2 Kb subfragment of the HindIII K fragment which contains both the HindIII and EcoRI site of the genome of pig pustular disease virus and is capable of being expressed in a host cell in which the virus is I, introduced, The invention further provides vaccines and immunization methods for the recombinant pig pustular disease virus. - - -! BRIEF DESCRIPTION OF THE INVENTION Figures 1A-1B: They show a detailed diagram of the genomic DNA of SPV (Kasza voltage) including single terminal repeat (TR) and long regions. A restriction map for the HindIII enzyme is indicated (23). The fragments are with letters in order of decreasing size. Note that terminal repeats are greater than 2.1 kb but less than 9.7 kb in size.

Figures 2A-2C: They show the homology that exists between the ORF 515-85.1 and the Vaccinia virus 01L ORF. Figure 2A shows two maps. The first line of Figure 2A is a restriction map of the SPV HindIII M fragment and the second is a restriction map of the DNA insert in plasmid 515-85.1. The location of the ORF 515-85.1 [W OlL-type] is also indicated on the map. The locations of the DNA sequences shown in Figures 2B and 2C are indicated below the map by heavy bars in Figure 2A. Figure 2B shows the homology between the W 01L ORF and the 515-85.1 ORF in their respective N-terms; Figure 2C shows the homology between the W 01L ORF and the 515-85.1 ORF in their respective C terms.

Figures 3A-3C: They show a description of the DNA insert in the Homology Vector 520-17.5. Figure 3A contains a diagram showing the orientation of the DNA fragments assembled in the plasmid 520-17.5 and the table indicating the origin of each fragment. Figure 3B shows the sequences located in each of the A and B Boards between the fragments, and Figure 3C shows the sequences located in Juntas C and D. Figures 3B and 3C also describe the restriction sites used to generate each fragment as well as the synthetic linker sequences which were used to join the fragments are described for each meeting. The synthetic linker sequences are underlined by a heavy bar. The location of the gene code regions and the various regulatory elements are also shown. The following two conventions were used: numbers in parentheses () refer to amino acids, and restriction sites in angle brackets [] indicate the remnants of the sites which were destroyed during construction. The following abbreviations were used: pig pustular disease virus (SPV), late promoter 2 (LP2), lactose operon Z gene (lacZ) and Escherichia coli (E. coli).

Figures 4A-4D: They show a detailed description of the DNA insert in the Homology Vector 538-46.16. Figure 4A contains a diagram showing the orientation of the DNA fragments assembled in plasmid 538-46.16 and the table indicating the origin of each fragment. Figure 4B shows the sequences located in Juntas A and B between the fragments, and Figure 4C shows the sequences located in Juntas D and E. Figures 4B and 4D also describe the restriction sites used to generate each fragment as well as The synthetic linker sequences which were used to join the fragments are described for each joint. The synthetic linker sequences are underlined by a heavy bar. The location of the gene code regions and the various regulatory elements are also shown. The following two conventional ones were used: numbers in parentheses () refer to amino acids, and restriction sites in angle brackets [] indicate the remnants of the sites which were destroyed during "construction." The following abbreviations were used, pig pustular disease virus (SPV), pseudorabies virus ^ (PRV), g50 (gD), glycoprotein 63 (g63), initial promoter 1 (EP1), late promoter 1 (LP1), late promoter 2 (LP2), lactose operon Z gene (lacZ) and Escherichia coli (E. coli).

Figures 5A-5D: They show a detailed description of the Pig Pustular Disease Virus S-PRV-013 and the DNA insertion in the Homology Vector 570-91.64. Figure 5A contains a diagram showing the orientation of the DNA fragments assembled in the plasmid 570-91.64 and the table indicating the origin of each fragment. Figure 5B shows the sequences located at Juntas A and B between the fragments, and Figure 5C shows the sequences located at Junction C and Figure 5D shows the sequences located at Juntas D and E. The restriction sites used for generating each fragment as well as the synthetic linker sequences which were used to join the fragments are described for each joint in Figures 5B to 5D. The location of several regions of gene coding and regulatory elements is also given. The following two conventions were used: numbers in parentheses () refer to amino acids, and restriction sites in angle brackets [] indicate the remaining sites which are destroyed during construction. The following abbreviations were used: pig pustular disease virus (SPV), pseudorabies virus (PRV), Escherichia coli (E. coli), late synthetic promoter of eruptive or pustular disease 1 (LP1), late promoter Synthetic pustular disease 2 initial promoter 2 (LP2EP2), gilí (gC) base pairs (BP).

Figure 6 Map showing the genomic DNA fragment of Pustulosa de M hind III pig pustular disease virus of 5.6 kilobases. The open reading frames (ORF) are shown with the number of amino acids encoded in each open reading frame. The open reading frame of the pig eruptive disease virus shows significant sequence identities for the open reading frames of the vaccinia virus and are labeled with the vaccinia virus nomenclature (56 and 58). The open reading frame I4L (SEQUENCE ID NO .: 196) shows the amino acid sequence homology to the large subunit of ribonucleotide reductase (57) and the open reading frame 01L (SEQUENCE ID NO: 193) shows the homology of amino acid sequence to the leucine closure motif characteristic of certain eukaryotic transcriptional regulatory proteins (13). The BglII site in the open reading frame I4L and the Accl site in the open reading frame 01L are insertion sites for foreign DNA in nonessential regions of the pig pustular disease genome. The homology vector 738-94.4 contains a DNA suppression of pig pustular disease virus from nucleotides 1679 to 2452 (SEQUENCE ID NO: 189). the black bar at the bottom indicates the regions for which the DNA sequence is known and refers to SEQUENCES ID NOs: 189 and 195. The positions of the Accl restriction sites, BglII, and HindIII are shown. The open reading frame I3L (SEQUENCE ID NO: 190), the open reading frame I2L (SEQUENCE ID NO: 191) and the open reading frame E10R (SEQUENCE ID NO: 194) are shown. SEQUENCE ID NO. 221 contains the complete base pair sequence 5785 of the HindIII M fragment. The open reading frames within the HindIII M fragment of the SPV are the partial open I4L reading frame (445 AA, Nucí 2 to 1336); the partial I3L open reading frame (275 AA, Nucí 1387 to 2211); the open partial I2L reading frame (75 AA, Nucí 2215 to 2439, the open reading frame I1L (313 AA, Nucí 2443 to 3381, the open reading frame 01L (677AA, Ncl 3520 to 55509, the open reading frame partial E10R (64 AA; Nucí 5787 to 5596).

Figures 7A-7D: They show a detailed description of the Pig Pustular Disease Virus S-SPV-015 and the insertion of DNA in the Homology Vector 727-54.60. Figure 7A contains a diagram showing the orientation of the DNA fragments assembled in the plasmid 727-54.60 and the table indicating the origin of each fragment. Figure 7B shows the sequences located at Juntas A and B between the fragments, and Figure 7C shows the sequences located at Junction C and Figure 7D shows the sequences located at Juntas D and E. The restriction sites used for generating each fragment as well as the synthetic linker sequences which are used to join the fragments are described for each parameter in Figures 7B to 7D. The location of several regions of gene coding and regulatory elements is also given. The following two conventions were used: numbers in parentheses () refer to amino acids, and restriction sites in angle brackets [] indicate the remaining sites which are destroyed during construction. The following abbreviations were used: pig pustular disease virus (SPV), pseudorabies virus (PRV), Escherichia coli (E. coli), synthetic late disease promoter 1 (LP1), synthetic late promoter of pustular disease 2 initial promoter 2 (LP2EP2), glycoprotein B (gB), base pairs (BP).

Figures 8A-8D: The detailed description of the Disease Virus Pustulosa of Pig S-SPV-042 and the insertion DNA in the Vector of Homology 751-07.Al. The diagram showing the orientation of the DNA fragments assembled in the plasmid 751-07.Al. The origin of each fragment is indicated in the table. The sequences located in each of the joints between the fragments is also shown. The restriction sites used to generate each fragment as well as the synthetic linker sequences which are used to join the fragments are described for each joint. Figures 8A-8D show the sequences located on Board A (SEQUENCE ID NOS: 197), t \ (SEQUENCE ID NO: 198), C (SEQUENCE ID NO: 199J, D_ (SEQUENCE ID NO: 200), and E (SEQUENCE ID NO: 201) between the -fragments and the ; sequences located in the boards. The location of several gene coding regions and the regulatory elements are also given. The following two conventions were used: numbers in parentheses () refer to amino acids, and restriction sites in angle brackets [] indicate the remaining sites which are destroyed during construction. The following abbreviations were used: pig pustular disease virus (SPV), chicken myelomonocytic growth factor (c) (MGF), Escherichia coli (E. coli), late synthetic promoter of pustular disease 1 (LP1), late promoter Synthetic pustular disease 2 initial promoter 2 (LP2EP2), polymerase chain reaction (PCR), base pairs (BP).

Figures 9A-9D: The detailed description of the Pig Pustular Disease Virus S-SPV-043 and the DNA insertion in the Homology Vector 751-56.Al. The diagram showing the orientation of the DNA fragments assembled in the plasmid.751-56.Al. The origin of each fragment is indicated in the table. , The sequences located in each of the joints between the fragments is also shown. Figures 9A-9D show the sequences located in the_Junta_A (SEQUENCE ID NOS: 202), (SEQUENCE ID NO: 203), C (SEQUENCE ID NO: 204), D (SEQUENCE ID NO: .205) and E ( SEQUENCE ID NO: 206) between the fragments and the sequences located in the joints. The restriction sites used to generate each fragment as well as the synthetic linker sequences which are used to join the various coding regions of gene and regulatory elements are also given. The following two conventions were used: the numbers in parenthesis 0 refer to amino acids, and the restriction sites in angle brackets [] indicate the remaining sites which are destroyed during construction. The following abbreviations were used: pig pustular disease virus (SPV), chicken interferon (cIFN), Escherichia coli (E. coli), synthetic late promoter of pustular disease 1 (LP1), synthetic late promoter of pustular disease 2 initial promoter 2 (LPE2EP2), polymerase chain reaction (PCR), base pairs (BP).

Figure 10A-10D: The detailed description of the Pig Pustular Disease Virus S-SPV-037 and the DNA insertion in the Homology Vector 752-22.1. The diagram showing the orientation of the DNA fragments assembled in the plasmid 752-22.1. The origin of each fragment is indicated in the table. The sequences located in each of the joints between the fragments are also shown. Figures 10A-10D show the sequences located in Board A (SEQUENCE ID NOS: 207) r, (SEQUENCE ID "NO: 208), C (SEQUENCE? D Y: 209) - and D (SEQUENCE" ID NO: 210 ) between the fragments and the sequences located in the joints. The restriction sites used to generate each fragment as well as the synthetic linker sequences which are used to join the fragments are described for each joint. The location of several regions of gene coding and regulatory elements are also given. The following two conventions were used: numbers in parentheses () refer to amino acids, and restriction sites in angle brackets [] indicate the remaining sites which are destroyed during construction. The following abbreviations were used: pig pustular disease virus (SPV), Escherichia coli (E. coli), synthetic late promoter of pustular disease 2 initial promoter 2 (LP2EP2), polymerase chain reaction (PCR), base pairs (BP).

Figures 11A-11B: FIG.: Restriction Endonuclease Map and Open Reading Frames in the HindIII N fragment from SPV and part of the HindIII fragment from: SP. Inserts of the foreign gene in a non-essential site of the Hind III N of the pig pustular disease virus and genomic DNA of Hind III M include the EcoR V site (S-SPV-060), the SnaB I site (S-SPV -061), the Bgl II site in Hind III N (S-SPV-062) and the Bgl II site in Hind III.M (S-SPV-Q4-7J.) The insertions of the gene., Alien in the table open reading frame I7L (SEQUENCE ID NO: 23.0) and the open reading frame I4L (SEQUENCE ID NO.231) indicate that the sequence of the complete open reading frame is not essential for the replication of the pig pustular disease virus and is Suitable for the insertion of foreign genes The sites of addition for the insertion of foreign genes include, but are not limited to, the Hind III sites, the Ava I site and the BamHl site.

Figure 11B: The Restriction Endonuclease Map and the Open Reading Tables in the HindIII K genomic fragment of SPV. The insertion of the foreign gene into a non-essential site of the Hind III K genomic DNA of the pustular disease virus includes, but is not limited to, the unique EcoR I site (S-SPV-059). Three open reading frames (ORFs) were identified within a region of approximately 3.2 kB (SEQUENCE ID NO: 1) of the HindIII K fragment of approximately 6.7 kb SPV. Inserts of foreign DNA at the unique EcoRI site within the HindIII K SPV genomic fragment indicate that the sequence is not essential for the replication of the "pig pustular disease virus and is suitable for the insertion of foreign genes." The unique EcoRI site is located between the open reading frame of 77.2 kd protein and the open reading frame of T5 protein in an intergenic region indicating that the intergenic region contains sites suitable for the insertion of foreign DNA: The protein FR of 77.2 is also identified. kd (SEQUENCE ID NO: 3) and the open reading frame of protein T5 (SEQUENCE ID NO: 4) and the open reading frame of the unknown function (SEQUENCE ID NO: 2) which are suitable sites for the insertion of foreign DNA. The open reading frame of 77.2 kd of SPV protein (SEQUENCE ID NO: 3) has the sequence homology of amino acid to rabbit fibroid virus (RFV) 77.2 kd protein. The open reading frame of SPV T5 protein has the amino acid sequence homology for the T5 protein of rabbit fibroma virus (RFV). The open reading frames identified are within a base pair segment of approximately 3141 of the Hind III K fragment of the SPV (SEQUENCE ID NO: 1). The approximately 3500 base pairs remaining from the Hind III K SPV fragment has been previously sequenced (R.F. Massung et al.), Virology 197, 511-528. (1993)).

Figures 12A-12C: The detailed description of the pustular disease virus S-SPV-047 and the insertion of DNA in the homology vector 779-94.31. The diagram showing the orientation of the DNA fragments assembled in the plasmid 779-94.31. The origin of each fragment is indicated in the Table. The sequences located in each of the joints between the fragments is also shown. Figures 12A-J.2C show the sequences. located on the board A (S:), C, D, and E between the fragments and the sequences located in the joints. The restriction sites used to generate each fragment as well as the sequences of the synthetic launcher which are used to join the fragments are described for each joint. The location of several regions of gene coding and regulatory elements is also given. The following two conventions are used: numbers in parentheses, (), refers to amino acids, and restriction sites in angle brackets [], indicate the remnants of sites which are destroyed during construction. The following abbreviations were used: pig pustular disease virus (SPV), pseudorabies virus (PRV), Escherichia coli (E. coli), late promoter 2 synthetic late promoter 2 pustular disease (LP2EP2), synthetic late promoter 1 pustular disease (LP1), base pairs (BP).

Figures 13A-13D: Detailed description of the pustular disease virus S-SPV-052 and the insertion of DNA in the homology vector 789-41.7. The diagram showing the orientation of the DNA fragments assembled in the plasmid '789-41.7. The origin of each fragment is indicated in the Table. The sequences located in each of the joints between the fragments is also shown. Figures 13A-13D show. the sequences located in "the joint A, B, C, D, E and F- between the fragments and the sequences located in the joints, the restriction sites used to generate" each fragment as well as the -synthetic linker sequences which They were used to join the fragments are described for each board. The location of several regions of gene coding and regulatory elements is also given. The following two conventions were used: numbers in parentheses, (), refers to amino acids, and restriction sites in angle brackets [], indicate the remnants of sites which are destroyed during construction. The following abbreviations were used: pig pustular disease virus (SPV), pseudorabies virus (PRV), Escherichia coli (E. coli), early promoter 2 synthetic late promoter 2 of pustular disease (LP2EP2), late promoter 2 promoter 1 Initial synthetic pustular disease (EP1LP2), synthetic late promoter 1 of pustular disease (LP1), base pairs (BP).

Figures 14A-14D: Detailed description of the pustular disease virus S-SPV-053 and the insertion of DNA in the homology vector 789-41.27 The diagram showing the orientation of the DNA fragments assembled in the plasmid 789-41.27 The origin of each fragment is indicated in the Table The sequences located in each of the joints between the fragments : are also displayed. Figures 14A-14D show the sequences I located on the joint A, B, C, D, E, F and G between the fragments j and the sequences located in the joints. The restriction sites used to generate each fragment as well as the sequences of the synthetic launcher which are used to join the fragments are described for each joint. The location of several regions of gene coding and regulatory elements is also given. The following two conventions were used: numbers in parentheses, (), refers to amino acids, and restriction sites in angle brackets [], indicate the remnants of sites which are destroyed during construction. The following abbreviations were used: pig pustular disease virus (SPV), pseudorabies virus (PRV), Escherichia coli (E. coli), early promoter 2 synthetic late promoter 2 of pustular disease (LP2EP2), late promoter 2 promoter 1 Initial synthetic pustular disease (EP1LP2), synthetic late promoter 1 of pustular disease (LP1), base pairs (BP).

Figures 15A-15D: Detailed description of the pig pustular disease virus S-SPV-054 and the insertion of DNA in the homology vector 789-41.47. The diagram showing the orientation of the DNA fragments assembled in plasmid 789-41.47. The origin of each fragment is indicated in the Table. The localized sequences - in each of the joints. between the; Fragments are also shown. Figures 15A-15D show the • sequences located on joint A, B, C (sequence ID No.), D, E, F and G between the fragments and the sequences located in the joints. The restriction sites used to generate each fragment as well as the sequences of the synthetic launcher which are used to join the fragments are described for each joint. The location of several regions of gene coding and regulatory elements is also given. The following two conventions were used: numbers in parentheses, (), refers to amino acids, and restriction sites in angle brackets [], indicate the remnants of sites which are destroyed during construction. The following abbreviations were used: pig pustular disease virus (SPV), pseudorabies virus (PRV), Escherichia coli (E. coli), late promoter 2 early synthetic pustular disease promoter 1 (EP1LP2), synthetic late promoter 1 of pustular disease (LP1), base pairs (BP) .

Figures 16A-16E: The detailed description of the pig pustular disease virus S-SPV-055 and the insertion of DNA in the homology vector 789-41.73. The diagram showing the orientation of the DNA fragments assembled in plasmid 789-41.73. The origin of each fragment is indicated in the Table. The sequences located ^ in each of the joints between the fragments are also shown. Figures 16A-16E show the sequences located in joints A, B, C, D, E, F, G and H between the fragments and the sequences located in the joints. The restriction sites used to generate each fragment as well as the sequences of the synthetic launcher which are used to join the fragments are described for each joint. The location of several regions of gene coding and regulatory elements is also given. The following two conventions were used: numbers in parentheses, (), refers to amino acids, and restriction sites in angle brackets [], indicate the remnants of sites which are destroyed during construction. The following abbreviations were used: pig pustular disease virus (SPV), pseudorabies virus (PRV), Escherichia coli (E. coli), early promoter 2 synthetic late promoter 2 of pustular disease (LP2EP2), late promoter 2 promoter 1 Initial synthetic pustular disease (EP1LP2), synthetic late promoter 1 of pustular disease (LP1), base pairs (BP).

DETAILED DESCRIPTION OF THE INVENTION This invention provides a recombinant pig pustular disease virus comprising a foreign DNA inserted into a genome of pustular disease virus, wherein the foreign DNA is inserted into the EcoRI site within a corresponding region - to the subfragment of 3.2 Kb of the HindSII fragment which contains both the HindIII site and an EcoRI. The genome of pustular disease virus and is capable of expressing itself in a host cell in which the virus is introduced.

This invention provides a virus of recombinant pustular disease comprising foreign DNA inserted into the genome of pig pustular disease virus, wherein the foreign DNA is inserted into a) an Accl site within a region corresponding to the subfragment HindIII to BglII of the larger HindIII M fragment and b) an EcoRI site with a region corresponding to a 3.2 Kb subfragment of the HindIII K fragment which contains both a HindIII and EcoRI site of the pig pustular disease virus genome and is capable of being expressed in a host cell in which the virus is introduced.

In another embodiment, the open reading frame encodes a B18R gene. In another embodiment, the open reading frame encodes a B4R gene. In another embodiment the open reading frame encodes the homologue of 'pig pustular disease of the protein gene 77.2 kd. In another embodiment, the open reading frame encodes the pig pustular disease homologue of the T5 protein gene. - In another embodiment, the foreign DNA sequence is inserted into the EcoRV restriction endonuclease site within the subfragment of approximately 2 kB of HindIII to Ba H1 of the pig pustular disease virus-genome. In 'other incorporation the sequence. Strange DNA is inserted into the SnaBI restriction endonuclease site within the subfragment of approximately 2.0 kB HindIII to BamHI of the pig pustular disease virus genome.

In another embodiment the foreign DNA sequence is inserted into a subfragment of approximately 1.2 kB of BamHI to the HindIII of the HindIII N fragment of the pig pustular disease virus genome. In another embodiment the foreign DNA sequence is inserted into an open reading frame within a subfragment of approximately 1.2 kB of BamHI to HindIII of the HindIII N fragment of the pig pustular disease virus genome. In another embodiment, the foreign DNA sequence is inserted into the open reading frame which encodes an I4L gene. In another embodiment the foreign DNA sequence is inserted into the BglII restriction endonuclease site within the subfragment of approximately 1.2 kB of BamHI to HindIII of the pig pustular disease virus genome.

In another embodiment, the recombinant pig pustular disease virus contains the foreign DNA sequence inserted into a subfragment of approximately 3.6 kB larger from HindIII to BglII of the 'HindIII M fragment of the genomic DNA of the. Pustular "Pig Disease." In another embodiment, the foreign DNA sequence is inserted into an open reading frame within a subfragment of approximately 3.6 kB larger from HindIII to BglII of the HindIII M fragment of the genomic DNA of pustular disease virus. In another embodiment, the open reading frame encodes an I4L gene.

In another embodiment the foreign DNA sequence of the recombinant pustular disease virus is inserted into a non-essential open reading frame (ORF) of the HindIII M fragment. The example of the open reading frame includes but is not limited to: I4L, I2L, 01L, and E10L.

In another embodiment, the recombinant pig pustular disease virus further comprises a foreign DNA sequence inserted into an open reading frame encoding thymidine kinase of pig pustular disease virus. In one embodiment, the foreign DNA sequence is inserted into the Ndel site within the open reading frame encoding thymidine kinase of pig pustular disease virus.

For the purposes of this invention, "a recombinant pig pustular disease virus capable of duplication" is a live pig pustular disease virus which has been generated by well known recombinant methods.

By those skilled in the art, for example, the methods established in the work PROCEDURE FOR THE RECOMBINATION OF HOMOLOGOUS TO GENERATE RECOMBINANT SPV in Materials and Methods yi has not been eliminated the genetic material essential for the duplication of the virus of pustulant disease of recombinant pig.

For the purposes of this invention, an "insertion site which is not essential for the replication of the pig pustulant disease virus" is a region or region which corresponds to a specific fragment in the viral genome of pustular disease where a DNA sequence is not necessary for viral duplication, for example, the complex protein binding sequences, sequences whose code for the reverse transcriptase or an essential glycoprotein, the DNA sequences necessary for packaging, and so on.

For the purposes of this invention, a "promoter" is a specific DNA sequence on the DNA molecule to which the foreign RNA polymerase binds and in which the transcription of the foreign RNA is initiated.

For the purposes of this invention, an "open reading frame" is a DNA segment which contains codons that can be transcribed into RNA which can be translated into an amino acid sequence and which does not contain i a codon termination.

The invention also provides a sequence of Strange DNA or an alien RNA which encodes a polypeptide.

Preferably, the polypeptide is antigenic in the animal.

Preferably, this antigenic polypeptide is a linear polymer of more than 10 amino acids linked by peptide bonds which stimulate the animal to produce antibodies.

The pustular disease virus S-SPV-003 has been deposited according to the Budapest Treaty on Deposit International of Microorganisms for the purpose of the patent procedure with the patent cultivation deposit of the American Type Culture Collection, 12301 Parkla n Drive, Rockville, Maryland 20852, United States of America under accession number ATCC No. VR 2335 For the purposes of this invention, a "polypeptide which is a detectable label" includes the form of a cobalt, trimer and tetramer of the polypeptide. E. coli β-galactosidase is a tetramer composed of four polypeptide or monomer subunits.

The foreign DNA which encodes a polypeptide includes but is not limited to: the surface protein of feline leukemia virus, the transmembrane protein of feline leukemia virus, the feline leukemia virus gape, the transmembrane protease of = virus of feline leukemia, ~ - the feline immunodeficiency virus protease / opener, the feline immunodeficiency virus envelope, the feline leukemia virus protease / opener, the feline leukemia virus envelope, the canine parvovirus VP2, the canine parvovirus VPl / 2, interleukin-12 bovine cytosine protein 35, bovine cytosine interleukin-12 protein 40, bovine respiratory syncytial virus glycoprotein G, Newcastle disease fusion, infectious rhinotracheitis virus glycoprotein D, canine distemper virus fusion, canine distemper virus hemagglutinin, DV HA, glycoprotein 45 of bovine viral diarrhea virus type 1, glycoprotein 48 of the viru s of bovine viral diarrhea type 1, glycoprotein 53 of bovine viral diarrhea virus type 1, glycoprotein 53 of bovine viral diarrhea virus type 2. - The present invention further provides a virus of recombinant pustular disease in which the foreign DNA encodes an antigenic polypeptide is: pig influenza virus hemagglutin, pig influenza virus neurominidase, pig influenza virus matrix, virus nucleoprotein of swine flu, African pig fever virus or mycoplasma and hyopneumoniae. Preferred embodiments of such viruses are designated S-SPV-121, and S-SPV-122.

The present invention further provides a recombinant pig pustular disease virus which foreign DNA encodes an antigenic polypeptide is: sitosin is the chicken-macrophage migration inhibitory factor (cMIF), the chicken myelomonocyte growth factor (cMGF) ), or chicken interferon (cIFN) Preferred incorporations of such viruses are designated S-SPV-068 and S-SPV-105.

The present invention further provides a recombinant pig pustular disease virus which the foreign DNA encodes an antigenic polypeptide is: porcine reproductive and respiratory syndrome virus (PRRS) 0RF2, 0RF3, 0RF4, 0RF5, 0RF6 and 0RF7, pseudorabies gB, gD , gl. Preferred incorporations of such viruses are designated S-SPV-076, S-SPV-079, S-SPV-090, S-SPV-084, S-SPV-091, S-SPV-092, S-SPV-093, S-SPV-094, S-SPV-095.

The present invention further provides a recombinant pig pustular disease virus in which the foreign DNA encodes an antigenic polypeptide is: infectious bovine rhinotracheitis virus glycoprotein B, glycoprotein D and glycoprotein I, bovine respiratory synovial virus binding protein (BRSV G), bovine respiratory synovial virus fusion protein (BRSV F), bovine respiratory synovial virus nucleocapsid protein (BRSV N). Preferred incoporations of such viruses are designated S-SPV-109, S-SPV-110, S-SPV-111, S-SPV-113, S-SPV-115, S-SPV-119, S-SPV-112. .

The present invention further provides a recombinant pig pustular disease virus in which the foreign DNA encodes an antigenic polypeptide is: glycoprotein 48 or glycoprotein 53 of bovine viral diarrhea virus (BVDV). A preferred embodiment of such a virus is designated S-SPV-099.

The present invention further provides a recombinant pig pustular disease virus in which foreign DNA encodes an antigenic polypeptide is: feline immunodeficiency virus protease / opener and envelope, envelope and feline leukemia virus protease / opener . Preferred incorporations of such viruses are designated: S-SPV-106, S-SPV-089, S-SPV-100, S-SPV-107, S-SPV-108.

The present invention further provides a virus of recombinant pustular disease in which the foreign DNA encodes an antigenic polypeptide is: canine parvovirus VP2 and VP1 / 2. Preferred incorporations of such viruses are designated: S-SPV-114, S-SPV-116, S-SPV-117, S-SPV-118.

The present invention provides a recombinant pustular disease virus comprising foreign DNA inserted into the genomic DNA of pig pustular disease virus, wherein one or more of the foreign DNAs is inserted into each of the HindIII K fragment of the genomic DNA of pustular disease virus and within the HindIII M fragment of the genomic DNA of pig pustular disease virus and is capable of being expressed in a host cell infected with pig pustular disease virus. Preferred incorporations of such viruses are designated: S-SPV-127, S-SPV-128, S-SPV-131, and S-SPV-132.

The present invention provides a recombinant pig pustular disease virus comprising foreign DNA inserted into the genomic DNA of pig pustular disease virus, wherein the one or more foreign DNAs which encode a fusion protein are inserted into each HindIII K fragment of the genomic DNA of pig pustular disease virus and within the HindIII M fragment of the genomic DNA of pig pustular disease virus and is capable of being expressed in an infected host cell of pig pustular disease virus. Preferred incorporations of such viruses are designated S-SPV-130.

The invention further provides a pustular disease virus capable of "recumbent pig" from duplication which contains foreign DNA encoding an antigenic polypeptide which is or is from pseudorabies virus (PRV) g50 (gD), pseudorabies virus (PRV) gil (gB), pseudorabies virus (PRV) gilí (gC), pseudorabies virus (PRV) glycoprotein H, pseudorabies virus (PRV) glycoprotein E, gastroenteritis Transmissible (TGE) glycoprotein 195, the transmissible gastroenteritis matrix protein (TGE), swine rotavirus 38 glycoprotein, pig parvovirus capsid protein, protective serine hydodysentery antigen, bovine viral diarrhea glycoprotein 55 (BVD), the hemagglutinin-neuraminidase virus of Newcasttle disease (NDV), pork flu neuraminidase or swine flu hemagglutinin. Preferably, the antigenic polypeptide is the pseudorabies virus (PRV) g50, (gD). Preferably, the antigenic protein is a hemagglutinin-neuraiminidase of Newcastle disease virus (NDV).

The invention further provides a virus of recombinant pig pustular disease capable of duplication which contains foreign DNA encoding an antigenic polypeptide which is or comes from serpulina hydodisenteriae, foot and mouth disease virus, pig cholera virus , African swine fever virus or mycoplasma hyopneumoniae.

The invention further provides a virus of recombinant pig pustular disease capable of duplication containing the foreign DNA encoding RNA encoding Neclast disease virus of antigenic polypeptide (NDV) hemagglutinin-neuraminidase further comprising foreign DNA encoding polypeptide which is a marker detectable The present invention further provides a recombinant pig pustular disease virus which comprises a foreign DNA sequence inserted into a non-essential site of the pig pustular disease genome, wherein the foreign DNA sequence encodes an antigenic polypeptide derived from rhinotracheitis virus. Infectious bovine is capable of being expressed in a host infected with the recombinant pustular disease virus. Examples of such an antigenic polypeptide are glycoprotein E and infectious bovine rhinotracheitis virus G glycoprotein.

The present invention further provides a recombinant pig pustular disease virus which comprises a foreign DNA sequence inserted into a non-essential site of the pig pustular disease genome, wherein the DNA sequence is foreign encodes an antigenic polypeptide derived from the laryngotraquitis virus infectious is able to be expressed in a host infected with the pig pustular disease virus ! recombinant. Examples of such an antigenic polypeptide are Glycoprotein G and glycoprotein I of infectious laryngotracheitis virus.

In an incorporation of the recombinant pig pustular disease virus the foreign DNA sequence encodes a cytosine. In. another incorporation the cytosine is a factor of | myelomonocytic growth of chicken (cMGF) or chicken interferon j (cIFN). Cytosines include but are not limited to: the transforming growth factor beta, the epidermal growth factor family, the fibroblast growth factors, the epatosite growth factor, the insulin type growth factor, vascular endothelial growth factor, interleukin 1, the IL-1 receptor antagonist, interleukin-2, interleukin-3, interleukin-4, interleukin-5, interleukin-6, soluble receptor IL-6, interleukin-7, interleukin-8 , interleukin-9, interleukin-10, interleukin-11, interleukin-12, interleukin-13, angiogenin, chemokines, colony-stimulating factors, macrophage-granulocyte colony stimulating factors, erythropoietin, interferon, gamma interferon, cell factor stem (or known as breast cell growth factor, or lingando protein c-kit), leukemia inhibitory factor, oncostatin M, pleitotrophin, 5 secretory leucite protease inhibitor, cell factor d e sperm, tumor necrosis factors, and soluble TNF receptors. These cytosines are human, bovine, equine, feline, canine, porcine or poultry.

The present invention further provides a recombinant pig pustular disease virus which comprises a foreign DNA sequence inserted into a non-essential site of the pig pustular disease genome, wherein the foreign DNA sequence encodes an antigenic polypeptide derived from a " human pathogen and is capable of - expressing itself in a host infected with the recombinant pig pustular disease virus.

The recombinant SPV expressing cytosine was used to enhance the immune response either alone or when combined with vaccines containing cytokines or antigen genes from microorganisms that cause disease.

The antigenic polypeptide of a human pathogen Those which are derived from human herpes virus include, but are not limited to: hepatitis B virus and hepatitis C virus, hepatitis B virus core and surface antigens, hepatitis C virus, human immunodeficiency virus, simple herpes virus-1, simple herpes virus-2, human cytomegalovirus, Epstein-Barr virus, Varicella-Zoster virus, human herpes-6 virus, human herpes-7 virus, human influenza virus, angina virus , hantaan virus, pneumonia virus, rhinovirus, poliovirus, human respiratory sinsial virus, retrovirus, human T cell leukemia virus, rabies virus, mumps virus, malaria (Plasmodium falciparum), Bordetella pertussis, Diphtheria, Rickettsia pro azekii , Borelia Berfdorferi, tetanus toxin, malignant tumor antigens.

In one embodiment of the invention, a pig pustular disease virus contains the foreign DNA sequence encoding the core protein of hepatitis "3" virus.

The present invention further provides a recombinant pig pustular disease virus which comprises a foreign DNA sequence grafted to a non-essential site of the pig pustular disease genome, wherein the foreign DNA sequence encodes a cytosine capable of stimulating an immune a host infected with the recombinant pustular disease virus and capable of expressing itself in the infected host.

The present invention further provides a recombinant pustular disease virus which comprises a foreign DNA sequence inserted into a non-essential site of the pig pustular disease genome, wherein the foreign DNA sequence encodes an antigenic polypeptide derived from an equine pathogen and which is capable of being expressed in a host infected with the recombinant pustular disease virus.

The antigenic polypeptide of an equine pathogen can be derived from the. Equine influenza or equine herpes virus. In one embodiment, the antigenic polypeptide is equine influenza neuraminidase or hemagglutinin. Examples of such antigenic polypeptides are equine influenza A / Alaska 91 neuraminidase, equine influenza A / Prague 56 neuraminidase, equine influenza A / Miami 63 neuraminidase, influenza virus. influenza virus, equine type A / Kentucky 81 neuraminidase ,. equine influenza virus type A / Kentucky 92 neuraminidase, equine herpes virus type 1, glycoprotein B,. equine herpes virus type 1 glycoprotein D, Streptecoccus equi, equine infectious anemia virus, equine encephalitis virus, equine rhinovirus and equine rotavirus.

The present invention further provides an antigenic polypeptide which includes, but is not limited to: gEl pig cholera virus gE2 pig cholera virus, swine influenza hemagglutinin virus, neuroiminidase, matrix and nucleoprotein, pseudorabia, gB, gC and gD, and PRRS virus from the reading frame 7.

The present invention further provides a recombinant pig pustular disease virus which comprises a foreign DNA sequence inserted into a non-essential site of the pig pustular disease genome, wherein the foreign DNA sequence encodes an antigenic polypeptide derived from the bovine respiratory sinsial virus. or of the bovine parainfluenza virus and is capable of being expressed in a host infected with the recombinant pig pustular disease virus.

For example, the infectious bovine rhinotracheitis virus gE antigenic polypeptide, the equine pathogen of bovine respiratory synovial virus, can be derived from the equine influenza virus is the bovine protein resuscitation protein (BRSV G), the protein of fusion of bovine sinsial respiratory virus (BRSV F), the protein nucleocapsid of bovine respiratory synovial virus (BRSV N), the type 3 fusion protein of bovine parainfluenza virus, and the neuraminidase hemagglutinin type 3 of bovine parainfluenza virus.

The present invention further provides a recombinant pig pustular disease virus which comprises a foreign DNA sequence inserted into a non-essential site of the pig pustular disease genome, wherein the foreign DNA sequence encodes viral diarrhea virus glycoprotein 48 bovine (BVDV) or glycoprotein 53, and wherein the foreign DNA sequence is capable of being expressed in a host infected with the recombinant pig pustular disease virus.

The present invention further provides a virus of recombinant pustular disease which comprises a foreign DNA sequence inserted into a non-essential site of the pig pustule disease genome, wherein the foreign DNA sequence encodes an antigenic polypeptide derived from the infectious bursal disease virus and wherein the foreign DNA sequence is capable of being expressed in a host infected with the recombinant pustular disease virus. Examples of such an antigenic polypeptide are the polyprotein of infectious bursal disease virus and VP2.

The present invention further provides a recombinant pig pustular disease virus in which the foreign DNA sequence encodes an antigenic polypeptide which includes, but is not limited to: MDV gA, MDV gB, MDV gD, MDV HN, NDV F, ILT gB, ILT gl, ILT gD, IBDV VP2, IBDV VP3, IBDV VP4, IBDV polyprotein, IBV spike, IBV matrix, avian encephalomyelitis virus, poultry reovirus, poultry paramyroidevirus, poultry influenza virus, poultry adenovirus, disease virus pustulosa of birds, poultry coranavirus, avian rotavirus, chicken anemia virus, Salmonella ssp. E. coli, Pasteurella spp., Bordetella spp., Eimeria spp., Histomonas spp., Trichomonas spp., Bird nematodes, cestodes, trematodes, bird lice / weevils and bird protozoa.

The invention further provides that the inserted foreign DNA sequence is under the control of the promoter. In one embodiment the viral promoter of pig pustular disease. In another embodiment the foreign DNA sequence is under the control of an upstream endogenous pustular disease virus promoter. In another embodiment the foreign DNA sequence is under the control of a heterologous upward promoter.

For the purposes of this invention, the promoters include but are not limited to the synthetic pustular disease viral promoter, the late synthetic pustular disease promoter 1, the late synthetic pustular disease promoter 2 promoter 2, the pustular disease promoter 01L , the I4L promoter of pustular disease, the I3L promoter of pustular disease, the I2L promoter of pustular disease, the I1L promoter of pustular disease, the ElOR promoter of pustular disease, gX PRV, alpha 4 of HSV-1, immediate HCMV initially, MDV gA, MDV gD, ILT gB, BHV-1.1 VP8 and ILT gD and internal ribosomal entry site promoter. Alternate promoters are generated by the method known to those skilled in the art, for example as set forth in the work STRATEGY FOR THE CONSTRUCTION OF VIRAL PROMOTERS OF SYNTHETIC PUSTULOSE DISEASE in Materials and Methods.

The invention provides a homology vector for producing a recombinant pig pustular disease virus by inserting foreign DNA into the genomic DNA of a pig pustular disease virus. The homology vector comprises a DNA molecule of double strain consisting essentially of a foreign DNA sequence of double strain or (RNA). which does not occur naturally in an animal in which the recombinant pig pustular disease virus is introduced, with one end of the foreign DNA, the double pig pig pustular disease viral DNA homologous to the genomic DNA located on a side of a site of the genomic DNA which is not essential for the replication of the pig pustular disease virus, and at the other end the foreign DNA, the double pig pig pustular disease viral DNA homologous to the genomic DNA located on the other side from the same site on genomic DNA. Preferably the RNA encodes a polypeptide.

In another embodiment of the present invention, the double strain pig pustular disease viral DNA of the homology vectors described above is homologous to the genomic DNA present within the HindIII M fragment. In another embodiment the viral DNA of pig pustular disease Double strain of the homology vectors described above is homologous to the genomic DNA present within a subfragment of approximately 2 Kb of HindIII to BglII. In a preferred embodiment, the double-stranded pig pustule disease viral DNA is homologous to the genomic DNA within the BglII site located in this HindIII to BglII suffragment.

In another embodiment, double-strain pig pustular disease viral DNA is homologous to the genomic DNA present within the open reading frame contained in the larger HindIII to BglII subfragment. Preferably, the double-stranded pig pustular disease viral DNA is homologous to the genomic DNA present within the Accl restriction endonuclease site located in the larger subfragment of HindIII to BglII.

In one embodiment, the polypeptide is a detectable marker. Preferably, the polypeptide which is a detectable marker is E. coli β-galactosidase.

In one embodiment, the foreign DNA which codes for a polypeptide includes but is not limited to: feline leukemia virus surface protein, feline leukemia virus transmembrane protein, feline leukemia virus, transmembrane protease of feline virus feline leukemia, feline immunodeficiency virus protease / opener, feline immunodeficiency virus envelope, feline leukemia virus protease / opener, feline leukemia virus envelope, canine parvovirus VP2, canine parvovirus VPl / 2, interleukin-35 protein 12 Bovine Cytokine, Interleukin-12 Bovine Cytokine Protein, Bovine Respiratory Syncytial Virus G glycoprotein, Newcastle Disease Fusion, Infectious Rhinotracheitis Virus Glycoprotein D, Canine Distemper Virus Fusion, Canine Distemper Virus Hemagglutinin DVHA, glycoprotein 45 type 1 Bovine Viral Diarrhea Virus, glycoprotein 48 type 1 Bovine Viral Diarrhea Virus, glycoprotein 5 3 type 1 of Bovine Viral Diarrhea Virus, glycoprotein 53 type 2 of Bovine Viral Diarrhea Virus.

Other polypeptides include: pseudorabies virus (PRV) g50 (gD) pseudorabies virus (PRV) gil (gB), pseudorabies virus (PRV) gilí (gC), pseudorabies virus (PRV) H glycoprotein, transmissible gastroenteritis (TGE), glycoprotein 195, transmissible gastroenteritis matrix protein (TGE), pig rotavirus 38 glycoprotein, pig parvovirus capsid protein, Serpulina hydodysenteriae protective antigen, viral diarrhea glycoprotein 53 bovine (BVD), Ne castle disease virus (NDV) hemagglutinin-neuraminidase, pig influenza neuraminidase or haemagglutinin. Preferably it is an antigenic polypeptide or is from Serpulina Hydodysenteriae, Foot and Mouth Disease Virus, Pig Elf Virus gEl and gE2, Swine Influenza Virus, African Pig Fever Virus or Mycloplasma hyipneumoniae, Haemagglutinin pig influenza virus, neuraminidase and matrix and nucleoprotein, PRRS virus 0RF7, and core protein B virus.

In one embodiment, the polypeptide is antigenic in the animal.

In one embodiment of the present invention, the foreign DNA sequence of double strain in the homology vector encodes an antigenic polypeptide derived from the human pathogen.

For example, the antigenic polypeptide of a human pathogen is derived from the human herpes virus, simple herpes virus-1, the. simple herpes virus-2, cytomegalovirus, Epstein-Barr virus, Varicell-Zoster virus, human * herpes-6 virus, human herpes-7 virus, human influenza, human immunodeficiency virus, rabies virus, rubella virus, hepatitis B virus and hepatitis C virus. In addition, the antigenic polypeptide of a human pathogen can be associated with malaria or a malignant tumor of the group consisting of Plasmodium falciparum, Bordetella pertusis and malignant tumor.

In an embodiment of the present invention, the foreign DNA sequence of double strain in the homology vector encodes a cytokine capable of stimulating the human immune response. In one embodiment, the cytokine is a chicken myelomonocyte growth factor (cMGF) or a chicken interferon (cIFN). For example, the cytokine can be, but is not limited to, interleukin-2, interleukin-6, interleukin-12, 5 interferons, macrophage-granulocyte colony, colony stimulation factors, and interleukin receptors.

In an embodiment of the present invention, the foreign DNA sequence of double strain in the homology vector encodes an antigenic polypeptide derived from the equine pathogen.

The antigenic polypeptide of an equine pathogen can be derived from equine influenza virus or equine herpes virus. Examples of such antigenic polypeptides are viruses equine influenza A / Alaska 91 neuraminidase, equine influenza A virus / Prague 56 neuraminidase, equine influenza virus type A / Miami 63 neuraminidase, equine influenza virus type A / Kentucky 81 neuraminidase, influenza virus equine herpes type 1 glycoprotein B, and equine herpes virus type 1 glycoprotein D.

In one embodiment of the present invention, the foreign double stranded DNA sequence of the homology vector encodes an antigenic polypeptide derived from the bovine respiratory syncytial virus or the bovine parainfluenza virus.

For example, the antigenic polypeptide is derived from infectious bovine gut rhinotracheitis, the bovine respiratory syncytial virus binding protein (BRSV G), the respiratory syncytial virus bovine fusion protein (BRSV F), the respiratory syncytial virus nucleocapsid protein bovine (BRSV N), type 3 fusion protein of bovine parainfluenza virus and neuraminidase hemagglutinin type 3 of bovine parainfluenza virus.

In an embodiment of the present invention, the foreign double stranded DNA sequence of the homology vector encodes an antigenic polypeptide derived from the infectious bursal disease virus. Examples of such antigenic polypeptides are the polyprotein of the infectious bursal disease virus and the infectious bursal disease virus BV2, VP3, or VP4.

For the purpose of this invention, a "homology vector" is a plasmid constructed to insert the DNA at a specific site on the genome of a pig pustular disease virus.

In one embodiment of the invention, the double strain pig pustular disease viral DNA of the homology vectors described above is homologous to the genomic DNA present within the open reading frame encoding the thymidine kinase of pig pustular disease. Preferably, the double-stranded pig pustular disease viral DNA is homologous to the genomic DNA present within the restriction endonuclease site Ndel located in the open reading frame encoding the thymidine kinase of pig pustular disease.

The invention further provides homology vectors described above, the foreign DNA sequence of which is under the control of a promoter located upstream of the foreign DNA sequence. The promoter may be a viral promoter of endogenous pig pustular disease or an exogenous promoter. Promoters include, but are not limited to, the synthetic pustular disease viral promoter, the synthetic late promoter of pustulosa-1 disease, the late promoter synthetic pustular 2 early promoter 2, the pustular disease promoter 01L, the disease promoter I4L putulose, the I3L promoter of pustular disease, the I2L promoter of pustular disease, the ILP promoter of pustular disease, the ElOR promoter of pustular disease, the PRV gX, the alpha 4 HSV-1, the immediate HCMV initially, the BHV- 1.1 VP8, the glycoprotein of infectious larigontraqueitis virus, the gD virus of infectious laryngotracheitis, the glycoprotein A of the marek virus, the glycoprotein B of the marek virus, and the glycoprotein D of the virus of the disease of marek The invention further provides a vaccine comprising an effective immunizing amount of a recombinant pig pustular disease virus of the present invention and a suitable carrier.

Suitable carriers for the pig pustular disease virus are well known in the art and include proteins, sugars, etc. An example of such a suitable carrier is a physiologically balanced culture medium containing one or more. stabilizing agents such as lactose, hydrolysed and stabilized proteins, etc.

For the purposes of this invention, an "effective immunizing amount" of the. Recombinant pig pustular disease virus of the present invention is within the range of 103 to 109 PFU / dose.

The present invention also provides a method for immunizing an animal, wherein the animal is a human, a pig, a bovine, an equine, a goat or a sheep. For the purposes of this invention, this includes immunizing the animal against the virus or viruses that cause disease or pseudorabies, transmissible gastroenteritis, pig rotavirus, pig parvovirus, Serpulina hyodysenteriae, bovine viral diarrhea, Newcastle disease, swine influenza, PRRS, bovine respiratory syncytial virus 4, type 3 parainfluenza virus, foot and mouth disease, pig cholera, African pig fever or Mycoplasma hyopneumoniae. For the purposes of this invention, the method for immunizing also includes immunizing the animal against the human pathogens, the bovine pathogens, the equine pathogens, and the poultry pathogens described in the preceding part of this section.

The method comprises administering to the animal an effective immunizing dose of the vaccine of the present invention. The vaccine can be administered by any of the methods well known to those skilled in the art, for example, by intramuscular, subcutaneous, intraperitoneal or intravenous injection. Alternatively, the vaccine can be administered intranasally or orally.

The present invention also provides a method for testing a pig to determine whether the pig has been vaccinated with the vaccine of the present invention, particularly the incorporation containing the recombinant pig pustular disease virus S-SPV-008 (ATCC Access No. VR 2339), or becomes infected with the naturally occurring wild-type pseudorabies virus. This method involves obtaining from the pig to be tested a sample of a suitable body fluid, detect in the sample the presence of pseudorabies antibody virus, the absence of such antibodies, indicating that the pig has not been vaccinated or infected, and for the pig in which antibodies to the pseudorabies virus are present, detect in the sample the absence of antibodies to the pseudorabies virus antigens which are normally present in the body fluid of a pig infected by the virus of pseudorabies that occur naturally but which are not present in a vaccinated pig indicating that the pig was vaccinated and not infected.

The present invention provides a recombinant SPV which when inserted into the foreign DNA sequence or gene can be used as a diagnostic assay. In one embodiment, the FIV env and gag genes and D. immitis p39 and 22kd are used in the diagnostic assay to detect the feline immunodeficiency caused by FIV and to detect the heartworm caused by D. immitis, respectively.

The present invention also provides a host cell infected with a recombinant pig pustular disease virus capable of duplication. In one embodiment, the host cell is a mammalian cell.

Preferably, the mammalian cell is a Vero cell.

Preferably, the mammalian cell is an ESK-4 cell, a PK-15 cell or an EMSK cell. For the purposes of this invention a "host cell" is a cell used to propagate a vector and its insert. Infecting the cell was achieved by methods well known to those skilled in the art, for example, as set forth in the work PROCEDURE OF TRANSFECTION-INFECTION in Material and Methods.

The methods for constructing, selecting and purifying the recombinant pig pustular disease viruses described above are detailed below in Materials and Methods.

EXPERIMENTAL DETAILS Materials and methods PREPARATION OF VIRUS SUPPLY OF PUREULOSE PIGS DISEASE. Samples of the pig pustular disease virus (SPV) were prepared by infecting the embryonic pig kidney cells (EMSK), ESK-4 cells, PK-15 cells or Vero cells at a multiplicity of infections of 0.01 PFU / cell in a 1: 1 mixture of an Iscove Modified Dulbecco's medium (IMDM) and an RPMI 1640 medium containing 2 mM glutamine, 100 units / ml pelicillin, 100 units / ml streptomycin (these components were obtained from Sigma or an equivalent provider, and are referred to as the negative EMSK medium hereinafter.) Before infection, monolayers of cells were washed once with the EMSK negative medium to remove the traces of fetal bovine serum, the SPV contained in the initial inoculum (0.5 ml for a 10 cm plate).; 10 ml for a bottle of T175 cm) was then allowed to absorb on the cell monolayer for 2 hours, being redistributed every half hour. After this period, the inoculum origin-I-was placed at the recommended volume with the addition of the complete EMSK medium (the negative EMSK medium plus 5% fetal bovine serum). The plates were incubated at 37 ° C in 5% C02 until the cytopathic effect was completed. The medium and cells were harvested and frozen in a 50 ml conical screw cap tube at -70 ° C. With freezing at 37oC, the virus supply was aliquoted into 1.0 ml flasks and refrozen at -70oC. The concentrations were usually around 106 PFU / ml.

PREPARATION OF SPV DNA For the isolation of DNA from pig pustular disease virus, a confluent monolayer of EMSK cells in a T175 cm2 bottle was infected at a multiplicity of 0.1 and incubated for 4-6 days until the cells were showing 100% effect cytopathic The infected cells were then harvested by scraping the cells inside the medium and centrifuged at 300 revolutions per minute for 5 minutes in a clinical centrifuge. The medium was decanted and the cell pellet was gently resuspended in 1.0 ml Phosphate Buffer Salt Water (PBS: 1.5 g Na2HP04, 0.2 g KH2P04, 0.8 g NaCl and 0.2 g KCl per liter H20) (by T175) and subjected to two successive freezing-thawing (-70 ° C) to 37oc). With the last thawing, the cells (on the ice) were sonicated twice for 30 seconds each with 45 seconds of cooling between them. The cell wastes were then removed by centrifugation. (Sorvall RC-5B supervelocity centrifuge) The cell wastes were then removed by centrifugation (Sorvall RC-5B supervelocity centrifuge) at 3000 revolutions per minute for 5 minutes in an HB4 rotor at 4 ° C. The virus virions of pig pustular disease, present in the supernatant, were then pelleted by centrifugation at 15,000 revolutions per minute for 20 minutes at 4 ° C in a SS34 rotor (sorvall) and resuspended in 10 mM Tris (pH 7.5). This fraction was then layered on a gradient of 36% sucrose (w / b in 10 mM tris pH 7.5) and centrifuged (Beckman Ultracentrifuge L8-70M) at 18,000 revolutions per minute for 60 minutes in a SW41 rotor (Beckman) at 4 ° C. The virion pellet was resuspended in 1.0 ml of 10 mM tris pH 7.5 and sonicated on ice for 30 seconds. This fraction was layered on a continuous sucrose gradient of 20% to 50% and centrifuged at 16,000 revolutions per minute for 60 minutes in a SW41 rotor at 4oC. The SPV virion band located about three quarters down the gradient was harvested, diluted with 20% sucrose and pelleted by centrifugation at 18,000 revolutions per minute for 60 minutes in a SW41 rotor at 4oC. The resulting pellet was then washed once with 10 mM tris of pH 7.5 to remove the signs of sucrose and finally resuspended in 10 M Tris pH 7.5. The SPV DNA was then extracted from the virions purified by lysis (4 hours at 6 [deg.] C.) was induced by the addition of EDTA, SDS and proteinase at the final concentrations of 20 mM of 0.5% and 0.5 mg / ml, respectively. After digestion, three extractions of phenol: chloroform (1: 1) were conducted and the sample precipitated by the addition of two volumes of absolute ethanol and incubation at -20 ° C for 30 minutes. The sample was then centrifuged in an Eppendorf minifuge for 5 minutes at full speed. The supernatant was decanted, and the air pellet was dried and rehydrated in 0.01 M Tris pH 7.5, 1MM EDTA at 4oC.

PREPARATION OF INFECTED CELL LISTS. For the preparation, the serum-free medium was used. A confluent monolayer of cells (EMSK, ESK-4, PK-15 or Vero for SPV or VERO for PRV) in a 25 cm2 bottle or a 60 mm petri dish were infected with 100 μl of the virus sample. After the cytopathic effect was completed, the medium and cells were harvested and the cells pelleted at 3,000 revolutions per minute for 5 minutes in a clinical centrifuge. The cell pellet was resuspended in 250 μl of the interruption buffer (2% sodium dodecyl sulfate, 2% 3-mercaptoethanol). The samples were sonicated for 30 seconds on ice and stored at -20 ° C.

WEST STAIN PROCEDURE. The samples of lysates and protein standards were run on a polyacrylamide gel according to the procedure Laemnli (1970). After gel electrophoresis the proteins were transferred and processed according to Sambrook and others (1982). The primary antibody or pig anti-PRV serum (Shope strain, lot370, PRV8201, NVSL, Ames, IA) was diluted in 1: 100 with 5% fat-free dry milk in a Tris-sodium chloride, and Sodium Azide (TSA: 6.61g Tris-HCl, 0.97 Tris-base, 9. 0g NaCl, and 2. Og Sodium Azide per liter H20). The secondary antibody was an anticorheal alkaline phosphatase conjugate diluted 1: 1000 with TSA.

BIOLOGICAL MOLECULAR TECHNIQUES. Techniques for the manipulation of bacteria and DNA, including such procedures as restriction endonuclease digestion, gel electrophoresis, gel DNA extraction, ligation, phosphorylation with kinase, phosphatase treatment, growth of bacterial cultures, transformation of bacteria with DNA, and other molecular biological methods are described by Maniatis et al. (1982) and Sambroo, et al. (1989). Except as noted, these were used with a smaller variation.

DNA SEQUENCE. The sequence was carried out using the kit of Sequenase Kit and 35S-dATP (NEN). The reactions using both dGTP mixtures and the dITP mixtures were carried out to clarify areas of compression. Alternatively, the compressed areas were resolved on formamide gels. The hardened ones were subclones of double strain plasmid or M13 subclones of single strain, and the primers were either made for the vector just outside the insert to be sequenced or for the previously obtained sequence. The obtained sequence was assembled and compared using the Dnaster program. The manipulation and comparison of the sequences obtained was carried out with the programs Superelone ** "03 and Supersee" 3103 of Coral Software.

CLONING WITH THE REACTION OF POLYMERASE CHAIN. the polymerase chain reaction (PCR) was used to introduce convenient restriction sites for the manipulation of several DNAs. The procedures used are described by Innis et al. (1990). In general, the amplified fragments were less than 500 base pairs in size and critical regions of amplified fragments were confirmed by the DNA sequence. The primers used in each case are detailed in the descriptions of the constructions of the homology vectors given below.

HOMOLOGO RECOMBINATION PROCEDURE TO GENERATE A RECOMBINANT SPV. This method relies on the homologous recombination between pig pustular disease virus DNA and the plasmid DNA homology vector that occurs in tissue culture cells containing both the pig pustular disease virus DNA and the pig vector. homology of transfected plasmid. For homologous recombination to occur, monolayers of EMSK cells were infected with S-SPV-001 (Kasza strain SPV, 17) at a multiplicity of infection of 0.01 PFU / cell to introduce duplicating SPV (for example DNA synthesis) in the cells. - The plasmid DNA homology vector is then transfected to these cells according to the transfection-infection procedure. The construction of the homology vectors used in this procedure is described below.

INFECTION PROCEDURE- RANSFECTION. The 6 cm plates of EMSK cells (about 80% confluent) were infected with S-SPV-001 at a multiplicity of infection of 0.01 PFU / cell in a negative medium of EMSK and incubated at 37 ° C in a C02 environment of 5% humidified for 5 hours. The transfection procedure used is essentially that recommended for Lipofectin * 43 ^ 3 Reagent (BRL). Briefly, for each 6 cm plate, 15 μg of plasmid DNA was diluted to 100 μl with H20. Separately, 50 micrograms of Lipofectin Reagent was diluted to 100 μl with H20. The 100 μl of the diluted Lipofectin Reagent was added dropwise to the diluted plasmid DNA in a 5 ml cap tube of polystyrene and mixed gently. The mixture was then incubated for 15-20 minutes at room temperature. During this time, the virus inoculation was removed from the 6 cm plates and the cell monolayers were washed once with the EMSK negative medium.Three ml of the negative EMSK medium was then added to the plasmid DNA / lipofectin mixture and the contents The cells were incubated overnight (for about 16 hours) at 37 ° C in a humidified 5% C02 environment, and on the day the 3 ml negative EMSK medium was treated. The cells were then incubated at 37 ° C in 5% C02 for 3-7 days until the cytopathic effect of the virus was 80-100%. described above for the preparation of virus supplies This supply was mentioned as a transfection supply and was subsequently analyzed for the recombinant virus by BLUOGAL ANALYSIS FOR PULMONARY VIRUS RECOMBINANT PESTULOSA OR CP ANALYSIS RG FOR VIRUS OF PENDULOSA DISEASE OF RECOMBINANT PIG.

RECOMBINANT SPV ANALYSIS EXPRESSING jS-galactosidase (GLUOGAL ESSAYS AND CPRG). When the E. coli (lacZ) -galactosidase marker gene was incorporated into a recombinant virus, the plates containing the recombinants were visualized by one of two simple methods. In the first method, the chemical BluogalMaroa (Bethesda Research Laboratory) was incorporated (200 μg / ml) into the agarose during the plaque examination, and the active / 3-galactosidase expressing plaques turned blue. The blue plates were then taken on fresh cells (EMSK) and purified by additional blue plate isolation. In the second method, the CPRG (Boehringer Mannheim) was incorporated (400 μg / ml) into the agarose overlay during the plaque assay, and the active / 3-galactosidase expressing plaques became red. The red plates were then taken on fresh cells (EMSK) and purified by additional red plate isolation. In both cases the viruses were typically purified with three rounds of plaque purification.

EXAMINATION REGARDING EXPRESSION OF GENE OUTSIDE IN SPV RECOMBINANT USING BLACK PLATE TESTS. To analyze the expression of foreign antigens expressed by recombinant pig pustular disease viruses, monolayers of EMSK cells were infected with recombinant SPV, overlaid with a nutrient agarose medium and incubated for 6-7 days at 37 ° C. C for plaque development to occur.

The overlapping of agarose was then removed from the dish, the cells were fixed with 100% methanol for 10 minutes at room temperature and the cells were air-dried. The binding of the cells resulted in cytoplasmic antigen as well as the detection of surface antigen while the expression of surface-specific antigen can be detected using non-fixed cells. The primary antibody was then diluted to the appropriate dilution with PBS and incubated on the cell monolayer for 2 hours at room temperature. To detect the PRV g50 (gD) expression of S-SPV-008, the anti-PRV serum (strain Shope; lot370, PDV8201, NVSL, Ames, IA) was used (diluted 1: 100). to detect the NDV HN expression of S-SPV-009, a rabbit antiserum specific for the HN protein (rabbit anti-NDV # 2) was used (diluted 1: 1000). The unbound antibody was then removed by washing the cells three times with PBS at room temperature. The secondary antibody, either a goat anti-mouse (PRV-g50 (gD); S-SPV-008) or a goat anti-rabbit (NDV HN; S-SPV-009), peroxidase of strong conjugated root was diluted 1 : 250 with PBS and incubated with the cells for 2 hours at room temperature. The disunited secondary antibody was then removed by washing the cells three times with PBS at room temperature. The cells were then incubated 15-30 minutes at room temperature with a freshly prepared substrate solution (100 μg / ml 4-chloro-l-naphthol, 0.003% H202 in PBS). The plates expressed the black spot of the correct antigen).

PROCEDURE FOR THE PURIFICATION OF VIRAL GLICOPROTEINS TO BE USED AS DIAGNOSTICS. The viral glycoproteins are purified using antibody affinity columns. To produce monoclonal antibodies, BALB / c female mice 8 to 10 weeks old are vaccinated intraperitoneally seven times at 2 to four weeks intervals with 10 'PFU of S-SPV-009, -014, -016, -017 , -018 or -019. Three weeks after the last vaccine, the mice are injected intraperitoneally with -40 mg of the corresponding viral glycoprotein. The vessels of the -ratons are removed after three days of the last dose of antigen.

The splenocytes are fused with the mouse NS1 / Ag4 plasmacytoma cells by the modified procedure of Oi and Herzenberg, (41). Splenocytes and plasmacytoma cells are pelleted together by centrifugation to 300 x g for 10 minutes. One ml of 50% solution of the polyethylene glycol (molecular weight 1300-1600) was added to the cell pellet with stirring for one minute. Dulbecco's modified Eagle's medium (5ml) was added to the cells over three minutes. Cells are pelleted by centrifugation at 300 x g for 10 minutes and resuspended in medium containing 10% fetal bovine serum and containing 100 mM hypoxanthine., 0.4 mM aminopterin and 16 mM thymidine (HAT). Cells (100 ml) were added to the wells from eight to ten 96-well tissue culture plates containing 100 ml of normal vessel delivery layer cells and incubated at 37 ° C. The cells are fed a fresh HAT medium every three to four days.

The hybridoma culture supernatants are tested with the ELISA TEST in 96-well microconcentration plates coated with 100 ng of viral glycoprotein. The supernatants of the reactive hybridomas are further analyzed by black plate and West blot assay. The selected hybridomas are cloned twice by limiting dilution. The acetic fluid is produced by intraperitoneal injection of 5 x 10 6 hybridoma cells in treated-pristine BALB / c mice.

The cell lysates of S-SPV-009, -014, -016, -017, -018, or -019 are obtained as described in PREPARATION OF INFECTED CELL LISTS. Cell lysates containing glycoprotein (100 mis) were passed through a 2-ml affinity resin agarose to which 20 mg of monoclonal antibody glycoprotein had been immobilized according to the manufacturer's instructions (AFC Medium, New Brunswick Scientific, Edison, N.J.). The column was washed with 100 ml of 0.1% Nonidet P-40 in a salt water buffered with phosphate (PBS) to remove the non-specifically bound material.

The bound glycoprotein is eluted with 100 mM carbonate buffer, pH 10.6 (40). The pre- and post-enumerated fractions are monitored for purity by reactivity to the SPV monoclonal antibodies in the ELISA system.

ESSAY ELISA. An enzyme-linked immunosorbent assay (ELISA) protocol was used to determine the immune status of cattle after vaccination and challenge.

A solution of glycoprotein antigen (100 ml to ng / ml in PBS) was allowed to be absorbed in the wells of the microconcentration dishes for 18 hours at 4 ° C. The coated wells were rinsed once with PBS. The wells are blocked by adding 250 ml of PBS containing 1% BSA (Sigma) and incubated 1 hour at 37 < > C. The blocked wells are rinsed once with PBS containing Q.02% Tween 20. 50 ml of the test serum (previously diluted 1: 2 in PBS containing 1% BSA) was added to the wells and incubated one hour at 37 ° c. The antiserum was removed and the wells were washed three times with PBS containing 0.02% Tween 20. 50 ml of a solution containing the strong anti-peroxidase IgG anti-peroxidase (diluted 1: 500 in PBS containing 1% BSA, Kirkegaard and Perry Laboratories, Inc.) was added to visualize the wells containing the antibody against the specific antigen. The solution was incubated for one hour at 37 ° C, then removed and the wells were washed three times with PBS containing 0.02% Tween 20. 100 ml of the substrate solution (ATBS, Kirkegaard and Perry Laboratories, Inc.) were added to each well and color was allowed to develop for 500 minutes. the reaction was terminated by the addition of 0.1M oxalic acid. The color is read at the absorbance of 410 nm on an automatic plate reader.

STRATEGY FOR THE CONSTRUCTION OF VIRAL PROMOTERS OF PENTULOSE SYNTHETIC DISEASE. For recombinant pig pustular disease vectors, synthetic pustular disease promoters offer several advantages including the ability to control the resistance and timing of foreign gene expression. Three promoter cassettes LP1, EP1 and LP2, based on promoters that have been defined in the vaccine virus (1, 7 and 8) were designated. Each cassette was designed to contain the DNA sequences defined in the flanked vaccine by restriction sites which can be used to combine the cassettes in any order or combination. The initiator methionines were also designed in each cassette so that framework fusions can be made in either the EcoRI or BamHl sites. A set of translational stop codons in all three reading frames and an initial transcriptional termination signal (9) were also designed downstream from the inner frame fusion site. The DNA encoding each cassette was synthesized according to standard techniques and cloned into the appropriate homology vectors (see Figures 3 and 4).

VACCINATION STUDIES IN DISEASE VIRUSES RECOMBINANT PORK PULPOSE CONTAINING GENES OF GLYCOPROTEIN OF VIRUS OF PSEUDORRABIA. Young weaned pigs from a pseudorabies free herd were used to test the efficacy of the recombinant pig pustular disease virus containing one or more of the pseudorabies virus glycoprotein genes (SPV / PRV). The piglets were inoculated intramuscularly, intradermally or orally around 103"to 107 units formador plates (PFU) of the recombinant SPV / PRV viruses.

Immunity was determined by measuring the PRV serum antibody levels and challenge of the pigs vaccinated with the virulent strain of pseudorrabi virus. Three to four weeks after vaccination, both vaccinated and unvaccinated groups of pigs were challenged with the virulent strain of pseudorabies virus (VDL4892) After the challenge, pigs were observed daily for 14 days for clinical signs of pseudorabies. .

Serum samples were obtained at the time of vaccination, challenge and weekly intervals two to three weeks after vaccination and assay for neutralizing antibody serum.

CLONING OF VIRUS GENES g48 and g53 OF BOVINE VIRAL DIARRHEA. The g48 and g53 genes of bovine viral diarrhea were cloned by a PCR CLONING procedure as described by Katz et al. (42) for the HA gene of human influenza. Viral RNA prepared from the Singer strain of BVD virus cultured in Madin-Darby bovine kidney cells (MDBK) was first converted to cDNA "using an oligonucleotide primer specific for the target gene.The cDNA was then used as a template for Polymerase chain reaction (PCR) cloning (15) from the target region PCR primers were designed to incorporate the restriction sites which allowed the cloning of the amplified coding regions into vectors containing the appropriate signals expression in SPV A pair of oligonucleotides were required for each coding region The g48 gene coding region of the Singer strain BVDV (49) was cloned using the following primers: 5 '-ACGTCGGATCCCTTACCAAACCACGTCTTACTCTTGTTTTCC-3' for primed cDNA and combined with 5 '-ACATAGGATCCCATGGGAGAAAACATAACACAGTGGAACC-3' for PCR The coding region of the g53 gene of the Singe strain r BVDV (49) was cloned using the following primers: 5'-CGTGGATCCTCAATTACAAGAGGTATCGTCTAC-3 'for primed cDNA and combined with 5' -CATAGATCTTGTGGTGCTGTCCGACTTCGCA-3 'for PCR. Note that this general strategy was used to clone the coding region of the g48 and g53 genes of other BVDV strains. The DNA fragment for BVDV g48 was digested with BamHl to give a 678 bp fragment. The DNA fragment for BVDV g53 was digested with Bgl11 and Ba Hl to give a fragment of 1187 bp. BVDV g48 or g53 DNA fragments were cloned into the BamH1 site for the LP2EP2 promoter of the SPV homology vector to give the homology vectors 727-78.1 and 738-96, respectively.

CLONING OF A "FUSION OF BOVINE RESPIRATORY SINSIAL VIRUSES, NUCLEOCAPSID GENES AND GLICOPROTEIN The fusion genes of respiratory synovial virus (F), nucleocapsid (N), and glycoprotein (G) were cloned by a PCR cloning procedure essentially as described by Katz et al. (42) for the HA gene of human influenza Viral RNA prepared from the BRSV virus cultured in bovine nasal turbinate (BT) cells were first converted to cDNA using a specific oligonucleotide primer for the target gene .. The cDNA was then used as a template for the cloning of the polymerase chain reaction (PCR) (15) of the target region.The PCR primers were designed to incorporate the restriction sites which allow the cloning of the coding regions amplified in vectors containing the appropriate signals for the SPV expression. A pair of oligonucleotides were required for each coding region. The F-gene coding region of strain BRSV 375 (VR-1339) was cloned using the following primers: 5 '-TGCAGGATCCTCATTTACTAAAGGAAAGATTGTTGAT-3' for cDNA priming and combined with 5 '-CTCTGGATCCTACAGCCATGAGGATGATCATCAGC-3' for PCR. The N gene coding region of strain BRSV 375 (VR-1339) was cloned using the following primers: 5'-CGTCGGATCCCTCACAGTTCCACATCATTGTCTTTGGGAT-3 'for cDNA priming and combined with 5' -CTTAGGATCCCATGGCTCTTAGCAAGGTCAAACTAAATGAC-3 'for PCR. The coding region of the G gene of strain 375 BRSV (VR-1339) was cloned using the following primers: 5'-CGTTGGATCCCTAGATCTGTGTAGTTGATTGATTTGTGTGA-3 'for the cDNA i m p r i m a d and c o m b i n a n d o c o n 5' -CTCTGGATCCTCATACCCATCATCTTAAATTCAAGACATTA-3 'para-Í PCR. Note that the general strategy is used to clone the coding region of the F genes, N and G of other strains of BRSV. The DNA fragments for BRSV F, N, or G were digested with BamHl to give 1722 bp, 1173 bp, or 771 bp fragments, respectively;; The BRSV F, N and G DNA fragments were cloned into the BamH1 site near the LP2EP2 promoter of the SPV homology vector to give homology vectors, 727-20.10 ', 7X3-55.37 and 727-20.5, respectively.

RNA ISOLATED FROM CONCANAVALINA STIMULATED CHICKEN SQUASH CELLS. The 3-week SPAFAS hatched chick chicken spleens were dissected, washed, and disrupted via syringe / needle to release the cells. After allowing the stroma and the debris to settle, the cells were pelleted and washed twice with PBS. The cell pellet was treated with a hypotonic lysis buffer to lyse red blood cells, and the splenosites were recovered and washed twice with PBS. The splenosites were resuspended in 5 x 10ß cells / ml in RPMI containing 5% FBS and 5 μg / ml concavalin A and incubated at 39 ° for 48 hours. Total RNA was isolated from the cells using guanidine isothioate lysing reagents and Promega RNA isolation kit protocols (Promega Corporation, Madison, Wisconsin). 4 μg of total RNA was used in each first strain reaction containing the copied antisense primers and the reverse transcriptase to AMV (Promega Corporation, Madison, Wisconsin). The cDNA synthesis was carried out in the same tube following the reverse transcriptase reaction, using the appropriate sense ® primers and DNA DNA polymerase (Life Technologies, Inc., Bethesda, Maryland).

EXAMINATION OF GENES ENZYMATIC MARKERS EXPRESSING RECOMBINANT HERP VIRUSES. When the β-glucuronidase marker gene E. coli (uidA) was incorporated into a recombinant virus the plates containing the recombinants were visualized by a simple assay. The enzyme substrate was incorporated (300 μg / ml) in the agarose overlay during the plaque assay. The substrate X-glucide Chx (5-bromo-4-chloro-3-indolyl-β-D-glucuronic acid cyclohexylammonium salt, BioSynth AG) was used for the uidA marker gene. Plates that expressed active marker enzyme turned blue. The blue plates were then taken on fresh ESK-4 cells and purified by additional blue plate isolation. In recombinant virus strategies in which the enzyme marker gene is removed, the assay involves the white plaque purification plates of a background of blue parental plaques. In both cases the viruses were typically purified with three rounds of plaque purification.

VECTOR OF HOMOLOGY 515-85.1. Plasmid 515-85.1 was constructed for the purpose of inserting foreign DNA into the SPV. It contains a unique Accl restriction enzyme site within which foreign DNA can be inserted. When a plasmid containing a foreign DNA insert in the Accl site was used according to the homologous recombination procedure to generate a recombinant SPV, a virus containing the foreign DNA will result. A restriction map of the DNA insert in the homology vector 515-85.1 is given in Figures 3A-3C. It can be constructed using standard recombinant DNA techniques (22 and 29) by joining two restriction fragments from the following sources. The first fragment is a restriction fragment of about 2972 base pairs HindIII to BamH1 of pSP 64 (Promega). The second fragment is a restriction subfragment of approximately 3,628 base pairs HindIII to BglII of the HindIII restriction M fragment of SPV (23).

VECTOR OF HOMOLOGY 520-17.5. Plasmid 520-17.5 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene of β-galactosidase E. coli (lacZ) flanked by SPV DNA. Upstream of the marker gene is a fragment of approximately 2149 base pairs of the SPV DNA. Downstream of the marker gene is a fragment of approximately 1484 base pairs of the SPV DNA. When this plasmid is used according to the homologous recombination procedure to generate the recombinant SPV, a virus containing the DNA encoded for the marker gene will be detected.Note that the β-galactosidase marker gene (lacZ ^ is under the control of a promoter) of "Early / Late Synthetic Pustular Disease A detailed description of the plasmid is given in Figures 3A-3C, which can be constructed using standard recombinant DNA techniques (22 and 30), by joining the restriction fragments of the following sources with the synthetic DNA sequences indicated in Figures 3A-3C. The vector of the plasmid was. derived from a "fragment" restriction of approximately 2972 base pairs HindIII to BamH1 from pSP64 (Promega). Fragment 1 is a subfragment of approximately 2149 base pairs of HindIII to Accl of the HindIII restriction M fragment of SPV (23). Fragment 2 is a restriction fragment of about 3006 base pairs BamH1 to PvuII of plasmid pJF751 (11). Fragment 3 is a restriction subfragment of approximately 1484 base pairs Accl to BglII of the M fragment of HindIII SPV (23).

VECTOR OF HOMOLOGY 538-46.16. Plasmid 538-46.16 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a β-galactosidase marker gene E. coli (lacZ) and the PRV g50 gene (gD) flanked by the SPV DNA. Upstream of the foreign genes is a fragment of approximately 2149 base pairs of SPV DNA. Downstream of foreign genes is a fragment of approximately 1484 base pairs of SPV DNA. When this plasmid is used according to the homologous recombination procedure to generate recombinant SPV, a virus containing the DNA encoded for the foreign genes will result. Note that the β-galactosidase marker gene (lacZ) is under the control of a synthetic late pustular disease (LP1) promoter and the g50 (gD) gene is under the control of the synthetic early / late pustular disease promoter (EP1LP2) . A detailed description of the plasmid is given in 3A-3C. This can be constructed using the standard recombinant DNA techniques (22 and 30) by joining the restriction fragments of the following sources with the synthetic DNA sequences indicated in Figures 3A-3C. The plasmid vector was derived from the restriction fragment of approximately 2972 base pairs HindIII to BamHl from pSP64 (Promega) Fragment 1 is a restriction subfragment of approximately 2149 base pairs HindIII to Accl of the HindIII restriction fragment m of SPV (23). Fragment 2 is a restriction fragment of about 3006 base pairs BamH1 to PvuII of plasmid pJF751 (11). Fragment 3 is a restriction subfragment of approximately 1571 base pairs E. cori to Stul fragment 7 of PRV BamHl. Note that the E. cori site was introduced into this fragment by PCR cloning. In this procedure, the primers described below were used together with an annealing consisting of the BamHl subfragment number 7 of PRV subcloned into pSP64. The first primer sites 87.03 (5 '-CGCGAATTCGCTCG CAGCGCTATTGGC-3') on the sequence of PRV g50 (gD) (26) at about three, amino acids primed towards the 3 'end of the gene. The second primer sites of 87.06 Í5 < -GTGGAGTGGCTGCTGAAG-3 ') on the opposite strain to approximately 174 amino acids by priming towards the 5' end of the gene. The PCR product can be digested with E. cori and Sali to produce a fragment of _5Q9 pairs, de-h > ase. The subfragment of approximately 1049 base pairs Exit to Stul of BamHL number 7 of the PRV can then be ligated to the approximately 509 base pair fragment E. cori to Sali to generate fragment 3 of approximately 1558 base pairs E. cori a Stul. Fragment 4 is a restriction subfragment of approximately 1484 base pairs Accl to BglII of the M-fragment of HindIII of SPV M (23).

VECTOR OF HOMOLOGY 570-91.41. Plasmid 570-91.41 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene of β-galactosidase E. coli (lacZ) and the gilí gene of PRV (gC) flanked by the SPV DNA. Upstream of the foreign DNA genes is a fragment of approximately 2149 base pairs of SPV DNA. Downstream of foreign genes is a fragment of approximately 1484 base pairs of SPV DNA. When this plasmid is used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV, a virus containing the DNA encoded for the foreign genes will result. Note that the β-galactosidase marker gene (lacZ) is under the control of a synthetic late pustular disease promoter (LP1) and the "gilí gene" (gO is under the control of the synthetic late "pustular disease promoter"). (EP1LP2) A detailed description of the plasmid is given in Figures 5A-5D, which can be constructed using the standard recombinant DNA techniques (22 and 30), by joining the restriction fragments <3e and the following 7 'sources with the synthetic DNA sequences indicated in Figures 5A-5D.The plasmid vector was derived from the restriction fragment of approximately 2979 base pairs HindIII to BamHl from pSP64 (Promega) Fragment 1 is a restriction subfragment of approximately 2484 base pairs BglII to Accl of the HindIII restriction M fragment of SPV (23). Fragment 2 is a restriction fragment of approximately 3002 base pairs BamH1 to PvuII of plasmid pJF751 (11). Fragment 3 is a fragment of approximately 2378 base pairs Ncol to Ncol of plasmid 251-41.A, a subfragment of BamHI # 2 and # 9 of PrV.

The EcoRI linkers have replaced the Ncol and Ncol sites at the ends of this fragment. Fragment 4 is a restriction subfragment of approximately 2149 base pairs Accl to HindIII of the M fragment of SPV HindIII (23). The Accl sites in fragments 1 and 4 have been converted to the PstI sites using synthetic DNA linkers.

VECTOR OF HOMOLOGY 570-91.64. Plasmid 570-91.64 was constructed "for the purpose of inserting foreign DNA into the SPV, which incorporates a β-galactoside EcoRI marker gene. (lacZ) and the gilí gene "de" PRV "(gC) flanked by SPV DNA.

Upstream of the foreign DNA genes is a fragment of approximately 1484 base pairs of the SPV DNA. Downstream of the foreign genes is a fragment of approximately 2149 base pairs of the DNA -SPV. When this plasmid is used according to the HOMOLOGOUS RECOMBINATION PROCEDURE TO GENERATE A RECOMBINANT SPV, a DNA containing a virus encoded for the foreign genes will be found. Note that the 3-galactosidase marker gene (lacZ) is under the control of the synthetic late pustular disease (LPl) promoter, and the gilí (gC) gene is under the control of the synthetic early / late pustular disease promoter (LP2EP2) . A detailed description of the plasmid is given in Figures 7A-7D. This can be constructed using standard DNA recombinant techniques (22 and 30) by joining the restriction fragments of the following sources with the synthetic DNA sequences indicated in 5A-5D. The plasmid vector was derived from a restriction fragment of approximately 2972 base pairs HindIII to BamH1 from pSP64 (Promega). Fragment 1 is a restriction sub-fragment of approximately 1484 base pairs of BglII to Accl of the M restriction fragment of HindIII SPV (23). Fragment 2 is a restriction fragment of about 3002 base pairs of BamHI to PvuII of plasmid pJF751 (11). Fragment 3 is a fragment of approximately 2378 base pairs Ncol to Ncol of plasmid 251-41. , a subfragment of BamHl # 2 and # 9 of PRV. The EcoRI linkers have replaced the Ncol and Ncol sites at the ends of this fragment. Fragment 4 is a restriction subfragment of approximately 2149 base pairs Accl to HindIII of the M HindIII subfragment of SPV (23). The Accl sites in fragments 1 and 4 have been converted to PstI sites using the synthetic DNA linkers.

VECTOR OF HOMOLOGY 727-54.60. Plasmid 727-54.60 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene for E. coli β-galactosidase (lacZ) and pseudorabies virus (PRV) gil (gB) flanked by SPV DNA. Upstream of the foreign genes is a fragment of approximately 1484 base pairs of the SPV DNA. Downstream of foreign genes is a fragment of approximately 2149 base pairs of SPV DNA. When the plasmid is used according to the HOMOLOGOUS RECOMBINATION PROCEDURE TO GENERATE RECOMBINANT SPV, a virus containing the DNA encoded for the foreign genes will result. Note that the β-galactosidase marker gene (lacZ) is under the control of the synthetic late pustular disease (LP1) promoter and the gV gene of PRV is under the control of the synthetic late / early pustular disease promoter (LP2EP2). A detailed description of the plasmid is given in Figures 7A-7D. This can be constructed using standard recombinant DNA techniques (22, 30), using joining the restriction fragments of the following sources with the synthetic DNA sequences indicated in Figures 7A-7D. The plasmid vector f e-derived from a restriction fragment of about 2979 base pairs HindIII to BamH1 from pSP64 (Promega). Fragment 1 is a restriction subfragment of BglII to Accl of approximately 1484 base pairs of the HindIII restriction M fragment of the SPV (23). Fragment 2 is a fragment of approximately 3500 base pairs which contains the coding sequences for the gV gene of the PRV within the Kpnl C fragment of the PRV DNA (21). Fragment 2 contains a synthetic fragment of approximately 53 base pairs containing the amino terminus of the gV gene of PRV, a fragment of approximately 78 base pairs from Smal to Nhel of the Kpnl C genomic fragment of PRV, and a fragment of approximately 3370 base pairs Nhel to EcoRI of the Kpnl C genomic fragment of the PRV (21). fragment 3 is a restriction fragment of about 3010 base pairs BamH1 to PvuIJ of plasmid pJF751 (11). Fragment 4 is a subfragment of approximately 2149 base pairs Accl to HindIII of the M fragment of HindIII from SPV. The Accl sites in fragments 1 and 4 were converted to the unique Notl sites • using the Notl linkers.

VECTOR OF HOMOLOGY 751.07.Al. Plasmid 751- 07.Al was used to insert the foreign DNA into the SPV. This incorporates a g n marker / 3-ga? Actsidase E.coli (lacZ) in the chicken interferon gene (cIFN) flanked by the SPV DNA. When this plasmid was used according to the PROCEDURE OF HOMOLOGO RECOMBINATION TO GENERATE RECOMBINANT SPV, - 'was a virus that contains DNA encoded for foreign genes. Note that the (β-galactosidase (lacZ) marker gene is under the control of the synthetic late pustular disease promoter (LP1) and the cIFN gene is under the control of a "promoter". late synthetic / early pustular disease (LP2EP2). The homology vector was "constructed using" standard recombinant DNA techniques (22 and 30) by joining the restriction fragments from the following sources with the appropriate synthetic DNA sequences. The plasmid vector was derived from a Restriction fragment of about 2972 base pairs HindIII to BamH1 of pSP64 (Promega). Fragment 1 is a restriction subfragment of approximately 1146 base pairs BglII to Accl of the M HindIII fragment of SPV (23). Fragment 2 is a fragment of approximately 577 base pairs EcoRI a BglII for the cIFN gene (54) derived by reverse transcription and the polymerase chain reaction (PCR) (Sambrook et al., 1989) of ISOLATED CONCAVALINE RNA A STIMULATED CHICKEN VESSEL CELLS. The antisense primer (6 / 94.13) used for reverse transcription and PCR was 5'- CGACGGATCCGAGGTGCGTTTGGGGCTAAGTGC-3 '(SEQUENCE ID NO: 211). The sense primer (6 / 94.12) used for the PCR was 5- CCACGGATCCAGCACAACGCCGAGTCCCACCATGGCT-3 '(SEQUENCE ID NO: 212). The Ba Hl fragment resulting from reverse transcription and PCR was a purified gel and was used as a template for a second PCR reaction to = introduce a unique EcoRI site at the 5 'end and a unique BglII site at the end 3*. The second-PCR reaction used the primer 6 / 94.22 (5'-CCACGAATTCGATGGCTGTGCCTGCAAGCCCACAG-3 '; SEQUENCE ID NO: 213) at the 5' end and the .imprimator 6 / 94.34 (5'-CGAAGATCTGAGGTGCGTTTGGGGCTAAGTGC-3 'SEQUENCE_ ID NO: 214) at the 3 'end to give a fragment of approximately 577 base pairs. The DNA fragment contained the coding sequence of the amino acid 1 to amino acid 193 of the chicken interferon protein (549 which includes a signal sequence of 31 amino acids at the amino terminus and 162 amino acids of the mature protein encoding the interferon The fragment 3 is a restriction fragment of approximately 3002 base pairs of BamHI to PvuII of the plasmid pJF751 (11) .Fragment 4 is a restriction subfragment of approximately 2156 base pairs Accl to HindIII of the restriction M fragment HindIII from SPV (23) The Accl site in the SPV homology vector was converted to a NotI site.

VECTOR OF HOMOLOGY 751-56.Al. Plasmid 751-56.Al was used to insert the foreign DNA into the SPV. This incorporates an E. coli / 3-galactosidase marker gel (lacZ) and the chicken myelomonocyte growth factor (cMGF) gene flanked by SPV DNA. When this plasmid was used according to the HOMOLOGO RECOMBINATION PROCEDURE TO GENERATE "RECOMBINANT" SPV, a virus containing DNA encoded for foreign genes was found.Note that the β-galactosidase (lacZ) marker gene is under the control of a promoter of synthetic late pustular disease (LPl) and the cMGR gene is under the control of a synthetic late / early pustular disease promoter (LP2EP2) .The homology vector was constructed using standard recombinant DNA techniques (22 and 30) by binding the restriction fragments from the following sources with the appropriate synthetic DNA sequences The plasmid vector was derived from a restriction fragment of approximately 2972 base pairs HindIII to BamH1 from pSP64 (Promega) .Fragment 1 is a restriction subfragment of approximately 1146 base pairs of BglII to Accl of the M HindIII fragment of the SPV (23) The fragment 2 is a fragment of approximately 640 base pairs EcoRI to BamH1 encoded for the cMGF gene (55) derived by reverse transcription and polymerase chain reaction (PCR) (Sambrook et al., 1989) of RNA ISOLATED FROM CONCAVALIN, STIMULATED CHICKEN SQUASH CELLS. The antisense primer (6 / 94.20) used for reverse transcription and PCR was 5'- CGCAGGATCCGGGGCGTCAGAGGCGGGCGAGGTG-3 '(SEQUENCE ID NO: 215). The sense primer (5 / 94.5) used for the PCR was 5'-GAGCGGATCCTGCAGGAGGAGACACAGAGCTG-3 '(SEQUENCE ID NO: 216). The BamHI fragment derived from the PCR was subcloned into a plasmid and used as a quench for a second PCR reaction using the primer 6 / 94.16 (5 '-GCGCGAATTCCATGTGCTGCCTCACCCCTGTG-3'; SEQUENCE ID NO: 217) at the 5 'end and the primer 6 / 94.20 (5'-CGCAGGATCCGGGGCGTCAGAGGCGGGCGAGGTG-3'; SEQUENCE ID NO: 218) at the 3 'end to give a fragment of approximately 640 base pairs. The "DNA-fragment" contains the sequence-decoding of the amino acid 1 to the amino acid 201 of the cMGF protein (55) which includes a signal sequence of 23 amino acids at the amino terminus and 178 amino acids of the mature protein coding cMGF: Fragment 3 is a restriction fragment of approximately 3002 base pairs BamH1 to Pvul1 of plasmid pJF751 (11) Fragment 4 is a restriction subfragment of approximately 2156 base pairs Accl to HindIII of M fragment of HindIII restriction SPV (23) The Accl site in the SPV homology vector was converted to a single Notl site.

VECTOR OF HOMOLOGY 752-22.1. Plasmid 752-22.1 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene jS-galactosidase E. coli (lacZ) flanked by the SPV DNA. Upstream of the foreign gene is a fragment of approximately 855 base pairs of the SPV DNA. Downstream of the foreign genes is a fragment of approximately 1113 base pairs of the SPV DNA. When the plasmid is used according to the HOMOLOGOUS RECOMBINATION PROCEDURE TO GENERATE RECOMBINANT SPV, a virus containing DNA encoded for the foreign genes was found. Note that the β-galactosidase marker gene (lacZ) is under the control of a promoter of the 01L gene of pig pustular disease virus. The vector of homology • obambi € n -. a contains: the synthetic late / early promoter (LP2EP2) into which a second foreign gene is inserted into a single site.BamHl, or EcoRI. A detailed description of the plasmid ': - s da. in Figures 10A-10EY This was constructed using standard recombinant DNA techniques (22, 30), by joining the restriction fragments of the following sources with the synthetic DNA sequences indicated in Figures 10A-10D-. The plasmid vector was. derived from a restriction fragment of about 2519 base pairs HindI-II to Sphl from pSP65 (Promega). Fragment 1 is a subfragment of approximately 855 base pairs of the HindIII restriction M fragment of SPV (23) synthesized by polymerase chain reaction using the primers DNA 5 '-GAAGCATGCCCGTTCTTATCAATAGTTTAGTCGAAAATA-3' and 5'-CATAAGATCTGGCATTGTGTTATTATACTAACAAAAATAAG-3 ' to produce a fragment of 855 base pairs with Sphl and BglII terminus. Fragment 2 is a fragment of 3002 base pairs of BamHI to PvuII derived from plasmid pJF751 (49) containing the lacZ E. coli gene. Fragment 3 is a subfragment of approximately 1113 base pairs of the M HindIII fragment of SPV synthesized by polymerase chain reaction using the primers 5 'DNA -CCGTAGTCGACAAAAGATCGACTTATTAATATGTATGGGATT-3' and 5'-GCCTGAAGCTTCTAGTACAGTATTTACGACTTTTGAAAT-3 'to produce a fragment of 1113 base pairs with Salí and HindIII ends.

VECTOR OF HOMOLOGY 752-29.33. The plasmid 759.33 : was built 'for the purpose of inserting the foreign DNA into the SPV. This incorporates a β-galactosidase marker gene E. coli ! (lac Z) and ung gene "type 1 equine herpesvirus: flanked by = the SPV DNA." Up-from the alien gene is a fragment of approximately 855 base pairs of the SPV DNA.

Downstream of the foreign genes is a fragment of approximately .113 base pairs of the SPV DNA. When the ! plasmid is used according to the HOMOLOGO RECOMBINATION PROCEDURE TO "GENERATE RECOMBINANT SPV, will result in a virus containing the DNA encoded for the foreign genes." Note that the β-galactosidase marker gene (lacZ) is under the control of the promoter of 01L gene of the pig pustular disease virus and the gB gene of EHV-1 is under the control of the late / early promoter (LP2EP2) .The gB gene cassette of the EHV-1 promoter LP2EP2 was inserted into the Notl site of the vector of homology 738-94.4 The homology vector 752-29.33 was constructed using standard recombinant DNA techniques (22, ), by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2519 base pairs HindIII to Sphl from pSP65 (Promega). Fragment I is a subfragment of approximately 855 base pairs of the HindIII M restriction fragment of SPV (23) synthesized by polymerase chain using primers 5 'DNA -GAAGCATGCCCGTTCTTATCAATAGTTTAGTCGAAAATA-3' and 5'-CATATGATCTGGCATTGTGTTATTATACTAACAAAAATAATAAG-3 'to produce a fragment of 855_- base pairs with the ends pHI- and GblII. Fragment 2 is a fragment of 3002 base pairs of BamHI to PvulI derived from plasmid pJF751 (49) "containing the lasZ gene E. coli .. Fragment 3 is the product of a PCR reaction (EcoRI to BamHl) and a restriction fragment (BamHl to Pmel) ligated together to give a gB gene EHV-1 which is a fragment EcoRI to Pmel of approximately 2941 base pairs 8979 amino acids) in length. The PCR fragment is a fragment of approximately 429.pairs of base having a synthetic site and EcoRI at the 5 'end of the gene and a natural BamHl site at the 3' end within the "a" fragment of BamHI of the genomic DNA. from EHV-1. The restriction fragment is a fragment of approximately 2512 base pairs of BamH1 to Pmel within the "I" fragment of BamHI of the genomic DNA of EHV-1. In the procedure for producing the 5 'end PCR fragment, the primers described below were used with an annealing consisting of the "a" and "i" fragments of BamHI from EHV-1.

The first priming 5 / 94.3 (5'-CGGAATTCCTCTGGTTCGCCGT-3 ') sits on the gB sequence of EHV-1 at amino acid number 2 and introduces an EcoRI site at the 5' end of the gB EHV-1 gene and a codon Start ATG. The second primer 5 / 94.4 (5 '-GACGGTGGATCCGGTAGGCGGT-3') sits on the gB sequence of EHV-1 at approximately 144 amino acids on the opposite strain to primer 5 / 94.3 and prints towards the 5 'end of the gene. The PCR product was digested with EcoRi and BamHl to: give a fragment of 429 base pairs in length corresponding to the 5 'end of the gB gene of EHV-1. Fragment 3 consists of - the products of the PCR reaction _ (EcoRi to BamH1) and the restriction fragment (BamH1 to Pmel) - taken together to give the gene "gB of? HV-i which is an EcoRI fragment. a Pmel of approximately 2941 base pairs (979 amino acids) in length Fragment 4 is a subfragment of approximately 1113 base pairs of the M HindIII fragment of SPV synthesized by polymerase chain reaction using primer or e -s DNA 5 '- CCGTAGTCGACAAAGATCGACTTATTAATATGTATGGGATT-3 'and 5'-GCCTGAAGCTTCTAGTACAGTATTTACGACTTTTGAAAT3' to produce a 1113 base pair fragment with SalI and HindIII ends.

VECTOR OF HOMOLOGY 746-94.1. Plasmid 746-94.1 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a ß-galactoside EcoRI marker gene (lacZ) and an infectious bovine rhinotracheitis virus E (gE) glycoprotein gene flanked by SPV DNA. Upstream of the foreign gene is a fragment of approximately 855 base pairs of the SPV DNA. Downstream of the foreign genes is a fragment of approximately 1113 base pairs of the SPV DNA. When the plasmid is used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV, a virus containing the DNA encoded for the foreign genes will result. Note that the β-galactosidase marker gene (lacZ) is under the control of a promoter of the 01L gene of pig pustular disease virus and the gE IBRV gene is under the control of the late / early promoter (-LP2EP2). This was constructed using standard recombinant DNA techniques (22, 30) by joining the restriction fragments of the following sources with the synthetic DNA sequences. A fragment of 1250 base pairs EcoRI to BamH1 encoded for amino acids 1 to 417 of the IBRV gE gene (lacking 15α amino acids of the carboxy terminal transmembrane region) "was inserted into the unique EcoRI and BamHl sites of the vector homology 752-22.1 (Figures 10A-10D) The 1250 base pair fragment EcoRI to BamHI was synthesized by polymerase chain reaction (15) using genomic DNA IBRV (Cooper) as an annealed and 10 / 94.23 primer ( 5'-GGGGAATTCAATGCAACCCACCGCGCCGCCCC-3 '; SEQUENCE ID NO: 219) at the 5' end of the gE gene of IBRV (amino acid 1) and the primer 10 / 94.22 (5'-GGGGGATCCTAGGGCGCGCCCGCCGGCTCGCT-3 '; SEQUENCE ID NO: 220) in amino acid 417 of the gE gene of IBRV.

VECTOR OF HOMOLOGY 767-67.3. Plasmid 767-67.3 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates an EcoRI β-galactosidase marker gene (lacZ) and a viral bovine diarrhea virus glycoprotein 53 gene (BVDV gp53) flanked by SPV DNA. Upstream of the foreign gene is a fragment of approximately 855 base pairs of the SPV DNA. "Down-the-stranger genes is a fragment of approximately 1113 base pairs of the SPV DNA." When the plasmids are used according to the HOMOLOGO RECOMBINATION PROCEDURE FOR "-" GENERATE "SPV" 'RECOMBINANT, will result a virus containing the DNA encoded for the foreign genes. Note that the β-galactosidase marker gene (lacZ) is under the control of a promoter of the 01L gene of pig pustular disease virus and the gp53 gene of BVDV is under the control of the late / early promoter (LP2EP2). This was constructed, using the standard recombinant DNA techniques (22, 30) by joining the restriction fragments of the following sources with the synthetic DNA sequences. A fragment of 1187 base pairs of BamHl encoded for gp53 of BVDV was inserted into the unique BAamHI sites of homology vector 752-22.1 (Figures 10A-10D). The 1187 base pair BamH1 fragment was synthesized by polymerase chain reaction (15) as described in the cloning of genes gp48 and gp53 of BOVINE VIRAL DIARRHEA VIRUS.

VECTOR OF HOMOLOGY 771-55.11. Plasmid 771-55.11 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a βRI-galactosidase marker gene from EcoRI (lacZ) and a bovine viral diarrhea virus glycoprotein 48 gene (BVDV gp48) flanked by SPV DNA. Upstream of the foreign gene is a fragment of approximately 855 base pairs of the SPV DNA. Towards -abaj-o of foreign genes -is a fragment of approximately 1113 base pairs of SPV DNA. When the plasmid is used according to the RECOMBINATION PROCEDURE. THE ENGINEER TO GENERATE THE RECOMBINANT SPV, a virus containing the DNA encoded for the foreign genes will result.Note that the β-galactosidase (lacZ) marker gene is under control of a 01L promoter of pig pustular disease virus and the gp48 gene of BVDV is under the control of the late / early promoter (LP2EP2). ^ This was constructed using the standard recombinant DNA techniques (22, 30) by the join the restriction fragments of the following sources with the synthetic DNA sequences A 678 base pair BamHl fragment encoded for the BVDV gp48 was inserted into the unique BamHl sites of the homology vector 752-22.1 (Figures 10A-10D). The 678 base pair BamHl fragment was synthesized by polymerase chain reaction (15) as described in the GENE CLONING gp48 AND gp53 OF VIRUSES BOVINE VIRAL DIARRHEA.

PLASMID 551-47.23. Plasmid 551-47.23 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates an ß-glucurinidase marker gene from EcoRI (ß-glu) under the control of a late / early pustular disease promoter (LP2EP2). This is useful for inserting the marker gene into the sites in the SPV genome to produce a recombinant pig pustular disease virus. This was constructed using standard recombinant DNA techniques (22, 30) by binding the restriction fragments from the following sources. "The plasmid vector was derived from a restriction fragment of approximately 3005 base pairs of HindIII from pSP65 (Promega) .Fragment 1 is a fragment of approximately 1823 base pairs EcoRI to Smal of the plasmid pRAJ260 (Clonetech) .Note that the "coRI and" Smal sites were introduced by PCR cloning. The plasmid "551-47.23 was used to" make the recombinant pustular disease viruses S-SPV-059, S-SPV- 060, S-SPV-061, and S-SPV-062.

VECTOR OF HOMOLOGY 779-94.31. Plasmid 779-94.31 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates an ß-galactosidase marker gene from EcoRI (lacZ) and a gB gene from pseudorabies virus (PRV) gB (gil) flanked by SPV DNA. Upstream of the foreign gene is a fragment of approximately 538 base pairs of the SPV DNA. Downstream of the foreign genes is a fragment of approximately 1180 base pairs of the SPV DNA. When the plasmid is used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV, a virus containing the DNA encoded for the foreign genes will result. Note that the β-galactosidase marker gene (lacZ) is under the control of a synthetic late pustular disease (LP1) promoter and the gV gene of PRV is under the control of the synthetic late / early pustular disease promoter (LP2EP2"- A detailed description of the plasmid is given in Figures 12A-12E, which was constructed using standard xecombinant DNA techniques (22, and 30), by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector was derived from a fragment of approximately 2986 base pairs HindIII to PstI from pSP64 (Promega) .Fragment 1 is a subfragment of approximately 542 base pairs HindIJI to BglII of the HindIII restriction fragment of the SPV. (2. 3) . Fragment 2 is a fragment of approximately 3500 base pairs which contains the coding sequence for the gV gene of the PRV within the C fragment of Kpnl of the genomic PRV DNA (21). Fragment 2 contains a synthetic fragment of approximately 53 base pairs containing the amino terminal of the gV gene of PRV; a fragment of approximately 78 base pairs Smal to the Nhel of the genomic fragment C of Kpnl of the PRV, and a fragment of approximately 3370 base pairs of Nhel to EcoRI of the genomic fragment C of Kpnl of PRV (21). Fragment 3 is a fragment of about 3010 base pairs 3010 base pairs BamHI to PVII of plasmid pJF751 (11). Fragment 4 is a subfragment of approximately 1180 base pairs of BglII to PstI of the M fragment of HindIII SPV. The BglII sites in fragments 1 and 4 were converted to the unique HindIII sites using the HindIII linkers. 5 VECTOR OF HOMOLOGY 789-41.7. Plasmid 789-41.7 was constructed "for the purpose of" inserting the foreign DNA e? the SPV. This incorporates an ß-galactosidase marker gene from EcoRI (lacZ) y_un.gen-de i / 1rus from "pseudorabia (PRV) 'gB (gil) and- the 10. gV gene from PRV (g50) flanked by" DNA from SPV. "-Hacia" above the foreign gene is a fragment of approximately 1484 base pairs of the SPV DNA. Downstream of foreign genes is a fragment of approximately 1560 base pairs of SPV DNA.

\ When the plasmid is used according to the PROCEDURE OF f 151 RECOMBINATION -HOMOLOGY TO -GENERATE RECOMBINANT SPV, i; a virus containing the DNA encoded for the foreign genes will result. Note that the β-galactosidase marker gene (lacZ) is under the control of a synthetic late pustular disease (LP1) promoter and the gV gene of PRV is under control of the synthetic late / early pustular disease promoter (LP2EP2), and the gD gene of PRV is under the control of a synthetic initial / late pustular disease promoter (EP1LP2). A detailed description of the plasmid is given in Figures 13A-13D.

This was constructed using standard recombinant DNA techniques (22, and 30), by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2979 base pairs HindIII to BamH1 from pSP64 (Promega). Fragment 1 is a subfragment of approximately 1484 base pairs BglII to Accl of the HindIII restriction M fragment of the SPV (23). Fragment 2 is a subfragment of approximately 1552 base pairs of the BamHI fragment # 7 del'PRV which contains the coding sequence for the PRV gD gene from amino acid 3 to amino acid 79. The EcoRI site and the start codon ATG translation are derived from the polyrase chain reaction using "a 5 'primer with an EcoRI site.The Stul site at the 3' end is normally within the 3 'gl gene of PRV to the PRV gD gene. Complete open reading frame beginning at the EcoRI site codes for 405 amino acids.Fragment 3 is a subfragment of approximately 48 base pairs Accl to Ndel of the HindIII SPV fragment.? fragment 4 is a fragment of approximately 3500 base pairs which contains the coding sequence for the PRV gB gene within the Kpnl fragment of genomic PRV DNA (21) .Fragment 4 contains a synthetic fragment of approximately 53 base pairs containing the amino terminal of the gB PRV gene, or a fragment of approximately 78 base pairs Smal to Nhel of the Kpnl C genomic fragment of the PRV, and a fragment of approximately 3370 base pairs Nhel to EcoRI from the genomic fragment C Kpnl of PRV (21). Fragment 5 is a fragment of about 3010 base pairs of BamHI to PvulI of plasmid pJF751 (11). Fragment 6 is a subfragment of approximately 1560 base pairs of Ndel to HindIII of the M HindIII fragment of the SPV. The Accl sites in fragments 1 and 3 were converted to the PstI sites using the PstI linkers. The Ndel sites in fragments 3 and 6 were converted to the unique HindIII sites using the HindIII linkers. A subfragment of approximately 545 base pairs Ndel to Ndel (Nucleotides 1560 to 2104) of the M HindIII fragment of the SPV has been deleted which will expand the SPV 3 and 6 fragments.

VECTOR OF HOMOLOGY 789-41.27. Plasmid 789-41.27 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a ß-galactosidase marker gene EcoRI (lacZ) the pseudorabies virus (PRV) gene gB (gil) and the gV gene of PRV (gilí) flanked by the SPV _DNA. Upstream of the foreign genes is a fragment of approximately 1560 base pairs of the SPV DNA. Downstream of foreign genes is a fragment of approximately 1484 base pairs of SPV DNA. When the plasmid is used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV, a virus containing the DNA encoded for the foreign genes will result. Note that the β-galactosidase marker gene (lacZ) is under the control of a synthetic late pustular disease (LP1) promoter, the gV gene of PRV is under the control of the synthetic late / early pustular disease promoter (LP2EP2), and the gV gene of PRV is under the control of a synthetic initial / late pustular disease promoter (EP1LP2). A detailed description of the plasmid is given in Figures 14A-14D. This was constructed using standard recombinant DNA techniques (22, and 30), by joining the restriction fragments of the following sources with the indicated synthetic DNA sequences. The plasmid vector was derived from a fragment of approximately 2972 base pairs HindIII to BamH1"de-pSP64. (Próméga) - Fragment 1 is a" subfragment of approximately 1560 base pairs to HindIII to Ndel fragment M HindIII SPV. Fragment 2 is a fragment of approximately 3500 base pairs which contains the coding sequence for the gV gene of the PRV within the C Kpnl fragment of the genomic PRV DNA (21). Fragment 2 contains a fragment of about 53 synthetic base pairs containing the term aminp of the gV gene of the PRV, a fragment of approximately 78 base pairs - Smal to Nhil of the Kpnl genomic fragment. C: PRV, and a fragment of approximately 3370 base pairs of Nhel to EcoRI of the Kpnl C genomic fragment of PRV (21). Fragment 3 is a restriction fragment of about 3010 base pairs of BamHI to PvuII of plasmid pJF751 (11). Fragment 4 is a subfragment of approximately 48 base pairs Accl to Ndel of the M HindIII fragment of the SPV. The S fragment is a fragment of approximately 2378 base pairs Ncol to Ncol of plasmid 251-41.A, a subfragment of BamHI # 2 and # 9 of the PRV. The EcoRI linkers have replaced the Ncol sites at the ends of the fragment. Fragment 6 is a restriction subfragment of approximately 1484 base pairs Accl to BglII of the HindIII restriction M fragment of the SPV (23). The Ndel sites in fragments 1 and 2 were converted to the unique HindIII sites using the HindIII linkers. The Accl site in fragments 4 and 6 were converted to the unique PstI sites using the PstI linkers. A subfragment of approximately 545 base pairs Ndel to Ndel (Nucieotides 1560 to 2104) "of the" M HindIII fragment of the SPV has been deleted which will reach the SPV fragments 4 and 6. - - VECTOR OF HOMOLOGY 789-41.47. Plasmid 789-41.47 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates an ß-galactosidase marker gene from EcoRI (lacZ), the gC gene from pseudoralSia virus (PRV) (gilí) and the gD gene from PRV (g50) flanked by 'Sí'V DNA. Upstream of the foreign gene is a fragment of approximately 1484 base pairs of the SPV DNA.Under the foreign genes is a fragment of approximately 1560 base pairs of the SPV DNA.When the plasmid is used according to the PROCEDURE OF RECOMBINATION HOMOLOGOUS TO GENERATE RECOMBINANT SPV, will be a virus containing DNA encoded for foreign genes.Note that the marker gene of β-galactosidase (lacZ) is under the control of a promoter of synthetic late pustular disease (LPl) and the gene PRV gC is under the control of the synthetic initial / late pustular disease promoter (EP1LP2), and the gV gene of PRV is under the control of a synthetic initial / late pustular disease promoter (EP1LP2) .A detailed description of the plasmid is Figure 15A-15D, this was constructed using the standard recombinant DNA techniques (22, and 30), by joining the restriction fragments from the following source s with the synthetic DNA sequences. The plasmid vector was derived from a fragment of approximately 2972 base pairs HlndT ?? "- to BámHI of pSPé4 (Promega). Fragment 1 is a restriction subfragment of approximately 1484 base pairs BglII to Accl fragment M of HindIII restriction of SPV (23) Fragment 2 is a subfragment of approximately 1552 base pairs of the BamHI fragment # 7 of the PRV which contains the coding sequence for the PRV gD gene from amino acid 3 to amino acid 279. EcoRI site and the initiation codon, translational ATG are derived from the "polymerase chain reaction using a 5 'primer with an EcoRI site." The Stul-e site "the 3' end is normally within the gene 3 'gl from PRV to PRV gD gene The complete open reading frame starting at the EcoRI site codes for 405 amino acids.Fragment 3 is a subfragment of approximately 48 base pairs Accl to Ndel of the M fragment HindIII SPV. 4 is a fragment of restriction of approximately 3010 base pairs BamH1 to PvuII of plasmid pJF751 (11). Fragment 5 is a fragment of about 2378 base pairs Ncol to Ncol of plasmid 251-41.A, a subfragment of BamHI # 2 and # 9 of PRV. The EcoRI linkers have replaced the Ncol sites at the ends of the fragment.

Fragment 6 is a subfragment of approximately 1560 base pairs of Ndel to HindIII of the M HindIII fragment of the SPV. The Accl sites in fragments 1 and 3 were converted to the unique PstI sites using the PstI linkers. The Ndel sites in fragments 3 and 6 were converted to the unique HindIII sites using the HindIII linkers. A subfragment of approximately 545 base pairs - Ndel 'to Ndel (Nucleotides 1560 to 2104) of the M HindIII fragment of the SPV has been deleted which would be extended to the SPV 3 and 6 fragments.

VECTOR OF HOMOLOGY 789-41.73. Plasmid 789-41.73 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates an ß-galactosidase marker gene from EcoRI (lacZ), the gC gene from the. pseudorabia (PRV) (gilí) and the jV gene of PRV (g50) flanked by SPV DNA. Upstream of the foreign gene is a fragment of approximately 1484 base pairs of the SPV DNA. Downstream of foreign genes is a fragment of approximately 1560 base pairs of SPV DNA. When the plasmid is used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV, a virus containing the DNA encoded for the foreign genes will result. Note that the β-galactosidase marker gene (lacZ) is under the control of a synthetic late pustular disease (LP1) promoter and the gV gene of PRV is under the control of the synthetic initial / late pustular disease promoter (EP1LP2), and the gV gene of PRV is under the control of a late / initial synthetic pustular disease promoter (LP2EP2). A detailed description of the plasmid is given in Figures 16A-16D. This was constructed using the standard recombinant DNA techniques (22, and 30), by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector was derived from a fragment of approximately 297.2.pairs of basal HindIII to BamH1 from pSP64 (Promega). Fragment 1 is a restriction subfragment of approximately 1484 base pairs -BglII to Accl of the M fragment, of HindIII restriction. of -SPV (23). Fragment 2 is a i subfragment of approximately 1552 base pairs of the BamHI fragment # 7 of the PRV which contains the coding sequence for the gD gene of PRV from amino acid 3 to amino acid 279.! | The EcoRI site and the ATG translation start codon are derived from the polymerase chain reaction using a 5 'primer with an EcoRI site.The Stul site at the 3' end is normally within the 3 'gl gene of the PRV at PRV gene gD The complete open reading frame beginning at the EcoRI site codes for 405 amino acids.Fragment 3 is a subfragment of approximately 2378 base pairs Ncol to Ncol from plasmid 251-41.A, a subfragment of BamHl # 2 and # 9 of the PRV.The EcoRI linkers have replaced the Ncol sites at the ends of the fragment.Fragment 4 is a subfragment of approximately 48 base pairs Accl to Ndel of the M fragment of HindIII SPV.Fragment 5 is a fragment of approximately 3500 base pairs which contains the coding sequence for the gV gene of the PRV within the Kpnl fragment C of the genomic PRV DNA (21) The fragment 5 contains a synthetic fragment of approximately 53 base pairs which is it contains the amino terminus of the gV gene of PRV, a fragment of approximately 78 base pairs from Smal to Nhel of the genomic fragment C Kpnl of PRV, and a fragment of approximately 3370 base pairs from Nhel to EcoRI of the genomic fragment "C Kpnl PRV (21). Fragment 6 is a restriction fragment of about 3010 base pairs of BamHI to PvuII "of plasmid pJF751 (11) .The fragment - of about 1560 base pairs of Ndel to HindIII of the M HindIII fragment of the SPV. fragments 1 and 3 were converted to the unique PstI sites using the PstI linkers.The Ndel sites in fragments 3 and 6 were converted to the unique HindIII sites using the HindIII linkers. "A subfragment of approximately 545- base pairs Ndel Ndel (Nucleotides 1560 to 2104) "of the M HindIII fragment of the SPV has been deleted which would be extended to the SPV 3 and 6 fragments.

VECTOR OF HOMOLOGY 791-63.19. Plasmid 791-63.19 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a β-galactosidase marker gene from EcoRI (lacZ) flanked by the SPV DNA. Upstream of the foreign gene is a fragment of approximately 1484 base pairs of the SPV DNA. Down the foreign genes is a fragment of approximately 2149 base pairs of the SPV DNA. When the plasmid is used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV, a virus containing the DNA encoded for the foreign genes will result. Note that the β-galactosidase marker gene (lacZ) is under the control of a synthetic late pustular disease (LP1) promoter. This was constructed using the standard recombinant DNA techniques (22, and 30), by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2972 base pairs HindIII to BamH1 from pSP64 (Promega) Fragment 1 is a restriction subfragment of approximately 1484 base pairs BglII to Accl of the HindIII restriction M fragment of the SPV (23). Fragment 2 is a restriction fragment of about 3010 base pairs BamH1 to PvuII of plasmid pJF751 (11). Fragment 3 is a subfragment of approximately 2149 base pairs Accl to HindIII of the M HindIII fragment of SPV. The Accl sites in fragments 1 and 3 were converted to the unique Notl sites using the Notl linkers.

VECTOR OF HOMOLOGY 791-63.41. Plasmid 791-63.41 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a β-galactosidase marker gene from EcoRI (lacZ) flanked by the SPV DNA. Upstream of the foreign gene is a fragment of approximately 1484 base pairs of the SPV DNA. Down the foreign genes is a fragment of approximately 2149 base pairs of the SPV DNA. When the plasmid is used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV, a virus containing the DNA encoded for the foreign genes will result. Note that the β-galactosidase marker gene (lacZ) is under the control of a synthetic late pustular disease (LP2) promoter. This was constructed using the standard recombinant DNA techniques (22, and 30), by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2972 base pairs HindIII to BamH1 from pSP64 (Promega) Fragment 1 is a restriction subfragment of approximately 1484 base pairs BglII to Accl of the HindIII restriction M fragment of the SPV (23). Fragment 2 is a restriction fragment of about 3010 base pairs BamHI to PvulI of plasmid pJF751 (11). Fragment 3 is a subfragment of approximately 2149 base pairs Accl to HindIII of the M HindIII fragment of SPV. The Accl sites in fragments 1 and 3 were converted to the unique Notl sites using the Notl linkers.

VECTOR OF HOMOLOGY 796-18.9. Plasmid 796-18.9 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a β-galactosidase marker gene from EcoRI (lacZ) flanked by the SPV DNA. Upstream of the foreign gene is a fragment of approximately 1484 base pairs of the SPV DNA. Down the foreign genes is a fragment of approximately 2149 base pairs of the SPV DNA. When the plasmid is used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV, a virus containing the DNA encoded for the foreign genes will result. Note that the β-galactosidase marker gene (lacZ) is under the control of a synthetic initial pustular disease promoter (EP1). This was constructed using standard recombinant DNA techniques (22, and 30), by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2972 base pairs HindIII to BamH1 from pSP64 (Promega). Fragment 1 is a restriction subfragment of about 1484 base pairs BglII to Accl of the restriction M: fragment: HindIII of the SPV (23) .. a_.El, fragment 2 is a restriction fragment of approximately 3010 base pairs BamHl to PvuII of plasmid pJF751 (11). Fragment 3 is a subfragment of approximately 2149 base pairs Accl to HindIII of the M HindIII fragment of SPV. The Accl sites in fragments 1 and 3 were converted to the unique Notl sites using the Notl linkers.

VECTOR OF HOMOLOGY 783-39.2. Plasmid 783-39.2 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates an E. coli β-galactosidase marker gene (lacZ) and a viral bovine diarrhea virus glycoprotein 53 gene (BVDV gp53) flanked by the SPV DNA. Upstream of the foreign gene is a fragment of approximately 1484 • base pairs of the SPV DNA. Downstream of foreign genes is a fragment of approximately 2149 base pairs of SPV DNA 5. When the plasmid is used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV, a virus containing the DNA encoded for the foreign genes will result. Note that the β-galactosidase marker gene (lacZ) is under the control of a late promoter (LP1) and the gp53 gene of BVDV is under the control of the initial / late promoter (LP2EP2). This was constructed using the standard recombinant DNA techniques (22, and 30), by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector was derived from a fragment restriction of approximately 2972 base pairs HindIII to BamHl from pSP64 (Promega). Fragment 1 is a restriction subfragment of approximately 1484 base pairs BglII to Accl of the HindIII restriction M fragment of the SPV (23). Fragment 2 is a fragment of approximately 1187 base pairs BamHl encoded for gp53 of BVDV. The 1187 base pair BamHI fragment was synthesized by the polymerase chain reaction (15) as described in CLONING OF BOVINE VIRAL DIARRHEA GENES gp48 and gp53. Fragment 3 is a fragment of approximately 3010 base pairs of BamHl a PvuII of plasmid pJF751 (11). Fragment 4 is a subfragment of approximately 2149 base pairs Accl to HindIII of the M HindIII fragment of SPV. The Accl sites in fragments 1 and 3 were converted to the unique Notl sites using the Notl linkers.

VECTOR OF HOMOLOGY 749-75.78. Plasmid 749-75.78 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a β-galactosidase marker gene from E. coli (lacZ) and the infectious bursal disease virus (IBDV) polymerase gene flanked by the SPV DNA. Toward above the foreign gene is a fragment of approximately 1484 base pairs of the SPV DNA. Down the foreign genes is a fragment of approximately 2149 base pairs of the SPV DNA. When the plasmid is used according to the RECOMBINATION PROCEDURE HOMOLOGOUS TO GENERATE RECOMBINANT SPV, will result in a virus containing the DNA encoded for the foreign genes. Note that the β-galactosidase marker gene (lacZ) is under the control of a synthetic late promoter (LP1) and the IBDV polymerase gene is under the control of the late synthetic / initial promoter (LP2EP2). This was constructed using standard recombinant DNA techniques (22, and 30), by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2972 base pairs HindIII to BamH1 from pSP64 (Promega). The fragment 1 is a restriction subfragment of approximately 1484 base pairs BglII to Accl of the HindIII restriction M fragment of the SPV (23). Fragment 2 is a fragment of approximately 2700 EcoRI to AscI synthesized by cDNA cloning and polymerase chain reaction (PCR) of the temperate RNA of IBDV. The cDNA and PCR primers (5'-CACGAATTCTGACATTTTCAACAGTCCACAGGCGC-3 '; 12 / 93.4) and 5'-GCTGTTGGACATCACGGGCCAGG-3'; 9 / 93.28) were used to synthesize a fragment of approximately 1400 base pairs EcoRI to Bell at the 5 'end of the IBDV polymerase gene. The cDNA and PCR primers (5 '-GGCGGCGCCAGGCGAAGGCCGGGGATACGG-3': 12 / 93.2) and 5'-GGCGCGCCAGGCGAAGGCCGGGGATACGG-3 '; 12 / 93.3) were used to synthesize a fragment of approximately 1800 base pairs from Bell to AscI from the 3 'end of the IBDV polymerase gene. The two fragments were ligated to the Bell site to form a fragment -about-approximately. 2700 base pairs EcoRi to Bell. Fragment 3 is a fragment of about 3010 base pairs of BamHI to PvuII of plasmid pJF751 (11). Fragment 4 is a subfragment of approximately 2149 base pairs Accl to HindIII of the M HindIII fragment of SPV. The Accl sites in fragments 1 and 4 were converted to the unique Notl sites using the Notl linkers.

VECTOR OF HOMOLOGY 761-75.Bl8. Plasmid 761-75.B18 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates an E. coli β-galactosidase marker gene (lacZ) and the feline immunodeficiency virus (FIV) protease gene (gag) flanked by the SPV DNA.

Upstream of the foreign gene is a fragment of approximately 885 base pairs of SPV DNA. Downstream of the foreign genes is a fragment of approximately 1113 base pairs of the SPV DNA. When the plasmid is used according to the HOMOLOGO RECOMBINATION PROCEDURE TO GENERATE SPV RECOMBINANT, will be a virus containing DNA encoded for foreign genes. Note that the β-galactosidase marker gene (lacZ) is under the control of a gene promoter 01L of pig pustular disease virus and the gag gene FIV- is under the control of the late / initial promoter (LP2EP2). The homology vector was constructed using the standard recombinant DNA techniques (22, and 30), by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2519 pairs of : HindIII base to fragment "give Sphl restriction of pSP65 (Promega) Fragment 1 is a subfragment of approximately 855 base pairs of the HindIII restriction fragment of SPV M (23) synthesized by polymerase chain reaction using the primers 5 'DNA GAAGCATGCCCGTTCTTATCAATAGTTTAGTCGAAAATA-3' and 5'CATAAGATCTGGCATTGTGTTATTATACTAACAAAAATAATAAG-3 'to produce a fragment of 855 base pairs with Sphl and BglII termini. Fragment 2 is a fragment 3002 base pairs of BamHI to PvulI derived from plasmid pJF751 (49) containing the gene LacZ E. coli. Fragment 3 is a fragment of about 1878 base pairs EcoRI to BglII synthesized by polymerase chain reaction (PCR) using the FIV cDNA (strain PPR) (61). The primer (5 'GCGTGAATTCGGGGAATGGACAGGGGCGAGAT-3'; 11 / 94.9) is synthesized from the 5 'end of the gag FIV gene, introduces an EcoRi site at the 5' end of the gene and an ATG start codon. The primer (5 '-GAGCCAGATC GCTCTTTTTTACTTTCCC-3'; 11 / 94.10) is synthesized from the 3 'end of the gag FIV gene. The PCR product was digested with EcoRI and Bgl11 to give a fragment of 1878 base pairs in length corresponding to the gag gene of FIV. Fragment 4 is a subfragment of approximately 1113 base pairs of the M HindIII fragment of SPV synthesized by polymerase chain reaction using DNA primers 5'- CCGTAGTCGACAAAGATCGACTTATTAATATGTATGGGATT-3 'and .5' GCCTGAAGCTTCTAGTACAGTATTTACGACTTTTGAAAT-3 'to produce an i fragment of 1113 base pairs with SalI and HindIII ends. ! . - -. : VECTOR OF HOMOLOGY 781-84. CU. Plasmid 781-84.C11 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a β-galactosidase marker gene from E. coli (lacZ) and the envelope gene from feline immunodeficiency virus (FIV) (env) flanked by the SPV DNA. Upstream of the foreign gene is a fragment of approximately 885 base pairs of the SPV DNA. Downstream of the foreign genes is a fragment of approximately 1113 base pairs of the SPV DNA. When the plasmid is used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV, a virus containing the DNA encoded for the foreign genes will result. Note that the β-galactosidase marker gene (lacZ) is under the control of a late promoter of pig pustular disease virus (LP1) and the FIV env gene is under the control of the late / initial synthetic pustule disease promoter ( LP2EP2). The homology vector was constructed using the standard recombinant DNA techniques (22, and 30), by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector was derived from a fragment of restriction of approximately 2972 base pairs HindIII to the BamH1 restriction fragment of pSP64 (Promega). Fragment 1 is a subfragment of approximately 1484 base pairs Bgll to Accl of the M HindIII fragment of SPV (23). Fragment 3 is a fragment of approximately 2564 base pairs of ... BamHl to BamHl- del..gen. FIV env (61) synthesized by CLONING WITH THE POLYMERASE CHAIN REACTION. The tempering for the PCR reaction was the genomic cDNA of PPR of FIV strain (61). The primer upwards 10 / 93.21 (5 '-GCCCGGATCCTATGGCAGAAGGGTTTGCAGC-3';) was synthesized corresponding to the 5 'end of the FIV env gene starting at nucleotide 6263 of the PPR genomic cDNA of the FIV strain, and the procedure introduced a BamH1 site at the 5' end and the BamH1 site was destroyed during the cloning of the PCR fragment. The downstream primer 10 / 93.20 (5'-CCGTGGATCCGGCACTCCATCATTCCTCCTC-3 ';) was synthesized corresponding to the 3' end of the FIV env gene starting at nucleotide 8827 of the PPR genomic cDNA, and the procedure introduced a BamHl site at the end 3 and fragment 3 is a restriction fragment of about 3010 base pairs BamH1 to PvuII of plasmid pJF751 (11). Fragment 4 is a restriction subfragment of approximately 2149 base pairs Accl to HindIII of the HindIII restriction fragment of SPV M (23). The Accl site in the SPV homology vector was converted to a single Notl site.

EXAMPLES Example 1 Homology Vector 515-81.1. The homology vector 515-85.1 is a plasmid useful for the insertion of DNA into the SPV. The plasmid 515-85.1 contains a unique Accl restriction site within which the foreign DNA can be cloned. A plasmid containing such foreign DNA insert can be used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV to generate an SPV containing the foreign DNA. For this procedure to be successful, it is important that the insertion site (Accl) be a non-essential region for the duplication of the SPV and that the site be flanked with the appropriate pig pustular disease virus DNA to mediate homologous recombination. between the virus and the plasmid DNAs. The Accl site in the homology vector 515-85.1 is used to insert the foreign DNA into at least three recombinant SPVs (see examples 2-4). • In order to define the appropriate insertion site, a library of SPV HindIII restriction fragments was generated. Several of these restriction fragments (restriction fragments HindIII G, J, and M see FIGS. 1A-1B) were subjected to restriction mapping analysis. Two restriction sites were identified in each fragment as the potential insertion sites. These sites include Hpal and NruI in fragment g, Ball and Xbal in fragment J, and Accl and PstI in fragment M. A marker gene of β-galactosidase (lacZ) was inserted in each of the sites potential The resulting plasmids were used in the RECOMBINANT RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The generation of the recombinant virus was determined by RECOMBINANT SPV EXAMINATION EXPRESSING ß- • GALACTOSIDASE ESSAYS. Four to six sites were found to generate the recombinant virus, however the capacity of each one of these viruses to be purified out of the parental SPV varied greatly. In one case, the virus could not be purified above the 1% level, otherwise the virus could not be purified above the 50% level, and in a third case the virus could not be purified above the 90% level . The inability to purify these viruses indicated an instability at the insertion site. This makes the corresponding sites inappropriate for the insertion of foreign DNA. However, the insertion in a site, the Accl site of homology vector 515-85.1, resulted in a virus which was easily purified at 100% (see example 2), clearly defining an appropriate site for the insertion of foreign DNA .

The homology vector 515-85.1 was further characterized by DNA sequence analysis. Two regions of the homology vector were sequenced. The first region covers a sequence of 599 base pairs flanking the single Accl site. The second region covers the 899 base pairs up from the unique HindIII site. The sequence of the first region encodes an open reading frame (ORF) which shows the homology to amino acids 1 to 115 of the vaccinia virus (W) OlL open reading frame identified by Goebel et al., 1990 (Figures 2A-2C) . The sequence of the codes of the second region for an open reading frame which show homology with amino acids 568 to 666 of the same OlL open reading frame of the vaccinia virus (see Figures 2A-2C). These data suggest that the Accl site interrupts the open reading frame of type OlL W of presumption at approximately 41 amino acids, suggesting that open reading frame codes for a non-essential gene for SPV duplication. Goebel and others suggest that the OlL W open reading frame contains a leucine closure motif characteristic of certain eukaryotic transcriptional regulatory proteins, however these indicate that it is not known if this gene is essential for the duplication of the virus.

The DNA sequence located upstream of the OlL W type open reading frame would be expected to contain a viral promoter of pig pustular disease.

The viral promoter of pig pustular disease will be useful as a control element of foreign DNA introduced into the genome of pig pustular disease.

The 2 S-SPV-003 S-SPV-003 is a virus of pig pustular disease that expresses a foreign gene. The gene for ß-galactosidase E.coli (lacZ gene) was inserted into the open reading frame 515-85.1 of SPV. The foreign gene (lacZ) is under the control of the synthetic initial / late promoter (EP1LP2).

S-SPV-003 was derived from S-SPV-001 (strain of Kasza). This was achieved using the homology vector 520-17.5 (see Materials and Methods) and the S-SPV-001 virus in HOMOLOGO RECOMBINATION PROCEDURE TO GENERATE RECOMBINANT SPV. The transfection strain was examined by EL EXAMINATION FOR RECOMBINANT SPV EXPRESSING β-GALACTOSIDASE (BLUOGAL AND CPRG ESSAYS). The final result was the recombinant virus designated S-SPV-003. This virus was tested for the expression of β-galactosidase, purity and stability of insert by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of purification, all the plates observed were blue indicating that the virus was pure, stable and expressed the foreign gene. The assays described here were carried out in VERO cells as well as in EMSK cells, indicating that VERO cells will be a suitable substrate for the production of recombinant SPV vaccines. The S-SPV-003 has been "deposited with ATCC Accession Number VR 2335.

Example 3 S-SPV-008 SPV-008 is a pig pustular disease virus that expresses at least two foreign genes. The gene for / 3-galactosidase E. coli (lacZ gene) and the gene for pseudorabies virus (PRV) g50 (gD) (26) was inserted into the open reading frame 515-85.1 of SPV. The lacZ gene is under the control of a synthetic late promoter (LP1) and the g50 gene (gD) is under the control of a synthetic initial / late promoter (EP1LP2).

S-SPV-008 was derived from S-SPV-001 (strain Kasza). This was achieved using the homology vector 538-46.16 (see Materials and Methods) and the S-SPV-001 virus in HOMOLOGOUS RECOMBINATION PROCEDURE TO GENERATE AN SPV RECOMBINANT. The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING jS-GALACTOSIDASE (BLUOGAL AND CPRG ESSAYS). The final result of the red plaque purification was the recombinant virus designated S-SPV-008.; This virus was tested for the expression of 3-galactosidase, purity and insert stability by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the marker gene.

S-SPV-008 was examined for the expression of PRV-specific antigens using the BLACK PLATE EXAMINATION FOR EXPRESSION OF OUTSIDE GENE IN RECOMBINANT SPV. Anti-PRV pig serum was shown to react specifically with the S-SPV-008 plates and not with the negative control plates S-SPV-009. All S-SPV-008 plates observed reacted with the pig antiserum indicating that the virus was being stably expressed in the foreign PRV gene. The black plate test was also performed on non-fixed monolayers. The SPV plates on the non-fixed monolayers also exhibited a specific reactivity with the pig anti-PRV serum indicating that the PRV antigen is expressed on the surface of the infected cell. - - To confirm the expression of the PRV g50 gene product (gD), the cells were infected with the SPV and the samples of the infected cell lysates were subjected to polyacrylamide gel electrophoresis of - ^ SDS. 'ELGEN was stained and analyzed using the WEST-DESCRIBED PROCEDURE.The anti-PRV pig serum was used to detect the expression of PRV-specific proteins.The lysate of S-SPV-008 from infected cells exhibited a band specific to approximately 48 kd, the reported size of the g50 of PRV (gD) (35).

The g50 of PRV (gD) is the homologue g50 (gD) of HSV-1 (26). Several investigators have shown that the W expressing g50 of HSV-1 (gD) will protect the mice against the challenge with HSV-1 (6 and 34). Therefore, S-SPV-008 should be valuable as a vaccine to protect pigs against PRV disease.

It was anticipated that several other PRV glycoproteins will be useful in the creation of recombinant pig pustular disease vaccines for protection against PRV disease. These PRV glycoproteins include gil (28), gilí (27) and gH (19). The gilí coding region of PRV has been designed behind several synthetic pustular disease promoters. The techniques used to create S-SPV-008 will be used to create recombinant pig pustular disease viruses expressing all four of these PRV glycoprotein genes. Such recombinant pig pustular disease viruses will be useful as vaccines against PRV disease. Dice; than the vaccines of PRV. described here do not express the gX or PRV gl, these will be compatible with the current PRV diagnostic tests (gX HerdChek®, gl HerdChek® and ClinEase®) which are used to distinguish vaccinated animals from infected animals. S-SPV-008 has been deposited with ATCC Accession Number VR 2339.

Example 6 S-SPV-013 S-SPV-013 is a pig pustular disease virus that expresses at least two foreign genes. The gene for ß-galactosidase E. coli (lacZ) and the gene for pseudorabies gilí virus (gC) were inserted into the restriction site of single PstI (PstI linkers inserted into a single Accl site) of the vector homology 570-33.32. The lacZ gene is under synthetic late control (LP1) and the glia gene of PRV (gC) is under the control of the late synthetic / initial promoter (LP2EP2).

S-SPV-013 was derived from S-SPV-001 (Kasza strain). This was accomplished using the homology vector 570-91.64 (see Materials and Methods) and the S-SPV-001 virus in HOMOLOGOUS RECOMBINATION PROCEDURE FOR- GENERATING RECOMBINANT SPV. . The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING ß -GALACSOSIDASE (BLUOGAL AND CPRG ESSAYS). The final result of the red plaque purification was the recombinant virus designated S-SPV-013. This virus was tested for the expression of β-galactosidase, purity and stability of insert by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene.

S-SPV-013 was examined for the expression of PRV-specific antigens using the EXAMINATION BLACK PLATE FOR GENE EXPRESSION IN RECOMBINANT SPV. The polyclonal goat anti-PRV gibi antibody (gC) was shown to react specifically with the S-SPV-013 plates and not with the S-SPV-001 negative control plates. All the S-SPV-013 plates observed reacted with the pig antiserum indicating that the virus was being stably expressed in the foreign PRV gene. The assays described here were carried out on EMSK and VERO cells, indicating that EMSK cells were a suitable substrate for the production of recombinant vaccines.

To confirm the expression of the gilí gene product of PRV (gC), the cells were infected with the SPV and the samples of the infected cell lysates were subjected to polyacrylamide gel electrophoresis of SDS. The gene was stained and analyzed using the WEST STAIN PROCEDURE. Polyclonal goat anti-PRV gibi antibody (gC) was used to detect the expression of PRV-specific proteins. The lysate of infected cells S-SPV-013 exhibited two specific bands which are of the reported size of gilí of PRV (gC) (37) -a mature form of 92 kd and a pre-Golgi form of 74 kd.

The gilí of recombinant expressed PRV (gC) has been shown to elicit a significant immune response from mice and pigs (37, 38). In addition, when the gilí (gC) is coexpressed with the gil (gB) or the g50 (gD), a significant protection of the challenge with the virulent PRV is obtained (39). Therefore S-SPV-013 is valuable as a vaccine to protect pigs against PRV disease. Since the PRV vaccines described here do not express the gX or the gl of the PRV, these will be compatible with the current PRV diagnostic tests (gX HerdChek®, gl HerdChek® and ClinEase®) which are used to distinguish the animals vaccinated from infected animals. The S-SPV-013 has been deposited with the Accession Number ATCC 24 18.

Protection against the disease Aujeszky using the recombinant pig pustular disease virus vaccines S-SPV-008 and S-SPV-013.

A vaccine containing S-SPV-008 and S-SPV-013 (1 x 106PFU / ml) (2ml of a mixture of 1: 1 of the two viruses) was given to two groups of pigs (5 pigs in each group) using intradermal inoculation or by an oral / pharyngeal spray. A control group of 5 pigs received S-SPV-001 by both intradermal and oral / pharyngeal inoculation. The pigs were challenged after three weeks of vaccination with the virulent PRV strain 4892 by intranasal inoculation. The table presents a summary of the clinical responses. The data support an increase in protection against Aujeszky's disease in the S-SPV-008 / S-SPV-013 vaccines compared to the vaccinated controls S-SPV-001.

Vaccine Route of Signals CNS Average of respiratory inoculation after group after defilement (# with challenge challenge (# with signs / number (days of signs / total number) clinical) total) S-SPV-008 + Intradermal 3 / 5 0/5 2. S S-SPV- 013 S-SPV-008 + Oral / 3/5 0/5 2 .2 S-SPV-013 pharyngeal S-SPV-001 Intradermal + 5/5 2/5 7. 8 (Control) Oral / pharyngeal Example 7 S-SPV-015 S-SPRV-015 is a virus of pig pustular disease that expresses at least two genes aj enos. The gene for / 3-galactosidase E. coli (lacZ) and the gene for the gilí pseudorabies virus (gD) (PRV) were inserted into the open reading frame SPV 617-48. 1 (a single restriction site Notl has been relocated to a single Accl restriction site. The lacZ gene is under synthetic late control (LP1) and the gV gene of PRV is under the control of the late synthetic / initial promoter (LP2EP2).

S-SPV-015 was derived from S-SPV-001 (strain Kasza). This was achieved using the homology vector 727-54.60 (see Materials and Methods) and the S-SPV-001 virus in HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING 3-GALACTOSIDASE (BLUOGAL AND CPRG ESSAYS). The final result of the red plaque purification was the recombinant virus designated S-SPV-015.

This virus was tested for the expression of / 3-galactosidase, • purity and stability of insert through multiple ducts ^ monitored by -the plaque test. Blue, as described in Materials and Methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene.

S-SPV-015 was examined for the expression of PRV-specific antigens using the BLACK PLATE EXAMINATION FOR EXPRESSION OF OUTSIDE GENE IN RECOMBINANT SPV. The polyclonal anti-PRV serum was shown to react specifically with the S-SPV-015 plates and not with the negative control plates S-SPV-001. All S-SPV-015 plates observed reacted with the antiserum indicating that the virus was being stably expressed in the foreign PRV gene. The assays described here were carried out on ESK-4 cells, indicating that ESK-4 cells were a suitable substrate for the production of recombinant SPV vaccines.

To confirm the expression of the PRV gene product, the cells were infected with SPV-015 and the samples of the infected cell lysates were subjected to SDS polyacrylamide gel electrophoresis. The gene was stained and analyzed using the WEST STAIN PROCEDURE. Polyclonal anti-PRV serum was used to detect the expression of PRV-specific proteins. The lysate of infected cells ^ S-SPV-015 .exhibited: bands - which correspond to 120 kd, 67 kd and 58 kd, which are of the reported size of gil of PRV glycoprotein.

S-SPV-015 is useful as a vaccine for pig against the pseudorabies virus. A superior vaccine was formulated by combining S-SPV-008 (PRV g50), S-SPV-013 (PRV gilí), and S-SPV-015 for protection against pseudorabies in pigs.

Therefore S-SPV-015 is valuable as a vaccine to protect the pig against PRV disease. Since the PRV vaccines described here do not express the gX or the gl of the PRV, these will be compatible with the current PRV diagnostic tests (gX HerdChek®, gl HerdChek® and ClinEase®) which are used to distinguish the animals vaccinated from infected animals. S-SPV-015 has been deposited with ATCC Accession Number 2466.

Example 8 Recombinant pig pustular disease virus expresses more than one pseudorabies virus glycoprotein (PRV), which may allow the production of neutralizing antibodies against pseudorabies virus, was constructed in order to obtain a recombinant pig pustular disease virus with an improved capacity to protect against PRV infection than that one, which can be obtained by using a recombinant pig pustular disease virus expressing only one of those PRV glycoproteins.

There are several examples of such recombinant pig pustular disease viruses expressing more than one of the PRV glycoproteins: a recombinant pustular disease virus expressing the g50 of PRV g (D) and the gilí (gC), a pig pustular disease virus recombinant expressing g50 of PRV (gD) and gil (gB); a recombinant pig pustular disease virus expressing gil (gB) and gilí (gC) of PRV; and a recombinant pig pustular disease virus g50 of PRV (gD), gilí (gC) and gil (gB). Each of the viruses mentioned above is also designed to contain and express the E. coli β-galactosidase gene (lacZ) which will facilitate the cloning of recombinant pig pustular disease virus.

Below are three examples of a recombinant pig pustular disease virus expressing RV g50 (gD), PRV gilí (gC), PRV gil (gB) and E. coli 3-galactosidase (lacZ): (a) The recombinant pig pustular disease virus containing and expressing the PRV g50 gene (gD), the PRV gilí gene (gC), the PRV gil gene (gB) and the lacZ gene. All four genes are inserted into the Accl restriction endonuclease site unique within the M fragment of HindIII of the pig pustular disease virus genome. The gVl gene of PRV (gD) is under the control of a synthetic initial / late promoter (EP1LP2), of the gilí gene of PRV (gC) is under the control of a synthetic initial promoter (EP2), the gil gene of PRV ( gB) is under the control of a late synthetic / initial promoter (LP2EP2) and the lacZ gene is under the control of a synthetic late promoter (LP1). (b) The recombinant pig pustular disease virus containing and expressing the gVR gene of PRV (gD), the gilí gene of PRV (gC), the gil gene of PRV (gB) and the lacZ gene. All four genes are inserted into the unique Accl restriction endonuclease site within the M fragment of HindIII of the pig pustular disease virus genome. The PRV g50 gene (gD) is under the control of an initial / late promoter synthetic (EP1LP2), the gilí gene of PRV (gC) is under the control of a synthetic initial / late promoter (EP1LP2), the gil gene of PRV (gB) is under the control of a synthetic late / initial promoter (LP2EP2 ) _ and the lacZ gene is under the control of a synthetic late promoter (LP1). (c) The recombinant pig pustular disease virus containing and expressing the PRV g50 gene (gD), the PRV gili gene (gC), the gill gene of PRV (gB) and the lacZ gene. All four genes were inserted into the unique Accl restriction endonuclease site within the M fragment of HindIII of the pig pustular disease virus genome. The PRV g50 gene (gD) is under the control of a synthetic initial / late promoter (EP1LP2), the gilí gene of PRV (gC) is under the control of a late / synthetic initial promoter (LP2EP2), the gil gene of PRV (gB) it is under the control of a late synthetic / initial promoter (LP2EP2) and the lacZ gene is under the control of a synthetic late promoter (LP1).

Protection against Aujeszky's disease using recombinant pig pustular disease virus vaccines S-SPV-008, S-SPV-013 and S-SPRV-015.

A vaccine containing S-SPV-008, S-SPV-013 and S-SPV-015 (2 ml of 1 x 107PFU / ml of the virus) or a mixture of S-SPV-008, S-SPV-013 and S- SPV-015 (2 ml of a mixture of 1: 1 of the three viruses, 1 X 107 PFU / ml) was given to four groups of pigs (5 pigs per group) by intramuscular inoculation. A control group of 5 pigs received S-SPV-001 by intramuscular inoculation. The pigs were challenged four weeks after vaccination with the virulent PRV, strain 4892, by intranasal inoculation. The pigs were observed daily for 14 days for clinical signs of pseudorabies, and the table presents a summary of the clinical responses. The data show that the vaccine pigs with S-SPV-008, S-SPV-013 or S-SPV-015 have a partial protection and the pigs vaccinated with the vaccine combination S-SPV-008 / S-SPV-013 / S-SPV-015 had complete protection against Aujeszky's disease caused by pseudorabies virus compared to vaccine controls S-SPV-001.

Vaccine Route of Signals CNS Average of respiratory inoculation after the group after the challenge (# with challenge challenge (# with signs / number (days of signs signs / total number) clinical) total) S-SPV-008 Inmuscular 2 / 5 2/5 2.0 S-SPV-013 Intramuscular 1/5 0/5 0.4 S-SPV-015 Intramuscular / 5. 0/5 1.0 S-SPV-008 Intramuscular 0/5 0/5 0.0 S-SPV-013 S-SPV-015 S-SPV-001 Intramuscular 5/5 2/5 3.6 (Control) Example 17 The development of vaccines can be designed using the virus of pig pustular disease to express antigens of microorganisms that cause disease.

VIRUSES OF TRANSMISSIBLE GASTROENTERITIS The main neutralizing antigen of the transmissible gastroenteritis virus (TGE), glycoprotein 195 for use in the pig pustular disease virus vector has been cloned. The clone of the neutralizing antigen is described in the patent application of the United States of America No. 078,519 filed July 27, 1987. It is contemplated that the procedure that has been used to express the g50 of PRV (gD) in the SPV and are described herein are applicable to TGE.

PORCINO PARVOVIRUS. The major porcine parvovirus (pig) capsid protein (PPV) was cloned for use in the pig pustular disease virus vector. The capsid protein clone is described in U.S. Patent No. 5,068,192 issued Nov. 26, 1991. It is contemplated that the procedures that have been used to express the g50 of PRV (gD) in SPV and which are described here are applicable to the PPV.

ROTAVIRUS OF PIG The main neutralizing antigen of glycoprotein 38 rotavirus was cloned for use in the vector of pig pustular disease virus. The clone of glycoprotein 38 is described in U.S. Patent No. 5,068,192 issued November 26, 1991. It is contemplated that the procedures that have been used to express the g50 of PRV (gD) in SPV and that are described here are applicable to the SRV.

MARRANO COLOR VIRUS The main neutralizing antigen of bovine viral diarrhea virus (BVD) is described in the serial application No. 225,032 filed on July 27, 1988. Since marrano cholera viruses and BVDs are a protective cross (31) BVD virus antigen has been targeted for use in the pig pustular disease virus vector. It is contemplated that the procedures that have been used to express the gVV of PRV (gD) in the SPV and that are described herein are applicable to the BVD virus.

SERPULINA HYODYSENTERIAE A protective antigen of Serpulina hyodysenteriae (39, for use in the vector of pig pustular disease virus have been cloned.) It is contemplated that the procedures_which have been used to express the g50 d PRV (gD) in the SPV and- that are described here also apply to the Serpulina hyodysenteriae.

The antigens of the following microorganisms were also used to develop animal vaccines: swine influenza virus, foot and mouth disease virus, African swine fever virus, swine flu virus, Mycoplasma hyopneumoniae, Pig infertility / pig reproductive respiratory syndrome and respiratory syndrome (PRRS / SIRS).

The antigens of the following microorganisms can also be used for animal vaccines: 1) canine - canine distemper, perme virus, canine adenovirus type 1 (hepatitis), adenovirus type 2 (respiratory disease), parainfluenza, Leptospira canicola, icterohemorrhage, parvovirus, coronavirus , Borrelia burgdorferi, canine herpes virus, Bordetella bronchiseptica, Dirofilaria immitis (heartworm) and rabies virus. 2) Feline - gaga fiv and env, feline leukemia virus, feline immunodeficiency virus, feline herpes virus, feline infectious peritonitis, canine herpes virus, canine coronavirus, canine parvovirus, paracitic diseases in animals (including Dirofilaria immitis in dogs) and cats), equine infectious anemia, Streptococcus equi, coccidia, emeria, chicken anemia virus, Borrelia bergdorferi, canine coronavirus, Pasteurella haemolytica.

Example 24 Homology vector 738-94.4 The homology vector 738-94.4 is a vector of pig pustular disease virus expressing a foreign gene. The gene for / 3-galactosidase E. coli (lacZ) was inserted into the OlL open reading frame. The lacZ gene is under the control of the OlL promoter. The homology vector 738-94.4 contains a deletion of the SPV DNA of nucleotides 1679 to 2454 (SEQUENCE ID NO: 189) which suppresses part of the open reading frame OlL.

The upstream SPV sequences were synthesized by polymerase chain reaction using primers 5 'DNA -GAAGCATGCCCGTTCTTATCAATAGTTTAGTCGAAAATA-3' and 5 '-CATAAGATCTGGCATTGTGTTATTATACTAACAAAAATAATAAG-3' to produce a fragment of 855 base pairs with Bgl11 and Sphl ends. The OlL promoter is present in this fragment. The downstream SPV sequences were synthesized by polymerase chain reaction using the DNA primers 5'-CCGTAGTCGACAAAGATCGACTTATTAATATGTATGGGATT-3 'and 5'-GCCTGAAGCTTCTAGTACAGTATTTACGACTTTTGAAAT-3' to produce the 1113 base pair fragment with SalI and HindIII termini.

The recombinant pig pustular disease virus was derived using a homology vector 738-94.4 h S-SPV-001 (Kaszna strain) in the HOMOLOGO RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING / 3-galactosidase (BLUOGAL ESSAYS AND ). The final result of 1 purification of red plaque is the recombinant virus. This virus was tested for ß-galactosidase expression, purity, and insert stability by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of purification, all the plates observed are blue indicating that the virus is pure, stable and expressing the foreign gene. The recombinant pig pustular disease viruses derived from the homology vector 738-94.4 are used as an expression vector to express foreign antigens and as a vaccine to elevate a protective immune response in animals to foreign genes expressed by the virus of recombinant pig pustular disease. Other promoters in addition to the OlL promoter are inserted into the deleted region including LP1, EP1LP2, LP2EP2, immediate initial HCMV, and one or more foreign genes are expressed from these promoters.

Example 24B The homology vector 752-22.1 is a vector of pig pustular disease virus that was used to express two foreign genes. The gene for / 3-galactosidase E. coli (lacZ) was inserted into the OlL open reading frame. The lacZ gene is under the control of the OlL promoter. A second foreign gene is expressed from the LP2EP2 promoter inserted in an EcoRI or BamH1 site after the LP2EP2 promoter sequence. The homology vector 752-22.1 contains a deletion of the SPV DNA from nucleotides 1679 to 2452 (SEQUENCE ID NO: 189) which removes part of the OlL ORF. The homology vector 752-22.1 was derived from the homology vector 738-94.4 by insertion of the promoter fragment LP2EP2 (see Materials and Methods). The homology vector 752-22.1 is further enhanced by placing the lacZ gene by the control of the synthetic LP1 promoter. The LP1 promoter results in higher levels of lacZ expression compared to the OlL SPV promoter.

Example 25 S-SPV-041 S-SPV-041 is a pig pustular disease virus that expresses at least two foreign genes. The gene for jS-galactosidase E. coli (lacZ) and the gene for glycoprotein B type 1 herpes virus (gB) were inserted into the open reading frame 738-94.4 (a deletion of 773 base pairs of the ORF OlL SPV, deletion of nucleotides 1679 to 2452, SEQUENCE ID NO: 189). The lacZ gene is under the control of the OlL promoter of pig pustular disease and the gB gene of EHV-1 is under the control of the synthetic initial late promoter (LP2EP2).

S-SPV-041 was derived from S-SPV-001 (strain Kasza). This was achieved using the homology vector 752-29.33 (see Materials and Methods) and the S-SPV-001 virus in HOMOLOGO RECOMBINATION PROCEDURE TO GENERATE A RECOMBINANT SPV. The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING 3-galactosidase (BLUOGAL AND CPRG ESSAYS). The final result of the red plaque purification was the recombinant virus designated S-SPV-041. This virus was tested for the expression of β-galactosidase, purity and stability of insert by multiple ducts monitored by the blue plate assay as described in Materials and methods . After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the ajen gene.

S-SPV-041 is useful as a vaccine in horses against EHV-1 infection and is useful for the expression of glycoprotein B EHV-1.

S-SPV-045 S-SPV-045 is a pig pustular disease virus that expresses at least two foreign genes. The gene for jß-galactosidase E. coli (lacZ) and the gene for infectious bovine rhinotracheitis virus (E g) glycoprotein E were inserted into the open reading frame 738-94.4 (a deletion of 773 base pairs of the ORF OlL SPV, deletion of nucleotides 1679 to 2452, SEQUENCE ID NO: 189). The lacZ gene is under the control of the OlL promoter of pig pustular disease and the IBRV gE gene is under the control of the synthetic initial late promoter (LP2EP2).

S-SPV-045 was derived from S-SPV-001 (strain Kasza). This was achieved using the homology vector 746-94.1 (see Materials and Methods) and the S-SPV-001 virus in HOMOLOGO RECOMBINATION PROCEDURE TO GENERATE A SPV RECOMBINANT. The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING β-galactosidase (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-045. This virus was tested for the expression of / 3-galactosidase, purity and insert stability by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After the three initial rounds of purification, all plates were observed to be blue indicating that the virus was pure, stable, and expressing the ajen gene.

S-SPV-045 is useful for the expression of the glycoprotein IBRV E.

S-SPV-049 S-SPV-049 is a pig pustular disease virus that expresses at least two foreign genes. The gene for 3-galactosidase E. coli (lacZ) and the gene for bovine viral diarrhea virus glycoprotein 48 (gp48) were inserted into the ORF 738-94.4 (a deletion of 773 base pairs of the OlL ORF SPV; Nucleotide deletion 1679 to 2452, SEQUENCE IDENTIFICATION NO: 189). The lacZ gene is under the control of the OlL promoter of pig pustular disease, and the gp48 gene of BVDV is under the control of the late synthetic / initial promoter (LP2EP2).

S-SPV-049 was derived from S-SPV-001 (strain Kasza). This was accomplished using the homology vector 771-55.11 (see Materials and Methods) and the S-SPV-001 virus in HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING S-GALACTOSIDASE (BLUOGAL AND CPRG ESSAYS). The final result of the red plaque purification was the recombinant virus designated S-SPV-049. This virus was tested for the expression of / 3-galactosidase, purity and insert stability by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene.

S-SPV-049 is useful as a vaccine for cattle against BVDV infection and is useful for the expression of BVDV glycoprotein 48.

S-SPV-050 S-SPV-050 is a pig pustular disease virus that expresses at least two foreign genes. The gene for (β-galactosidase E. coli (lacZ) and the gene for glycoprotein 53 of bovine viral diarrhea virus (gp53) were inserted into the ORF 738-94.4 (a deletion of 773 base pairs of the OlL ORF SPV Deletion of nucleotides 1679 to 2452, SEQUENCE IDENTIFICATION NO: 189) The lacZ gene is under the control of the OlL promoter of pig pustular disease, and the IBRV gE gene is under the control of the late synthetic / initial promoter (LP2EP2) .

S-SPV-050 was derived from S-SPV-001 (strain Kasza). This was achieved using the homology vector 771-55.11 (see Materials and Methods) and the S-SPV-001 virus in HOMOLOGO RECOMBINATION PROCEDURE TO GENERATE A SPV RECOMBINANT. The transfection strain was examined by EXAM FOR THE SPV RECOMBINANT? EXPRESSING jß-GALACTOSIDASE (BLUOGAL AND CPRG ESSAYS). The final result of the red plaque purification was the recombinant virus designated S-SPV-050. This virus was tested for the expression of / β-galactosidase, purity and stability of insert by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene.

S-SPV-050 is useful as a vaccine for cattle against BVDV infection and is useful for the expression of BVDV glycoprotein 53.

Example 26 Viruses of recombinant sow pustular disease, S-SPV-42 or S-SPV-043 expressing chicken myelomonocyte growth factor (cMGF) or chicken interferon (cIFN), respectively, are useful for improving the immune response when add to the vaccines against bird disease. Chicken myelomonocyte growth factor (cMGF) is homologous to the mammalian interleukin-6 protein, and chicken interferon (cIFN) is homologous to mammalian interferon. When used in combination with vaccines against specific poultry diseases, S-SPV-042 and S-SPV-043 provide mediated cell or humoral immunity and improved mucosa against the viruses that cause poultry disease including , but not limited to the Marek's disease virus, the Newcastle disease virus, the infectious laryngotracheitis virus, the infectious bronchitis virus, and the infectious bursal disease virus.

'Example 26A S-SPV-042 S-SPV-042 is a virus of pig pustular disease that expresses at least two aj genes. The gene for jβ-galactosidase E. coli (lacZ) and the gene for chicken interferon (cIFN) were inserted into the SPV 617-48.1 ORF (a unique Notl restriction site has replaced a unique Accl restriction site) . The lacZ gene is under the control of the synthetic late promoter (LP1), and the cIFN gene is under the control of the late synthetic / initial promoter (LP2EP2).

S-SPV-042 was derived from S-SPV-001 (strain Kasza). This was accomplished using the homology vector 751-07.Al (see Materials and Methods) and the S-SPV-001 virus in HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING jß-GALACTOSIDASE (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-042. This virus was tested for the expression of jß-galactosidase, purity and stability of insert by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene.

S-SPV-042 has interferon activity in the cell culture. The addition of the conditioned medium of S-SPV-042 to the chicken embryo fibroblast cell (CEF) culture inhibits the infection of the CEF cells by vesicular stomatitis virus or by turkey herpes virus. The S "-SPV-042 is useful to improve the immune response when it is added to vaccines against the disease of chickens.

Example 26B S-SPV-043 S-SPV-043 is a pig pustular disease virus that expresses at least two foreign genes. The gene for jß-galactosidase E. coli (lacZ) and the gene for chicken myelomonocyte growth factor (cMGF) were inserted into the SPV 617-48.1 ORF (a single Notl restriction site has replaced an Accl restriction site only) . The lacZ gene is under the control of the synthetic late promoter (LP1), and the cIFN gene is under the control of the late synthetic / initial promoter (LP2EP2).

S-SPV-043 was derived from S-SPV-001 (strain Kasza), This was achieved using the homology vector 751-56.Al (see Materials and Methods) and the virus S-SPV-001 in RECOMBINATION PROCEDURE OF HOMOLOGO TO GENERATE A RECOMBINANT SPV. The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING jß-GALACTOSIDASE (BLUOGAL AND CPRG ESSAYS). The final result of the red plaque purification was the recombinant virus designated S-SPV-043.

This virus was tested for the expression of β-galactosidase, purity and stability of insert by multiple ducts monitored by the blue plate assay -as described in Materials and Methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene.

S-SPV-043 is useful for improving the immune response when it is added to vaccines against bird disease.

Example 27 Insertion in a non-essential Site in the Region of 2.0 kB from HindIII to BglII of Fragment M HindIII of Pustular Pig Disease Virus A 2.0 kB region of HindIII to Bgl11 of the HindIII M fragment of the pig pustular disease virus is useful for the insertion of foreign DNA into the SPV. The foreign DNA is inserted into a unique BglII restriction site in the nucleotide region 540 of SEQUENCE OF IDENTIFICATION NO: 195). A plasmid containing an alien DNA insert is used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV to generate an SPV containing the foreign DNA. For this procedure to be successful, it is important that the insertion site be in a region not essential for the duplication of the SPV and that the site be flanked with the appropriate pig pustular disease virus DNA to mediate the homologous recombination between the virus and the plasmid DNA . The unique BglII restriction site in the 2.0 kb region of HindIII to BglII of the HindIII M fragment of pig pustular disease virus is located within the coding region of the open reading frame of SPV 14L. The open reading frame 14L has a sequence similarity to the vaccine virus and the smallpox virus ribonucleotide reductase gene (large subunit) (56-58). the ribonucleotide reductase gene (large subunit) is not essential for DNA duplication of the vaccine virus and is an appropriate insertion site in the pig pustular disease virus.

Example 28 S-SPV-047 S-SPV-047 is a virus of pig pustular disease that expresses two foreign genes. The gene for jß-galactosidase E. coli (lacZ) and the gene for pseudorabies virus gB (gil) were inserted into a unique HindIII site (HindIII linker inserted into the.-Restriction endonuclease site BglII within the subfragment from 2.0 kB BglII to HindIII fragment M HindIII). The BglII insertion site is within the open reading frame I4L of the SPV which has a significant homology with the vaccinia virus ribonucleoside diphosphate reductase gene. The lacZ gene is under the control of the synthetic late promoter (LP1), and the gV gene of PRV (gil) is under the control of the late synthetic / initial promoter (LP2EP2).

S-SPV-047 was derived from S-SPV-001 (strain Kasza). This was accomplished using the homology vector 779-94.31 (see Materials and Methods) and the S-SPV-001 virus in HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING jß-GALACTOSIDASE (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-047. This virus was tested for the expression of jß-galactosidase, purity and stability of insert by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene.

• S-SPV-047 was tested for the expression of PRV-specific antigens using the BLACK PLATE EXAMINATION EXPRESSION OF OLD GENE IN RECOMBINANT SPV. The polyclonal anti-PRV serum was shown to react specifically with the S-SPV-047 plates and not with the S-SPV-001 negative control plates. All the S-SPV-047 plates observed reacted with the pig PRV antiserum indicating that the virus was being stably expressed in the foreign PRV gene. The assays described here were carried out on ESK-4 cells, indicating that ESK-4 cells were a suitable substrate for the production of recombinant SPV vaccines.

To confirm the expression of the gV gene product of the PRV, the cells were infected with SPV-047 and the samples of the infected cell lysates and the culture supernatants were subjected to SDS polyacrylamide gel electrophoresis. The gene was spotted and analyzed using the WEST STAIN PROCEDURE. Polyclonal anti-PRV serum was used to detect the expression of PRV-specific proteins. Lysate of infected cells and supernatants of cells infected with S-SPV-047 exhibited bands corresponding to 120 kd, 67 kd and 58 kd, which are the expected size of PRV glycoprotein B.

The gB PRV-expressed recombinant SPV has been shown to elicit an immune response -significant in the-pig (37, 38), see the Example 8). In addition, the gV of the PRV is expressed in the recombinant SPV, a significant protection of the challenge was obtained with the virulent PRV. (See Examples 6 and 8). Therefore, S-SPV-047 is valuable as a vaccine to protect the pig against PRV disease. Since the PRV vaccines described here do not express PRV gX or gl, they will be compatible with the current PRV diagnostic tests (gX HerdChek gl HerdChek® and ClinEase®) which are used to distinguish vaccinated animals from infected animals.

S-SPV-052 S-SPRV-052 is a pig pustular disease virus that expresses three foreign genes. The gene for ß-galactosidase E. coli (lacZ) and the gene for the pseudorabies virus gB (ill) were inserted into the unique HindIII restriction site (HindIII linker inserted into the N-site only in the OlL open reading frame). of SPV; a subfragment of approximately 545 base pairs from Ndel to Ndel (nucleotides 1560 to 2104) of the M HindIII SPV fragment have been deleted). The PRV gD gene (g50) was inserted into the unique PstI restriction site (the PstI linkers inserted into a single Accl site in the OlL open reading frame of SPV). The lacZ gene is under the control of the synthetic late promoter (LP1), the gV gene of PRV (gil) is under the control of the late / synthetic initial promoter (LP2EP2), and the gD gene of the PRV (g50) is low the control of the synthetic initial / late promoter (EP1LP2).

S-SPV-052 was derived from S-SPV-001 (strain Kasza). This was achieved using the homology vector 789-41.7 (see Materials and Methods) and the S-SPV-001 virus in HOMOLOGO RECOMBINATION PROCEDURE TO GENERATE A SPV RECOMBINANT. The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING jß-GALACTOSIDASE (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-052. This virus was tested for the expression of S-galactosidase, purity and stability of insert by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene.

S-SPV-052 was assayed for the expression of PRV-specific antigens using the BLACK PLATE EXAMINATION FOR EXPRESSION OF OUTSIDE GENE IN RECOMBINANT SPV. The polyclonal anti-PRV serum was shown to react specifically with the S-SPV-052 plates and not with the negative control plates S-SPV-001. All the S-SPV-052 plates observed reacted with the pig PRV antiserum indicating that the virus was being stably expressed in the foreign PRV gene. The assays described here were carried out on ESK-4 cells, indicating that ESK-4 cells were a suitable substrate for the production of recombinant SPV vaccines.

To confirm the expression of the gV and gD gene products of the PRV, the cells were infected with SPV-052 and the samples of the infected cell lysates and the culture supernatants were subjected to SDS polyacrylamide gel electrophoresis. The gene was stained and analyzed using the WEST STAIN PROCEDURE. Polyclonal anti-PRV serum was used to detect the expression of PRV-specific proteins. The lysate of infected cells and the supernatants of the cells infected with S-SPV-052 exhibited bands corresponding to 120 kd, 67 kd and 58 kd, which are the expected size of PRV glycoprotein B; and a 48 kd which is of the expected size for PRV glycoprotein D.

The recombinant-expressed VPS of PRV gB and gD has been shown to elicit a significant immune response in the pig (37, 38), see Example 8). In addition, the gV of the PRV is expressed in the recombinant SPV, a significant protection of the challenge was obtained with the virulent PRV. (See Examples 6 and 8). Therefore, S-SPV-052 is valuable as a vaccine to protect the pig against PRV disease. Since the PRV vaccines described here do not express PRV gX or gl, they will be compatible with the current PRV diagnostic tests (gX HerdChek gl HerdChek® and ClinEase®) which are used to distinguish vaccinated animals from Inflated animals.

S-SPV-053 S-SPRV-053 is a pig pustular disease virus that expresses three foreign genes. The gene for jβ-galactosidase E. coli (lacZ) and the gene for pseudorabies virus gB (gil) were inserted into the unique HindIII restriction site (HindIII linker inserted into the Ndel site only in the OlL open reading frame). of SPV, a subfragment of approximately 545 base pairs from Ndel to Ndel (nucleotides 1560 to 2104) of the M HindIII SPV fragment have been deleted). The gene for PRV gC (gilí) was inserted into the unique PstI restriction site (the PstI linkers inserted into a single Accl site in the OlL open reading frame of SPV). The lacZ gene is under the control of the synthetic late promoter (LP1), the gV gene of PRV (gil) is under the control of the late / synthetic initial promoter (LP2EP2), and the gC gene of the PRV (gili) is under control of the initial / late synthetic promoter (EP1LP2). ... _ -. "- _. .. ..- S-SPV-053 was derived from S-SPV-001 (strain Kasza). This was achieved using the homology vector 789-41.27 (see Materials and Methods) and the S-SPV-001 virus in HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING β-GALACTOSIDASE (BLUOGAL AND CPRG ESSAYS). The final result of the red plaque purification was the recombinant virus designated S-SPV-053.

This virus was tested for the expression of β-galactosidase, purity and stability of insert by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene.

S-SPV-053 was assayed for the expression of PRV-specific antigens using the BLACK PLATE EXAMINATION FOR EXPRESSION OF OUTER GENE IN RECOMBINANT SPV. The polyclonal anti-PRV serum was shown to react specifically with the S-SPV-053 plates and not with the negative control plates S-SPV-001. All the S-SPV-053 plates observed reacted with the pig PRV antiserum indicating that the virus was being stably expressed in the foreign PRV gene. The assays described here were carried out on ESK-4 cells, indicating that ESK-4 cells were a suitable substrate for the production of recombinant SPV vaccines.

To confirm the expression of the gV and gC gene products of the PRV, the cells were infected with SPV-053 and the samples of the infected cell lysates and the culture supernatants were subjected to SDS polyacrylamide gel electrophoresis. The gene was stained and analyzed using the WEST STAIN PROCEDURE. Polyclonal anti-PRV serum was used to detect the expression of PRV-specific proteins. The lysate of infected cells and the supernatants of the cells infected with S-SPV-053 exhibited bands corresponding to 120 kd, 67 kd and 58 kd, which are the expected size of PRV glycoprotein B; and a 92 kd which is the expected size for glycoprotein C of the PRV.

The recombinant-expressed VPS of PRV gB and gC has been shown to elicit a significant immune response in the pig (37, 38), see Example 8). In addition, the gB and the gC of the PRV is expressed in the recombinant SPV, a significant protection of the challenge was obtained with the virulent PRV.

(See Examples 6 and 8). Therefore, S-SPV-053 is valuable as a vaccine to protect the pig against PRV disease. Since the PRV vaccines described here do not express gX or gl of the PRV, these will be compatible with the current diagnostic tests of PRV (gX HerdChek gl HerdChek® and ClinEase®) which are used to distinguish vaccinated animals from infected animals.

S-SPV-054 S-SPRV-054 is a pig pustular disease virus that expresses three foreign genes. The gene for jß-galactosidase E. coli (lacZ) and the gene for the pseudorabies virus ge (gilí) were inserted into the unique HindIII restriction site (HindIII linker inserted into the Ndel site only in the OlL open reading frame). of SPV, a subfragment of approximately 545 base pairs from Ndel to Ndel (nucleotides 1560 to 2104) of the M HindIII SPV fragment have been deleted). The gene for PRV gD (g50) was inserted into the unique PstI restriction site (the PstI linkers inserted into a single Accl site in the open OlL reading frame of SPV). The lacZ gene is under the control of the synthetic late promoter (LP1), the gV gene of PRV (gili) is under the control of the synthetic initial / late promoter (EP1LP2), and the gD gene of the PRV (g50) is under control of the initial / late synthetic promoter (EP1LP2).

S-SPV-054 was derived from S-SPV-001 (strain Kasza). This was achieved using the homology vector 789-41.47 (see Materials and Methods), and the S-SPV-001 virus in HOMOLOGOUS RECOMBINATION PROCEDURE_ TO GENERATE AN SPV RECOMBINANT. The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING jß-GALACTOSIDASE (BLUOGAL AND CPRG ESSAYS). The final result of the red plaque purification was the recombinant virus designated S-SPV-054. This virus was tested for the expression of jß-galactosidase, purity and stability of insert by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene.

S-SPV-054 was tested for the expression of PRV-specific antigens using the BLACK PLATE EXAMINATION EXPRESSION OF OLD GENE IN RECOMBINANT SPV. The polyclonal anti-PRV serum was shown to react specifically with the S-SPV-054 plates and not with the S-SPV-001 negative control plates. All the S-SPV-054 plates observed reacted with the pig PRV antiserum indicating that the virus was being stably expressed in the foreign PRV gene. The assays described here were carried out on ESK-4 cells, indicating that ESK-4 cells were a suitable substrate for the production of recombinant SPV vaccines.

To confirm the expression of the gV and gD gene products of the PRV, the cells were infected with SPV-054 and the samples of the infected cell lysates and the culture supernatants were subjected to SDS polyacrylamide gel electrophoresis. The gene was stained and analyzed using the WEST STAIN PROCEDURE. Polyclonal anti-PRV serum was used to detect the expression of PRV-specific proteins. The lysate of infected cells and the supernatants of the cells infected with S-SPV-054 exhibited bands corresponding to 92 kd, which are the expected size of PRV glycoprotein C and a 48 kd which is of the expected size for the PRV glycoprotein D. . .

The expressed-recombinant SPV of PRV gC and gD has been shown to elicit a significant immune response in the pig (37, 38), see Example 8). In addition, the gC and the gD of the PRV is expressed in the recombinant SPV, a significant protection of the challenge was obtained with the virulent PRV.

(See Examples 6 and 8). Therefore, S-SPV-054 is valuable as a vaccine to protect the pig against PRV disease. Since the PRV vaccines described here do not express gX or gl of the PRV, these will be compatible with the current diagnostic tests of PRV (gX HerdChek gl HerdChek® and ClinEase®) which are used to distinguish vaccinated animals from infected animals.

S-SPV-055 S-SPRV-055 is a pig pustular disease virus that expresses four foreign genes. The gene for jß-galactosidase E. coli (lacZ) and the gene for the pseudorabies virus gB (gil) were inserted into the unique HindIII restriction site (HindIII linker inserted into the Ndel site only in the OlL open reading frame). of SPV, a subfragment of approximately 545 base pairs from Ndel to Ndel (nucleotides 1560 to 2104) of the M HindIII SPV fragment have been deleted). The gene for PRV gD (g50) and gC (gilí) of PRV were inserted into the unique PstI restriction site (the PstI linkers inserted into a single Accl site in the open OlL reading frame of SPV). The lacZ gene is under the control of the synthetic late promoter (LPl), the gV gene of PRV (gil) is under the control of the late / initial promoter (LP2EP2), and the gV gene of PRV (gilí) is under the control of the synthetic initial / late promoter (EP1LP2).

S-SPV-055 was derived from S-SPV-001 (strain Kasza). This was achieved using the homology vector 789-41.73 (see Materials and Methods) and the S-SPV-001 virus in HOMOLOGO RECOMBINATION PROCEDURE TO GENERATE AN SPV RECOMBINANT. The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING jß-GALACTOSIDASE (BLUOGAL AND CPRG ESSAYS). The final result of the red plaque purification was the recombinant virus designated S-SPV-055. This virus was tested for the expression of jß-galactosidase, purity and stability of insert by multiple ducts monitored by the blue plate assay as described in Materials and methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene.

S-SPV-055 was assayed for the expression of PRV-specific antigens using the BLACK PLATE EXAMINATION FOR EXPRESSION OF OLD GENE IN RECOMBINANT SPV. Polyclonal anti-PRV serum was shown to react specifically with the S-SPV-055 plates and not with the S-SPV-001 negative control plates. All S-SPV-055 plates observed reacted with the pig PRV antiserum indicating that the virus was being stably expressed in the foreign PRV gene. The assays 5 described here were carried out on ESK-4 cells, indicating that the ESK-4 cells were a suitable substrate for the production of the recombinant SPV vaccines.

To confirm the expression of the products of gene gB, gC and gD of the PRV, the cells were infected with the • SPV-055 and the samples of the infected cell lysates and the culture supernatants were subjected to SDS polyacrylamide gel electrophoresis. The gene was stained and analyzed using the WEST STAIN PROCEDURE. The anti-PRV serum of polyclonal pig was used to detect-the expression of PRV-specific proteins. The lysate of infected cells and the supernatants of the cells infected with S-SPV-055 • exhibited bands corresponding to 120 kd, 67 kd, and 58 kd, which are the expected size of PRV glycoprotein B; a 92 kd which is of the expected size of PRV glycoprotein C; and a 48 kd which is of the expected size for PRV glycoprotein D.

The expressed-recombinant SPV of PRV gB, gC and gD has been shown to elicit a significant immune response in the pig (37, 38), see Example 8). In addition, gB, gC and gD of PRV is expressed in the recombinant SPV, a significant protection of the challenge was obtained with the virulent PRV. (See Examples 6 and 8). Therefore, S-SPV-055 is valuable as a vaccine to protect the pig against PRV disease. Since the PRV vaccines described here do not express gX or gl of the PRV, these will be compatible with the current diagnostic tests of PRV (gX HerdChek gl HerdChek® and ClinEase®) which are used to distinguish vaccinated animals from infected animals.

Example 29 S-SPV-059 S-SPRV-059 is a pustular pig e.nfe.rmedad virus that expresses a foreign gene. The gene for E. coli β-glucuronidase (uidA) was inserted into the EcoRI restriction site in the B18R open reading frame of SPV within the K genomic fragment of SPV HindIII. The uidA gene is under the control of the late synthetic / initial promoter (LP2EP2). A partial sequence of the 3.2 kb region of the SPV of the 6.5 kb HindIII K fragment of the SPV indicates three potential open reading frames. The B18R open reading frame of the SPV shows sequence homology to the vaccinia virus B18R gene, 77.2 K rabbit fibroma virus protein, the open reading frame C19L / B25R of the vaccinia virus and the ankyrin repeat region of a variant of human brain. The B18R gene codes for a soluble interferon receptor with a high affinity and a broad specification. The B4R open reading frame of the SPV shows a sequence homology to the T5 protein of rabbit fibroma virus.

S-SPV-059 was derived from S-SPV-001 (Kasza strain). This was achieved using the homology vector 796-50.31 and the S-SPV-001 virus in HOMOLOGOUS RECOMBINATION PROCEDURE TO GENERATE RECOMBINANT SPV. The homology vector 796-50.31 was generated by inserting a round terminated Notl fragment containing the uidA cassette of LP2EP2 promoter from plasmid 551-47.23 (see Materials and Methods) into a unique EcoRI site (terminated in round form) in the fragment HindIII 6.5 kb SPV (Figure 29B). The transfection strain was examined by EXAMINATION FOR RECOMBINANT HERP VIRUS EXPRESSING ENZYMATIC MARKERS GENES. The final result of the purification of blue plate was the recombinant virus designated S-SPV-059. This virus was tested for the expression of jß-glucuronidase, purity and stability of insert through multiple ducts monitored by the blue plate assay as described in Materials and Methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene.

S-SPV-059 has been purified and expresses the foreign gene, E. coli uidA, indicating that the EcoRI site within the 6.5 kb HindIII K fragment is a stable insertion site for foreign genes. The recombinant pig pustular disease virus using this insertion site is useful for the expression of foreign antigen genes, as a vaccine against the disease or as an expression vector for raising antibodies to the foreign gene.

S-SPV-060 • S-SPV-060 is a virus of pig pustular disease that expresses a foreign gene. The gene for E. coli ß-glucuronidase (uidA) was inserted into the EcoRV restriction site unique within the genomic fragment "N HindIII SPV.The uidA gene is under the control of the synthetic late / initial promoter (LP2EP2). The partial sequence of the N HindIII fragment of 3.2 kb • SPV (SEQUENCE ID NO.) Indicates two potential open reading frames. Open reading frame 171 of SPV shows sequence homology with 17 vaccine virus protein. The I4L open reading frame of SPV shows sequence homology with the rinonucleoside diphosphate reductase gene of the vaccinia virus. Two potential open reading frames I5L and I6L, between I4L and I7L of open reading frames are of unknown function.

S-SPV-060 was derived from S-SPV-001 (strain Kasza). This was achieved using the homology vector 796-71.31 and the S-SPV-001 virus in HOMOLOGOUS RECOMBINATION PROCEDURE TO GENERATE RECOMBINANT SPV. The homology vector 796-71.31 was generated by the insertion of a terminus Notl-terminus fragment containing the cassette promoter LP2EP2 uidA from plasmid 551-47.23 (see Materials and Methods) in a single SnaBI site in the N HindIII fragment of 3.2 SPV kb (figure HA). The transfection strain was analyzed by the RECOMBINANT HERPES VIRUS EXAMINATION EXPRESSING ENZYMATIC MARKERS GENES. The final result of blue plate purification is the recombinant virus designated S-SPV-060. This virus is assayed for the expression of jß-glucuronidase, purity and stability of insert by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of purification, - the plates observed were blue indicating that the virus was pure, stable and expressed the foreign gene.

The S-SPV-060 is purified and expresses the foreign gene, E. coli uidA, indicated that the EcoRI site within the 3.2 kb N HindIII fragment is a stable insertion site for foreign genes. The recombinant pig pustular disease virus using this insertion site is useful for the expression of foreign antigen genes, as a vaccine against the disease or as an expression vector for culturing antibodies to foreign expressed genes.

S-SPV-061 S-SPV-061 is a pig pustular disease virus that expresses a foreign gene. The gene for E. coli ß-glucuronidase (uidA) was inserted into the unique SnaBI restriction site within the genomic N HindIII SPV fragment. The uidA gene is under the control of the late synthetic / initial promoter (LP2EP2). The partial sequence of the 3.2 kb N HindIII fragment of SPV indicates two potential open reading frames. The open reading frame 171 of SPV shows homology of sequences with 17 the vaccine virus protein. The open reading frame I4L of SPV shows the sequence homology with i the rinonucleoside diphosphate reductase gene of the vaccine virus. Two potential open reading frames I5L and I6L, between I4L and I7L of open reading frames are of unknown function.

S-SPV-061 was derived from S-SPV-001 (strain Kasza). This was achieved using the homology vector 796-71.41 and the S-SPV-001 virus in HOMOLOGOUS RECOMBINATION PROCEDURE TO GENERATE RECOMBINANT SPV. The homology vector 796-71.41 was generated by the insertion of a terminating Notl end fragment containing the cassette uidA LP2EP2 promoter from plasmid 551-47.23 (see Materials and Methods) in a single SnaBI site in the 3.2 kb N HindIII fragment of SPV. The transfection strain was analyzed by the RECOMBINANT HERPES VIRUS EXAMINATION EXPRESSING 5 ENZYMATIC MARKER GENES. The final result of blue plate purification is the recombinant virus designated S-SPV-061. This virus is tested by the expression of jß-glucuronidase, purity and stability of insert through multiple ducts monitored by the blue plate assay as described in Materials and 10 Methods. After three initial rounds of purification, the • Plaques observed were blue indicating that the virus was pure, stable and expressed the foreign gene.

S-SPV-061 is purified and expresses the foreign gene, - 15 E. coli uidA, indicated that the SnaBI site within the 3.2 Kb N HindIII fragment is a stable insertion site "for foreign genes. recombinant pork pustulosa • using this insertion site is useful for the expression of foreign antigen genes, such as a vaccine against disease 20 or as an expression vector for culturing antibodies to foreign expressed genes.

S-SPV-062 S-SPV-062 is a pig pustular disease virus that expresses a foreign gene. The gene for E. coli ß-glucuronidase (uidA) was inserted into the unique BglII restriction site within the genomic N HindIII SPV fragment (figure HA). The uidA gene is under the control of the late synthetic / initial promoter (LP2EP2). The partial sequence of the 3.2 kb N HindIII fragment of SPV indicates two potential open reading frames. The open reading frame 171 of SPV shows sequence homology with 17 the vaccine virus protein. The open I4L reading frame of SPV shows sequence homology with the rinonucleoside diphosphate reductase gene of vaccinia virus. Two potential open reading frames I5L and I6L, between I4L and I7L of open reading frames are of unknown function.

S-SPV-062 was derived from S-SPV-001 (strain Kasza). This was achieved using the homology vector 796-71.51 and the S-SPV-001 virus in RECOMBINATION PROCEDURE HOMOLOGO TO GENERATE A RECOMBINANT SPV. The homology vector 796-71.41 was generated by the insertion of a strict Notl end fragment containing the cassette uidA LP2EP2 promoter from plasmid 551-47.23 (see Materials and Methods) at a single BglII site on the 3.2 kb N HindIII fragment of SPV. The transfection strain was analyzed by the EXAMINATION OF RECOMBINANT HERPES VIRUS EXPRESSING MARKER GENES ENZYMATICS. The final result of blue plate purification is the recombinant virus designated S-SPV-062. This virus is assayed for the expression of jß-glucuronidase, purity and stability of insert by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of purification, the plates observed were blue indicating that the virus was pure, stable and expressed the foreign gene.

S-SPV-062 is purified and expresses the foreign gene, E. coli uidA, indicated that the BglII site within the 3.2 Kb N HindIII fragment is a stable insertion site for foreign genes. The recombinant pig pustular disease virus using this insertion site is useful for the expression of foreign antigen genes, as a vaccine against the disease or as an expression vector for cultivating antibodies to foreign expressed genes.

Example 30 The recombinant pig pustular disease virus expressing E. coli jS-galactosidase (lacZ) under the control of a late synthetic or synthetic early eruption promoter.

Three recombinant pig pustular disease viruses, S-SPV-056, S-SPV-057 and S-SPV-058 have been constructed expressing E. coli jß-galactosidase (lacZ) under the control of a synthetic pustular disease promoter, LP1, LP2 and EP1, respectively, have been constructed. • S-SPV-056 was derived from S-SPV-001 (Cepa Kasz). 5 This was achieved using the homology vector 791-63.19 (see Materials and Methods) and virus S-SPV-001 in the HOMOLOGO RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection strain was examined by the RECOMBINANT SPV EXAMINATION EXPRESSING jß-galactosidase (BLUOGAL ESSAYS AND CPRG).

S-SPV-057 was derived from S-SPV-001 (Kasza Strain). This was achieved using the homology vector 791-63.41 (see Materials and Methods) and virus S-SPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was examined by the EXAMINATION FOR SPV RECOMBINANT EXPRESSING β-galactosidase (BLUOGAL ESSAYS AND CPRG). S-SPV-058 was derived from S-SPV-001 (Cepa Kasza). This can be achieved using the homology vector 796-18.9 (see Materials and Methods) and the S-SPV-001 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The Transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING jß-galactosidase (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification were the viruses designated S-SPV-056, S-SPV-057 and S-SPV-058. The viruses were analyzed by expression of jß-galactosidase, the purity and the insert stability by means of multiple ducts monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of initial purification, all the plates observed were blue indicating that the virus was pure, stable and expressed the foreign gene.

The recombinant pig pustular disease virus expresses a foreign gene such as an E. coli jß-galactosidase in a human cell line. To optimize expression of the foreign gene, S-SPV-056, S-SPV-057 and S-SPV-058 were used to compare the optimal expression levels of E. coli jß-galactosidase under the control of viral promoters. of late or early synthetic pustular disease. Human cell lines in which expression of the recombinant pig pustular disease virus had been detected including but not limited to 143B (osteosarcoma), A431 (epodermoid carcinoma), A549 (lung carcinoma), Capan-1 (carcinoma) of liver), CF500 (skin fibroblasts), liver chang (liver), Detroit (skin fibroblasts down), HEL-199 (embryonic lung), HeLa (cervical carcinoma), HeP-2 (carcinoma of larynx epidemial), HISM (soft intestinal muscle), HNK (neonatal kidney), MRC-5 (embryonic lung), NC-H292 (lung mucoepidermoid carcinoma), OVCAR-3 (ovarian carcinoma), RD (rhabdosarcoma), THP (monocyte leukemia), IL2- NS (B lymphocyte line, non-segregating), WISH (amnion).

Example 31 S-SPV-051 The recombinant pig pustular disease virus expresses at least two foreign genes. The gene for E. coli jß-galactosidase (lacZ) and the gene for bovine viral diarrhea virus bovine glycoprotein 53 (g53) were inserted between the open reading frame SPV 617-48.1 (a unique Notl restriction site that has replaced a Accl single restriction site). The lacZ gene is under the control of the synthetic late promoter (LP1) and the g53 gene BVDV is under the control of the synthetic late / early promoter (LP2EP2).

S-SPV-051 was derived from S-SPV-001 (Cepa Kasz).

This was accomplished using the homology vector 783-39.2 (see Materials and Methods) and the S-SPV-001 virus in the HOMOLOGO RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection strain was examined by the RECOMBINANT SPV EXAMINATION EXPRESSING jß-galactosidase (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-051. These viruses were analyzed by the expression of jß-galactosidase, the purity and stability of insertion by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of initial purification, all the plates observed were blue indicating that the virus was pure, stable and expressed the foreign gene.

The S-SPV-051 was tested by the expression of BVDV specific antigens using the BLACK PLATE EXAMINATION FOR THE EXPRESSION OF GENE OUTSIDE IN RECOMBINANT SPV. A mouse monoclonal antibody to g53 BVDV was shown to react specifically with the S-SPV-051 plates and not with the negative control plates S-SPV-001. All the observed plates of S-10 SPV-051 reacted with the monoclonal antibody for g53 BVDV • indicating that the virus was stably expressing the foreign BVDV gene. The assays described here were carried out on ESK-4 cells, indicating that ESK-4 cells would be a suitable substrate for the production of recombinant-vaccines SPV.

To confirm the expression of the BVDV g53 gene product, cells were infected with SPV-051 and samples from infected cell lysates and supernatants cultures were subjected to SDS polyacrylamide gel electrophoresis. The gene was stained and analyzed using the WEST STAIN PROCEDURE. A mouse monoclonal antibody to gDV from BVDV was used to detect the expression of BVDV-specific proteins. The cell lysate and the The supernatant of the S-SPV-051 INFECTED CELLS exhibited bands at 53 kd and higher indicating the glycosylated and non-glycosylated forms of the g53 BVDV protein.

S-SPV-051 is useful as a vaccine in cattle against BVDV infection and is useful for the expression of glycoprotein 53 of BVDV.

Example 32 S-SPV-044 S-SPV-044 is a pig pustular disease virus that expresses at least two foreign genes. The gene for E. coli jß-galactosidase (lacZ) and the gene for the infectious bursal disease virus polymerase protein IBDV) were inserted from 617-48.1 ORF (a unique NotI site that has replaced a single Accl restriction site). The lacZ gene is under the control of the synthetic late promoter (LP1), and the IBDV polymerase gene is under the control of the late synthetic / initial promoter (LP2EP2).

S-SPV-044 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 749. 75.78 (see Materials and Methods) and virus S-SPV-001 in HOMOLOGO RECOMBINATION PROCEDURE TO GENERATE AN SPV RECOMBINANT. The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING β-GALACTOSIDASE (BLUOGAL AND CPRG ESSAYS). The final result of the red plaque purification was the recombinant virus designated S-SPV-044.

This virus was tested for the expression of β-galactosidase, purity and stability of insert by multiple ducts monitored by the blue plate assay as described in Materials and methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene.

S-SPV-044 is useful for the expression of IBDV protein polymerase. S-SPV-044 is useful in an in vitro approach for an attenuated recombinant IBDV vaccine. The strains of RNA from the attenuated IBDV strain were synthesized in a bacterial expression system using T3 or T7 promoters (pBlueScript plasmid, Stratagene, Inc.) to synthesize short and long segments of double strain of the IBDV genome. The double-stranded RNA segments of IBDV and S-SPV-044 are transfected into the CEF cells: The pig pustular disease virus expresses the IBDV polymerase but does not duplicate in the CEF cells. The IBDV polymerase produced from S-SPV-044 synthesizes the attenuated IBDV virus infectious from the double-stranded RNA genomic tempers. The resulting attenuated IBDV virus is useful as a vaccine against infectious bursal disease in chickens.

Example 33 S-SPV-046 S-SPV-046 is a virus of pig pustular disease that expresses at least two foreign genes. The gene for E. coli / 3-galactosidase (lacZ) and the gene for feline immunodeficiency virus (FIV) gag protease (gag) were inserted into ORF 738-94.4 (a deletion of 773 base pairs ORL of OlL of SPV, deletion of nucleotides 1669 to 2452, SEQUENCE ID NO: 189). The lacZ gene is under the control of the OlL promoter of pig pustular disease, and the gag FIV gene is under the control of the late synthetic / initial promoter (LP2EP2).

S-SPV-046 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 761.75.B18 (see Materials and Methods) and the S-SPV-001 virus in HOMOLOGOUS RECOMBINATION PROCEDURE TO GENERATE RECOMBINANT SPV. The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING jß-GALACTOSIDASE (BLUOGAL AND CPRG ESSAYS). The final result of the red plaque purification was the recombinant virus designated S-SPV-046.

This virus was tested for the expression of jß-galactosidase, purity and stability of insert by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene.

To confirm the expression of the gag FIV gene product, the cells were infected with SPV-046 and the samples of the infected cell lysates and the culture supernatants were subjected to SDS polyacrylamide gel electrophoresis. The gene was stained and analyzed using the WEST STAIN PROCEDURE. Feline anti-FIV serum (strain PPR) was used to detect FIV-specific proteins.

The cell lysate and supernatant of S-SPV-046 infected cells exhibited bands at 26 kd and 17 kd which are of the expected sizes. of the processed form of the gag FIV protein. The disease virus, pustular recombinant pig expressed FIV gag protein was properly processed and segregated into the culture medium.

S-SPV-048 S-SPV-048 is a virus of pig pustular disease that expresses at least two foreign genes. The gene for E. coli jß-galactosidase (lacZ) and the gene for the envelope of (env) feline immunodeficiency virus (FIV) were inserted into the ORF 617 48.1 of SPV (a unique Notl restriction site has replaced a site Single Accl restriction site The lacZ gene is under the control of the synthetic late promoter (LP1), and the FIV env gene is under the control of the synthetic late / initial promoter (LP2EP2) .The S-SPV-048 was derived from the S- SPV-001 (Kasza strain) This was achieved using the homology vector 781-84.C11 (see Materials and Methods) and the S-SPV-001 virus in HOMOLOGO RECOMBINATION PROCEDURE TO GENERATE A SPV RECOMBINANT. The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING jß-GALACTOSIDASE (BLUOGAL AND CPRG ESSAYS). The final result of the red plaque purification was the recombinant virus designated S-SPV-048.

This virus was tested for the expression of β-galactosidase, purity and stability of insert by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene.

S-SPV-046 and S-SPV-048 are useful alone or in combination as a vaccine in cats against FIV infection and are useful for the expression of FIV gag and env proteins. A recombinant pig pustular disease virus expressing both the FIV gag and env proteins are useful as a vaccine in cats against FIV infection.

The recombinant pig pustular disease virus expressing the F and G proteins of the syncytial virus of • Human breathing are useful as a vaccine against human disease. 5 Example 34 In Vitro Property of Chicken IFN Expressed in Recombinant Pustular Disease Virus. 10 • The growth properties of recombinant viruses in cell culture. The growth properties of recombinant S-SPV-042 were not effected in the kidney cells of embryonic pig (ESK-4). compared to wild-type pig pustular disease virus.- The western blot analysis carried out on the supernatants of the cells infected with the recombinant virus SPV / cIFN. Rabbit and mouse antisera were raised against cIFN from concentrated SPV / cIFN-infected supernatants and pre-clarified against ESK-4 cells infected with wild-type SPV in preparation for western analyzes. The anti-cIFN antisera reacted with denatured proteins on the Nitrocellulose from the infected supernatants of wild-type virus SPV and SPV / recombinant cIFN. A reactive band with an estimated molecular weight size range of 17-20 kilodaltons was presented in the SPV / cIFN line section, and absent in the SPV wild type control lines.

Effect of cIFN expressed in supernatants of cells infected with SPV / cIFN (S-SPV-042), FPV / cIFN and FPV / cIFN / NDV on the growth of Vesicular Stomatitis Virus.

The clarified virion supernatants of SPV / cIFN infected cells, FPV / cIFN and FPV / cIFN / NDV were tested for the presence of viral inhibitory activity, the results are shown in Table 1. Briefly, the CEF cells were incubated with supernatants diluted in series. Subsequently, 40,000 plaque forming units (pfu) / well; of vesicular stomatitis virus (VSV) were added and 48 hours Then, the wells were rated for the presence of the cytopathic effect of VSV (CPE). The recombinant viral supernatants containing the cIFN were shown to inhibit the VSV induced by CPE, whereas, the viral control supernatants did not. The cytopathic effect induced by VSV can be reversed in the presence of rabbit anti-cIFN serum.

Table 1 Viral Supernatants Recombinant cIFN activity (units / ml) SPV / IFN 2,500,000 SPV < 100 FPV / IFN 250,000 FPV / cIFN / NDV 250,000 FPV > 100 One unit of cIFN activity is defined as the dilution of pustular disease virus supernatant which 100% VSV CPE was inhibited.

Effect of expressed cIFN of supernatants of infected SPV / cIFN cells on turkey herpes virus.

The supernatant containing recombinant cIFN of ESK-4 cells infected with the SPV / cIFN virus was tested for its ability to inhibit the growth of turkey herpes virus (HVT) in CEF cells, the results are shown in Table 2. Briefly, supernatants diluted in series were incubated with CEF cells, and then subsequently infected with 100 pfu / well of wild type HVT. The plates were counted in all the wells after 48 hours. Units of 10-100 of cIFN activity were shown to inhibit the formation of HVT plate (100 pfu / well). Supernatants of the wild type SPV did not inhibit the formation of HVT plate.

Table 2 Supernatant SPV / cIFN Number of HVT plates (units / mla) 0 99 1000 0 100 0 10 45 to. A unit of cIFN activity is defined as the dilution of pustular disease virus supernatant which is 100% VSV. CPE was inhibited.

Induction of NO by chicken macrophages after treatment with cIFN expressed in supernatants of infected SPV / cIFN cells.

The HD 11 cells or bone marrow adherent cells were incubated with 1000 units / ml cIFN of the supernatants SPV / cIFN, lipopolysaccharide (LPS) (6ng / ml) or with both the cIFN and the LPS, the results are shown in Table 3. After 24 hours, the supernatant fluids were collected and the nitrite levels were measured. These data demonstrate that the expressed cIFN of the SPV / cIFN supernatants have the ability to activate chicken macrophages in the presence of LPS.

Table 3 Conclusions 1. Recombinant pig pustular disease viruses express biologically active chicken interferon in the supernatants of infected cells, as measured by protection of the CEF cell from the VSV infection. 2. Chicken interferon expressed in supernatants of the infected SPV / recombinant cIFN cells has been shown to protect the CEF cell against infection with HVT in a dose that is manner dependent. 3. The expressed chicken interferon from SPV / cIFN acted synergistically with the LPS to activate chicken macrophages as detected by induction of nitric oxide. 4. The above data indicate that recombinant pig pustular disease viruses expressed as chicken IFN may have beneficial applications as immune modulating agents in vitro, in vivo and in egg.

Example 35 As an alternative to building the IBD vaccine using a viral vector delivery system and / or subunit approaches, the IBD virus RNA is engineered to be manipulated directly by reconstructing the virus using the full-length RNA derived from the cDNA clones representing both RNA subunits of double large strain (segment A) and small (segment B). The generation of IBD virus is this way that offers several advantages over "the first two approaches." First, if the IBD virus is regenerated using hardened RNA, one is able to manipulate the cloned cDNA copies of the viral genome before transcription (generation of RNA) Using this approach, it is possible to either attenuate a virulent IBD strain or replace the variable region VP2 of the attenuated vaccine column with that of the virulent strains.In doing so, the present invention provides protection against the strain Virulent IBDV while at the same time providing the safety and efficiency of the vaccine strain.In addition, using this approach, the present invention constructs and tests temperature-sensitive IBD viruses using RNA polymerase derived from the infectious pancreatic necrosis virus birnavirus (IPNV ) and the polyprotein derived from IBDV The IPNV polymerase has an optimal activity at a lower temperature than that of the IBDV The IPNV polymerase recognizes the 5 regulatory signals present on IBDV, the hybrid virus is expected to be attenuated at the high temperatures present in chickens. Alternatively, it is possible to construct test IBD viruses generated using the RNA polymerase derived from IBDV serotype 2 virus and the protein derived from IBDV serotype 1 virus. • The cDNA clones representing the complete IBDV genome (segments A and B double-stranded RNA) were constructed, initially using the BursaVac vaccine strain (from Sterwin Laboratories). Once the cDNA_ clones representing the full-length copies of segments A and B are constructed, RNA annealing was prepared. Given that the IBDV exists as an RNA virus of double-disseginated strain, both strains of sense and antisense RNA of each segment were produced using the pBlueScript plasmid; Stratagene, Inc.). These vectors use the highly specific phage promoters SP6 or T7 to produce the quantities of RNA substrate in vitro. A single restriction endonuclease site was designed in the 3 'PCR primer to line the DNA for the generation of transcripts run during transcription.

Purified RNA transcripts (four strains) were transfected into chicken embryo fibroblast (CEF) cells to determine if the RNA is infectious. If the IBD virus is generated, as determined by black plate assays using the Mabs specific IBDV, no additional manipulations are required and the vaccine strain design can begin. The advantage of this method is that the designed IBD viruses generated in this way will be pure and will require little or no purification, mostly decreasing the time required to generate new vaccines. If negative results are obtained using purified RNAs, functional viral RNA polymerase is required through the use of an auxiliary virus. The birnaviruses duplicate their nucleic acid by shifting the strain (semi-conservative) with the RNA polymerase, agglutinating the ends of the double-stranded RNA molecules forming circular ring structures (Muller &Nitschke, Virology 159, 174-177, 1987). . The open reading frame polymerase of about 878 amino acids in the pig pustular disease virus expressed in this recombinant virus (S-SPV-044) was used to provide the polymerase of IBDV RNA in trans. The pig pustular disease virus expressed foreign antigens recognizable immunologically in poultry cells (CEF cells) where there is no evidence of productive duplication of the viral vector. In the present invention the IBDV polymerase protein is expressed in the same cells as the transfected RNA using the pig pustular disease vector without contamination of the cells with duplication of SPV.

With the demonstration that the IBD virus is generated in vitro using genomic RNA, attenuated virus vaccines against infectious bursal disease were developed. Using recombinant DNA technology together with the newly defined system to generate IBD virus, specific deletions within the viral genome, facilitating the construction of attenuated viruses was done. Using this technology, the IBDV region responsible for virulence is identified and attenuated immunogenic IBDV vaccines are generated. The present invention provides a virulent IBD strain or replacement of the variable region VP2 of the attenuated vaccine column with that of a virulent strain, thus protecting against the virulent strain while providing the safety and efficacy of the vaccine strain. .

Example 36 The effects of the rabbit antipollo interferon antibody (cIFN) on the growth of turkey herpes virus.

SPV / cIFN supernatants (SPV 042) infected with ESK-4 cells were harvested 48 hours after infection and concentrated 5-10 times, using Centricon 10 columns (Amicon). One ml of concentrated supernatant was injected into a rabbit three times, at intervals of three weeks, and then bled. This rabbit antiserum was then used in the culture to study the effect of interferon on the growth of HVT. It was shown that the anti-cIFN inverts the block to HVT (1: 200) and the VSV (1:80) growth induced by the addition of cIFN in plaque assays. In addition, it was shown that the addition of the anti-cIFN (1: 100) in the medium of transiently transfected CEFs with levels of subplates of viral DNA HVT improves, the formation of the HVT plates (200 plates / well). The CEFs transfected with HVT DNA in the absence of the anti-cIFN did not give plaques.

HVT is highly susceptible to interferon - produced from CEFs and then when cIFN is blocked, HVT growth is improved.

Applications include: (1) using the antibody for cIFN as an additive to increase HVT concentrations in vaccine strains; (2) use the antibody for cIFN as an additive to facilitate the formation of new recombinant HVT viruses through cosmid reconstructions.

S-SPV-063 S-SPV-063 is a pig pustular disease virus that expresses at least two foreign genes. The gene for 3-galactosidase E. coli (lacZ) and the gene for the pig-influenced virus (SIV) NP (H1N1) were inserted into the open reading frame SPV 617-48.1 (a unique restriction site Notl has repositioned a single AccI restriction site The lacZ gene is under synthetic late control (LP1) and the SIV NP gene is under the control of the synthetic late / initial promoter (LP2EP2).

S-SPV-063 was derived from S-SPV-001 (strain Kasza). This was accomplished using the homology vector 807-41.3 (see Materials and Methods) and the S-SPV-001 virus in HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING / 3-GALACTOSIDASE (BLUOGAL AND CPRG ESSAYS). The final result of the red plaque purification was the recombinant virus designated S-SPV-063. This virus was tested for the expression of jß-galactosidase, purity and stability of insert by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene.

S-SPV-063 was examined for the expression of SIV-specific antigens using the BLACK PLATE EXAMINATION OF GENE EXPRESSION IN RECOMBINANT SPV. The polyclonal anti-SIV serum or a polyclonal goat anti-NP serum was shown to react specifically with the S-SPV-063 plates and not with the S-SPV-001 negative control plates. All the S-SPV-063 plates observed reacted with the pig SIV antiserum or the goat anti-NP serum indicating that the virus was being stably expressed in the foreign SIV gene. The assays described here were carried out on ESK-4 cells, indicating that ESK-4 cells were a suitable substrate for the production of recombinant SPV vaccines. - To confirm the expression of the SIV NP gene products, the cells were infected with S-SPV-063 and samples from the infected cell lysates and culture supernatants were subjected to SDS polyacrylamide gel electrophoresis. The gene was stained and analyzed using the WEST STAIN PROCEDURE. Polyclonal pig anti-SIV serum or a polyclonal goat anti-NP serum was used to detect the expression of SIV-specific proteins. Cell lysate and the supernatant of cells infected with S-SPV-O63 exhibited bands corresponding to 56 kd, which are the expected size of the SIV NP protein.

S-SPV-063 is useful as a vaccine for swine against SIV infection and is useful for expression of NP from SIV. S-SPV-063 is useful as a vaccine in combination with the S-SPV-066 which expresses NA and S-SPV-065 which expresses the HA of SIV.

S-SPV-064 S-SPV-064 is a virus of pig pustular disease that expresses a foreign gene. The gene for E. coli jß-glucuronidase (uidA) was inserted into the unique Xhol restriction site within the genomic J HindIII fragment of 6.9 kb of SPV. The uidA gene is under the control of the late synthetic / initial promoter (LP2EP2). The J HindIII genomic fragment contains part of A50R ORF (aa 227 to 552). The unique Xhol site is not within the ORF A50R. The Xhol site is 25 kb from the 3 'end of the pig pustular disease virus genome (62).

S-SPV-064 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 807. 42.28 and the S-SPV-001 virus in HOMOLOGO RECOMBINATION PROCEDURE TO GENERATE A RECOMBINANT SPV. The homology vector 807-42.28 was generated by inserting a round terminated Notl fragment containing the uidA cassette of LP2EP2 promoter from plasmid 551-47.23 (see Materials and Methods) into a single NotI site (unique Xhol site converted to Notl by a DNA linker) in the J HindIII fragment of 6.9 kb of SPV. The transfection strain was examined by EXAMINATION FOR RECOMBINANT HERP VIRUS EXPRESSING ENZYMATIC MARKERS GENES. The final result of blue plate purification was the recombinant virus designated S-SPV-064. This virus was tested for the expression of jß-glucuronidase, purity and stability of insert by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene. : - .. - - "- - ._: _: .- 'S-SPV-064 is purified and expresses the foreign gene, E. coli uidA, indicating that the Xhol site within the J HindIII fragment of 6.9 kb is A stable insertion site for foreign genes The recombinant pig pustular disease virus using this insertion site is useful for the expression of foreign antigen genes, as a vaccine against the disease or as an expression vector to elevate the antibodies for the foreign gene.

S-SPV-065 S-SPV-065 is a pig pustular disease virus that expresses at least two foreign genes. The gene for E. coli jß-galactosidase (lacZ) and the gene for swine influenza virus (SIV) HA (H1N1) were inserted into the ORV 617 48.1 of SPV (a unique Notl restriction site has replaced a site of Accl restriction only). The lacZ gene is under the control of the synthetic late promoter (LP1), and the HA of SIV is under the control of the late synthetic / initial promoter (LP2EP2).

S-SPV-065 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 807-84.8 (see Materials and Methods) and the virus S-SPV-001 in HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING jß-GALACTOSIDASE (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-065. This virus was tested for the expression of / 3-galactosidase, purity and stability of insert through multiple ducts monitored by the blue plate assay as described in Materials and Methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene.

S-SPV-065 was assayed for the expression of SIV-specific antigens using the BLACK PLATE EXAMINATION FOR EXPRESSION OF OUTSIDE GENE IN RECOMBINANT SPV. The polyclonal pig anti-SIV serum or a polyclonal goat anti-HA serum was shown to react specifically with the S-SPV-065 plates and not with the negative control plates S-SPV-001. All S-SPV-065 plates observed reacted with the pig SIV antiserum or the SIV foreign gene. The assays described here were carried out on ESK-4 cells, indicating that ESK-4 cells were a suitable substrate for the production of vaccines • SPV recombinants.

To confirm the expression of the SIV NP gene products, the cells were infected with SPV-065 and the , samples of the infected cell lysates and culture supernatants were subjected to SDS polyacrylamide gel electrophoresis. The gene was stained and analyzed using the WEST STAIN PROCEDURE. Polyclonal pig anti-SIV serum or a polyclonal goat anti-HA serum was used to detect the expression of SIV-specific proteins. The lysate of infected cells and the supernatants of the cells infected with S-SPV-065 exhibited bands corresponding to 64 kd, which are the expected size of the HA protein of SIV.

S-SPV-065 is useful as a vaccine for swine against SIV infection and is useful for the expression of SIV HA. S-SPV-065 is useful as a vaccine in combination with S-SPV-066 which expresses NA and S-SPV-063 which expresses SIV NP.

S-SPV-066 S-SPV-066 is a virus of pig pustular disease that expresses at least two foreign genes. The gene for E. coli jß-galactosidase (lacZ) and the gene for swine influenza virus (SIV) HA (H1N1) were inserted into the ORF 617-48.1 of SPV (a unique Notl restriction site has replaced a site of Accl restriction only). The lacZ gene is under the control of the synthetic late promoter (LP1), and the SIV HA is under the control of the late synthetic / initial promoter (LP2EP2). - S-SPV-066 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 807-84.35 (see Materials and Methods) and the virus S-SPV-001 in HOMOLOGO RECOMBINATION PROCEDURE TO GENERATE RECOMBINANT SPV.- The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING 3-GALACTOSIDASE (BLUOGAL AND CPRG ESSAYS). The final result of the red plaque purification was the recombinant virus designated S-SPV-066.

This virus was tested for the expression of jß-galactosidase, purity and stability of insert by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the ajen gene.

To confirm the expression of the SIV NP gene products, the cells were infected with SPV-066 and the samples of the infected cell lysates and the culture supernatants were subjected to SDS polyacrylamide gel electrophoresis. The gene was stained and analyzed using the WEST STAIN PROCEDURE. Polyclonal anti-SIV serum or a polyclonal goat anti-HA serum was used to detect the expression of SIV-specific proteins. The lysate of infected cells and the supernatants of the cells infected with S-SPV-06.6 exhibited bands corresponding to 64 kd, which are the expected size of the HA protein of SIV.

S-SPV-066 is useful as a vaccine for swine against SIV infection and is useful for the expression of SIV HA. S-SPV-066 is useful as a vaccine in combination with the S-SPV-065 which expresses HA and S-SPV-063 which expresses NP of SIV.

S-SPV-071 S-SPV-071 is a virus of pig pustular disease that expresses at least four foreign genes. The gene for E. coli S-galactosidase (lacZ) and the genes for (SIV) HA (H1N1) and NA (H1N1) of swine influenza virus (SIV) were inserted into the ORF of 617 48.1 SPV (a unique Notl restriction site has replaced a restriction site Accl only). The lacZ gene is under the control of the synthetic late promoter (LP1), and the SIV HA and NA genes are under the control of the synthetic late / initial promoter (LP2EP2).

S-SPV-071 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 816-86.35 (see Materials and Methods) and the S-SPV-001 virus in HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING β-GALACTOSIDASE (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-071. This virus was tested for the expression of jß-galactosidase, purity and stability of insert by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene.

S-SPV-071 was assayed for the expression of SIV-specific antigens using the BLACK PLATE EXAMINATION FOR EXPRESSION OF OUTSIDE GENE IN RECOMBINANT SPV. The polyclonal goat anti-HA serum was shown to react specifically with the S-SPV-071 plates and not with the S-SPV-001 negative control plates. All the S-SPV-071 plates observed reacted with the goat HA antiserum indicating that the virus was stable expressing the foreign SIV gene. The assays described here were carried out on ESK-4 cells, indicating that ESK-4 cells were a suitable substrate for the production of recombinant vaccines SPV._ __ _ - ._ __. .. -_. . . .. -_ - .-- _. .. To confirm the expression of the SIV HA and NA gene products, the cells were infected with SPV-071 and the samples of the infected cell lysates and the culture supernatants were subjected to SDS polyacrylamide gel electrophoresis. . The gene was stained and analyzed using the WEST STAIN PROCEDURE. A polyclonal anti-SIV serum or a polyclonal goat anti-HA serum was used to detect the expression of SIV-specific proteins. Lysate of infected cells and supernatants of cells infected with S-SPV-071 exhibited bands corresponding to 64 kd and 52 kd, which are the expected size of the SIV HA and NA protein.

S-SPV-071 is useful as a vaccine for swine against SIV infection and is useful for the expression of SIV-HA. S-SPV-071 is useful as a vaccine in combination with S-SPV-063 which expresses SIV NP.

S-SPV-074 S-SPV-074 is a pig pustular disease virus that expresses at least four foreign genes. The gene for E. coli S-glucuronidase (uidA) and the genes for swine influenza virus (SIV) HA (H1N1) and NA (H1N1) were inserted-within the ORF of 617 48.1 SPV (a Notl restriction site only one Accl restriction site has been replaced). The uidA gene is under the control of the late synthetic / initial promoter (LP2EP2), and the SIV HA and NA genes are under the control of the late synthetic / initial promoter (LP2EP2).

S-SPV-074 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 817.14.2 (see Materials and Methods) and the S-SPV-001 virus in HOMOLOGOUS RECOMBINATION PROCEDURE TO GENERATE RECOMBINANT SPV. The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING β-galactosidase (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-074. This virus was tested for the expression of jß-galactosidase, purity and stability of insert by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene.

S-SPV-074 was assayed for the expression of SIV-specific antigens using the BLACK PLATE EXAMINATION FOR EXPRESSION OF OUTSIDE GENE IN RECOMBINANT SPV. The polyclonal anti-SIV serum was shown to react specifically with the S-SPV-074 ~ plates with the S-SPV-001 negative control plates. All the S-SPV-074 plates observed reacted with the goat HA antiserum indicating that the virus was stable expressing the foreign SIV gene. The assays described here were carried out on ESK-4 cells, indicating that ESK-4 cells were a suitable substrate for the production of recombinant SPV vaccines.

S-SPV-074 is useful as a vaccine in a pig against SIV infection and is useful for expressing SIV HA and NA. S-SPV-074 is useful as a vaccine in combination with S-SPV-063 which expresses SIV NP, S-SPV-063, -065, -066, -071 and -074 are useful alone or in combination as a vaccine in a pig against the infection of swine influenza and are useful for the expression of proteins SIV NP, HA and NA.

S-SPV-068 S-SPV-068 is a pig pustular disease virus that expresses at least two foreign genes. The gene for E. coli jβ-galactosidase (lacZ) and the gene for the chicken macrophage migration inhibitory factor (cMIF) were inserted into the ORF 738-94.4 (a deletion of 773 base pairs of the OlL ORF of SPV; deletion of nucleotides 1679 to 2452, SEQUENCE ID NO: 189). The lacZ gene is under the control of the disease promoter, pig, pustulose, and the cMIF gene is under the control of the late synthetic / initial promoter (LP2EP2).

S-SPV-068 was derived from S-SPV-001 (Cepa Kasza) '. This was achieved using the homology vector 802-95.Al (see Materials and Methods) and the S-SPV-001 virus in HOMOLOGO RECOMBINATION PROCEDURE TO GENERATE A SPV RECOMBINANT. The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING ß-galactosidase (BLUOGAL AND CPRG ESSAYS). The final result of the red plaque purification was the recombinant virus designated S-SPV-068.

This virus was tested for the expression of jß-galactosidase, purity and stability of insert by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene.

To confirm the expression of the cMIF gene products, the cells were infected with SPV-068 and the samples of the infected cell lysates and the culture supernatants were subjected to SDS polyacrylamide gel electrophoresis. The gene was stained and analyzed using the WEST STAIN PROCEDURE. An antihuman goat anti-human cMIF antibody was used to detect the expression of cMIF-specific proteins. The lysate of infected cells and the supernatants of the cells infected with S-SPV-068 exhibited a band corresponding to approximately 15 kd, which is the expected size of the cMIF protein.

S-SPV-068 is useful as a vaccine in chickens to inhibit the migration of macrophages and to stimulate an immune response against infection by poultry pathogens. S-SPV-068 is useful for the expression of cMIF.

VECTOR OF HOMOLOGY 802-95.Al. Plasmid 802-95.1 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene of E. coli β-galactosidase (lacZ) and a gene of inhibitory factor of migration • of chicken macrophage (cMIF) flanked by SPV DNA. Upstream of the foreign gene is a fragment of approximately 855 5 base pairs of the SPV DNA. Downstream of the foreign genes is a fragment of approximately 1113 base pairs of the SPV DNA. When the plasmid is used according to the HOMOLOGO RECOMBINATION PROCEDURE TO GENERATE A RECOMBINANT SPV, a virus containing DNA encoded for the genes will result others. Note that the β-galactosidase marker gene (lacZ) • is under the control of an OlL gene promoter of pig pustular disease virus and the cMIF gene is under the control of the late / initial promoter (LP2EP2). The cMIF gene cassette of LP2EP2 was inserted into the BaraHI site of the homology vector 752-22.1. The homology vector 802-95.Al was constructed using the standard recombinant DNA techniques (22, 30), by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2519 base pairs HindIII to Sphl from pSP65 (Promega). Fragment 1 is a subfragment of approximately 855 base pairs of the HindIII restriction M fragment of SPV (23) synthesized by polymerase chain reaction using primers 5 'DNA GAAGCATGCCCGTTCTTATCAATAGTTTAGTCGAAAATA-3' and 5 '-CATAAGATCTGGCATTGHTGTTATTATACTAACAAAATAAG-3' to produce a fragment of 855 base pairs with Sphl and BglII termini. Fragment 2 is a fragment of 3002 base pairs of BamHI to PvuII derived from plasmid pJF751 (49) containing the E. coli lacZ gene. Fragment 3 is a fragment of approximately 363 base pairs BglII encoded for the cMIF gene (63) derived from reverse transcription and polymerase chain reaction (PCR) (Sambrook et al., 1989) of a CONCAVALIN RNA ISOLATED UNAS CELLS OF STIMULATED CHICKEN SPICES. The antisense primer used for reverse transcription and PCR was 5 'TCGAAGATCTTCTCATGCAAAGGTGGAACCGTTC-3' (6 / 95.28; SEQUENCE ID NO: 58). The perceived primer used for the PCR was 5 'TCGAAGATCTCATGCCTATGTTCACCATCCACAC-3 • (6 / 95.27; SEQUENCE ID NO: 59). The DNA fragment contains the open reading frame of 121 amino acids of the chicken macrophage migration inhibitory factor pin. The native methionine codon of cMIF is preceded by the amino acid codons for met-asn-ser-asp-lys. Fragment 4 is a subfragment of approximately 1113 base pairs of the M HindIII fragment of SPV synthesized by polymerase chain reaction using primers 5 'DNA -CCGTAGTCGACAAAGATCGACTTATTAATATGTATGGGATT-3' (and 5 'GCCTGAAGCTTCTAGTACAGTATTTACGACTTTTGAAAT-3' to produce a fragment of 1113 base pairs with the Salí and HindIII ends.

S-SPV-069 S-SPV-069 is a virus of pig pustular disease that expresses at least two foreign genes. The gene for E. coli jß-galactosidase (lacZ) and the gene for the fusion pin (F) of respiratory syncytial virus (HRSV) were inserted into the ORF 738-94.4 of SPV (a deletion of 773 base pairs of the ORF OlL of SPV, deletion of nucleotides 1679 to 2452, SEQUENCE ID NO: 189). The lacZ gene is under the control of the P01L promoter of pig pustular disease, and of the F gene of HRSV under the control of the late synthetic / initial promoter (LP2EP2). S-SPV-069 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 810.29.A2 (see Materials and Methods) and the S-SPV-001 virus in HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING jß-galactosidase (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-069- This virus was tested for the expression of β-galactosidase, purity and stability of insert by multiple ducts monitored by the blue plate assay as it was described in Materials and Methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene.

S-SPV-069 was assayed for the expression of HRSV-specific antigens using the BLACK PLATE EXAMINATION FOR EXPRESSION OF OUTSIDE GENE IN RECOMBINANT SPV. Serum monoclonal antibody 621 (Biodesign, Inc.) against F of HRSV was shown to react specifically with the S-SPV-069 plates and not with the negative control plates S-SPV-001. All the observed plates of S-SPV-069 reacted with the monoclonal antibody 621 indicating that the virus was stable expressing the foreign PRV gene. The assays described here were carried out on ESK-4 cells, indicating that ESK-4 cells were a suitable substrate for the production of recombinant SPV vaccines.

S-SPV-078 S-SPV-078 is a pig pustular disease virus that expresses at least two foreign genes. The gene for E. coli / S-galactosidase (lacZ) and the gene for. the human respiratory syncytial virus (G) subjection protein (G) were inserted into the ORF 617 48.1 of the SPV (a single Notl restriction site has replaced a single Accl restriction site.) The lacZ gene is under the control of the promoter late / initial synthetic (LP2EP2), and the HRSV gene of the late synthetic / initial promoter (LP2EP2).

S-SPV-078 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 822-52G7 (see Materials and Methods) and virus S-SPV-001 in HOMOLOGO RECOMBINATION PROCEDURE TO GENERATE AN SPV RECOMBINANT. The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING jß-galactosidase (BLUOGAL ESSAYS AND CPRG). The final result of purification • Red plaque was the recombinant virus designated S-SPV-078. This virus was tested for β-galactosidase expression, purity and insert stability by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene. • S-SPV-068 and S-SPV-078 are individually useful or in combination as a vaccine in pigs against human respiratory syncytial virus infection and are useful for expression of HRSV F and G genes.

VECTOR OF HOMOLOGY 810-29.A2. Plasmid 810-29A2 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene of E. coli β-20 galactosidase (lacZ) and a fusion gene (F) of human respiratory syncytial virus (HRSV) flanked by the SPV DNA. Upstream of the foreign gene is a fragment of approximately 855 base pairs of the SPV DNA. Down the foreign genes is a fragment of approximately 1113 base pairs of DNA of SPV. When the plasmid is used according to the HOMOLOGOUS RECOMBINATION PROCEDURE TO GENERATE RECOMBINANT SPV, a virus containing DNA encoded for the foreign genes will result. Note that the β-galactosidase marker gene (lacZ) is under the control of an OlL gene promoter of pig pustular disease virus and the F gene of HRSV is under the control of the late / initial promoter (LP2EP2). The homology vector was constructed using standard recombinant DNA techniques (22, 30), by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2519 base pairs HindIII to Sphl from pSP65 (Promega). Fragment 1 is a subfragment of approximately 855 base pairs of the HindIII restriction M fragment of SPV (23) synthesized by polymerase chain reaction. using DNA primers 5 '-GAAGCATGCCCGTTCTTATCAATAGTTTAGTCGAAAATA-' and 5'-CATAAGATCTGGCATTGTGTTATTATACTAACAAAAATAAG-3 'to produce a fragment of 855 base pairs with Sphl and BglII termini. Fragment 2 is a fragment of 3002 base pairs of BamHI to PvuII derived from plasmid pJF751 (49) containing the E. coli lacZ gene. Fragment 3 is an EcoRI restriction fragment of approximately 1728 base pairs synthesized by reverse transcriptase and polymerase chain reaction (PCR) (15, 42) using RNA from Strain A2 of HRSV (ATCC VR-1302). The primer (5 'GCCGAATTCGCTAATCCTCAAAGCAAATGCAAT-3', 4 / 95.23) is synthesized from the 5 'end of the HRSV F gene, and inserted into an EcoRI site at the 5' end of the gene and an ATG start codon.

The primer (5 '-GGTGAATTCTTTATTTAGTTACTAAATGCAATATTATTT-3'; 4 / 95.24) is synthesized from the 3 'end in the HRSV gene and was used for a transcript Reverse and polymerase chain reaction. The PCR product was digested with EcoRI to give a fragment of 1728 base pairs in length corresponding to the F gene of HRSV. Fragment 4 is a subfragment of approximately 1113 base pairs of the M HindIII fragment of SPV synthesized by polymerase chain reaction using primers 5 'DNA -CCGTAGTCGACAAAGATCGACTTATTAATATGTATGGGATT-3' and 5'GCCTGAAGCTTCTAGTACAGTATTTACGACTTTTGAAAT-3 'to produce a fragment of 1113 pairs of base with ends Salí and HindIII.

VECTOR OF HOMOLOGY 822-52G.7. Plasmid 822-, 52G.7 was constructed for the purpose of inserting foreign DNA. in the SPV. This incorporates a marker gene of E. coli β-galactosidase (lacZ) and a human respiratory syncytial virus (HRSV) subjection gene (G) flanked by the SPV DNA. Upstream of the foreign genes is a fragment of approximately 1484 base pairs of the SPV DNA. Down the foreign genes is a fragment of approximately 2149 base pairs of the SPV DNA. When this plasmid is used according to the HOMOLOGO RECOMBINATION PROCEDURE TO GENERATE A RECOMBINANT SPV, a virus containing DNA encoded for the foreign genes will result. Note that the β-galactosidase marker gene (lacZ) is under the control of a late / initial promoter of synthetic pustular disease (LP2EP2) and the G gene of HRSV is under the control of the late / initial synthetic pustular disease promoter (LP2EP2 ). This was constructed using standard recombinant DNA techniques (22 and 30), by joining the restriction fragments from the following sources. The plasmid vector was derived from a restriction fragment of approximately 2972 base pairs HindIII to BamHI (Promega). Fragment 1 is a restriction subfragment of approximately 1484 base pairs Accl to BglII of the M fragment of SPV HindIII (23). Fragment 2 is a restriction fragment of about 3006 base pairs of BamHI to PvulI of plasmid pJF751 (11). Fragment 3 is an EcoRI restriction fragment of approximately 899 base pairs synthesized by reverse transcriptase and polymerase chain reaction (PCR) (15, 42) using RNA from Strain A2 of HRSV. (ATCC VR-1302). - The primer (5 'GCCGAATTCCAAAAACAAGGACCAACGCAC-3'; 4 / 95.22) is synthesized from the 5 'end of the HRSV F gene, and is introduced into an EcoRI site at the 5' end of the gene and an ATG start codon. The primer (5 'GCCGAATTCACTACTGGCGTGGTGTGTTG-3'; 4 / 95.26) is synthesized from the 3 'end of the HRSV gene and used for reverse transcription and polymerase chain reaction. The PCR product was digested with EcoRI to give a fragment of 899 base pairs in length corresponding to the G gene of HRSV. Fragment 4 is a restriction subfragment of approximately 2149 base pairs HindIII to Accl of the HindIII restriction M fragment of SPV (23).

VECTOR OF HOMOLOGY 807-41.3. The plasmid 807-41.3 was used to insert the foreign DNA into the SPV. This incorporates a marker gene of E. coli β-galactosidase (lacZ) and the protein core gene (NP) of swine influenza virus (SIV) flanked by SPV DNA. When this plasmid was used according to the HOMOLOGO RECOMBINATION PROCEDURE TO GENERATE A RECOMBINANT SPV, a virus containing DNA encoded for the foreign genes will result. Note that the β-galactosidase marker gene (lacZ) is under the control of the synthetic late pustular disease (LP1) promoter and the SIV NP gene is under the control of the late initial / synthetic pustular disease promoter (LP2EP2). The homology vector was constructed using standard recombinant DNA techniques (22 and 30), by joining the restriction fragments of the following sources with the appropriate synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2972 base pairs HindIII to BamH1 from pSP64 (Promega). Fragment 1 is a subfragment of approximately 1484 base pairs BglII to Accl of the M fragment of SPV HindIII (23). Fragment 2 is a fragment of approximately 1501 base pairs of EcoRI to EcoRI of the SIV NP gene synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) (15, 42) using RNA from the H1N1 strain of SIV (NVSL). The primer (5 'CATGAATTCTCAAGGCACCAAACGATCATATGAGA-3 Y- 6 / 95.13) synthesizes from the 5' end of the SIV NP gene, and also introduces an EcoRI site at the 5 'ATTTGAATTCAATTGTCATACTCCTCTCGCATTGTCT-3'; 6 / 95.14) synthesizes from the 3 'end and the SIV NP gene, introduces an EcoRI site at the 3' end of the gene, and was used to reverse the polymerase chain reaction and transcription. The PCR product was digested with EcoRI to give a fragment of 1501 base pairs in length corresponding to the NP gene of SIV. Fragment 3 is about 3010 pairs of the restriction fragment from BamH1 to PuvII of plasmid pJF51 (11). Fragment 4 is a restriction subfragment of approximately 2149 base pairs Accl to HindIII of the HindIII restriction M fragment of SPV (23).

VECTOR OF HOMOLOGY 807.84.8. The plasmid 807-84.8 was used to insert the foreign DNA in the SPV. This -includes a marker gene of E. coli β-galactosidase (lacZ) and the pig influenza virus (SIV) and the hemagglutinin gene (HA) flanked by the SPV DNA. When this plasmid was used according to the HOMOLOGO RECOMBINATION PROCEDURE TO GENERATE A RECOMBINANT SPV, a virus containing DNA encoded for the foreign genes will result. Note that the β-galactosidase marker gene (lacZ) is under the control of the synthetic late pustular disease (LP1) promoter and the SIV HA gene is under the control of the synthetic late / initial promoter (LP2EP2). The homology vector was constructed using standard recombinant DNA techniques (22 and 30), by joining the restriction fragments of the following sources with the appropriate synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2972 • base pairs HindIII to BamHl of pSP64 (Promega). Fragment 1 is a restriction subfragment of approximately 1484 pairs 5 of base Bgl11 to Accl for fragment M of HindIII of SPV (23). Fragment 2 is a fragment of approximately 1721 base pairs of BamHI to BamHI of the SIV HA gene synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) (15, 42) using RNA from the H1N1 strain of SIV (NVSL). He primer (5 'CCGAGGATCCGGCAATACTATTAGTCTTGCTATGTACAT-3'; • 6 / 95.5) synthesizes from the 5 'end of the SIV HA gene, and introduces a BamH1 site at the 5, end of the gene. The primer (5'-CTCTGGATCCTAATTTAAATACATATTCTGCACTGTS-3 '; 6 / 95.6) synthesizes the 3' end and the HA gene of SIV, introduces a BamHl site in the 'end of the gene, and was used to invert the. polymerase chain reaction and transcription. The PCR product was digested with EcoRI to give a fragment of 1721 base pairs in length corresponding to the HA gene of SIV. Fragment 3 is approximately 3010 base pairs of the restriction fragment from BamHI to PvuII from plasmid pJF51 (11). Fragment 4 is an M fragment of approximately 2149 base pairs of Accl (23).

VECTOR OF HOMOLOGY 807-84.35. Plasmid 807-84.35 was used to insert the foreign DNA into the SPV. East incorporates a marker gene of E. coli β-galactosidase (lacZ) and the marker gene and the pig influenza virus virus (SIV) neuraminidase (NA) gene flanked by the SPV DNA. When this plasmid was used according to the HOMOLOGO RECOMBINATION PROCEDURE TO GENERATE A RECOMBINANT SPV, a virus containing DNA encoded for the foreign genes will result. Note that the β-galactosidase marker gene (lacZ) is under the control of the synthetic late pustular disease (LP1) promoter and the SIV HA gene is under the control of the late synthetic / initial pustular disease promoter (LP2EP2). The homology vector was constructed using standard recombinant DNA techniques (22 and 30), by joining the restriction fragments of the following sources with the appropriate synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2972 base pairs HindIII to BamH1 from pSP64 (Promega) .. Fragment 1 is a restriction subfragment of approximately 1484 base pairs Bgl11 to Accl for M fragment of HindIII of SPV (23). Fragment 2 is a fragment of approximately 1414 base pairs of EcoRI to BglII of the SIV HA gene synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) (15, 42) using RNA from the H1N1 strain of SIV (NVSL). The primer (5 'AATGAATTCAAATCAAAAAATAATAACCATTGGGTCAAT-3'; (6.95.12) synthesizes from the 3 'end of the SIV NA gene, and introduces an EcoRI site at the 5' end of the gene. The primer (5'-GGAAGATCTACTTGTCAATGGTGAATGGCAGATCAG-3 '; 6 / 95.13) synthesizes from the 3' end and the NA gene from SIV, introduces a BglII site at the 3 'end of the gene, and was used to reverse the polymerase chain reaction and transcription. The PCR product was digested with EcoRI to give a fragment of 1414 base pairs in length corresponding to the NA gene of SIV. Fragment 3 is about 3010 base pairs of the BamH1 to PvuII restriction fragment of plasmid pJF51 (11). Fragment 4 is a restriction subfragment of approximately 2149 base pairs Accl to HindIII of the HindIII restriction M fragment of SPV (23).

VECTOR OF HOMOLOGY 807-86.35. The plasmid 807-86.35 was used to insert the foreign DNA into the SPV. This incorporates a marker gene of E. coli β-galactosidase (lacZ) and the marker gene and swine influenza virus virus (SIV) HEMAGGLUTININ (HA) and neuraminidase (NA) gene flanked by SPV DNA. When this plasmid was used according to HOMOLOGO RECOMBINATION PROCEDURE TO GENERATE A SPV RECOMBINANT, will be a virus containing DNA encoded for foreign genes. Note that the β-galactosidase marker gene (lacZ) is under the control of the synthetic late pustular disease promoter (LP1) and the SIV NA and HA genes are each under the control of the late synthetic / initial pustular disease promoter (LP2EP2). The homology vector was constructed using standard recombinant DNA techniques (22 and 30), by joining the restriction fragments of the following sources with the appropriate synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2972 base pairs HindIII to BamH1 from pSP64 (Promega). Fragment 1 is a restriction subfragment of approximately 1484 base pairs BglII to Accl for M fragment of SPV HindIII (23). Fragment 2 is a fragment of approximately 1721 base pairs of BamHI to BamHI of the SIV HA gene synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) (15, 42) using RNA from the H1N1 strain of SIV (NVSL). The primer (5 '-CCGAGGATCCGGCAATACTATTAGTCTTGCTATGTACAT-3'; 6 / 95.5) synthesizes from the 5 'end of the SIV NA gene, and introduces a BamH1 site at the 5' end of the gene. The primer (5'-CTCTGGGATCCTAATTTTAAATACATATTCTGCACTGTA-3 '; 6 / 95.6) synthesizes from the 3' end and the HA gene of SIV, introduces a BamHI site at the 3 'end of the gene, and was used to reverse the polymerase chain reaction and transcription. The PCR product was digested with EcoRI to give a fragment of 1721 base pairs in length corresponding to the HA gene of SIV. Fragment 3 is a fragment of approximately 1414 base pairs EcoRI to BglII of the SIV NA gene synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) (15,42) using the RNA of the H1N1 strain of SIV (NVSL). The primer (5 'AATGAATTCAAATCAAAAAATAAATAACCATTGGGTCAAT-3'; 6 / 95.12) synthesizes from the 5 'end of the SIV NA gene and introduces an EcoRI site at the 5' end of the gene. The primer (5'-GGAAGATCTACTTGTCAATGGTGAATGGCAGATCAG-3; 6 / 95.13) synthesizes from the 3 'end of the SIV NA gene, and introduces a BglII site at the 3' end of the gene, and was used for the reverse transcription and the reaction of polymerase chain. The PCR product was digested with EcoRI to give a fragment of 1414 base pairs in length corresponding to the NA gene of SIV. Fragment 4 is a restriction subfragment of approximately 2149 base pairs Accl to HindIII of the HindIII restriction M fragment of SPV (23).

VECTOR OF HOMOLOG A 817-14.2. Plasmid 817-14.2 was used to insert foreign DNA into the SPV. This incorporates a marker gene of E. coli β-galactosidase (lacZ) and the marker gene and swine influenza virus virus (SIV) HEMAGGLUTININ (HA) and neuraminidase (NA) gene flanked by SPV DNA. When this plasmid was used according to the HOMOLOGO RECOMBINATION PROCEDURE TO GENERATE A RECOMBINANT SPV, a virus containing DNA encoded for the foreign genes will result. Note that the β-galactosidase marker gene (uidA) is under the control of the synthetic late promoter / promoter of synthetic late pustular disease (LP2EP2) and the NA and HA genes of SIV are each under the control of the late pustular disease promoter / initial synthetic (LP2EP2). The homology vector was constructed using standard recombinant DNA techniques (22 and 30), by joining the restriction fragments of the following sources with the sequences Appropriate synthetic DNA The plasmid vector was derived from a restriction fragment of approximately 2972 base pairs HindIII to BamH1 from pSP64 (Promega). Fragment 1 is a restriction subfragment of approximately 1484 base pairs BglII to Accl for M fragment of SPV HindIII (23). Fragment 2 is a fragment of approximately 1721 base pairs of BamHI to BamHI of the SIV HA gene synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) (15)., 42) using RNA from the SIV H1N1 strain (NVSL). The primer (5 '-CCGAGGATCCGGCAATACTATTAGTCTTGCTATGTACAT-3'; 6 / 95.5) synthesizes from the 5 'end of the SIV NA gene, and introduces a BamH1 site at the 5' end of the gene. The primer (5'-CTCTGGGATCCTAATTTTAAATACATATTGTGCACTGTA-3 '; 6 / 95.6) synthesizes from the 3' end and the HA gene of SIV, introduces a BamHI site at the 3 'end of the gene, and was used to reverse the polymerase chain reaction and transcription. The PCR product was digested with EcoRI to give a fragment of 1721 base pairs in length corresponding to the HA gene of SIV. Fragment 3 is a fragment of approximately 1414 base pairs EcoRI to BglII of the SIV NA gene synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) (15,42) using the RNA of the H1N1 strain of SIV (NVSL). The primer (5 'AATGAATTCAAATCAAAAAAAATAATAACATTGGGTCAAT-3'; 6 / 95.12) synthesizes from the 5 'end of the SIV NA gene and introduces an EcoRI site at the 5' end of the gene. The primer (5'-GGAAGATCTACTTGTCAATGGTGAATGGCAGATCAG-3; 6 / 95.13) synthesizes from the 3 'end of the SIV NA gene, and introduces a BglII site at the 3' end of the gene, and was used for the reverse transcription and the reaction of polymerase chain. The PCR product was digested with EcoRI to give a fragment of 1414 base pairs in length corresponding to the NA gene of SIV. Fragment 4 is a restriction fragment of about 2834 base pairs of Notl of the restriction fragment of plasmid pRAJ260 (Clonetech). Fragment 5 is a restriction subfragment of approximately 2149 base pairs Accl to HindIII of the HindIII restriction M fragment of SPV (23).

PRRS HOMOLOGY VECTORS CONTAINING UNIQUE OR MULTIPLE PRRS GENES (ORF2, ORF3, ORF4 ORF50RF6 or ORF7: The PRRS homology vector is constructed for the purpose of inserting foreign DNA into an SPV, which incorporates a marker gene of E. coli jß- galactosidase (lacZ) and a gene ORF2, ORF3, ORF4", 0RF5, ORF6 u ORF7 of porcine reproductive respiratory syndrome virus (PRRS) flanked by the SPV DNA. Upstream of the foreign gene is a fragment of approximately 855 base pairs of the SPV DNA. Downstream of the foreign genes is a fragment of approximately 1113 base pairs of SPV DNA. When the plasmid is used according to the HOMOLOGOUS RECOMBINATION PROCEDURE TO GENERATE RECOMBINANT SPV, a virus containing DNA encoded for the foreign genes will result. Note that the β-galactosidase marker gene (lacZ) is under the control of an OlL gene promoter from pig pustular disease virus and the PRRS gene is under the control of the late / initial promoter (LP2EP2). The homology vector was constructed using the standard recombinant DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2519 base pairs HindIII to Sphl from pSP65 (Promega). Fragment 1 is a subfragment of approximately 855 base pairs of the SPV polymerase chain restriction using DNA primers 5 'GAAGCATGCCCGTTCTTATCAATAGTTTAGTCGAAAATA-3' and 5'-CATAAAAAGATCTGGCATTGTGTTATTATACTAACAAAAATAATAAG-3 'to produce a fragment of 855 base pairs with Sphl ends and BglII. Fragment 2 is a fragment of 3002 base pairs of BamHI to PvulI derived from plasmid pJF751 (49) containing the E. coli lacZ gene. Fragment 3 is an EcoRI restriction fragment to BamHl synthesized by reverse transcription and polymerase chain reaction (PCR) using the genomic RNA of a US-isolated PRRS obtained from the NVSL (reference strain). Each homology vector contains a multiple ORF2 to 7 PRRS virus. In order to synthesize the PRRS ORF2, the primer (5 'AATGAATTCGAAATGGGTCCATGCAAAGCCTTTTTG' 3; 1 / 96.15) is synthesized from the 50th end of the PRRS ORF2 gene, introducing an EcoRI site at the 5 'end of the gene. The primer (5'-CAAGGATCCCACACCGTGTAATTCACTGTGAGTTCG-3 '; 1 / 96.16) was used for reverse transcription and PCR and was synthesized from the 3 rd end of the PRRS ORF2 gene. The PCR product was digested with EcoRI and BamHI to give a fragment of 771 base pairs in length corresponding to the ORF2 gene of PPRS. To synthesize the PRRS 0RF3, the primer (5 'TTCGAATTCGGCTAATAGCTGTACATTCCTCCATATTT-3'; 1 / 96.7) is synthesized from the 5 'end of the PRRS 0RF3 gene, introducing an EcoRI site at the 5' end for the gene. The primer (5'-GGGGATCCTATCGCCGTACGGCACTGAGGG-3 '; 1 / 96.8) was used for reverse transcription and PCR and is synthesized from the 3' end of the PRRS ORF3 gene. To synthesize the PRRS 0RF4, the primer (5 'CCGAATTCGGCTGCGTCCCTTCTTTTCCTCATGG-3'; 1 / 96.11) is synthesized from the 5 'end of the PRRS 0RF4 gene, an EcoRI site is introduced in 5' CTGGATCCTTCAAATTGCCAACAGAATGGCAAAAAGAC-3 '; 1 / 96.12) was used for reverse transcription and PCR and is synthesized from the 3 'end of the PRRS ORF4 gene. The PCR product was digested with EcoRI and BamHl to give a fragment of 537 base pairs in length corresponding to the PRRS 0RF4 gene. To synthesize the PRRS 0RF5, the primer (5 'TTGAATTCGTTGGAGAAATGCTTGACCGCGGGC-3'; 1 / 96.13) is synthesized from the 5 'end of the 0RF5 gene. of PRRS, an EcoRI site is introduced at the 5 'end of the gene. The primer (5'-GAAGGATCCTAAGGACGACCCCATTGTTCCGCTG-3 '; 1 / 96.14) was used for reverse transcription and PCR and was synthesized from the 3' end of the PRRS 0RF5 gene. The PCR product was digested with EcoRI and BamHI to give a fragment of 603 base pairs in length corresponding to the PRRS 0RF5 gene. To synthesize the PRRS 0RF6, the primer (5 'CGGGAATTCGGGGTCGTCCTTAGATGACTTCTGCC-3'; 1 / 96.17) is synthesized from the 5 'end of the PRRS 0RF6 gene, an EcoRI site is introduced at the 5' end of the gene hte. The primer (5 '- GCGGATCCTTGTTATGTGGCATATTTGACAAGGTTTAC-3'; 1 / 96.18) was used for reverse transcription and PCR and was synthesized from the 3 'end of the PRRS ORF6 gene. The PCR product was digested with EcoRI and BamHl to give a fragment of 525 base pairs in length corresponding to the PRRS 0RF6 gene. to synthesize the PRRS 0RF7, the primer (5 'GTCGAATTCGCCAAATAACAACGGCAAGCAGCAGAAG-3'; 1 / 96.19) is synthesized from the 3 'end of the PRRS 0RF7 gene. Fragment 4 is a subfragment of approximately 1113 base pairs of the M HindIII fragment of SPV synthesized by polymerase chain reaction using DNA primers 5'-CCGTAGTCGACAAAGATCGACTTATTAATATGTATGGGATT-3 'and 5' GCCTGAAGCTTCTAGTACAGTATTTACGACTTTTTGAAT-3 'to produce a fragment of 1113 pairs of base with the ends Salí and HindIII.

Recombinant pig pustular disease virus expressing pseudorabies genes S-SPV-076 is a pig pustular disease virus that expresses at least three foreign genes. The gene for E. coli β-galactosidase (lacZ) and the genes for the pseudorabies virus (PRV) gD and gl were inserted into the ORF 617 48.1 of the SPV (a unique Notl restriction site has replaced an Accl restriction site). only) . The lacZ gene is under the control of the synthetic late promoter (LP1) and the gD and gl genes of the PRV are under the control of the late synthetic / initial promoter (LP2EP2).

S-SPV-077 is a pig pustular disease virus that expresses at least two foreign genes. The gene for E. coli jß-galactosidase (lacZ) and the gene for pseudorabies virus (PRV) gl were inserted into the ORF 617 48.1 of the SPV (a single Notl restriction site has replaced a single Accl restriction site) . The lacZ gene is under the control of the synthetic late promoter (LP1) and the gl gene of the PRV is under the control of the late synthetic / initial promoter (LP2EP2).

S-SPV-079 is a pig pustular disease virus that expresses at least two foreign genes. The gene for E. coli jß-galactosidase (lacZ) and the gene for pseudorabies virus (PRV) gl were inserted into the ORF 617 48.1 of the SPV (a single Notl restriction site has replaced a single Accl restriction site). The lacZ gene is under the control of the synthetic late promoter (LP1) and the gB gene of the PRV is under the control of the late synthetic / initial promoter (LP2EP2).

The S-SPV-076, S-SPV-077 and S-SPV-079 have been tested by the BLACK PLATE AND WEST SPOT TEST for the expression of PRV glycoproteins.

The S-SPV-076, S-SPV-077 and S-SPV-079 were derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector and the virus S-SPV-001 in the PROCEDURE OF HOMOLOGO RECOMBINATION TO GENERATE A RECOMBINANT SPV. The transfection strain was examined by RECOMBINANT SPV EXAMINATION EXPRESSING 0-galactosidase (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-076, S-SPV-077 and S-SPV-079. The viruses were tested for the expression of jß-galactosidase, purity and stability of insert by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene.

S-SPV-076, S-SPV-077 and S-SPV-079 are useful as a vaccine in swine against PRV infection and are useful for the expression of gD, gl or gB of PRV. S-SPV-071 is useful as a vaccine in combination with a recombinant pig pustular disease virus that gV expression of PRV, such as S-SPV-011, S-SPV-012 or S-SPV-013. 143B carcinoma * osteosarcoma * A431 squamous cell carcinoma * A549 lung carcinoma * CAPAN-1 liver carcinoma * CF500 skin fibroblasts Liver Chang liver Detroit skin fibroblast Down HEL-199 embryonic lung HeLa cervical carcinoma * Hep-2 carcinoma of the epidermal larynx HISM soft intestinal muscle HNK neonatal kidney MRC-T embryonic lung NCI-H292 pulmonary mucoepidermoid OVCAR-3 ovarian carcinoma * RD rhabdosarcoma * THP monocyte (leukemia) * WIL2-NS line B lymphocyte, non-segregating WISH PBL amnion peripheral blood lymphocytes Example 38 Pustular Virus Virus Recombinant Expressing Gene ORF 2, ORF 3, ORF 4. ORF 5 v ORF 6 of PRRS.

S-SPV-080 is a pig pustular disease virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for the ORF2 virus of the porcine reproductive respiratory syndrome (PRRS) were inserted into the ORV 738-94.4 of the SPV (a deletion of 773 base pairs of the OlL ORF of SPV, deletion of nucleotides 1669 to 2452 (SEQUENCE ID NO: 189). The lacZ gene is under the control of the P01I promoter? of pig pustular disease and the ORF2 gene of PRRS is under the control of the late synthetic / initial promoter (LP2EP2).

S-SPV-081 is a pig pustular disease virus that expresses at least two foreign genes. The gene for E. coli jß-galactosidase (lacZ) and the gene for porcine reproductive respiratory syndrome virus (PRRS) 0RF3 were inserted into the ORF SPV 738-94.4 (a suppression of 773 base wall of the ORL OlL of SPV the deletion of nucleotides 1669 to 2452, (SEQUENCE ID No. 189) The LacZ gene is under the control of the P01L promoter of pig pustular disease and the PRRS 0RF3 gene is under the control of the synthetic initial / late promoter ( LP2EP2).

S-SPV-082 is a pig pustular disease virus that expresses at least two foreign genes. The gene for E. coli jß-galactosidase (lacZ) and the gene for porcine reproductive respiratory syndrome virus (PRRS) 0RF4 were inserted into the ORF SPV 738-94.4 (a deletion of 773 base-wall OlL ORF). SPV, the deletion of the nucleotides 1669 to 2452, (SEQUENCE ID No. 189) The LacZ gene is under control of the P01L promoter of pig pustular disease and the PRRS 0RF3 gene is under the control of the synthetic initial / late promoter 10 (LP2EP2).

S-SPV-083 is a pig pustular disease virus that expresses at least two foreign genes. The gene for E. coli / 3-galactosidase. (LacZ). and the gene for the virus of porcine reproductive respiratory syndrome. (PRRS) ORF5. were inserted into the ORF SPV 738-94.4 (a deletion of 773 base wall of the OlL ORF of SPV, deletion of the nucleotides 1669 to 2452, (SEQUENCE ID No. 189) .The LacZ gene is under the control of the P01L promoter of Pustular pig disease and the ORF3 gene of PRRS is under the control of the synthetic initial / late promoter (LP2EP2).

S-SPV-084 is a pig pustular disease virus that expresses at least two foreign genes. The gene for E. coli jß-galactosidase (lacZ) and the gene for porcine reproductive respiratory syndrome virus (PRRS) ORF6 were inserted into the ORF SPV 738-94.4 (a suppression of 773 base wall of the OlL ORF of SPV; of nucleotides 1669 to 2452, (SEQUENCE ID No. 189) The LacZ gene is under the control of the P01L promoter of pig pustular disease and the PRRS 5 gene 0RF3 is under the control of the synthetic initial / late promoter (LP2EP2) .

S-SPV-085 is a pig pustular disease virus that expresses at least two foreign genes. The gene for ^ k | 10 E. coli jß-galactosidase (lacZ) and the gene for porcine reproductive respiratory syndrome virus (PRRS) 0RF7 were inserted into the ORF SPV 738-94.4 (a suppression of 773 base wall of the OlL ORF of SPV; of nucleotides 1669 to 2452, (SEQUENCE ID No. 189) The LacZ gene is under the control of the P01L promoter of pig pustular disease and the PRRS ORF3 gene is under the control of the synthetic initial / late promoter (LP2EP2 ).

The S-SPV-080, S-SPV-081, S-SPV-082, S-SPV-083, S-20 SPV-084, S-SPV-085 were derived from the S-SPV-001 (Kasza strain). This was achieved using the material and methods of the homology vector (PRRS HOMOLOGY VECTORS) and the S-SPV-001 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE TO GENERATE RECOMBINANT SPV. The transfection delivery was examined by the RECOMBINANT SPV EXAMINATION EXPRESSING β-galactosidase (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-080, S-SPV-081, S-SPV-082, S-SPV-083, S-SPV-084, S-SPV-085. This virus was tested for β-galactosidase expression, purity, and insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods. After the three initial purification runs, all the plates observed were blue indicating that the virus was pure, stable, and was expressing the foreign gene.

The S-SPV-080, S-SPV-081, S-SPV-082, S-SPV-083, S-SPV-084, S-SPV-085 are useful individually or in combination as vaccines for swine against the PRRS infection and are useful for the expression of 0RF2, ORF3; 'ORF4, ORF5, ORF6 and PRRS ORF7.

Example 39 The following experiment was carried out to determine the ability of the pig pustular disease virus to infect human cells in the culture and express foreign DNA such as lacZ.

S-SPV-003 was absorbed into the human cell lines listed in the Table below at an MOI = 0.1 for 2 to 3 hours. The cells were rinsed three times with PBS, the culture medium was added, and the cells were incubated at 37 degrees centigrade for 4 days. The cells were harvested and a lysate was prepared in 200 microliters of PBS by freezing / thawing three times. The cell waste was pelleted, and 10 microliters of supernatant was assayed for the activity -galactosidase by an ONPG assay at 37 degrees centigrade for one and a half hours. The table shows the results of the infection of several human cell lines with S-SPV-003 and the relative levels of cytopathic effect and lacZ expression.

The results show that several human cell lines vary in the ability to take S-SPV-003 and express lacZ. The CPE was minimal in all cases and did not result in viral duplication. An exception was the A549 cells which showed some rounding of the cells and lifting off the plate in one case, and in another case a 10-fold increase in the concentration during the step suggesting a limited viral duplication. Several cell lines showed significant lacZ activity without a cytopathic effect.

Different promoters of pustular disease express lacZ of the recombinant pig pustular disease virus in a number of human cell lines. Six different pig pustular disease viruses were constructed which expressed lacZ of EP1, LP1, LP2, EP1LP2, LP2EP2, or the SPV promoter P01L. The viruses were each used to infect 549, Chang liver or 143B cells at o.l moi, and the cells were rinsed between 2 and 3 hours later and subsequently incubated for 4 days at 37 degrees centigrade. Each cell line maintained a different hierarchy of promoter activity, which was reproducible in the following experiments.

For example, promoters EP1, LP2EP2 and P01L gave the highest expression in 143A cells, whereas LP2 was strongest in Chang liver cells and EP1LP2 in A549. In the Chang and A549 liver cells, the expression of the P01L promoter was poorer, whereas in the 143B, the expression of the LP2 was the poorer. Therefore, different human cell lines use pustular disease promoters in dissimilar form. This can be reflected in how the pig pustular disease virus can proceed along the path of duplication in different cell lines.

These initial and late promoters exhibited a lower or higher lacZ activity depending on the type of human cell infected with the recombinant pig pustular disease virus. By choosing different promoters for different target tissues, one is able to regulate the amounts of foreign gene product delivered by the pig pustular disease virus to target tissues.

The recombinant pig pustular disease virus is useful as a vaccine for human infectious disease and for delivering therapeutic agents to humans. The recombinant pig pustular disease virus is useful as a vaccine against viral or bacterial infection in humans and as a therapeutic for cancer or genetic disease to deliver antibodies, tumor antigens, ligands and cell surface receptors, immune modulatory molecules such as cytokines.

Example 40 Expression of S-SPV-003 of lacZ in cell lines Measurement of cytopathic effect and expression of lacZ * When human cells are infected with VPS, a cytopathic effect is sometimes seen. In most cell lines, this cytopathic effect is evidenced by a change in the appearance of the cells, becoming thinner and more torn along the edges; the cells look stressed. This phenomenon was assessed as follows: indicates that there is no difference between infected and uninfected cells; +/- indicates that the monolayer is visibly different from the uninfected ones, even though most of the cells appear normal; + _ indicates that the monolayer is obviously affected with most of the cells being stressed, it should be noted that in certain cell lines (HeLa, CF500, 143B), in which the concentrations were obtained after the serial step, there was no Evidence of reproduction of the SPV, with one exception.

A549 was given a ++ for cytopathic effect in one case, when the cells appeared to round and leave the plate during infection, when this observation was not repeated. A549 also showed evidence in another case of a 10-fold increase in concentration during passage, suggesting that this may support limited viral reproduction. • ** Activity of B-galactosidase in A260 units per cell lysate of 1/20 of a 35 mm dish: Without activity Unit 0.2-0.9 A • 2.60 10 ++ Unit 0.9-1.6, A 260 +++ Greater than 1.6 units A • 260 ! 5 Emplo 41; BUILDINGS AND BOVINE VACCINES S-SPV-112 S-SPV-112 is a pig pustular disease virus that expresses three foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for the subjection (G) of bovine respiratory syncytial virus (BRSV) were inserted into the unique Notl restriction site (the Notl linkers inserted at a unique Ndel site in the open reading frame OlL of SPV, a subfragment of approximately 545 base pairs of Ndel to Ndel (Nucleotides 1560 to 2104; SEQUENCE ID No. 189) of the M fragment of HindIII of SPV has been deleted). The gene for BRSV (F) fusion at the unique PstI restriction site (the PstI linkers inserted at a single Accl site in the open OlL reading frame of SPV). The LacZ gene is under the control of the synthetic promoter (LP1), the G and F genes of BRSV are each under the control of the synthetic initial / late promoter (LP2EP2).

The S-SPV-112 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 848-02 (see Meterials and Methods) and the S-SPV-001 virus in the RECOMBINATION PROCEDURE HOMOLOGOUS TO GENERATE SPV RECOMBINANT. The transfection supply was examined for the EXAMINATION TO EXPRESS SPL RÉCOMBINANTE ß-galactosidase (ESSAYOS BLUOGAL Y CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-112. This virus was tested for jβ-galactosidase expression, purity, and insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of purification, all the plates observed were blue indicating that the virus was pure, stable, and expressed the foreign gene.

S-SPV-112 is useful as a vaccine in cattle against the disease caused by bovine respiratory syncytial virus. The BRSV antigens are key to raising a protective immune response in the animal. The recombinant viruses are used alone or in combination as an effective vaccine. The pig pustular disease virus is useful for cloning other types of BRSV for protection against variants that develop rapidly in this disease. S-SPV-112 is also useful as an expression vector for expressing BRSV antigens. Such BRSV antigens are useful for identifying antibodies directed against the BRSV of the wild type. The virus is also useful as a source of antigens for the production of monospecific polyclonal or monoclonal antibodies. Such antibodies are useful in the development of specific diagnostic tests for viral proteins. The monoclonal and polyclonal antibodies are generated in mice using these viruses according to the PROCEDURE FOR THE PURIFICATION OF VIRAL GLICOPROTEINS FOR USE AS DIAGNOSTICS (Materials and Methods).

VECTOR OF HOMOLOGY 848-02. Plasmid 848-02 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene of E. Coli jß-galactosidase (lacZ), the binding (G) and fusion (F) genes of bovine respiratory syncytial virus (BRSV) flanked by SPV DNA. Upstream of the foreign genes is a fragment of approximately 1484 base pairs of the SPV DNA. Downstream of the foreign genes is a fragment of approximately 1560 base pairs of SPV DNA. When the plasmid is used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV, a virus containing DNA encoded for foreign genes will result. Note that the jβ-galactosidase marker gene (lacZ) is under the control of the synthetic late pustular disease (LP1) promoter, the F and G genes of BRSV are under the control of the late / initial synthetic pustular disease promoter (LP2EP2) . This was constructed using standard recombinant DNA techniques (22 and 30) by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2972 base pairs HindIII to BamH1 from pSP64 (promega). Fragment 1 is a subfragment of approximately 1484 base pairs BglII to Accl of the HindIII restriction M fragment of SPV (23). Fragment 2 is a fragment of approximately 1722 base pairs BamH1 generated by PCR which contains the coding sequence of the F gene of BRSV. Fragment 3 is a subfragment of approximately 48 base pairs Accl to Ndel of the M fragment of HindIII of SPV. Fragment 4 is a fragment of approximately 771 base pairs of Ba Hl generated by PCR which contains the coding sequence for the G gene of BRSV. The F and G genes of BRSV were synthesized by PCR as described in the CLONING OF BOVINE RESPIRATORY SINAL VIRUS FUSION, nucleocapsid genes and glycoprotein. Fragment 5 is a restriction fragment of about 3010 base pairs BamHI to PvulI of plasmid pJF 751 (11). Fragment 6 is a subfragment of approximately 1560 base pairs of Ndel to HindIII of the M fragment of HindIII SPV. The Accl sites in fragments 1 and 3 were converted to unique PstI sites using PstI linkers. The Ndel sites fragments 3 and 6 were converted to unique Lotl sites using the Lotl linkers. A subfragment of approximately 545 base pairs from Ndel to Ndel (nucleotides 560 to 2104; SEQUENCE ID No. 189) of the M fragment of SPV HindIII that can be extended to SPV fragments 3 and 6 has been deleted.

Recombinant pig pustular disease virus expressing BRSV FIG fusion protein.

S-SPV-130 -. . ..

S-SPV-130 is a pig pustular disease virus that expresses three foreign genes. The E. coli jß-galactosidase gene (lacZ) was inserted into the unique PstI restriction site (PstI linkers inserted into a single Accl site in the OlL open reading frame of SPV). Genes for the binding or subjection (G) of bovine and fusion respiratory syncytial virus (F) of the BRSV were inserted into the Notl restriction site (the Notl linkers inserted at the unique Ndel site in the open OLL reading frame of SPV; a subfragment of approximately 545 base pairs from Ndel to Ndel (nucleotides 1560 to 2104; SEQUENCE ID No. 189) of the M fragment of HindIII of SPV has been deleted). The LacZ gene is under the control of the synthetic late promoter (LP1), the F / G fusion gene BRSV is under the control of the late synthetic / initial promoter (LP2EP2). The F / G BRSV fusion gene comprises approximately 1,560 nucleotides of the F gene (520 amino acids including the amino terminus) fused in frame to approximately 580 nucleotides of the G gene (193 amino acids including the carboxy terminus).

S-SPV-130 is derived from S-SPV-001 (Cepa Kasza).

This was achieved using the VECTOR OF HOMOLOGY 807-75.41 (see Materials and Methods) and the virus S-SPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE TO GENERATE RECOMBINANT SPV. The transfection supply was examined for the EXAMINATION TO EXPRESS RECOMBINANT SPV jß-galactosidase (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-130. This virus was tested for the expression of / ß-galactosidase, of purity, and of stability inserted by multiple passes monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of purification, all the plates observed were blue indicating that the virus was pure, stable, and expressed the foreign gene.

S-SPV-130 is useful as a vaccine in cattle against the disease caused by bovine respiratory syncytial virus. The BRSV F / G fusion protein is particularly effective and key to raising a protective immune response in the animal. The BRSV F / G fusion protein contains the intact amino terminus of the F protein and the intact carboxy terminus of the G protein that includes the known immunogenic region of each protein. The BRSV F / G fusion protein provides an improved immune response compared to expressing BRSV F and G proteins separately or expressing epitopes isolated from BRSV F and G proteins. The pig pustular disease virus is useful for cloning other types of BRSV for protection against variants that develop rapidly in this disease. The pig pustular disease virus is also useful as an expression vector for expressing BRSV antigens. Such antigens of. BRSV are useful for identifying antibodies directly against wild-type BRSV. The virus is also useful as a source of antigens for the production of monospecific polyclonal or monoclonal antibodies. Such antibodies are useful in the development of specific diagnostic tests for viral proteins. Monoclonal or polyclonal antibodies are generated in mice using these viruses according to the PROCEDURE FOR THE PURIFICATION OF VIRAL GLICOPROTEINS FOR USE AS DIAGNOSTICS (Materials and Methods).

VECTOR OF HOMOLOGY 807-75.41. The homology vector 807-75.41 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene of E. Coli jß-galactosidase (lacZ), a fusion protein of the binding (G) and fusion (F) genes of bovine respiratory syncytial virus (BRSV) flanked by SPV DNA. Upstream of the foreign genes is a fragment of approximately 1484 base pairs of the SPV DNA. Downstream of the foreign genes is a fragment of approximately 1560 base pairs of the SPV DNA. When the plasmid is used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE A RECOMBINANT SPV, a virus containing DNA encoded for foreign genes will result. Note that the jß-galactosidase marker gene (lacZ) is under the control of a promoter of synthetic late pustular disease (LP1), the F / G fusion gene of BRSV is under the control of a promoter of late / initial synthetic pustular disease (LP2EP2). This was constructed using standard recombinant DNA techniques (22, 30) by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector is derived from a restriction fragment of approximately 2972 base pairs HindIII to BamH1 from pSP64 (promega). Fragment 1 is a restriction subfragment of approximately 1484 base pairs BglII to Accl of the HindIII restriction M fragment of SPV (23). Fragment 2 is a restriction fragment of approximately 3010 base pairs BamH1 to PvuII of plasmid pJF751 (11). Fragment 3 is a subfragment of approximately 48 base pairs Accl to Ndel of the M fragment of HindIII of SPV. Fragment 4 is a fragment of approximately 1560 base pairs of Ba Hl generated by PCR which contains the coding sequence of the F gene of BRSV. The F gene encoding the region of strain BRSV 375 (VR-1339) was cloned using the following primers: 5'-GCGGATCGGCGCGCCGGATTTTCCTACATCTACACT-3 '(5 / 96.26; SEQUENCE ID NO.12) for the primed cDNA and combined with 5' -CTAAAATTGAATTGTAAT-3 '(1 / 92.19; SEQUENCE ID No. 13) for the PCR. The DNA encodes 520 amino acids at the amino terminus of the BRSV F protein. The fragment 5 is a fragment of approximately 580 base pairs of Accl generated by PCR which contains the coding sequence for the G gene of BRSV. The G gene encoding the region of the BRSV strain 375 (VR-1339) was cloned using the following parameters: 5 'TTGGCGCGCCCTAGATCTGTGTAGTTGATTGATTTG-3' (5 / 96.28: SEQUENCE ID DO NOT. 14) for the cDNA primed and combined with 'TACGGCGCGCCGGGAAATGCTAAAGCCAAGCCCACA-3' (5 / 96.27; SEQUENCE ID DO NOT. 15) for PCR. The DNA product encodes 193 amino acids (including a translation stop codon) of the carboxy terminus of BRSV G protein. The coding sequences of F and G of BRSV are fused in the correct translational reading frame. Fragment 6 is a subfragment of approximately 1560 base pairs of Ndel to HindIII of the M fragment of HindIII SPV. The Accl sites in fragments 1 and 3 were converted to unique PstI sites using the PstI linkers. The Ndel sites in fragments 3 and 6 were converted to Notl sites using Notl linkers. A subfragment of approximately 545 base pairs from Ndel to Ndel (nucleotides 1560 to 2104; SEQUENCE ID No. 189) of the M fragment of SPV HindIII has been deleted which will be extended to SPV fragments 3 and 6.

S-SPV-099 S-SPV-099 is a pig pustular disease virus that expresses two foreign genes. The E. coli β-galactosidase gene (lacZ) is inserted into the unique PstI restriction site (PstI linkers inserted at the unique Accl site in the OlL open reading frame of SPV). The gene for glycoprotein 53 (gp53) of bovine viral diarrhea virus type 2 (BVDV-2) (strain 890) was inserted into the unique Notl restriction site (the Notl linkers inserted at the Ndel site only in the reading frame open OlL of SPV; a subfragment of approximately 545 base pairs from Ndel to Ndel (nucleotides 1560 to 2104; SEQUENCE ID No. 189) of the M fragment of HindIII from SPV has been deleted). The lacZ gene is under the control of the synthetic late promoter (LP1), the gp53 gene of the BVDV-2 is under the control of the late synthetic / initial promoter (LP2EP2).

S-SPV-099 is derived from S-SPV-001 (Cepa Kasza).

This was achieved using the VECTOR OF HOMOLOGY 807-815-73.16A (see Materials and Methods) and the virus S-SPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE TO GENERATE SPV • RECOMBINANT. The transfection supply was examined for the EXAMINATION TO EXPRESS RECOMBINANT SPV β-galactosidase (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-099. This virus was tested for jβ-galactosidase expression, purity, and insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of purification, all the plates observed were blue indicating that the virus was pure, stable, and expressed the foreign gene.

S-SPV-099 is useful as a vaccine in cattle against the disease caused by the virus. ^^ bovine viral diarrhea. The gp53 antigen of BVDV-2 is key to raising a protective immune response in the animal. The recombinant virus is useful alone or in combination as a vaccine effective. S-SPV-099 also as an expression vector for expressing BVDV antigens. Such BVDV antigens are useful for identifying antibodies directed against wild-type BVDV. The virus is also useful as a source of antigens for the production of polyclonal or monoclonal antibodies monospecific. Such antibodies are useful in the development of specific diagnostic tests for viral proteins.

Monoclonal or polyclonal antibodies are generated in mice using these viruses according to the PROCEDURE FOR • PURIFICATION OF VIRAL GLICOPROTEINS TO BE USED AS DIAGNOSTICS (Materials and Methods). 5 VECTOR OF HOMOLOGY 815-73.16A. The homology vector 815-73.16A was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene for E. coli jß-galactosidase (lacZ), and the glycoprotein 53 gene (gp53) of bovine viral diarrhea virus type 2 (BVDV-2) flanked by • SPV DNA. Upstream of the foreign genes is a fragment of approximately 1484 base pairs of the SPV DNA. Downstream of the foreign genes is a fragment of approximately 1560 base pairs of the SPV DNA. When the plasmid is used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE A RECOMBINANT SPV, will result a virus containing DNA encoded for foreign genes. Note that the 3-galactosidase marker gene (lacZ) is under the control of a synthetic late pustular disease (LPI) promoter, the gene BVDV gp53 is under the control of a late synthetic / initial pustular disease promoter (LP2EP2). This was constructed using standard recombinant DNA techniques (22, 30) by joining the restriction fragments of the following sources with the synthetic DNA sequences. The vector of The plasmid is derived from a restriction fragment of about 2972 base pairs HindIII to BamH1 of pSP64 (promega). Fragment 1 is a restriction subfragment of approximately 1484 base pairs BglII to Accl of the HindIII restriction M fragment of SPV (23). Fragment 2 is a restriction fragment of approximately 3010 base pairs BamH1 to PvuII of plasmid pJF751 (11). Fragment 3 is a subfragment of approximately 48 base pairs Accl to Ndel of the M fragment of HindIII of SPV. Fragment 4 is a fragment of approximately 1113 base pairs EcoRI / BamHI generated by PCR which contains the coding sequence of the gp53 gene of BVDV. The coding region of the gp53 gene of BVDV was cloned by reverse transcription and PCR using the BVDV type 2 RNA (strain 890) as a hardened RNA for reverse transcription and the following PCRs using the primers: 5 '-TTCGGATCCTGCTCAGACAGTATTGTGTATGTTATCAAGAGC-3' ( 2 / 96.32; SEQUENCE ID NO.16) in the -extreme 3 'of the gene "gp53 BVDV for reverse transcription and PCR combined with 5'-CCATGAATTCCTTCCCTGAATGCAAGGAGGGCTTC-3' (2 / 96.15; SEQUENCE ID No. 17) at the end 5 'of the BVDV gp53 gene for PCR The DNA encodes approximately 373 amino acids of the gp53 protein of BVDV The fragment 5 is a subfragment of approximately 1560 base pairs from Ndel to HindIII of the M fragment HindIII SPV. fragments 1 and 3 were converted to unique PstI sites using PstI linkers The Ndel sites in fragments 3 and 5 were converted to unique Notl sites using Notl linkers A subfragment of approximately 545 base pairs N del a Ndel (nucleotides 1560 to 2104; SEQUENCE ID No. 189) of the M fragment of HindIII from SPV have been deleted which will extend to fragments 3 and 5 of SPV.

S-SPV-109 S-SPV-109 is a virus of pig pustular disease that expresses two foreign genes. The E. coli jß-galactosidase (lacZ) gene is inserted into the unique PstI restriction site (the PstI linkers inserted into a single Accl site in the OlL open reading frame of SPV). The gene for infectious bovine rhinotracheitis virus (IBRV) glycoprotein D (gD) was inserted into the unique HindIII restriction site (the HindIII linkers inserted at the single Ndel site in the OlL open reading frame of SPV, a subfragment of approximately 545 base pairs of -Ndel to Ndel (nucleotides 1560 to 2104; SEQUENCE ID No. 189) of the M fragment of SPV HindIII has been deleted). The lacZ gene is under the control of the synthetic late promoter (LP1), the gD gene of IBRV is under the control of the late synthetic / initial promoter (LP2EP2).

S-SPV-109 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the VECTOR OF HOMOLOGY 835-57.5 (see Materials and Methods) and the virus S-SPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE TO GENERATE RECOMBINANT SPV. The transfection supply was examined for the EXAMINATION TO EXPRESS RECOMBINANT SPV jß-galactosidase (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-109. This virus was tested for jβ-galactosidase expression, purity, and insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of purification, all the plates observed were blue indicating that the virus was pure, stable, and expressed the foreign gene.

S-SPV-109 is useful as a vaccine in cattle against the disease caused by bovine viral diarrhea virus. The gD antigen of IBRV is key to raising a protective immune response in the animal. The recombinant virus is useful alone or in combination as an effective vaccine. S-SPV-109 also as an expression vector to express IBRV antigens. Such IBRV antigens are useful for identifying antibodies directed against wild-type IBRV. The virus is also useful as a source of antigens for the production of monospecific polyclonal or monoclonal antibodies. Such antibodies are useful in the development of specific diagnostic tests for viral proteins. Monoclonal or polyclonal antibodies are generated in mice using these viruses according to the PROCEDURE FOR THE PURIFICATION OF VIRAL GLICOPROTEINS FOR USE AS DIAGNOSTICS (Materials and Methods).

VECTOR OF HOMOLOGY 835-57.5. The homology vector 835-57.5 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates an E. coli jß-galactosidase marker gene (lacZ), and the infectious bovine rhinotracheitis virus (IBRV) glycoprotein D (gD) gene flanked by SPV DNA. Upstream of the foreign genes is a fragment of approximately 1484 base pairs of the SPV DNA. Downstream of the foreign genes is a fragment of approximately 1560 base pairs of the SPV DNA. When the plasmid is used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE A RECOMBINANT SPV, a virus containing DNA encoded for foreign genes will result. Note that the jβ-galactosidase marker gene (lacZ) is under the control of a synthetic late pustular disease (LP1) promoter, the gD gene of IBRV is under the control of a late / initial synthetic pustular disease promoter (LP2EP2) . This was constructed using standard recombinant DNA techniques (22, 30) by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector is derived from a restriction fragment of approximately 2972 base pairs HindIII to BamH1 from pSP64 (promises) Fragment 1 is a restriction subfragment of approximately 1484 base pairs BglII to Accl fragment M HindIII restriction of SPV (23). Fragment 2 is a restriction fragment of approximately 3010 base pairs BamH1 to PvuII of plasmid pJF751 (11). Fragment 3 is a subfragment of approximately 48 base pairs Accl to Ndel of the M fragment of HindIII of SPV. Fragment 4 is a fragment of approximately 1320 base pairs of EcoRI / BamH1 generated by PCR which contains the coding sequence of the gD gene of IBRV. The coding region of the gD gene of the IBRV was cloned by PCR using the K fragment of HindIII of the Cooper IBRV strain (pSY 524) as DNA annealing and the following primers: 5 'CGGGATCCTCACCCGGGCAGCGCGCTGTA-3' (4 / 96.12; SEQUENCE ID No. 18) at the 3 'end of the gd gene of IBRV and combined with 5' -CGGAATTCACAAGGGCCGATTGGCC-3 '(4 / 96.11; SEQUENCE ID No. 19) at the 5' end of the gD gene of IBRV. The DNA encodes approximately 440 amino acids of the gD protein of IBRV. Fragment 5 is a subfragment of approximately 1560 base pairs of Ndel to HindIII of the M fragment of HindIII of SPV. The Accl sites in fragments 1 and 3 were converted to unique PstI sites using the PstI linkers. The Ndel sites in fragments 3 and 5 were converted to unique Notl sites using the Notl linkers. A subfragment of approximately 545 base pairs of Ndel to Ndel (nucleotides 1560 to 2104; SEQUENCE ID No. 189) of the M fragment of HindIII of SPV has been deleted which would extend to fragments 3 and 5 of the SPV.

S-SPV-110 S-SPV-110 is a virus of pig pustular disease that expresses two foreign genes. The E. coli jß-galactosidase (lacZ) gene is inserted into the unique PstI restriction site (the PstI linkers inserted into a single Accl site in the OlL open reading frame of SPV). The gene for the infectious bovine rhinotracheitis virus (IBRV) glycoprotein I (gl) was inserted into the unique HindIII restriction site (the HindIII linkers inserted at the Ndel site only in the open OLL reading frame of SPV; a subfragment of approximately 545 base pairs from Ndel to Ndel (nucleotides 1560 to 2104; SEQUENCE ID No. 189) of the M fragment of HindIII from SPV has been deleted). The lacZ gene is under the control of the synthetic late promoter (LP1), the gl gene of IBRV is under the control of the late synthetic / initial promoter (LP2EP2).

S-SPV-110 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the VECTOR OF HOMOLOGY 835-58.5 (see Materials and Methods) and the virus S-SPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE TO GENERATE RECOMBINANT SPV. The transfection supply was examined for the EXAMINATION TO EXPRESS RECOMBINANT SPV β-galactosidase (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-110. This virus was tested for the expression of β-galactosidase, of purity. and of stability inserted by multiple passes monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of purification, all the plates observed were blue indicating that the virus was pure, stable, and expressed the foreign gene.

S-SPV-110 is useful as a vaccine in cattle against the disease caused by bovine viral diarrhea virus. The IBRV gl antigen is key to raising a protective immune response in the animal. The recombinant virus is useful alone or in combination as an effective vaccine. S-SPV-110 also as an expression vector to express IBRV antigens. Such IBRV antigens are useful for identifying antibodies directed against wild-type IBRV. The virus is also useful as a source of antigens for the production of monospecific polyclonal or monoclonal antibodies. Such antibodies are useful in the development of specific diagnostic tests for viral proteins. Monoclonal or polyclonal antibodies are generated in mice using these viruses according to the PROCEDURE FOR THE PURIFICATION OF VIRAL GLICOPROTEINS TO BE USED AS DIAGNOSTICS (Materials and Methods).

VECTOR OF HOMOLOGY 835-58.5. The homology vector 835-58.5 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates an E. marker gene.

Coli ß-galactosidase (lacZ), and the glycoprotein I (gl) gene of infectious bovine rhinotracheitis virus (IBRV) flanked by SPV DNA. Upstream of the foreign genes is a fragment of approximately 1484 base pairs of the SPV DNA. Downstream of the foreign genes is a fragment of approximately 1560 base pairs of the SPV DNA. When the plasmid is used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE A RECOMBINANT SPV, a virus containing DNA encoded for foreign genes will result. Note that the 3-galactosidase marker gene (lacZ) is under the control of a synthetic late pustular disease (LP1) promoter, the gD gene of IBRV is under the control of a late / initial synthetic pustular disease promoter (LP2EP2) . This was constructed using standard recombinant DNA techniques (22, 30) I by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector is derived from a restriction fragment of approximately 2972 base pairs HindIII to BamH1 from pSP64 (promega). Fragment 1 is a restriction subfragment of approximately 1484 base pairs BglII to Accl of the HindIII restriction M fragment of SPV (23). Fragment 2 is a restriction fragment of approximately 3010 base pairs BamH1 to Pvul1 of plasmid pJF751 (11). Fragment 3 is a subfragment of approximately 48 base pairs Accl to Ndel of the M fragment of HindIII of SPV. Fragment 4 is a fragment of approximately 1140 base pairs of EcoRI / BamHI generated by PCR which contains the coding sequence of the IBRV gl gene. The coding region of the IBRV gl gene was cloned by PCR using the Kind fragment of HindIII of the Cooper IBRV strain (pSY 524) as DNA template and the following primers: 5 '-ATCGGGATCCCGTTATTCTTCGCTGATGGTGG-3' (4 / 96.18; SEQUENCE ID No. 20) at the 3 'end of the IBRV gl gene and combined with 5' -ATCGGGATCCCGTTATTCTTCGCTGATGGTGG-3 '(4 / 96.17; SEQUENCE ID NO. 21) at the 5 'end of the IBRV gl gene. The DNA encodes approximately 380 amino acids of the gD protein of the IBRV. Fragment 5 is a subfragment of approximately 1560 base pairs of Ndel to HindIII of the M fragment of HindIII of SPV. The Accl sites in fragments 1 and 3 were converted to unique PstI sites using the PstI linkers. The Ndel sites in fragments 3 and 5 were converted to unique Notl sites using the Notl linkers. A subfragment of approximately 545 base pairs from Ndel to Ndel (nucleotides 1560 to 2104; SEQUENCE ID No. 189) of the M fragment of HindIII from SPV has been deleted which would extend to fragments 3 and 5 of the SPV.

S-SPV-111 S-SPV-111 is a virus of pig pustular disease that expresses two foreign genes. The E. coli β-galactosidase gene (lacZ) is inserted into the unique PstI restriction site (the PstI linkers inserted into a single Accl site in the OlL open reading frame of SPV). The gene for infectious bovine rhinotracheitis virus (IBRV) glycoprotein B (gB) was inserted into the unique NotI restriction site (the Notl linkers inserted at the Ndel site only in the open OlL reading frame of SPV, a subfragment of approximately 545 base pairs from Ndel to Ndel (nucleotides 1560 to 2104; SEQUENCE ID No. 189) of the M fragment of HindIII from SPV has been deleted). The lacZ gene is under the control of the synthetic late promoter (LP1), the gB gene of IBRV is under the control of the late synthetic / initial promoter (LP2EP2). The transcription direction of the gB gene of IBRV is opposite to the transcription direction of the lacZ gene of the OlL gene of SPV.

S-SPV-111 was derived from S-SPV-0O1 (Kaspa strain.) This was achieved using the VECTOR OF HOMOLOGY 847-15.1C (see Materials and Methods) and the S-SPV-001 virus in the PROCEDURE OF RECOMBINATION HOMOLOGOUS TO GENERATE RECOMBINANT SPV The transfection supply was examined for the RECOMBINANT SPV EXAMINATION jß-galactosidase (BLUOGAL ESSAYS AND CPRG) The final result of the red plaque purification was the recombinant virus designated S-SPV-111 This virus was tested for jß-galactosidase expression, purity, and insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods After three initial rounds of purification, all plates observed were blue indicating that the virus was pure, stable, and expressed the foreign gene.

S-SPV-111 is useful as a vaccine in cattle against the disease caused by bovine viral diarrhea virus. The IBRV gB antigen is key to raising a protective immune response in the animal. The recombinant virus is useful alone or in combination as an effective vaccine. S-SPV-111 also as an expression vector for expressing IBRV antigens. Such IBRV antigens are useful for identifying antibodies directed against wild-type IBRV. The virus is also useful as a source of antigens for the production of monospecific polyclonal or monoclonal antibodies. Such antibodies are useful in the development of specific diagnostic tests for viral proteins. Monoclonal or polyclonal antibodies are generated in mice using these viruses according to the PROCEDURE FOR THE PURIFICATION OF VIRAL GLICOPROTEINS TO BE USED AS DIAGNOSTICS (Materials and Methods).

VECTOR OF HOMOLOGY 847-15.1C. The homology vector 847-15.1C was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene for E. coli jß-galactosidase (lacZ), and the gene for glycoprotein B (gB) of infectious bovine rhinotracheitis virus (IBRV) flanked by SPV DNA. The transcription direction of the gB gene of IBRV is opposite to the transcription direction of the lacZ gene of the OlL gene of SPV. Upward of the foreign genes is a • fragment of approximately 1484 base pairs of SPV DNA. Downstream of the foreign genes is a fragment of about 1560 base pairs of the SPV DNA. When the plasmid is used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE A RECOMBINANT SPV, a virus containing DNA encoded for foreign genes will result. Note that the jß-galactosidase (lacZ) marker gene is under the control of a promoter of synthetic late pustular disease (LP1), the gB gene of IBRV is under the control of a promoter of late / initial synthetic pustular disease (LP2EP2). This was constructed using standard recombinant DNA techniques (22, 30) by joining the restriction fragments of the following sources with synthetic DNA sequences. The ~ plasmid vector is derived from a restriction fragment of approximately 2972 base pairs HindIII to BamH1 from pSP64 • (promises) Fragment 1 is a restriction subfragment of approximately 1484 base pairs BglII to Accl fragment M HindIII restriction of SPV (23). Fragment 2 is a restriction fragment of approximately 3010 base pairs BamH1 to PvuII of plasmid pJF751 (11). Fragment 3 is a subfragment of approximately 48 base pairs Accl to Ndel of the M fragment of HindIII of SPV. The fragment 4 is a fragment of approximately 2800 base pairs of EcoRI / BamHl generated by PCR which contains the coding sequence of the gB gene of IBRV. The coding region of the IBRV gB gene was cloned by PCR using the HindIII fragment A of the Cooper IBRV strain (pSY 830-71) as DNA template and the following primers: 5 '-CTTCGGATCCTCATGCCCCCCCGACGTCGGCCATC-3' (4 / 96.15 SEQUENCE ID NO.22) at the 3 'end of the gB gene of IBRV and combined with 5 • -TCATGAATTCGGCCGCTCGCGGCGGTGCTGAACGC-3' (4 / 96.10; SEQUENCE ID NO.23) at the 5 'end of the gB gene of IBRV. The DNA encodes approximately 932 amino acids of the gB protein of IBRV. Fragment 5 is a subfragment of approximately 1560 base pairs of Ndel to HindIII of the M fragment of HindIII of SPV. The Accl sites in fragments 1 and 3 were converted to unique PstI sites using the PstI linkers. The Ndel sites in fragments 3 and 5 were converted to unique Notl sites using the Notl linkers. A subfragment of approximately 545 base pairs of Ndel to Ndel (nucleotides 1560 to 2104; SEQUENCE ID No. 189) of the M fragment of HindIII of SPV has been deleted which would extend to fragments 3 and 5 of the SPV.

S-SPV-113 S-SPV-113 is a virus of pig pustular disease that expresses two foreign genes. The E. coli β-galactosidase gene (lacZ) is inserted into the unique PstI restriction site (the PstI linkers inserted into a single Accl site in the OlL open reading frame of SPV). The gene for infectious bovine rhinotracheitis virus (IBRV) glycoprotein C (gC) was inserted into the unique NotI restriction site (the Notl linkers inserted at the Ndel site only in the open OlL SPV reading frame, a subfragment of approximately 545 base pairs from Ndel to Ndel (nucleotides 1560 to 2104; SEQUENCE ID No. 189) of the M fragment of HindIII from SPV has been deleted). The lacZ gene is under the control of the synthetic late promoter (LP1), the gC gene of IBRV is under the control of the late synthetic / initial promoter (LP2EP2).

S-SPV-113 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the VECTOR OF HOMOLOGY 848-08 (see Materials and Methods) and the virus S-SPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE TO GENERATE RECOMBINANT SPV. The transfection supply was examined for the EXAMINATION TO EXPRESS RECOMBINANT SPV jß-galactosidase (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-113. This virus was tested for jβ-galactosidase expression, purity, and insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of purification, all the plates observed were blue indicating that the virus was pure, stable, and expressed the foreign gene.

S-SPV-113 is useful as a vaccine in cattle against the disease caused by bovine viral diarrhea virus. The IBRV gC antigen is key to raising a protective immune response in the animal. The recombinant virus is useful alone or in combination as an effective vaccine. S-SPV-113 also as an expression vector for expressing IBRV antigens. Such IBRV antigens are useful to identify the antibodies directed against the wild-type IBRV. The virus is also useful as a source of antigens for the production of monospecific polyclonal or monoclonal antibodies. Such antibodies are useful in the development of specific diagnostic tests for viral proteins. Monoclonal or polyclonal antibodies are generated in mice using these viruses according to the PROCEDURE FOR THE PURIFICATION OF VIRAL GLICOPROTEINS TO BE USED AS DIAGNOSTICS (Materials and Methods).

VECTOR OF HOMOLOGY 848-08. The homology vector 848-08 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene of E. coli 3-galactosidase (lacZ), and the glycoprotein C (gC) gene of infectious bovine rhinotracheitis virus (IBRV) flanked by SPV DNA. Upstream of the foreign genes is a fragment of approximately 1484 base pairs of the SPV DNA. Downstream of the foreign genes is a fragment of approximately 1560 base pairs of the SPV DNA. When the plasmid is used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE A RECOMBINANT SPV, a virus will result • Containing DNA encoded for foreign genes. Note that the jβ-galactosidase marker gene (lacZ) is under the control of a synthetic late pustular disease (LP1) promoter, the gC gene of IBRV is under the control of a late / initial synthetic pustular disease promoter (LP2EP2). ). This was constructed using standard recombinant DNA techniques (22, 30) by joining the restriction fragments of the following sources with synthetic DNA sequences. The plasmid vector is derived from a restriction fragment of approximately 2972 base pairs HindIII to BamH1 from pSP64 (promega). Fragment 1 is a restriction subfragment of approximately 1484 base pairs BglII to Accl fragment M HindIII restriction of SPV (23). Fragment 2 is a restriction fragment of approximately 3010 base pairs BamH1 to PvuII of plasmid pJF751 (11). Fragment 3 is a subfragment of approximately 48 base pairs Accl to Ndel of the M fragment of HindIII of SPV. The fragment 4 is a fragment of approximately 1563 base pairs of EcoRI / BamHI generated by PCR which contains the coding sequence of the gC gene of IBRV. The coding region of the gC gene of IBRV was cloned by PCR using fragment I of HindIII of the Cooper IBRV strain (pSY 830-71) as annealed DNA and the Following 25 primers: 5 '-CGGGATCCCTAGGGCGCGGAGCCGAGGGC-3' (4 / 96.14; SEQUENCE ID NO.24) at the 3 'end of the gC gene of IBRV and combined with 5' -CGGAATTCAGGCCCGCTGGGGCGAGCGTGG-3 ' (4 / 96.13; SEQUENCE ID No. 25) at the 5 'end of the gC gene of IBRV. The DNA encodes approximately 521 amino acids of the gC protein of IBRV. Fragment 5 is a subfragment of approximately 1560 base pairs of Ndel to HindIII of the M fragment of HindIII of SPV. The Accl sites in the fragments 1 and 3 were converted to unique PstI sites using the PstI linkers. The Ndel sites in fragments 3 and 5 were converted to unique Notl sites using the Notl linkers. A subfragment of approximately 545 base pairs of Ndel a Ndel (nucleotides 1560 to 2104; SEQUENCE ID No. 189) of the M fragment of HindIII of SPV has been deleted which would extend to fragments 3 and 5 of the SPV.

S-SPV-115 S-SPV-115 is a virus of pig pustular disease that expresses two foreign genes. The E. coli jß-galactosidase (lacZ) gene is inserted into the unique PstI restriction site (the PstI linkers inserted into a single Accl site in the OlL open reading frame of SPV). The gene for infectious bovine rhinotracheitis virus (IBRV) glycoprotein B (gB) was inserted into the unique NotI restriction site (the Notl linkers inserted at the Ndel site only in the open OlL reading frame of SPV, a subfragment of approximately 545 base pairs from Ndel to Ndel (nucleotides 1560 to 2104; SEQUENCE ID No. 189) of the M fragment of HindIII from SPV has been deleted). The lacZ gene is under the control of the synthetic late promoter (LP1), the gB gene of IBRV is under the control of the late synthetic / initial promoter (LP2EP2). The transcription direction of the gB gene of IBRV is opposite to the transcription direction of the lacZ gene of the OlL gene of SPV.

S-SPV-115 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the VECTOR OF HOMOLOGY 847-19.59 (see Materials and Methods) and the S-SPV-001 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE TO GENERATE RECOMBINANT SPV. The transfection supply was examined for the EXAMINATION TO EXPRESS RECOMBINANT SPV jß-galactosidase (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-115. This virus was tested for the expression of jß-galactosidase, of purity, and of stability inserted by multiple passes monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of purification, all the plates observed were blue indicating that the virus was pure, stable, and expressed the foreign gene.

S-SPV-115 is useful as a vaccine in cattle against the disease caused by bovine viral diarrhea virus. The IBRV gB antigen is key to raising a protective immune response in the animal. The recombinant virus is useful alone or in combination as an effective vaccine. S-SPV-115 also as an expression vector to express IBRV antigens. Such IBRV antigens are useful for identifying antibodies directed against wild-type IBRV. The virus is also useful as a source of antigens for the production of monospecific polyclonal or monoclonal antibodies. Such antibodies are useful in the development of specific diagnostic tests for viral proteins. Monoclonal or polyclonal antibodies are generated in mice using these viruses according to the PROCEDURE FOR THE PURIFICATION OF VIRAL GLICOPROTEINS TO BE USED AS DIAGNOSTICS (Materials and Methods).

VECTOR OF HOMOLOGY 847-19.59. The homology vector 847-19.59 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates an E. marker gene.

Coli 3-galactosidase (lacZ), and the glycoprotein B (gB) gene of infectious bovine rhinotracheitis virus (IBRV) flanked by SPV DNA. The transcription direction of the gB gene of IBRV is opposite to the transcription direction of the lacZ gene of the OlL gene of SPV. To the top of the foreign genes is a fragment of approximately 1484 base pairs of the DNA of the SPV. Downstream of the foreign genes is a fragment of approximately 1560 base pairs of the SPV DNA. When the plasmid is used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE A RECOMBINANT SPV, will be a virus containing DNA encoded for foreign genes. Note that the / 3-galactosidase marker gene (lacZ) is under the control of a synthetic late pustular disease (LP1) promoter, the gB gene of IBRV is under the control of a late / initial synthetic pustular disease promoter (LP2EP2 ). This was constructed using standard recombinant DNA techniques (22, 30) by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector is derived from a restriction fragment of approximately 2972 base pairs HindIII to BamH1 from pSP64 (promises) Fragment 1 is a restriction subfragment of approximately 1484 base pairs Bgl11 to Accl fragment M HindIII restriction of SPV (23). Fragment 2 is a restriction fragment of about 2800 base pairs BamH1 to PvuII of plasmid pJF751 (11). Fragment 3 is a subfragment of approximately 48 base pairs Accl to Ndel of the M fragment of HindIII of SPV. Fragment 4 is a fragment of approximately 2800 base pairs of EcoRI / BamH1 generated by PCR which contains the coding sequence of the gB gene of IBRV. The coding region of the IBRV gB gene was cloned by PCR using the HindIII fragment A of the Cooper IBRV strain (pSY 830-71) as DNA template and the following primers: 5 '-CTTCGGATCCTCATGCCCCCCCGACGTCGGCCATC-3' (4 / 96.15; SEQUENCE ID No. 26) at the 3 'end of the IBRV gB gene and combined with 5' -TCATGAATTCGGCCGCTCGCGGCGGTGCTGAACGC-3 '(4 / 96.10; SEQUENCE ID NO.27) at the 5' end of the gB gene of IBRV. The DNA encodes approximately 932 amino acids of the gB protein of IBRV. Fragment 5 is a subfragment of approximately 1560 base pairs of Ndel to HindIII of the M fragment of HindIII of SPV. The Accl sites in fragments 1 and 3 were converted to unique PstI sites using the PstI linkers. The Ndel sites in fragments 3 and 5 were converted to unique Notl sites using the Notl linkers. A subfragment of approximately 545 base pairs of Ndel to Ndel (nucleotides 1560 to 2104; SEQUENCE ID No. 189) of the M fragment of HindIII of SPV has been deleted which would extend to fragments 3 and 5 of the SPV.

S-SPV-119 S-SPV-119 is a virus of pig pustular disease that expresses two foreign genes. The E. coli β-galactosidase gene (lacZ) is inserted into the unique PstI restriction site (the PstI linkers inserted into a single Accl site in the OlL open reading frame of SPV). , The genes for glycoprotein D (gD) and glycoprotein I (gl) of infectious bovine rhinotracheitis virus (IBRV) were inserted into the unique Notl restriction site (the Notl linkers inserted at the Ndel site only in the open reading frame OlL from SPV, a subfragment of approximately 545 base pairs from Ndel to Ndel (nucleotides 1560 to 2104; SEQUENCE ID No. 189) of the M fragment of HindIII from SPV has been deleted). The lacZ gene is under the control of the synthetic late promoter (LP1), the gC gene of IBRV is under the control of the late synthetic / initial promoter (LP2EP2).

S-SPV-119 was derived from S-SPV-001 (Cepa Kasza).

This was achieved using the VECTOR OF HOMOLOGY 835-83 (see Materials and Methods) and the virus S-SPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE TO GENERATE RECOMBINANT SPV. The transfection supply was examined for the EXAMINATION TO EXPRESS RECOMBINANT SPV jß-galactosidase (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-119. This virus was tested for jβ-galactosidase expression, purity, and insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of purification, all the plates observed were blue indicating that the virus was pure, stable, and expressed the foreign gene.

S-SPV-119 is useful as a vaccine in cattle against the disease caused by bovine viral diarrhea virus. IBRV gD and gl antigens are key to raising a protective immune response in the animal. The recombinant virus is useful alone or in combination as an effective vaccine. S-SPV-119 also as an expression vector for expressing IBRV antigens. Such IBRV antigens are useful for identifying antibodies directed against wild-type IBRV. The virus is also useful as a source of antigens for the production of monospecific polyclonal or monoclonal antibodies. Such antibodies are useful in the development of specific diagnostic tests for viral proteins. Monoclonal or polyclonal antibodies are generated in mice using these viruses according to the PROCEDURE FOR THE PURIFICATION OF VIRAL GLICOPROTEINS TO BE USED AS DIAGNOSTICS (Materials and Methods).

VECTOR OF HOMOLOGY 835-83. The homology vector 835-83 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates an E. coli jß-galactosidase marker gene (lacZ), and the glycoprotein D (gD) and glycoprotein I (gl) genes of infectious bovine rhinotracheitis virus (IBRV) flanked by SPV DNA. Upstream of the foreign genes is a fragment of approximately 1484 base pairs of the SPV DNA. Downstream of the foreign genes is a fragment of approximately 1560 base pairs of the SPV DNA. When the plasmid is used according to HOMOLOGO RECOMBINATION PROCEDURE TO GENERATE A SPV RECOMBINANT, will be a virus containing DNA encoded for foreign genes. Note that the jß-galactosidase marker gene (lacZ) is under the control of a promoter of synthetic late pustular disease (LP1), the gC gene of IBRV is under the control of a promoter of late / initial synthetic pustular disease (LP2EP2). This was constructed using standard recombinant DNA techniques (22, 30) by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector is derived from a restriction fragment of approximately 2972 pairs from base HindIII to BamHl of pSP64 (promega). Fragment 1 is a restriction subfragment of approximately 1484 base pairs BglII to Accl of the HindIII restriction M fragment of SPV (23). Fragment 2 is a restriction fragment of about 3010 base pairs BamH1 to Pvul1 of plasmid pJF751 (11). Fragment 3 is a subfragment of approximately 48 base pairs Accl to Ndel of the M fragment of HindIII of SPV. Fragment 4 is a fragment of approximately 1320 base pairs of EcoRI / BamHI generated by PCR which contains the coding sequence of the gD gene of IBRV. The coding region of the gD gene of the IBRV was cloned by PCR using the K fragment of HindIII of the Cooper IBRV strain (pSY 524) as DNA annealing and the following primers: 5 '-CGGGATCCTCACCCGGGCAGCGCGCTGTA-3' (4 / 96.12; SEQUENCE ID NO. 18) at the 3 'end of the gD gene of the IBRV and combined with 5 • -CGGAATTCACAAGGGCCGACATTGGCC-3' (4 / 96.11; SEQUENCE ID NO. 19) at the 5 'end of the gD gene of IBRV. The DNA encodes approximately 440 amino acids of the gD protein of IBRV. Fragment 5 is a fragment of approximately 1140 base pairs of EcoRI / BamHI generated by PCR which contains the coding sequence of the IBRV gl gene. The coding region of the IBRV gl gene was cloned by PCR using the Kind fragment of HindIII from the Cooper IBRV strain (pSY 524) as a hardened DNA and the following PCR primers: 5 'ATCGGGATCCCGTTATTCTTCGCTGATGGTGG-3' (4 / 96.18; SEQUENCE ID NO. ) at the 3 'end of the IBRV gl gene and combined with 5'-ATCGGAATTCGCGGTGCCTGTTGCTCTGGATG-3' (4 / 96.17; SEQUENCE ID NO. 21) at the 5 'end of the IBRV gl gene. The DNA encodes approximately 380 amino acids of the? BRV gl protein. Fragment 6 is a subfragment of approximately 1560 base pairs of Ndel to HindIII of the M fragment of the HVV HindIII. The Accl sites in fragments 1 and 3 were converted to unique PstI sites using the PstI linkers. The Ndel sites in fragments 3 and 5 were converted to unique Notl sites using the. Notl linkers. A subfragment of approximately 545 base pairs of Ndel to Ndel (nucleotides 1560 to 2104; SEQUENCE ID No. 189) of the M fragment of SPV HindIII has been deleted which will be extended to fragments 3 and 6 of the SPV.

Example 42; CANINE CONSTRUCTIONS AND VACCINES S-SPV-114 S-SPV-114 is a virus of pig pustular disease that expresses two foreign genes. The gene for E. coli β-galactosidase (lacZ) is inserted into the unique PstI restriction site (the PstI linkers inserted into the single Accl site in the OlL open reading frame of SPV.) The gene for the VP2 protein of parvorirus canine (CPV) was inserted into the unique Notl restriction site (the Notl linkers inserted within a single Ndel site in the open OLL reading frame of SPV; a subfragment of approximately 545 base pairs from Ndel to Ndel (Nucleotides 1560 to 2104; SEQUENCE ID No. 189) of the M fragment of SPV HindIII have been deleted.) The lacZ gene is under the control of the synthetic late promoter (LP1), the VP2 gene of the CPV is under the control of the late synthetic / initial promoter. (LP2EP2) The transcription direction of the VP2 gene of the CPV is the same as the transcription direction of the lacZ gene and the OlL gene of SPV.

The S-SPV-114 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 848-15.14 (see Materials and Methods) and virus S-SPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was examined for the EXAMINATION TO EXPRESS RECOMBINANT SPV jß-galactosidase (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-114. This virus was tested for jβ-galactosidase expression, purity, and insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of purification, all plaques observed were blue indicating that the virus was pure, stable, and expressed the ajen gene.

S-SPV-114 was assayed for the expression of CPV-specific antigens using the BLACK PLATE EXAMINATION FOR EXPRESSION OF GENE GENE IN RECOMBINANT SPV. The canine antigen for CPV (from NVSL) was shown to react specifically with the S-SPV-114 plates and not with the negative control plates of S-SPV-003. All the S-SPV-114 plates observed reacted with the antiserum indicating that the virus was stably expressing the foreign SPV gene.

To confirm the expression of the CPV VP2 gene product, the cells were infected with "S-SPV-114 and the samples of the infected cell lysates were subjected to SDS polyacrylamide gel electrophoresis." The gel was stained and analyzed using the WEST STAIN PROCEDURE A canine antiserum for CPV (from NVSL) was used to detect expression of CPV-specific proteins Cell lysate from cells infected with S-SPV-114 exhibited bands corresponding to 60 kd , which are of the expected size of the CPV VP2 protein.

S-SPV-114 is useful as a vaccine against canine disease caused by canine parvovirus. The VP2 antigen of CPV is key to raising the protective immune response in the animal. Recombinant viruses are useful alone or in combination as an effective vaccine. S-SPV-114 is also useful as an expression vector for expressing CPV antigens. Such CPV antigens are useful for identifying antibodies directed against wild-type CPV. The virus is also useful as a source of antigens for the production of monospecific polyclonal or monoclonal antibodies. Such antibodies are useful in the development of specific diagnostic tests for viral proteins. Monoclonal or polyclonal antibodies are generated in mice using these viruses according to the PROCEDURE FOR THE PURIFICATION OF VIRAL GLICOPROTEINS FOR USE AS DIAGNOSTICS (Materials and Methods).

VECTOR OF HOMOLOGY 848-15.14. The homology vector 848-15.14 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene for E. coli / 3-galactosidase (lacZ), and for a canine parvovirus VP2 protein (CPV) gene flanked by SPV DNA. The transcription direction of the VP2 gene of the CPV is the same as the transcription direction of the lacZ gene and the OlL gene of SPV. Upstream of the foreign genes is a fragment of approximately 1484 base pairs of the SPV DNA. Down from the foreign genes is a fragment of approximately 1560 base pairs of SPV DNA. When the plasmid is used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS GENERATE A RECOMBINANT SPV, will result in a virus containing DNA encoded for foreign genes. Note that the marker JSS-galactosidase (lacZ) gene is under the control of a promoter of pustular disease synthetic late (LPL), the VP2 gene of CPV is under the control of a promoter of synthetic pustular disease late / early (LP2EP2) . This was constructed using standard recombinant DNA techniques (22, 30) by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector is derived from a restriction fragment of approximately 2972 base pairs HindIII to BamH1 from pSP64 (promega). Fragment 1 is a restriction subfragment of approximately 1484 base pairs BglII to Accl of the HindIII restriction M fragment of SPV (23). Fragment 2 is a restriction fragment of approximately 3010 base pairs BamH1 to PvuII of plasmid pJF751 (11). Fragment 3 is a subfragment of about 48 base pairs Accl to Ndel of the M fragment of HindIII of SPV. Fragment 4 is a fragment of approximately 1758 base pairs of EcoRI / BamHI generated by PCR which contains the coding sequence of the VP2 gene of CPV. The coding region of the VP2 gene of CPV was cloned by PCR using DNA isolated 2B fields (NVSL) as a temperate CPV DNA and the following primers PCR: 5'- CGGGATCCTTAATATAATTTTCTAGGTGCTAGTTG-3 '(4 / 96.26; SEQUENCE ID NO . 28) at the 3 'end of the CPV VP2 gene and combined with 5'- CGGAATTCGATGAGTGATGGAGCAGTTCAA-3' (4 / 96.25; SEQUENCE ID NO 29) at the 5 'end of the CPV VP2 gene.. The DNA encodes approximately 586 amino acids of the CPV VP2 protein. Fragment 5 is a subfragment of approximately 1560 base pairs of Ndel to HindIII of the M fragment of HindIII of SPV. The Accl sites in fragments 1 and 3 were converted to unique PstI sites using the PstI linkers. The Ndel sites in fragments 3 and 5 were converted to unique Notl sites using the Notl linkers. A subfragment of approximately 545 base pairs NdeI to NdeI (nucleotides 1560-2104; SEQUENCE ID No. 189) of the HindIII M fragment has been deleted SPV which extend fragments 3 and 5 of the SPV.

S-SPV-116 S-SPV-116 is a virus of pig pustular disease that expresses two foreign genes. The gene for E. coli jß-galactosidase (lacZ) is inserted into the unique PstI restriction site (the PstI linkers inserted in the single Accl site in the OlL open reading frame of SPV.) The gene for the VP2 protein of parvorirus canine (CPV) was inserted into the unique Notl restriction site (Notl linkers inserted within a single Ndel site in the open OlL reading frame of SPV; a subfragment of approximately 545 base pairs from Ndel to Ndel (Nucleotides 1560 a 2104; SEQUENCE ID No. 189) of the M fragment of SPV HindIII have been deleted.) The lacZ gene is under the control of the synthetic late promoter (LP1), the VP2 gene of the CPV is under the control of the late synthetic / initial promoter. (LP2EP2) The transcription direction of the VP2 gene of the CPV is the same as the transcription direction of the lacZ gene and the OlL gene of SPV.

The S-SPV-116 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 848-15.13 (see Materials and Methods) and virus S-SPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was examined for the EXAMINATION TO EXPRESS RECOMBINANT SPV jß-galactosidase (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-116. This virus was tested for jβ-galactosidase expression, purity, and insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of purification, all the plates observed were blue indicating that the virus was pure, stable, and expressed the foreign gene.

S-SPV-116 was tested for the expression of CPV-specific antigens using the BLACK PLATE EXAMINATION EXPRESSION OF GENE GENE IN RECOMBINANT SPV. The canine antigen for CPV (from NVSL) was shown to react specifically with the S-SPV-116 plates and not with the negative control plates of S-SPV-003. All the S-SPV-116 plates observed reacted with the antiserum indicating that the virus was stably expressing the foreign SPV gene.

To confirm the expression of the gene product of VP2 of CPV, the cells were infected with S-SPV-116 and the samples of the infected cell lysates were subjected to SDS polyacrylamide gel electrophoresis. The gel was stained and analyzed using the WEST STAIN PROCEDURE. A canine antiserum for CPV (from NVSL) was used to detect the expression of CPV-specific proteins. Cell lysate from cells infected with S-SPV-116 exhibited bands corresponding to 60 kd, which are the expected size of the CPV VP2 protein. . . -, ... .. S-SPV-116 is useful as a vaccine against canine disease caused by canine parvovirus. The VP2 antigen of CPV is key to raising the protective immune response in the animal. Recombinant viruses are useful alone or in combination as an effective vaccine. S-SPV-116 is also useful as an expression vector for expressing CPV antigens. Such CPV antigens are useful for identifying antibodies directed against wild-type CPV. The virus is also useful as a source of antigens for the production of monospecific polyclonal or monoclonal antibodies. Such antibodies are useful in the development of specific diagnostic tests for viral proteins. Monoclonal or polyclonal antibodies are generated in mice using these viruses according to the PROCEDURE FOR THE PURIFICATION OF VIRAL GLICOPROTEINS FOR USE AS DIAGNOSTICS (Materials and Methods).

VECTOR OF HOMOLOGY 848-15.13. The homology vector 848-15.13 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene of E. coli / 3-galactosidase (lacZ), and for a canine parvovirus VP2 protein (CPV) gene flanked by SPV DNA. The transcription direction of the VP2 gene of the CPV is the same as the transcription direction of the lacZ gene and the OlL gene of SPV. Upstream of the foreign genes is a fragment of approximately 1484 base pairs of the SPV DNA. Downstream of the foreign genes is a fragment of approximately 1560 base pairs of the SPV DNA. When the plasmid is used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE A RECOMBINANT SPV, a virus containing DNA encoded for foreign genes will result. Note that the β-galactosidase marker gene (lacZ) is under the control of a synthetic late pustular disease (LP1) promoter, the VP2 gene of CPV is under the control of a late / synthetic initial pustular disease promoter (LP2EP2) . This was constructed using standard recombinant DNA techniques (22, 30) by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector is derived from a restriction fragment of approximately 2972 base pairs HindIII to BamH1 from pSP64 (promega). Fragment 1 is a restriction subfragment of approximately 1484 base pairs BglII to Accl of the HindIII restriction M fragment of SPV (23). Fragment 2 is a restriction fragment of approximately 3010 base pairs BamH1 to Pvul1 of plasmid pJF751 (11). Fragment 3 is a subfragment of approximately 48 base pairs Accl to Ndel of the M fragment of HindIII of SPV. Fragment 4 is a fragment of approximately 1758 base pairs of EcoRI / BamHI generated by PCR which contains the coding sequence of the VP2 gene of CPV. The coding region of the VPV gene of CPV was cloned by PCR using DNA from the isolate of 2B CPV fields (NVSL) as a DNA template and the following PCR primers: .5'-CGGGATCCTTAATATAATTTTCTAGGTGCTAGTTG-3 '(4 / 96.26; SEQUENCE ID NO. 30) at the 3 'end of the VP2 gene of the CPV and combined with 5'-CGGAATTCGATGAGTGATGGAGCAGTTCAA-3' (4 / 96.25; SEQUENCE ID No. 31) at the 5 'end of the VP2 gene of the CPV. The DNA encodes approximately 586 amino acids of the CPV VP2 protein. Fragment 5 is a subfragment of approximately 1560 base pairs of Ndel to HindIII of the M fragment of HindIII of SPV. The Accl sites in fragments 1 and 3 were converted to unique PstI sites using the PstI linkers. The Ndel sites in fragments 3 and 5 were converted to unique Notl sites using the Notl linkers. A subfragment of approximately 545 base pairs from Ndel to Ndel (nucleotides 1560 to 2104; SEQUENCE ID No. 189) of the M fragment of SPV HindIII has been deleted which would extend fragments 3 and 5 of the SPV.

S-SPV-117 S-SPV-117 is a virus of pig pustular disease that expresses two foreign genes. The gene for E. coli jß-galactosidase (lacZ) is inserted into the unique PstI restriction site (the PstI linkers inserted at the single Accl site in the OlL open reading frame of SPV.) The gene for the VPl / 2 protein of canine parvorirus (CPV) was inserted into the unique Notl restriction site (Notl linkers inserted within a single Ndel site in the open OlL reading frame of SPV; a subfragment of approximately 545 base pairs from Ndel to Ndel (Nucleotides 1560 to 2104; SEQUENCE ID No. 189) of the HindIII fragment M of SPV have been deleted.) The lacZ gene is under the control of the synthetic late promoter (LP1), the VP1 / 2 gene of the CPV is under the control of the promoter late / synthetic initial (LP2EP2) The transcription direction of the VP1 / 2 gene of the CPV is the same as the transcription direction of the lacZ gene and the OlL gene of SPV.

The S-SPV-117 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 848-52A31 (see Materials and Methods) and virus S-SPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was examined for the EXAMINATION TO EXPRESS RECOMBINANT SPV jß-galactosidase (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-117. This virus was tested for jβ-galactosidase expression, purity, and insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of purification, all the plates observed were blue indicating that the virus was pure, stable, and expressed the foreign gene.

S-SPV-117 is useful as a vaccine against canine disease caused by canine parvovirus. The CPV / 2 antigen of CPV is key to raising the protective immune response in the animal. Recombinant viruses are useful alone or in combination as an effective vaccine. S-SPV-117 is also useful as an expression vector for expressing CPV antigens. Such CPV antigens are useful for identifying antibodies directed against wild-type CPV. The virus is also useful as a source of antigens for the production of monospecific polyclonal or monoclonal antibodies. Such antibodies are useful in the development of specific diagnostic tests for viral proteins. Monoclonal or polyclonal antibodies are generated in mice using these viruses according to the PROCEDURE FOR THE PURIFICATION OF VIRAL GLICOPROTEINS FOR USE AS DIAGNOSTICS (Materials and Methods).

VECTOR OF HOMOLOGY 848-52A31. The homology vector 848-52A31 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene of E. coli jß-galactosidase (lacZ), and for a protein gene of VP1 / 2 of canine parvovirus (CPV) flanked by the SPV DNA. The transcription direction of the VPl / 2 gene of the CPV is the same as the transcription direction of the lacZ gene and the OlL gene of SPV. Upstream of the foreign genes is a fragment of approximately 1484 base pairs of the SPV DNA. Downstream of the foreign genes is a fragment of approximately 1560 base pairs of the SPV DNA. When the plasmid is used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE A RECOMBINANT SPV, a virus containing DNA encoded for foreign genes will result. Note that the jβ-galactosidase marker gene (lacZ) is under the control of a synthetic late pustular disease (LP1) promoter, the VP1 / 2 gene of CPV is under the control of a late / initial synthetic pustular disease promoter ( LP2EP2). This was constructed using standard recombinant DNA techniques (22, 30) by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector is derived from a restriction fragment of approximately 2972 base pairs HindIII to BamH1 from pSP64 (promega). Fragment 1 is a restriction subfragment of approximately 1484 base pairs BglII to Accl of the HindIII restriction M fragment of SPV (23). Fragment 2 is a restriction fragment of approximately 3010 base pairs BamH1 to PvuII of plasmid pJF751 (11). Fragment 3 is a subfragment of approximately 48 base pairs Accl to Ndel of the M fragment of HindIII of SPV. Fragment 4 is a fragment of approximately 2172 base pairs of EcoR1 / BamHI generated by PCR which contains the coding sequence of the VP1 / 2 gene of CPV. The coding region of the VPV / 2 gene of CPV was cloned by PCR using DNA from the isolate of 2B fields CPV (NVSL) as a DNA template and the following PCR primers: 5'-CGGGATCCTTAATATAATTTTCTAGGTGCTAGTTG-3 '(4 / 96.26; SEQUENCE ID NO. 32) at the 3 'end of the VP1 / 2 gene of CPV and combined with 5'-CGGAATTCTATGTGTTTTTTTATAGGACTT-3' (5 / 96.25; SEQUENCE ID No. 33) at the 5 'end of the VP1 / 2 gene of CPV. The DNA encodes approximately 724 amino acids of the VPV / 2 CPV protein. Fragment 5 is a subfragment of approximately 1560 base pairs of Ndel to HindIII of the M fragment of HindIII of SPV. The Accl sites in fragments 1 and 3 were converted to unique PstI sites using the PstI linkers. The Ndel sites in fragments 3 and 5 were converted to unique Notl sites using the Notl linkers. A subfragment of approximately 545 base pairs from Ndel to Ndel (nucleotides 1560 to 2104; SEQUENCE ID No. 189) of the M fragment of HindIII from SPV has been deleted which would extend fragments 3 and 5 of the SPV.

S-SPV-118 S-SPV-118 is a virus of pig pustular disease that expresses two foreign genes. The gene for E. coli β-galactosidase (lacZ) is inserted into the unique PstI restriction site (the PstI linkers inserted at the single Accl site in the OlL open reading frame of SPV.) The gene for the VPl / 2 protein of canine parvorirus (CPV) was inserted into the unique NotI restriction site (the Notl linkers inserted into a single Ndel site in the open OLL reading frame of SPV; a subfragment of approximately 545. base pairs from Ndel to Ndel ( Nucleotides 1560 to 2104; SEQUENCE ID No. 189) of the M fragment of SPV HindIII have been deleted.) The lacZ gene is under the control of the synthetic late promoter (LP1), the VP1 / 2 gene of the CPV is under the control of the late / synthetic initial promoter (LP2EP2) The transcription direction of the VPl / 2 gene of the CPV is the same as the transcription direction of the lacZ gene and the OlL gene of SPV.

The S-SPV-118 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 848-52C8 (see Materials and Methods) and the S-SPV-001 virus in the RECOMBINATION PROCEDURE HOMOLOGOUS TO GENERATE RECOMBINANT SPV. The transfection supply was examined for the EXAMINATION TO EXPRESS RECOMBINANT SPV jß-galactosidase (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-118. This virus was tested for jβ-galactosidase expression, purity, and insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of purification, all the plates observed were blue indicating that the virus was pure, stable, and expressed the foreign gene.

S-SPV-118 is useful as a vaccine against canine disease caused by canine parvovirus. The CPV / 2 antigen of CPV is key to raising the protective immune response in the animal. Recombinant viruses are useful alone or in combination as an effective vaccine. S-SPV-118 is also useful as an expression vector for expressing CPV antigens. Such CPV antigens are useful for identifying antibodies directed against wild-type CPV. The virus is also useful as a source of antigens for the production of monospecific polyclonal or monoclonal antibodies. Such antibodies are useful in the development of specific diagnostic tests for viral proteins. Monoclonal or polyclonal antibodies are generated in mice using these viruses according to the PROCEDURE FOR THE PURIFICATION OF VIRAL GLICOPROTEINS FOR USE AS DIAGNOSTICS (Materials and Methods).

VECTOR OF HOMOLOGY 848-52C8. The homology vector 848-52A31 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene for E. coli β-galactosidase (lacZ), and for a VP1 / 2 protein gene from canine parvovirus (CPV) flanked by SPV DNA. The transcription direction of the VP1 / 2 gene of the CPV is the same as the transcription direction of the lacZ gene and the OlL gene of SPV. Upstream of the foreign genes is a fragment of approximately 1484 base pairs of the SPV DNA. Downstream of the foreign genes is a fragment of approximately 1560 base pairs of the SPV DNA. When the plasmid is used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE A RECOMBINANT SPV, a virus containing DNA encoded for foreign genes will result. Note that the β-galactosidase marker gene (lacZ) is under the control of a synthetic late pustular disease (LP1) promoter, the VP1 / 2 gene of CPV is under the control of a late / initial synthetic pustular disease promoter ( LP2EP2). This was constructed using standard recombinant DNA techniques (22, 30) by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector is derived from a restriction fragment of approximately 2972 base pairs HindIII to BamH1 from pSP64 (promega). Fragment 1 is a restriction subfragment of approximately 1484 base pairs BglII to Accl of the HindIII restriction M fragment of SPV (23). Fragment 2 is a restriction fragment of approximately 3010 base pairs BamH1 to Pvul1 of plasmid pJF751 (11). Fragment 3 is a subfragment of approximately 48 base pairs Accl to Ndel of the M fragment of HindIII of SPV. Fragment 4 is a fragment of approximately 2172 base pairs of EcoRI / BamH1 generated by PCR which contains the coding sequence of the VP1 / 2 gene of CPV. The coding region of the VPV / 2 gene of CPV was cloned by PCR using DNA from the isolate of 2B fields CPV (NVSL) as a DNA template and the following PCR primers: 5'-CGGGATCCTTAATATAATTTTCTAGGTGCTAGTTG-3 '(4 / 96.26; SEQUENCE ID NO. 34) at the 3 'end of the VP1 / 2 gene of the CPV and combined with 5'-CGGAATTCTATGTGTTTTTTTATAGGACTT-3' (5 / 96.25; SEQUENCE ID NO.35) at the 5 'end of the VP1 / 2 gene of the CPV. The DNA encodes approximately 724 amino acids of the CPV VP1 / 2 protein. Fragment 5 is a subfragment of approximately 1560 base pairs of Ndel to HindIII of the M fragment of HindIII of SPV. The Accl sites in fragments 1 and 3 were converted to unique PstI sites using the PstI linkers. The Ndel sites in fragments 3 and 5 were converted to unique Notl sites using the Notl linkers. A subfragment of approximately 545 base pairs from Ndel to Ndel (nucleotides 1560 to 2104; SEQUENCE ID No. 189) of the M fragment of HindIII from SPV has been deleted which would extend fragments 3 and 5 of the SPV.

Example 43; CONSTRUCTIONS AND AVICULTURE VACCINES S-SPV-105 S-SPV-105 is a virus of pig pustular disease that expresses at least two foreign genes. The gene for E. coli jß-galactosidase (lacZ) and the gene for chicken interferon gamma (cIFN?) Were inserted into the ORF 738-94.4 (a deletion of 773 base pairs of the OlL ORF of SPV, deletion of the nucleotides 1679 to 2452, SEQUENCE ID No. 189). The lacZ gene is under the control of the OlL promoter of pig pustular disease, and the cIFN gene. it is under the control of the late synthetic / initial promoter (LP2EP2).

The S-SPV-105 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 840-72.Al (see Materials and Methods) and the S-SPV-001 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was examined for the EXAMINATION TO EXPRESS RECOMBINANT SPV jß-galactosidase (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-105. This virus was tested for 3-galactosidase expression, purity, and insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of purification, all the plates observed were blue indicating that the virus was pure, stable, and expressed the foreign gene.

S-SPV-105 is confirmed to have cIFN activity? by measuring the growth inhibition of vesicular stomatitis virus in permissive cells by cocultivation with S-SPV-105 in comparison to the cocultivation of VSV with S-SPV-003.

S-SPV-105 is useful as a vaccine in chickens to stimulate a mediated humoral and cellular immune response against the infection of poultry pathogens. S-SPV-105 is useful for the expression of cIFN ?.

VECTOR OF HOMOLOGY 840-72.Al. The plasmid 840-72.Al was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates an E. coli jß-galactosidase marker gene (lacZ), and a chicken interferon gamma gene (cINF?) Flanked by SPV DNA. Upstream of the foreign gene is a fragment of approximately 855 base pairs of SPV DNA. Downstream of the foreign genes is a fragment of approximately 1113 base pairs of the SPV DNA. When the plasmid is used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV, a virus containing the DNA encoded for the foreign genes will result. Note that the / 3-galactosidase marker gene (lacZ) is under the control of an OlL gene promoter of pig pustular disease virus and the cIFN gene? is under the control of late / initial promoter (LP2EP2). The cIFN gene cassette? of LP2EP2 was inserted into the EcoRI and BamHl site of the homology vector 752-22.1. The homology vector 840-72.Al was constructed using standard recombinant DNA techniques (22, 30) by joining the restriction fragments from the following sources with the synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2519 base pairs HindIII to Sphl from pSP65 (promega). Fragment 1 is a subfragment of approximately 855 base pairs of the HindIII restriction fragment of SPV (23) synthesized by polymerase chain reaction using DNA primers 5'GAAGCATGCCCGTTCTTATCAATAGTTTAGTCGAAAATA-3 and 5'-CATAAGATCTGGCATTGTGTTATTATACTAACAAAAATAATAAG-3 'to produce a fragment of 855 base pairs with Sphl and BglII ends. Fragment 2 is a fragment of 3002 base pairs of BamHI to PvuII derived from plasmid pJF751 (49) containing the E. coli lacZ gene. Fragment 3 is a fragment of approximately 522 base pairs of EcoRI to BglII encoded for the cIFN? (62) derivative by reverse transcription and polymerase chain reaction (PCR) (Sambrook et al. 1989) of RNA ISOLATED CONCAVALINE STIMULATED CHICKEN SQUASH CELLS. He • antisense primer used for reverse transcription and PCR was 5 'CGTCAGATCTCAGGAGGTCATAAGATGCCATTAGC-3' (1 / 96.38; SEQUENCE 5 ID NO.36). The sensing primer used for PCR was 5 'CGTTGAATTCGATGACTTGCCAGACTTACAACTTG-3' (1 / 96.37, sequence id no.37). The DNA fragment contains the open reading frame of 168 amino acids of the gamma interferon chicken protein. The native methionine codon of cIFN? is preceded by the codons DNA for methionine-asparginase-serine. The fragment 4 is a • subfragment of approximately 1113 base pairs of the M HindIII fragment of SPV synthesized by polymerase chain reaction using 5 'DNA primers CCGTAGTCGACAAAGATCGACTTATTAATATGTATGGGATT-3' Y. 5' GCCTGAAGCTTCTAGTACAGTATTTACGACTTTTGAAAT-3 'to produce a fragment of 1113 base pairs with SalI and HindIII ends.

S-SPV-086 S-SPV-086 is a pig pustular disease virus that expresses at least two foreign genes. The gene for E. coli jß-galactosidase (lacZ) and the gene for chicken interferon gamma (cIFN?) Were inserted into the ORF 738-94.4 (a deletion of 773 base pairs of the OlL ORF of SPV, deletion of the nucleotides 1679 to 2452, SEQUENCE ID NO. 189). The lacZ gene is under the control of the OlL promoter of pig pustular disease, and the cIFN gene. it is under the control of the late synthetic / initial promoter (LP2EP2). • The S-SPV-086 was derived from S-SPV-001 (Strain 5 Kasza). This was achieved using the homology vector 836-62. Bl and S-SPV-001 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was examined for the EXAMINATION TO EXPRESS RECOMBINANT SPV jß-galactosidase (BLUOGAL ESSAYS AND CPRG). He The final result of the purification of red plaque was the recombinant virus designated S-SPV-086. This virus was tested for ß-galactosidase expression, purity, and insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods.

After three initial rounds of purification, all the plates observed were blue indicating that the virus was pure, stable, and expressed the foreign gene. The homology vector 836-62. Bl is constructed in the same manner as the homology vector 840-72.Al except because in 836-62. Bl, the fragment of approximately 522 base pairs EcoRI to BglII encoded for the cIFN gene? in the opposite orientation relative to the promoter LP2EP2 compared to 840-72.Al.

S-SPV-086 was tested for the expression of ß-galactosidase antigens using the BLACK PLATE EXAMINATION FOR EXPRESSION OF GENE GENE IN RECOMBINANT SPV. The anti-jS-galactosidase antiserum was shown to react specifically with the S-SPV-086 plates and not with the negative control plates of S-SPV-003. All the S-SPV-086 plates observed reacted with the antiserum indicating that the virus was stably expressing the foreign 3-galactosidase gene.

SPV-086 is useful for the expression of antisense RNA for cIFN? mRNA. When S-SPV-086 is transfected into duck embryo fibroblast (DEF) or chicken embryo fibroblast (CEF) cells, they will not lyse the cells, but will express cIFN? Antisense RNA in CEF cells and will inhibit the expression of cIFN protein? of DEF or CEF cells. Recombinant viruses, such as turkey herpes virus (HVT) or Marek's disease virus, cultured at higher concentrations (108 to 1010 pfu-ml) in transfected S-SPV-086 inside DEF cells or CEF, and transfected cells are selected for puromysin resistance by growth in the presence of puromisin. These transfected cells will grow continuously, express antisense to the cIFN gene? and allow a high concentration growth of herpes virus for turkeys or Marek's disease virus (108 to 1010 pfu / ml).

Example 44; Constructions and Vaccines for Feline S-SPV-106 S-SPV-106 is a pig pustular disease virus that expresses at least two foreign genes. The gene for E. coli /? -galactosidase (lacZ) and the genes for the envelope (env) of feline immunodeficiency virus (FIV) and gag-protease were inserted into the ORF 617 48.1 of SPV (a Notl restriction site only one that has replaced a restriction site Accl only). The lacZ gene is under the control of the synthetic late promoter (LP1), and the FIV env and gag-protease genes are under the control of the late synthetic / initial promoter (LP2EP2).

The S-SPV-106 was derived from - S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 836-22.Al (see Materials and Methods) and virus S-SPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was examined for the EXAMINATION TO EXPRESS RECOMBINANT SPV β-galactosidase (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-106. This virus was tested for jβ-galactosidase expression, purity, and insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods. After five initial rounds of purification, all the plates observed were blue indicating that the virus was pure, stable, and expressed the foreign gene.

S-SPV-106 was assayed for the expression of FIV-specific antigens using the BLACK PLATE EXAMINATION FOR EXPRESSION OF GENE GENE IN RECOMBINANT SPV. FIV gag-protease monoclonal antibodies were shown to react specifically with the S-SPV-106 plates and not with the negative control plates of S-SPV-003. All of the S-SPV-106 plates observed reacted with the antiserum indicating that the virus was stably expressing the foreign gene of the IVF gag-protease. - - S-SPV-106 is a recombinant pustular disease virus that expresses both the FIV env and the gag-protease proteins and is useful as a vaccine in cats against FIV infection. S-SPV-106 is also useful for the expression of the gag-protease and env proteins of FIV.

VECTOR OF HOMOLOGY 836-22. l. The plasmid 836-22Al was used to insert the foreign DNA into the SPV. This incorporates a marker gene for E. coli jß-galactosidase (lacZ), and the gag-protease and envelope (env) genes of feline immunodeficiency virus (FIV) flanked by SPV DNA. When this plasmid is used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE RECOMBINANT SPV, a virus containing a DNA encoded for foreign genes was found. Note that the jβ-galactosidase marker gene (lacZ) is under the control of the synthetic late pustulosus virus (LP1) promoter and the FIV env and gag-protease genes are under the control of the late synthetic / initial pustular disease promoter (LP2EP2). The homology vector was constructed using the standard recombinant DNA techniques (22 and 30) by joining the restriction fragments of the following sources with the appropriate synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2972 base pairs HindIII to BamH1 from pSP64 (promega). Fragment 1 is a restriction subfragment of approximately 1484 base pairs BglII to Accl of the M HindIII fragment of SPV (23). Fragment 2 is a fragment -from approximately 2564 base pairs of BamH1 to BamH1 of the FIV env gene (61) (approximately 860 amino acids which include the full length SU and the TM coding regions of the FIV env) synthesized by CLONING WITH THE POLYMERASE CHAIN REACTION. The tempering for the PCR reaction was the genomic cDNA of PPR of the FIV strain (61). The upstream primer 10 / 93.21 (5'-GCCCGGATCCTATGGCAGAAGGGTTTGCAGC-3 ';) was synthesized to the 5' end of the FIV env gene starting at nucleotides 6263 of the PPR genomic cDNA of the FIV strain and the procedure introduced a BamHl site into the 5 'end. The primer down 10 / 93.20 (5 'CCGTGGATCCGGCACTCCATCATTCCTCCTC-3'; ) was synthesized corresponding to the 3 'end of the FIV env gene starting from nucleotide 8827 of the FIV PPR genomic cDNA. Fragment 3 is a restriction fragment of about 1878 base pairs of EcoRI to Bgl11 of FIV (gag ORF is approximately 452 amino acids, ORF protease is approximately 209 amino acids) synthesized by chain reaction of polymerase (PCR) using the FIV cDNA (c ep to PPR) (6 1). The primer (5'GCGTGAATTCGGGAATGGACAGGGGCGAGAT-3 '; 11 / 94.9) synthesized from the 5' end of the IVF gag-protease gene introduces an EcoRi site at the 5 'end of the gene. The primer (5'-GAGCCAGATCTGCTCTTTTTACTTTCCC-3 '; 11 / 94.10) synthesized from the 3' end of the IVF gag-protease gene introduces a bglII site at the 3 'end of the gene. The PCR product was digested with EcoRI and BglII to give a fragment of 1878 base pairs in length corresponding to the FIV gag-protease gene. Fragment 4 is a restriction fragment of about 3010 base pairs of BamHI to PvulI of plasmid pJF751 (11). Fragment 5 is a restriction subfragment of approximately 2149 base pairs Accl to HindIII of the M HindIII restriction fragment of SPV (23). The Accl site in the SPV homology vector was converted to a single Notl site.

S-SPV-127 S-SPV-127 is a pig pustular disease virus that expresses four foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for (gag) feline immune deficiency virus (FIV) were introduced into the open rng frame 738-94.4 (an expression of 773 base pairs of the rng frame open OlL SPV, deletion of nucleotides 1669 to 2452, SEQUENCE ID No. 189). The gene for E. coli β-glucuronidase (uidA) and the gene for envelope (env) of feline immunodeficiency virus (FIV) were inserted into a single Notl site (Notl linkers inserted into the EcoRI restriction site unique within a region of approximately 3.2 kb (SEQUENCE ID NO.1) of the HindIII fragment K of SPV of 6.7 kb). The lacZ gene is under the control of the OlL promoter of pig pustular disease, the uidA gene is under the control of the synthetic initial promoter (EP2) and the envelope and FIV genes are each under the control of the late promoter. initial synthetic (LP2EP2).

The S-SPV-127 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 849-61.A14 (see Materials and Methods) and the S-SPV-046 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was examined for the EXAMINATION TO EXPRESS RECOMBINANT SPV β-galactosidase and / 3-glucuronidase (BLUOGAL AND CPRG). The final result of the purification of red plate and blue plate was the recombinant virus designated S-SPV-127. This virus was tested for the expressions of jß-galactosidase and β-glucuronidase, of purity, and of insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of purification, all the plates observed were blue indicating that the virus was pure, stable, and expressed the foreign gene.

S-SPV-127 is useful as a vaccine in cats against FIV infection. S-SPV-127 is also useful for the expression of gag and env proteins of FIV.

VECTOR OF HOMOLOGY 849-61.A14. The plasmid 849-61.A14 was used to insert the foreign DNA into the SPV. This incorporates a marker gene of E. coli jß-glucuronidase (uidA) and the envelope (env) gene of feline immunodeficiency virus (FIV) flanked by SPV DNA. When this plasmid was used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS FOR GENERATE RECOMBINANT SPV, was a virus containing DNA encoded for foreign genes. Note that the gene / 3-glycononidase (uidA) is under the control of a synthetic initial pustular disease promoter (EP2) and the FIV env gene is under the control of a late / initial synthetic pustular disease promoter (LP2EP2). The homology vector was constructed using standard recombinant DNA techniques (22 and 30), by joining the restriction fragments of the following sources with the appropriate synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 3005 base pairs HindIII of pSP65 (promega). Fragment 1 is a restriction sub-fragment of about 1652 base pairs HindIII to EcoRI of the HindIII restriction fragment of SPV. Fragment 2 is a fragment of about 2564 base pairs of BamHI to BamHI of the FIV env gene (61) (approximately 860 amino acids which includes the full length SU and the TM coding regions of the FIV env) synthesized by CLONING WITH THE REACTION OF POLYMERASE CHAIN. The tempering for the PCR reaction was the genomic cDNA of PPR strain FIV (61). The upstream primer 10 / 93.21 (5'-GCCCGGATCCTATGGCAGAAGGGTTTGCAGC-3 ';) was synthesized corresponding to the 5' end of the FIV env gene starting at nucleotide 6263 of the PPR genomic cDNA of FIV strain, and the procedure introduced a BamHI site at the end 5 AND The primer is below 1 0/9 3. 2 0 (5'CCGTGGATCCGGCACTCCATCATTCCTCCTC-3 ';) was synthesized corresponding to the 3 'end of the FIV env gene starting in nucleotide 8827 of the FIV PPR genomic cDNA, and the procedure introduced a BamH1 site at the 3-terminus AND fragment 3 is a restriction fragment of approximately 1800 base pairs EcoRI to Xmal containing the E. coli uidA gene. Fragment 4 is a restriction fragment of approximately 3010 base pairs BamH1 to Pvul1 of plasmid pJF751 (11). Fragment 5 is a restriction subfragment of approximately 5053 base pairs EcoRI to HindIII of the HindIII restriction fragment K of SPV. The EcoRI site in fragments 1 and 5 of the SPV homology vector was converted to a unique NotI site.

S-SPV-089 S-SPV-089 is a pig pustular disease virus that expresses three foreign genes. The gene for E. coli jß-galactosidase (lacZ) and the gene for feline leukemia virus (FeLV) were inserted into the open reading frame 738-94.4 (a deletion of 773 base pairs from the OlL open reading frame of SPV, deletion of nucleotides 1679 to 2452, -SECUENCE ID No. 189). The lacZ gene is under the control of the OlL promoter of pig pustular disease and the FeLV gene is under the control of the late synthetic / initial promoter (LP2EP2).

S-SPV-089 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 832-26.Al (see Materials and Methods) and the S-SPV-001 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was examined for the EXAMINATION TO EXPRESS RECOMBINANT SPV jß-galactosidase (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-089. This virus was tested for ß-galactosidase expression, purity, and insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods. After five initial rounds of purification, all the plates observed were blue indicating that the virus was pure, stable, and expressed the foreign gene.

S-SPV-089 was assayed for the expression of FeLV-specific antigens using the BLACK PLATE EXAMINATION FOR EXPRESSION OF GENE GENE IN RECOMBINANT SPV. Anti-p27 polyclonal mouse serum, rabbit anti-p27 serum and rabbit anti-β-galactosidase were shown to react specifically with the S-SPV-089 plates and not with the negative control plates of S- SPV-003. All S-SPV-089 observed plates reacted with the antiserum indicating that the virus is stably expressing the gag protease of FeLV and the proteins of E. coli / 3-galactosidase.

S-SPV-089 is useful as a vaccine in cats against the disease caused by the feline leukemia virus. The antigen of FeLV is key to raising the immune response in the animal. The recombinant viruses are useful alone or in combination as an effective vaccine. S-SPV-089 is also useful as an expression vector for expressing FeLV antigens.

Such FeLV antigens are useful for identifying antibodies directed against wild-type FeLV. The virus is also useful as a source of antigens for the production of monospecific polyclonal or monoclonal antibodies. Such antibodies are useful in the development of specific diagnostic tests for viral proteins. Monoclonal or polyclonal antibodies are generated in mice using these viruses according to the PROCEDURE FOR THE PURIFICATION OF VIRAL GLICOPROTEINS FOR USE AS DIAGNOSTICS (Materials and Methods).

VECTOR OF HOMOLOGY 832.26.Al. Plasmid 832-26.Al was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene of E. coli / S-galactosidase (lacZ), and the gene for feline leukemia virus (FeLV) flanked by SPV DNA. "Upstream of the foreign gene is a fragment of approximately 855 base pairs of the SPV DNA.A downstream of the foreign genes is a fragment of approximately 1113 base pairs of the SPV DNA.When the plasmid is used according to the HOMOLOGOUS RECOMBINATION PROCEDURE TO GENERATE RECOMBINANT SPV will result in a virus containing the DNA encoded for foreign genes.Note that the jß-galactosidase marker gene (lacZ) is under the control of an OlL gene promoter of pustular disease virus. pig and the FeLV gene is under the control of the late / initial promoter (LP2EP2) .The FeLV gene cassette of LP2EP2 was inserted into the EcoRI and BamH1 site of the homology vector 752-22.1 The homology vector 832- 26.Al was constructed using standard recombinant DNA techniques (22, 30) by joining the restriction fragments of the following sources with the synthetic DNA sequences. erivated from a restriction fragment of approximately 2519 base pairs HindIII to Sphl from pSP65 (promises) Fragment 1 is a subfragment of approximately 855 base pairs of the HindIII restriction M fragment of SPV (23) synthesized by polymerase chain reaction or a n d or i m p r i s D N A 'GAAGCATGCCCGTTCTTATCAATAGTTTAGTCGAAAATA-3' and 5'-CATAAGATCTGGCATTGTGTTATTATACTAACAAAAATAAG-3 'to produce a fragment of 855 base pairs with the Sphl and BglII ends. Fragment 2 is a fragment of 3002 base pairs BamH1 to Pvul1 derived from plasmid pJF751 (49) containing the E. coli lacZ gene. Fragment 3 is a restriction fragment of approximately 2160 base pairs of EcoRI to BamH1 from FeLV (the gag open reading frame is approximately 584 amino acids, the open reading frame of protease is approximately 136 amino acids ) synthesized by polymerase chain reaction (PCR) using cDNA from strain FeLV / FIDAS, type A (cDNA clone p61E, NIAIDS deposit from Dr. Mullen). The primer 5 'CGTCGAATTCGATGTCTGGAGCCTCTAGTGGGA-3'; 1 / 96.32 (SEQUENCE ID No. 38) is synthesized from the 5 'end of the FeLV gene, introduces an EcoRI site at the 5' end of the gene and the ATG start codon. The primer (5 'CGTCGGATCCGGCTCAAATAGCCGATACTCTTCTT-3', - 1 / 96.33) (SEQUENCE ID DO NOT. 39) is synthesized from the 3 'end of the FeLV gene. The PCR product was digested with EcoRI and BglII to give a fragment of 2160 base pairs in length corresponding to the FeLV. Fragment 4 is one of approximately 1113 base pairs of the M HindIII fragment of SPV synthesized by polymerase chain reaction using DNA primers of 'CCGTAGTCGACAAAGATCGACTTATTAATATGTATGGGATT-3 'and 5'GCCTGAAGCTTCTAGTACAGTATTTACGACTTTTGAAAT-3' to produce fragments of 1113 base pairs with the SalI and HindIII ends.

S-SPV-100 S-SPV-100 is a virus of pig pustular disease that expresses two foreign genes. The gene for E. coli jß-galactosidase (lacZ) and the gene for the envelope of (env) feline leukemia virus (FeLV) gp70 + pl5E were inserted into the open reading frame 617-48.1 of SPV (a site of Single Notl restriction has been replaced to the single Accl restriction site). The lacZ gene is under the control of the synthetic late promoter (LP1) and the env gene of FeLV is under the control of the late synthetic / initial promoter (LP2EP2).

The S-SPV-100 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 843-9322 (see Materials and Methods) and the S-SPV-001 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was examined for the EXAMINATION TO EXPRESS RECOMBINANT SPV β-galactosidase (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-100. This virus was tested for β-galactosidase expression, purity, and insert stability by multiple passes monitored by the plaque assay, blue as described in Materials and Methods. After five initial rounds of purification, all the plates observed were blue indicating that the virus was pure, stable, and expressed the foreign gene.

S-SPV-100 was assayed for the expression of FeLV-specific antigens using the BLACK PLATE EXAMINATION FOR EXPRESSION OF GENE GENE IN RECOMBINANT SPV. The anti-p70 polyclonal mouse serum, and rabbit anti-β-galactosidase were shown to react specifically with the S-SPV-100 plates and not with the negative control plates of S-SPV-003. All S-SPV-100 observed plates reacted with the antiserum indicating that the virus is stably expressing the gag protease of FeLV and the E. coli jß-galactosidase proteins.

S-SPV-100 is useful as a vaccine in cats against the disease caused by the feline leukemia virus.

The FeLV env antigen is key to raising the immune response in the animal. The recombinant viruses are useful alone or in combination as an effective vaccine. S-SPV-100 is also useful as an expression vector for expressing FeLV antigens. Such FeLV antigens are useful for identifying antibodies directed against wild-type FeLV. The virus is also useful as a source of antigens for the production of monospecific polyclonal or monoclonal antibodies. Such antibodies are useful in the development of tests, diagnostic specific for viral proteins. Monoclonal or polyclonal antibodies are generated in mice using these viruses according to the PROCEDURE FOR THE PURIFICATION OF VIRAL GLICOPROTEINS FOR USE AS DIAGNOSTICS (Materials and Methods). .-. - .-- .- I \ - VECTOR OF HOMOLOGY 843-9322. Plasmid 843-9322 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene for E. coli β-galactosidase (lacZ), and the gp70 + pl5E gene from the envelope (env) of the feline leukemia virus (FeLV) flanked by the SPV DNA. Upstream of the foreign gene is a fragment of approximately 1484 base pairs of the SPV DNA. Downstream of foreign genes is a fragment of approximately 2149 base pairs of SPV DNA. When the plasmid is used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE RECOMBINANT SPV, a virus containing DNA encoded for foreign genes will result. Note that the β-galactosidase marker gene (lacZ) is under the control of a late promoter (LP1) and the FeVL env gene is under the control of the late / initial promoter (LP2EP2). This was constructed using standard recombinant DNA techniques (22, 30) by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2972 base pairs HindIII to BamH1 from pSP64 (promega). Fragment 1 is a restriction subfragment of approximately 1484 base pairs BglII to Acc of the HindIII restriction M fragment of SPV (23). Fragment 2 is a restriction fragment of about 1973 base pairs EcoRi to BamHl of the gene (gp70 + pl5E) of FeLV env (the open reading frame -env is approximately 58 amino acids) synthesized by reaction. of polymerase chain (PCR) using cDNA from strain FeLV / FAIDS, type A (clone p61E from cDNA, NIAIDS deposit from Dr. Mullen). The primer (5'-CGTCGAATTCAATGGAAAGTCCAACGCACCCAAAA-3 '; 1 / 96.31) (SEQUENCE ID No. 40) is synthesized from the 5' end and the env gene of FeLV, introduces an EcoRi site at the 5 'end of the gene and a codon of start ATG. The primer (5 '-CGTCGGATCCGGGGACTAAATGGAATCATACA-3'; 1 / 96.28 (SEQUENCE ID NO.41) is synthesized from the 3 'end of the env gene of FeLV The PCR product was digested with EcoRI and BglII to give a fragment of 1973 pairs of base in length corresponding to the env gene of FeLV.Fragment 3 is a restriction fragment of approximately 3010 base pairs of BamHl to PvuII from plasmid pJF751 (11) .Fragment 3 is a subfragment of approximately 2149 base pairs Accl to HindIII of the M HindIII fragment of SPV Accl sites in fragments 1 and 3 were converted to unique NotI sites using Notl linkers.

S-SPV-107 v S-SPV-108 S-SPV-107 is a virus of. Pustular pig disease that expresses three foreign genes. The gene for E. coli jß-galactosidase (lacZ) is inserted into the unique PstI restriction reaction site (PstI linkers inserted into a single Accl site in the open reading frame olL of SPV). The gene for the virus - feline leukemia (FeLV) and envelope (env) gp70 + pl5E was inserted into the unique Notl restriction site (Notl linkers inserted into a single N site in the open OLL reading frame of SPV, a subfragment of approximately 545 base pairs from Ndel to Ndel (nucleotides 1560 to 2104; SEQUENCE ID NO. 189 of the M fragment of HindIII of SPV has been deleted). The lacZ gene is under the control of the synthetic late promoter (LP1), the genes and env of FeLV are under the control of the late synthetic / initial promoter (LP2EP2). The transcription direction of the env gene and FeLV are the same as the transcription direction of the lacZ gene and the OlL gene of SPV.

The S-SPV-107 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 840-68.Al and the S-SPV-001 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was examined for the EXAMINATION TO EXPRESS RECOMBINANT SPV jß-galactosidase (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-100. This virus was tested for the expression of jß-galactosidase, - pure2ia, and stability inserted by multiple passes monitored by the blue plate assay as described in Materials and Methods. After five initial rounds of purification, all the plates observed were blue indicating that the virus was pure, stable, and expressed the foreign gene. - - - - - ~ v. _-. .: .-...-Y:. :, .- • - -. ~ _ -. - a - S-SPV-108 'is a virus of pig pustular disease that expresses three foreign genes. The gene for E. coli jß-galactosidase (lacZ) is inserted into the unique PstI restriction reaction site (PstI linkers inserted into a single Accl site in the open reading frame olL of SPV). The gene for feline leukemia virus (FeLV) and envelope (env) gp70 + pl5E was inserted into the unique Notl restriction site (Notl linkers inserted into a single Ndel site in the OlL open reading frame of SPV; a subfragment of approximately 545 base pairs from Ndel to Ndel (nucleotides 1560 to 2104; SEQUENCE ID No. 189 of the M fragment of HindIII from SPV has been deleted). The lacZ gene is under the control of the synthetic late promoter (LP1), the genes and env of FeLV are under the control of the late synthetic / initial promoter (LP2EP2). The transcription direction of the env gene and FeLV are the same as the transcription direction of the lacZ gene and the OlL gene of SPV.

The S-SPV-108 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 840-68.A6 and the S-SPV-001 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was examined for the EXAMINATION TO EXPRESS RECOMBINANT SPV jß-galactosidase (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV ~ 10 .---- c. £ > This virus was tested; Regarding the expression of fi-galactosidase, - purity, and stability insert by multiple passes monitored by the blue plate assay as described in Materials and Methods. After five initial rounds of purification, all the plates observed were blue indicating that the virus was pure, stable, and expressed the foreign gene.

S-SPV-107 or S-SPV-108 are useful as a vaccine in cats against the disease caused by the feline leukemia virus. The FeLV env antigens are key to raising a protective immune response in the animal. The recombinant viruses are useful alone or in combination as an effective vaccine. S-SPV-107 or S-SPV-108 are also useful as an expression vector for expressing FeLV antigens. Such FeLV antigens are useful for identifying antibodies directed against wild-type FeLV. The virus is also useful as a source of antigens for the production of monospecific polyclonal or monoclonal antibodies. Such antibodies are useful in the development of specific diagnostic tests for viral proteins and "Monoclonal or polyclonal antibodies are generated in mice using these viruses according to the PROCEDURE FOR THE PURIFICATION OF VIRAL GLICOPROTEINS TO BE USED AS DIAGNOSTICS ( Materials and methods) .

VECTORS OF HOMOLOGY 840-68.Al and 840-8.A6. ~ Homology vectors are constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene of E. coli jß-galactosidase (lacZ), and for genes gp70 + pL5E of envelope (env) and protease (gag) of feline leukemia virus (FeLV) flanked by SPV DNA. The transcription direction of the env and feline leukemia virus gene is the same as the transcription direction of the lacZ gene and the OlL gene of SPV of the homology vector 840-68.Al. The transcription direction of the env gene and the feline leukemia virus is opposite to the transcription direction of the lacZ gene and the OlL gene of SPV at 840-68.A6. Upstream of the foreign genes is a fragment of approximately 1484 base pairs of the SPV DNA. Downstream of the foreign genes is a fragment of approximately 1560 base pairs of the SPV DNA. When the plasmid is used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE RECOMBINANT SPV, a virus containing DNA encoded for foreign genes will result. Note that the jβ-galactosidase marker gene (lacZ) is under the control of a synthetic late pustular disease (LP1) promoter, the env gene and gag / potease gene of the feline leukemia virus are "each - under the control of A late / initial promoter of synthetic pustular disease (LP2EP2) was constructed using standard recombinant DNA techniques (22 and 30), by joining the restriction fragments from the following sources with the synthetic DNA sequences. plasmid was derived from "a restriction fragment of approximately 2972 = ares of base HindIII to BamH1 of pSP64 ~ (promega). Fragment 1 is a restriction sub-fragment of approximately 1484 base pairs BglII to Acc of the M fragment of HindIII restriction of SPV (2. 3) . Fragment 2 is a restriction fragment of approximately 3010 base pairs BamH1 to PvuII of plasmid pJF751 (11). Fragment 3 is a subfragment of approximately 48 base pairs Accl to Ndel of the M HindIII fragment of SPV. Fragment 4 is a restriction fragment of approximately 2160 base pairs EcoRI to BamHI of the feline leukemia virus (gag open reading frame of approximately 584 amino acids, the open reading frame of protease is approximately 136 amino acids ) synthesized by polymerase chain reaction (PCR) using the cDNA of • strain FeLV / FAIDS, type A (cDNA clone p61E, NIAIDS deposit by Dr. Mullen). The primer 5 'CGTCGAATTCGATGTCTGGAGCCTCTAGTGGGA-5 3'; 1 / 96.32 (SEQUENCE ID No. 38) is synthesized from the 5 'end of the FeLV gene, introduces an EcoRI site at the 5' end of the gene. One the box start codon (ATG) is an LP2EP2 promoter, and one second in the box start codon is in the gene encoded by the primer-PCR. - "" The primer (5 'CGTCGGATCCGGCTCAAATAGCCGATACTCTTCTT-3'; 1 / 96.33) (SEQUENCE ID NO.39) is synthesized from the 3 'end of the FeLV gene. The PCR product was digested with EcoRI and BglII to give a fragment of 2160 base pairs in length corresponding to the feline leukemia virus gene. -The fragment 5 is a fragment of Restriction of approximately 1973 base pairs of EcoRI to BamHI of the feline leukemia virus env (gp70 + pl5E) (the open reading frame of env is approximately 658 • amino acids) synthesized by polymerase chain reaction (PCR) using the cDNA of the FeLV / FAIDS strain, type A (cDNA clone p61E, deposit NIAIDS of Dr. Mullen). The primer (5 '-CGTCGAATTCAATGGAAAGTCCAACGCACCCAAAA-3'; 1 / 96.31) (SEQUENCE ID NO: 40) is synthesized from the 5 'end of the fel gene of the feline leukemia virus, introduces an EcoRi site at the 5' end of the gene. One in the box start codon (ATG) is the promoter LP2EP2, and one second in the start codon of the frame is the gene encoded with the PCR primer. The primer (5'-CGTCGGATCCGGGGACTAAATGGAATCATACA-3 '; 1 / 96.28 (SEQUENCE ID NO.41) is synthesized from the 3' end of the feline leukemia virus env gene.The PCR product was digested with EcoRI and BglII to give a fragment of 1973 base pairs in length corresponding to the env gene of the feline leukemia virus Fragment 6 is a subfragment of approximately 1560 base pairs from Ndel to HindIII of the M fragment of SPV HindIII The Accl fragment sites 1 and 3 were converted to unique PstI sites using PstI linkers The Ndel sites in fragments 3 and 6 were converted to Notl sites using Notl linkers A subfragment of approximately 545 base pairs from Ndel to Ndel (nucleotides 1560 to 2104, SEQUENCE ID NO. ) of the M HindIII fragment of SPV have been deleted which would be extended to fragments 3 and 6 of the SPV.

'S-SPV-128 S-SPV-128 is a pig pustular disease virus that expresses four foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for feline leukemia virus (FeLV) were inserted into the open reading frame 738-94.4 (a suppression of 773 base pairs of the open reading frame OlL of SPV, suppression of nucleotides 1669 to 2452, SEQUENCE ID No. 189). The gene for E. coli ß-glucuronidase (uidA) and the gene for gp70 + pl5E from envelope (env) feline leukemia virus (FeLV) were inserted into a single Notl site (Notl linkers inserted at a restriction site Single EcoRI within a region of 3.2 kb approximately (SEQUENCE ID NO.1) of the 6.7 kb HindIII K fragment 6. The lacZ gene is under the control of the synthetic late promoter (LP1), the uidA gene is under the control of the synthetic initial promoter (EP2), and the envelope and feline leukemia virus genes are each under the control of the late synthetic / initial promoter (LP2EP2).

S-SPV-128 was derived from S-SPV-089 (Cepa Kasza). This was achieved using the homology vector 860-2 (see Materials and Methods) and the S-SPV-089 virus in the RECOMBINATION PROCEDURE HOMOLOGOUS TO GENERATE SPV AND RECOMBINANT. He . Transfection supply- was examined. 'respect' of the EXAMINATION TO EXPRESS: RECOMBINANT SPV- - jß-galactosidase and jß-glucuronidase (BLUOGAL TRIALS AND CPRG) and REVIEW FOR RECOMBINANT HERP VIRUS EXPRESSING ENZYMATIC MARKERS GENES). The final result of red plaque and purification of blue plaque was the recombinant virus designated S-SPV-128. This virus was tested for jß-galactosidase and β-glucuronidase expression, purity, and insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods. After three initial purification runs, all plaques were observed to be blue indicating that the virus was pure, stable, and was expressing the aj genes.

S-SPV-128 is useful as a vaccine in cats against IVF infection. S-SPV-128 is also useful for the expression of FIV env and gag proteins.

VECTOR OF HOMOLOGY 86.0-2. Plasmid 860-2 was used to insert foreign DNA into the SPV. This incorporates a marker gene for E. coli β-glucuronidase (uidA) and the gene for gp70 + pl5E from envelope (env) of feline leukemia virus (FeLV) flanked by SPV DNA. When this plasmid was used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS FOR GENERATE A RECOMBINANT SPV, was a virus containing DNA encoded for foreign genes. Note that the ß-glucuronidase marker gene (uidA) is under the control of a synthetic initial pustular disease promoter (EP2) and the env gene FeLV gene OlL is under control of a late pustular disease promoter. / Initial Synthetic (LP2EP2) The homology vector was constructed using the standard recombinant DNA techniques (22 and 30), by joining the restriction fragments of the following sources with the appropriate synthetic DNA sequences.The plasmid vector was derived from a restriction fragment of approximately 3005 base pairs HindIII of pSP65 (Promega) Fragment 1 is a restriction subfragment of approximately 1652 base pairs HindIII to EcoRI of the HindIII restriction fragment of SPV.Fragment 2 is a fragment of restriction of approximately 1973 base pairs EcoRI to BamHl from env (gp70 + pl5E) of FeLV (of approximately 860 amino acids which includes the full length SU and the TM coding regions of the FIV env) synthesized by polymerase chain reaction (PCR) using cDNA from strain FeLV / FAIDS, Type A (cDNA clone p61E; NIAIDS deposit by Dr. Mullens). The primer (5 '-CGTCGAATTCAATGGAAAGTCCAACGCACCCAAAA-3'; 1/96 .31) (SEQUENCE ID NO: 40) is synthesized from the 5 'end of the env gene of FeLV, introduces an EcoRI site at the 5' end of the gene and a codon Start ATG. The primer (5'-CGTCGGATCCGGGGACTAAATGGAATCATACA ~ 3 '; 1 / 96.28) (SEQUENCE ID No. 41) is synthesized from the 3' end and the env gene of FeLV. The PCR product was digested with EcoRI and BglII to give a 1973 base pair fragment in length corresponding to the env gene of FeLV. Fragment 3 is a restriction fragment of approximately 1800 pairs of cells from EcoRI- to Xpta? containing "E. coli üidA gene." - The 4 'fragment is "a restriction subfragment of approximately 5053 base pairs EcoRI to HindIII of the HindIII restriction K fragment of SPV. The EcoRI sites in fragments 1 and 4 of the SPV homology vector were converted to a single Notl site.

CONSTRUCTIONS AND PORCINE VACCINES S-SPV-084 S-SPV-084 is a pig pustular disease virus that expresses at least two aj genes. The gene for E. coli jß-galactosidase (lacZ) and the gene for porcine reproductive and respiratory syndrome virus (PRRS) open reading frame 6 were inserted into the open reading frame 738-94.4 of SPV (a deletion of 773 base pairs of the open reading frame OlL of the SPV, deletion of nucleotides 1669 to 2452, SEQUENCE ID NO: 189). The lacZ gene is under the control of the POIL promoter of pig pustuosa disease and the open reading frame 6 gene of the PRRS is under the control of the late synthetic / initial promoter (LP2EP2).

S-SPV-084 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 831-38.22 (see Materials and Methods) and the S-SPV-001 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE TO GENERATE SPV A RECOMBINANT. "The transfection supply was examined by him? XAMEN FOR RECOMBINANT SPV EXPRESSING jß-galactosidase (BLUOGAL ESSAYS AND CPRG) The final result of the red plaque purification was the recombinant virus designated S-SPV-084. This virus was tested for of β-galactosidase expression, purity and insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods After three initial rounds of initial purification, all plates observed were blue indicating that the virus was pure, stable and expressed the foreign gene.

To confirm the expression of the PRRS open reading frame 6 protein gene product of PRRS, the cells were infected with S-SPV-084 and the samples of the infected cell lysates were subjected to polyacrylamide gel electrophoresis. SDS. The gene was stained and analyzed using the WEST STAIN PROCEDURE. An anti-PRRS serum (NVSL) of polyclonal pig was used to detect the expression of specific PRRS proteins. The cell lysate of the cells infected with -S-SPV-084 exhibited "uhá" b "anda" corresponding to 18 kd, which is the expected size of the open reading frame matrix protein 6 of the PRRS.

S-SPV-084 is useful as a vaccine in pigs against PRRS infection. "^ 1 S-SPV ^ -Oßí also" is useful for expression of matrix protein "tie open reading frame 6 of the PRRS.

VECTOR OF HOMOLOGY 831-38.22. The homology vector 831-38.22 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene of E. coli β-galactosidase (lacZ), and the open reading frame marker gene 6 of the porcine reproductive respiratory syndrome virus (PRRS) flanked by the SPV DNA. Upstream of the foreign genes is a fragment of approximately 855 base pairs of the SPV DNA. Downstream of the foreign genes is a fragment of approximately 1113 base pairs of the SPV DNA. When the plasmid is used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE A RECOMBINANT SPV, a virus containing DNA encoded for foreign genes was found. Note that the β-galactosidase marker gene (lacZ) is under the control of the OlL promoter of porcine pustular disease virus and of the PRRS ORF 6 matrix gene is under the control of the late / initial promoter of synthetic pustular disease (LP2EP2 ). This was constructed using standard recombinant DNA techniques (22 and 30) by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2519 base pairs of HindIII to Sphl from pSP65 (Promega) Fragment 1 is a subfragment of approximately 855 base pairs of the M HindIII restriction fragment of SPV (23) synthesized by polymerase chain reaction using rimmers D NA 5 'GAAGCATGCCCGTTCTTATCAATAGTTTAGTCGAAAATA-3' and 5'-CATAAGATCTGGCATTGTGTTATTATACTAACAAAATAAG-3 'to produce a fragment of 855 base pairs with Sphl and BglII ends. Fragment 2 is a restriction fragment of approximately 3002 base pairs BamH1 to PvuII of plasmid pJF751 (11). Fragment 3 is an EcoRI restriction fragment to BamH1 synthesized by reverse transcription and polymerase chain reaction (PCR) using the genomic RNA of a U.S. of PRRS obtained from the NVSL (Reference strain, IA-2). To synthesize the PRRS 0RF6 matrix gene, the primer (5 'CGGGAATTCGGGGTCGTCCTTAGATGACTTCTGCC-3'; 1 / 96.17) (SEQUENCE ID NO: 42) is synthesized from the 5 'end of the PRRS ORF6 gene, introduces an EcoRI site at the end 5 'of the gene. The primer (5 'GCGGATCCTTGTTATGTGGCATATTTGACAAGGTTTAC-3'; 1 / 96.18) (SEQUENCE ID No. 43) is used to reverse transcription and PCR and is synthesized from the 3 'end of the PRRS 0RF6 gene. The PCR product was digested with EcoRI and BamHl to give a fragment of 532 base pairs in length corresponding to the PRRS 0RF6 gene. Fragment 4 is a subfragment of approximately 1113 base pairs of the M HindIII fragment of SPV synthesized by polymerase chain reaction using primers 5 'DNA -CCGTAGTCGACAAAGATCGACTTATTAATATGTATGGGATT-3' and 5 'GCCTGAAGCTTCTAGTAACAGTATTTACGACTTTTGAAAT-3f to produce a -fragment "of 1113 pairs base with SalI-and HindIII ends.

S-SPV-091 S-SPV-091 is a pig pustular disease virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for ORF 2 of the porcine reproductive and respiratory syndrome virus (PRRS) were inserted into the ORF 617-48.1 of the SPV (a unique Notl restriction site has replaced a Single Accl restriction site The lacZ gene is under the control of the synthetic late promoter (LP1) and the PRRS ORF2 gene is under the control of the synthetic late / initial promoter (LP2EP2).

S-SPV-091 was derived from S-SPV-001 (Cepa Kasza). 5 This was achieved using the homology vector 844-15.110 (see Materials and Methods) and the S-SPV-001 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING AN SPV RECOMBINANT. The transfection supply was examined by the EXAMINATION FOR RECOMBINANT SPV EXPRESSING "-galactosidase (ESSAYS) BLUOGAL AND CPRG). The final result of plaque purification • red were the recombinant virus designated S-SPV-091. This virus was tested for the expression of β-galactosidase, the purity and stability of the insert by multiple passes monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of initial purification, all the plates observed were blue indicating that the virus was pure, stable and expressed the gene • alien S-SPV-091 is useful as a vaccine in pigs against PRRS infection. S-SPV-091 is also useful for the expression of the ORF2 protein of PRRS.

VECTOR OF HOMOLOGY 844-15.110. Plasmid 844-25 15,110 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene of E. coli β-galactosidase (lacZ), and the 0RF2 gene of porcine reproductive respiratory syndrome virus (PRRS) flanked by SPV DNA. Upstream of the foreign genes is a fragment of approximately 1484 base pairs of the SPV DNA. Downstream of foreign genes is a fragment of approximately 2149 base pairs of SPV DNA. When the plasmid is used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE A RECOMBINANT SPV, a virus containing DNA encoded for foreign genes was found. Note that the β-galactosidase marker gene (lacZ) is under the control of the late promoter (LP1) of the porcine pustular disease virus and of the PRRS ORF2 gene is under the control of the late / initial promoter (LP2EP2). This was constructed using DNA techniques from , standard-recombinant (22 and 30) by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2972 base pairs of HindIII to BamH1 from pSP64 (Promega). Fragment 1 is a restriction subfragment of approximately 1484 base pairs BglII to Accl of the M HindIII restriction fragment of SPV (2. 3) . Fragment 2 is an EcoRI restriction fragment a BamHl synthesized by reverse transcription and polymerase chain reaction (PCR) using the genomic RNA of an isolated U.S. of PRRS obtained from the NVSL (Reference strain, IA-2). To synthesize the PRRS ORF2, the primer (5 'ATTGAATTCGAAATGGGGTCCATGCAAAGCCTTTTTG-3'; 1 / 96.15) (SEQUENCE ID NO.44) was synthesized from the 5 'end of the PRRS ORF2 gene, an EcoRI site was introduced at the 5' end of the gene. The primer (5 'CAAGGATCCCACACCGTGTAATTCACTGTGAGTTCG-3'; 1 / 96.16) (SEQUENCE ID NO.45) was used for reverse transcription and PCR and was synthesized from the 3 'end of the PRRS 0RF2 gene. The PCR product was digested with EcoRI and BamHI to give a fragment of approximately 788 base pairs in length corresponding to the PRRS 0RF2 gene. Fragment 3 is a restriction fragment of about 3010 base pairs BamH1 to PvuII of plasmid pJF751 (11). Fragment 4 is a subfragment of approximately 2149 base pairs Accl to HindIII of the M fragment of HindIII from SPV. The Accl sites in fragments 1 and 4 were converted to unique Notl sites using Notl linkers. - - - .. _ S-SPV-092 S-SPV-092 is a virus of pig pustular disease that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for porcine reproductive and respiratory syndrome virus (PRRS) ORF 7 nucleocapsids were inserted into the ORF 617-48.1 of SPV (a unique Notl restriction site has replaced a single Accl restriction site). The lacZ gene is under the control of the synthetic late promoter (LPl) and the ORF 7 S-SPV-092 nucleocapsid gene observed reacted with the antiserum indicating that the virus was stably expressing the ORAC 7 nucleocapsid protein of PRRS.

S-SPV-092 is useful as a vaccine in pigs against PRRS infection. S-SPV-092 is also useful for the expression of the nucleocapsid protein of PRRS ORF 7.

VECTOR OF HOMOLOGY 844-19.94. Plasmid 844-1994 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene of E. coli β-galactosidase (lacZ), and the ORF 7 gene of the porcine reproductive respiratory syndrome virus (PRRS) flanked by the -VPDNA. "Above the foreign gene is a fragment of about 1484" base pairs of DNA ~ of ~ SPV ~. Downstream of foreign genes is a fragment of approximately 2149 base pairs of SPV DNA. When the plasmid is used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE A RECOMBINANT SPV, a virus containing DNA encoded for foreign genes was found. Note that the β-galactosidase marker gene (lacZ) is under the control of the late promoter (LP1) of the PRRS ORF 7 gene is under the control of the late / initial promoter (LP2EP2). This was constructed using standard recombinant DNA techniques (22 and 30) by binding the restriction fragments from the following sources with the S-SPV-O92 observed reacted with the antiserum indicating that the virus was stably expressing the ORAC nucleocapsid protein 7 of PRRS.

S-SPV-092 is useful as a vaccine in pigs against PRRS infection. S-SPV-092 is also useful for the expression of the nucleocapsid protein of PRRS ORF 7.

VECTOR OF HOMOLOGY 844-19.94. Plasmid 844-1994 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene of E. coli β-galactosidase (lacZ), and the ORF 7 gene of the porcine reproductive respiratory syndrome virus (PRRS) flanked by the SPV DNA. Upstream of the foreign genes, there is a fragment "of approximately 1484 base pairs of the DNA 'of SPV". ~ Down the foreign genes is a fragment of approximately 2149 base pairs of the SPV DNA. When the plasmid is used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE A RECOMBINANT SPV, a virus containing DNA encoded for foreign genes was found. Note that the β-galactosidase marker gene (lacZ) is under the control of the late promoter (LP1) of the PRRS ORF 7 gene is under the control of the late / initial promoter (LP2EP2). This was constructed using standard recombinant DNA techniques (22 and 30) by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2972 pairs • from base HindIII to BamHl from pSP64 (Promega). Fragment 1 is a restriction subfragment of approximately 1484 5 base pairs BglII to Accl of the M HindIII restriction fragment of SPV (23). Fragment 2 is an EcoRI restriction fragment to BamH1 synthesized by reverse transcription and polymerase chain reaction (PCR) using the genomic RNA of a U.S. of PRRS obtained from the "NVSL (reference strain, IA-10 2) .To synthesize the PRRS ORF 7, the primer (5 ') • GTCGAATTCGCCAAATAACAACGGCAAGCAGCAGGAG 3 '; 1 / 96.19) (SEQUENCE ID NO. 46) was synthesized from the 5 'end of the PRRS ORF 7 gene, an EcoRI site was introduced at the 5' end of the gene. The primer (5 '- CAAGGATCCCAGCCCATCATGCTGAGGGTGATG-3'; l / 9"6.20) (SEQUENCE ID NO. 47) was used for reverse transcription and PCR and was synthesized from the 3 'end of the PRRS ORF 7 gene. The PCR product was digested with EcoRI and BamHl to give a fragment of approximately 383 base pairs in length corresponding to the PRRS ORF 7 gene. Fragment 3 is a restriction fragment of about 3010 base pairs BamH1 to PvuII of plasmid pJF751 (11). Fragment 4 is a subfragment of approximately 2149 base pairs Accl to HindIII of the M fragment of HindIII from SPV. The Accl sites in fragments 1 and 4 were converted to unique Notl sites using linkers Notl.

S-SPV-093 S-SPV-O93 is a pig pustular disease virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for porcine reproductive and respiratory syndrome virus (PRRS) ORF 3 were inserted into the ORF 617-48.1 of SPV (a unique Notl restriction site has replaced a Accl restriction site only). The lacZ gene is under the control of the synthetic late promoter (LP1) and the PRRS ORF3 gene is under the control of the late synthetic / initial promoter (LP2EP2).

S-SPV-093 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 839-58.9 (see Materials and Methods) and the virus' S-SPV-001 in RECOMBINATION PROCEDURE OF "HOMOLOGOUS TO GENERATE RECOMBINANT SPV." The transfection strain was examined by EXAMINATION FOR THE RECOMBINANT SPV EXPRESSING ß-galactosidase (BLUOGAL ESSAYS AND CPRG) The final result of the red plaque purification was the recombinant virus designated S-SPV-093. This virus was tested for the β-galactosidase expression, purity and stability of insert by means of multiple ducts monitored by the blue plate assay as described in Materials and Methods After the initial three rounds of purification, all plates were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene.

S-SPV-092 was assayed for the expression of PRRS-specific antigens using the BLACK PLATE EXAMINATION FOR EXPRESSION OF GENE GENE IN RECOMBINANT SPV. The polyclonal pig anti-PRRS serum (NVSL) was shown to react specifically with the S-SPV-093 plates and not with the S-SPV-003 negative control plates. All S-SPV-093 plates observed reacted with the antiserum indicating that the virus was stably expressing the PRRS ORF 3 protein.

To confirm the expression of the PRRS ORF 3 protein gene product, the cells were infected with S-SPV-093 and the samples of the used-cell-infected and the culture supernatants were subjected to polyacrylamide gel electrophoresis of SDS. The gene was stained and analyzed using the WEST STAIN PROCEDURE. An anti-PRRS serum from the polyclonal pig (NVSL) was used to detect the expression of specific PRRS proteins. Cell lysate and culture supernatant cells infected with S-SPV-093 exhibited a band corresponding to 45 kd, which is the expected size of the PRRS ORF 3 protein. The ORF 3 protein was shown to be secreted from the infected cells into the culture medium.

S-SPV-O93 is useful as a vaccine in pigs against PRRS infection. S-SPV-093 is also useful for the expression of the PRRS ORF 3 protein.

VECTOR OF HOMOLOGY 839-58.9. Plasmid 839-58.9 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene of E. coli β-galactosidase (lacZ), and the ORF 3 gene of the porcine reproductive respiratory syndrome virus (PRRS) flanked by the SPV DNA. Upstream of the foreign genes is a fragment of approximately 1484 base pairs of the SPV DNA. Downstream of foreign genes is a fragment of approximately 2149 base pairs of SPV DNA. When the plasmid is used according to the RECOMBINATION PROCEDURE OF 'HOMOLOGOUS TO GENERATE A RECOMBINANT SPV, it turned out' u - virus containing DNA encoded for foreign genes. Note that the β-galactosidase marker gene (lacZ) is under the control of the late promoter (LP1) of the ORF 3 gene of PRRS is under the control of the late / initial promoter (LP2EP2). This was constructed using standard recombinant DNA techniques (22 and 30) by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2972 base pairs of HindIII to Ba Hl from pSP64 (Promega). Fragment 1 is a restriction subfragment of approximately 1484 base pairs BglII to Accl of the M HindIII restriction fragment of SPV (23). Fragment 2 is an EcoRI restriction fragment to BamHl synthesized by reverse transcription and polymerase chain reaction (PCR) using the genomic RNA of a Isolated U.S. of PRRS obtained from the NVSL (Reference strain, IA-2). To synthesize the PRRS ORF 3, the primer (5'- TTCGAATCGGCTAATAGCTGTACATTCCTCCATATTT-3 '; 1 / 96.7) (SEQUENCE ID NO 48) was synthesized from the 5 'end of the PRRS ORF 3 gene, an EcoRI site was introduced at the 5' end of the gene. The primer (5'-GGGGATCCTATCGCCGTACGGCACTGAGGG-3 '; 1 / 96.8) (SEQUENCE ID No. 49) was used for reverse transcription and PCR and was synthesized from the 3' end of the PRRS ORF 3 gene. The PCR product was digested with EcoRI and BamHl to give a fragment of approximately 768 base pairs in length corresponding to the ORR 3 gene of PRRS.-., Fragment 3 is a restriction fragment i of approximately 3010 base pairs BamHI to PvuII of the plasmid. pJF751 (11). The fragment 4 is u? subfragment of approximately 2149 base pairs of Accl to HindIII of the M fragment of HindIII of SPV. The Accl sites in the fragments 1 and 4 were converted to unique Notl sites using Notl linkers.

S-SPV-094 S-SPV-094 is a virus of pig pustular disease that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for porcine reproductive and respiratory syndrome virus (PRRS) ORF 4 were inserted into the ORF 617-48.1 of SPV (a unique Notl restriction site has replaced a Accl restriction site only). The lacZ gene is under the control of the synthetic late promoter (LP1) and the PRRS ORF4 gene is under the control of the late synthetic / initial promoter (LP2EP2).

The S-SPV-094 was derived from the S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 839-58.36 (see Materials and Methods) and the S-SPV-O01 virus in HOMOLOGO RECOMBINATION PROCEDURE TO GENERATE A SPV RECOMBINANT. The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING ß-galactosidase (BLUOGAL AND CPRG ESSAYS). The final result of the red plaque purification was the recombinant virus designated S-SPV-094. This virus was tested for the expression of β-galactosidase, purity and stability of insert by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene.

S-SPV-094 was assayed for the expression of PRRS-specific antigens using the BLACK PLATE EXAMINATION FOR EXPRESSION OF GENE GENE IN RECOMBINANT SPV. The polyclonal pig anti-PRRS serum (NVSL) was shown to react specifically with the S-SPV-094 plates and not with the S-SPV-003 negative control plates. All S-SPV-094 plates observed reacted with the antiserum indicating that the virus was stably expressing the PRRS ORF 4 protein.

To confirm the expression of the PRRS ORF 4 gene product of PRRS, the cells were infected with S-SPV-094 and the samples of the infected cell lysates were subjected to the polyacrylamide gel electrophoresis of SDS. The gene was stained and analyzed using the WEST STAIN PROCEDURE. An anti-PRRS serum from the polyclonal pig (NVSL) was used to detect the expression of specific PRRS proteins. Cell lysate from cells infected with S-SPV-094 exhibited a band corresponding to 31 kd, which is the expected size of the PRRS ORF 4 protein.

S-SPV-094 is useful as a vaccine in pigs against PRRS infection. S-SPV-094 is also useful for the expression of the PRRS ORF 4 protein.

VECTOR OF HOMOLOGY 839-58.36. Plasmid 839-58.36 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene of E. coli β-galactosidase (lacZ), and the ORF 4 gene of porcine reproductive respiratory syndrome virus (PRRS) flanked by SPV DNA. Upstream of the foreign genes is a fragment of approximately 1484 base pairs of the SPV DNA. Downstream of foreign genes is a fragment of approximately 2149 base pairs of SPV DNA. _ When the "plasmid is used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE A RECOMBINANT SPV, was a virus containing DNA encoded for foreign genes. Note that the β-galactosidase marker gene (lacZ) is under the control of the late promoter (LP1) of the ORF 4"gene of PRRS is under the control of the late / initial promoter (LP2EP2). This was constructed using standard recombinant DNA techniques (22 and 30) by joining the restriction fragments of the following sources with the synthetic DNA sequences.The plasmid vector was derived from a restriction fragment of approximately 2972 pairs of HindIII to BamH1 base of pSP64 (Promega) Fragment 1 is a restriction subfragment of approximately 1484 base pairs BgIII to Accl of the M HindIII restriction fragment of SPV (23) Fragment 2 is an EcoRI restriction fragment to BamH1 synthesized by reverse transcription and polymerase chain reaction (PCR) using the genomic RNA of a PRRS Isolate US obtained from the NVSL (Reference strain, IA-2) To synthesize the PRRS ORF 4, the primer ( 5'- CCGAATTCGGCTGCGTCCCTTCTTTTCCTCATGG-3 '; 1 / 96.11) (SEQUENCE ID NO. 50) was synthesized from the 5 'end of the PRRS ORF 4 gene, an EcoRI site was introduced at the 5' end of the gene. The primer (5 'CTG? ATCCTTCAAATTGCCAACAGAATGGCAAAAAGAC-3'; 1 / 96.12 (SEQUENCE ID No. 51) was used for reverse transcription and PCR and was synthesized from the 3 'end of the PRRS ORF 4 gene. digested with EcoRI and BamHl to give a fragment of approximately 542 base pairs in length corresponding to the PRRS ORF 4 gene .. Fragment 3 is a restriction fragment of approximately 3010 base pairs BamH1 to PvuII of plasmid pJF751 (11). Fragment 4 is a subfragment of approximately 2149 base pairs Accl to HindIII of the M fragment of SPV HindIII The Accl sites in fragments 1 and 4 were converted to -Notl sites using Notl linkers.

S-SPV-095 S-SPV-095 is a pig pustular disease virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for porcine reproductive and respiratory syndrome virus (PRRS) ORF 5 were inserted into the ORV 617-48.1 of SPV (a unique Notl restriction site has replaced a Accl restriction site only). The lacZ gene is under the control of the synthetic late promoter (LP1) and the PRRS ORF5 gene is under the control of the late synthetic / initial promoter (LP2EP2). • S-SPV-095 was derived from S-SPV-001 (Strain 5 Kasza). This was accomplished using the homology vector 839-58.43 (see Materials and Methods) and the S-SPV-001 virus in HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING β-galactosidase (BLUOGAL AND CPRG ESSAYS). The final result of purification # of red plate was the recombinant virus designated S-SPV-095. This virus was tested for the expression of β-galactosidase, purity and stability of insert by multiple ducts monitored by the blue plate assay as described in Materials and Methods.- After the three initial "rounds" of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene.

To confirm the expression of the ORR 5 protein gene product of PRRS, the cells were infected with S-SPV-095 and the samples of the infected cell lysates were subjected to the polyacrylamide gel electrophoresis of SDS. The gene was stained and analyzed using the PROCEDURE OF STAINING OF THE WEST. An anti-PRRS serum from the polyslonal pig (NVSL) was used to detect the expression of specific PRRS proteins. Cell lysate from cells infected with S-SPV-095 exhibited a band corresponding to 26 kd, which is the expected size of the PRRS ORF 5 protein.

S-SPV-095 is useful as a vaccine in pigs against PRRS infection. S-SPV-095 is also useful for the expression of PRRS ORF 5 protein.

VECTOR OF HOMOLOGY 839-58.43. Plasmid 839-58.43 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene of E. coli β-galactosidase (lacZ), and the ORF 5 gene of the porcine reproductive respiratory syndrome virus (PRRS) flanked by the SPV DNA. Upstream of the foreign genes is a 'fragment of approximately .1484 base pairs' "of the SPV DNA. ~ '~ Downstream of foreign genes is a fragment of approximately 2149 base pairs of SPV DNA. When the plasmid is used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE A RECOMBINANT SPV, a virus containing DNA encoded for foreign genes was found. Note that the β-galactosidase marker gene (lacZ) is under the control of the late promoter (LP1) of the PRRS ORF 5 gene is under the control of the late / initial promoter (LP2EP2). This was built using techniques Standard recombinant DNA (22 and 30) by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2972 base pairs of HindIII to BamH1 from pSP64 (Promega). Fragment 1 is a restriction subfragment of approximately 1484 base pairs BglII to Accl of the M HindIII restriction fragment of SPV (23). Fragment 2 is an EcoRI restriction fragment to BamHl synthesized by reverse transcription and polymerase chain reaction (PCR) using the genomic RNA of a U.S. of PRRS obtained from the NVSL (Reference strain, IA-2). To synthesize the PRRS ORF 5, the primer (5'-TTGAATTCGTTGGAGAAATGCTTGACCGCGGGC-3 '; 1 / 96.13) (SEQUENCE ID NO. 52) was synthesized from the 5' end of the PRRS ORF 5 gene, an EcoRI site was introduced into the 5 'end of the gene. The primer (5 '-GAAGGATCCTAAGGACGACCCCATTGTTCCGCTG-3'; 1 / 96.14 (SEQUENCE ID No. 53) was used for reverse transcription and -CRP and was synthesized from the 3 'end of the ORR 5"" gene of PRRS. The PCR product was digested with EcoRl and "BámHI" for ar "a fragment of approximately 606 base pairs in length corresponding to the PRRS ORF 5 gene.Fragment 3 is a restriction fragment of approximately 3010 base pairs BamHl to PvulI of plasmid pJF751 (11) Fragment 4 is a subfragment of approximately 2149 base pairs Accl to HindIII of the M fragment of SPV HindIII The Accl sites in fragments 1 and 4 were converted to unique NotI sites using linkers Notl.

S-SPV-076 S-SPV-076 is a pig-pustular disease virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for glycoprotein D (gD) and glycoprotein I (gl) of pseudorabies virus (PRV) were inserted into the ORF 617-48.1 of SPV (a site Single Notl restriction has replaced a single Accl restriction site). The lacZ gene is under "e" control l! "synthetic late promoter (LP1) and the gD gene and gl of PRV is under the control of the late synthetic / initial promoter (LP2EP2).

S-SPV-076 was derived from S-SPV-001 (Cepa Kasza). This is achieved by using the homology vector 8'29-55.16 (see Materials and Methods) and the S-SPV-001 virus ep HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV The transfection strain was examined by EXAMINATION RECOMBINANT SPV EXPRESSING ß-galactosidase (BLUOGAL ESSAYS AND CPRG) The final result of the red plaque purification was the recombinant virus designated S-SPV-076. This virus was tested for the β-galactosidase expression, purity and stability of insert through multiple conduits monitored by the blue plate assay as described in Materials and Methods After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene • S-SPV-076 was assayed for the expression of the 5 specific PRV antigens using the BLACK PLATE EXAMINATION FOR EXPRESSION OF GENE GENE IN RECOMBINANT SPV. Anti-PRV polyclonal pig was shown to react specifically with the S-SPV-076 plates and not with the negative control plates S-SPV-003. All the S-SPV-076 plates observed reacted with the antiserum indicating that the virus was stably expressing the gD protein of PRV.

S-SPV-076 is useful as a vaccine in pigs against PRV infection. S-SPV-076 is also useful for the expression of the gD protein and gl of PRV.

VECTOR OF HOMOLOGY 829-55.16. Plasmid 829- • 55.16 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene of E. coli β-20 galactosidase (lacZ), and the glycoprotein D (gD) gene and pseudorabies virus glycoprotein I (gl) flanked by the SPV DNA. Upstream of the foreign genes is a fragment of approximately 1484 base pairs of the SPV DNA. Down the outside genes is a fragment of Approximately 2149 base pairs of the SPV DNA. When the plasmid is used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE A RECOMBINANT SPV, a virus containing DNA encoded for foreign genes was found. Note that the ß-galactosidase marker gene (lacZ) is under the control of the late promoter (LP1) and the gD and gl genes of PRV are under the control of the late / initial promoter (LP2EP2). The homology vector was constructed using standard recombinant DNA techniques (22 and 30) by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2972 base pairs of HindIII to BamH1 from pSP64 (Promega). Fragment 1 is a restriction subfragment of approximately 1484 base pairs BglII to Accl of the M HindIII restriction fragment of SPV (23). Fragment 2 is a restriction fragment of approximately SOCF-pairs of EcoRI a-Sali base - derived from plasmid 538-46. "16 (see O95 / 03070) Fragment 3 is a restriction subfragment of approximately 1900 base pairs SalI to BamHI of the BamHI # 7 genomic DNA fragment of PRV. Fragment 4 is a restriction fragment of approximately 3010 base pairs of Ba Hl a PvuII of plasmid pJF751 (11). Fragment 5 is a subfragment of approximately 2149 base pairs Accl to HindIII of the M fragment of HindIII of SPV. The Accl sites in fragments 1 and 5 were converted to unique Notl sites using Notl linkers. 25 S-SPV-079 • S-SPV-079 is a pig pustular disease virus that expresses two foreign genes. The gene for E. coli β-5 galactosidase (lacZ) and the gene for glycoprotein B (gB) of pseudorabies virus (PRV) were inserted into the unique HindIII restriction site (the HindIII linkers were inserted into a Unique Ndel site in the open OLL reading box of SPV, a subfragment of approximately 545 base pairs of Ndel to Ndel (Nucleotides 1560 to 2104; SEQUENCE ID NO: 189) of the M HindIII fragment of the SPV have been deleted). The lacZ gene is under the control of the synthetic late promoter (LP1) and the gV gene of PRV is under the control of the late synthetic / initial promoter (LP2EP2). S-SPV-079 contains a gene gB of PRV which encodes a protein ie 913 amino acids, "including 69 carboxy terminal amino acids that are missing in the gV gene of PRV of S-SPV-015.

S-SPV-079 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 825-84.3 (see Materials and Methods) and the S-SPV-001 virus in HOMOLOGOUS RECOMBINATION PROCEDURE TO GENERATE AN SPV RECOMBINANT. The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING β-galactosidase (BLUOGAL AND CPRG ESSAYS). The final result of the red plaque purification was the recombinant virus designated S-SPV-076.

This virus was tested for the expression of β-galactosidase, purity and stability of insert by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene.

S-SPV-079 was assayed for the expression of PRV-specific antigens using the BLACK PLATE EXAMINATION FOR EXPRESSION OF GENE GENE IN RECOMBINANT SPV. The polyclonal anti-PRV serum was shown to react specifically with the S-SPV-079 plates and not with the S-SPV-003 negative control plates. All the S-SPV-079 plates observed reacted with the antiserum indicating that the "virus - the PRV gB protein was stably expressing".

To confirm the expression of the gV gene product of PRV, the cells were infected with S-SPV-079 and the samples of the infected cell lysates were subjected to the polyacrylamide gel electrophoresis of SDS. The gene was stained and analyzed using the WEST STAIN PROCEDURE. An anti-PRV serum from the polyclonal pig was used to detect the expression of the PRV-specific proteins. Cell lysate from cells infected with S-SPV-079 exhibited bands corresponding to the precursor gB of 120 kd, and of the processed forms of 67 kd and 58 kd, which are the expected size of the gV protein of PRV. The gV of the PRV exists as a disulfide linked complex of these three forms.

S-SPV-079 is useful as a vaccine in a pig against PRV infection. S-SPV-079 is also useful for the expression of the gV protein of PRV.

VECTOR OF HOMOLOGY 825-84.3. Plasmid 825-84.3 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene of E. coli β-galactosidase (lacZ), and the glycoprotein B (gB) gene of pseudorabies virus (PRV) flanked by the SPV DNA. Upwards of the genes - there is a "fragment" of approximately: 1532 base pairs of the SPV DNA. - Downstream of the foreign genes is a fragment of approximately 1560 base pairs of the SPV DNA. plasmid is used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE A RECOMBINANT SPV, it will result a virus containing DNA encoded for foreign genes.Note that the marker gene of β-galactosidase (lacZ) is under the control of the synthetic late pustular disease (LP1) promoter, the PRV gB gene is under the control of the late synthetic / initial pustular disease promoter (LP2EP2). This was constructed using standard recombinant DNA techniques (22 and 30) by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2972 base pairs • from HindIII to BamHl from pSP64 (Promega). Fragment 1 is a restriction subfragment of approximately 1562 base pairs BglII to Ndel of the HindIII restriction M fragment of SPV (23). Fragment 2 is a fragment of approximately 2600 base pairs EcoRI to SalI derived from plasmid 727-54.60. Fragment 2 contains approximately 43 base pairs of synthetic DNA encoded for amino acids 1 to 16 of gB of PRV and a fragment of approximately 2600 base pairs Smal to Sali • of genomic DNA C of Kpnl of PRV. Fragment 3 is a fragment of approximately 210 base pairs of SalI to BamH1 generated by PCR which contains the coding sequence of the gV gene of PRV. Fragment 3 contains the 69 amino acids of carboxy terminal of gV of PRV which are missing from S-SPV-015. Fragment 3 is a restriction fragment of Salí to BamHl synthesized by polymerase chain reaction (PCR) using the temperate DNA of Kpnl genomic DNA C of PRV. The primer (5 'ATGAAGGCCCTGTACCCCGTCACGA-3'; 11 / 95.3) (SEQUENCE ID NO. 54) synthesized through the Salí of the gV gene of the PRV and reproduced an internal site Salí for the gB gene. . The primer 5 '- CGGGATCCGGCTACAGGGCGTCGGGGTCCTC3' -3 '; 11 / 95.4) (SEQUENCE ID No. 55) was used for PCR and was synthesized from the 3 'end of the PRV gB gene and introduced a BamH1 site at the 3' end of the gB gene of PRV. The PCR product was digested with Salí and Ba Hl to give a fragment of approximately 210 base pairs in length corresponding to the carboxy terminal of the gV gene of PRV. Fragment 4 is a restriction fragment of about 3010 base pairs BamH1 to PvuII of plasmid pJF751 (11). Fragment 5 is a subfragment of about 1560 base pairs Ndel to HindIII of the M fragment of HindIII of SPV. The Ndel sites in fragments 1 and 5 were converted to unique HindIII sites using the HindIII linkers. A subfragment of approximately 545 base pairs Ndel to Ndel (Nucleotides 1560 to 2104; SEQUENCE ID NO: 189) of the M HindIII SPV fragment has been deleted which will be extended to fragments 1 and 5 of SPV.

S-SPV-090 i S-SPV-090 is a pig pustular disease virus that expresses at least two foreign genes. The gene for E. coli β-galactosidase (lacZ) and the gene for glycoprotein I (gO) of pseudorabies virus (PRV) were inserted into the ORF 738-94.4 (a deletion of 773 base pairs of the OlL ORF of SPV, deletion of nucleotides 1679 to 2452; SEQUENCE ID NO: 189). The lacZ gene is under the control of the OlL promoter of pig pustular disease and the gl gene of the PRV is under the control of the late synthetic / initial promoter (LP2EP2).

The S-SPV-090 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 837-58.14 (see Materials and Methods) and the S-SPV-001 virus in HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING β-galactosidase (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-090. This virus was tested for the expression of β-galactosidase, purity and stability of insert by multiple ducts monitored by the blue plate assay as described in Materials and Methods. After the initial three rounds of purification, all plaques were observed to be blue indicating that the virus was pure, stable, and expressing the foreign gene.

S-SPV-090 is useful as a vaccine in sows. against: of PRV infection. The. SrSPV-09.0 is also useful for the expression of the glomercy of PRV gl.

VECTOR HOMOLOGY 837-58.14. Plasmid 837-58.14 was constructed for the purpose of inserting foreign DNA into the SPV. This incorporates a marker gene of E. coli β-galactosidase (lacZ), and the glycoprotein I (gl) gene of pseudorabies virus (PRV) flanked by the SPV DNA. Upstream of the foreign genes is a fragment of approximately 855 base pairs of the SPV DNA. Downstream of the foreign genes is a fragment of approximately 1113 base pairs of the SPV DNA. When the plasmid is used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE A RECOMBINANT SPV, a virus containing DNA encoded for foreign genes will result. Note that the β-galactosidase marker gene (lacZ) is r the control of the OlL gene promoter of the pig pustular disease virus and the gl gene of the PRV is r the control of the late synthetic / initial promoter (LP2EP2). The LP2EP2 PRV gene gl gene cassette was inserted into the Notl site of the homology vector 752-22.1. The homology vector 840-72.Al was constructed using standard DNA-recombinant techniques (22 and 30) by joining the restriction fragments of the following sources with the synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2519 base pairs of HindIII to Sphl from pSP65 (Promega). - - - The - fragment - 1 is - a subfragment of approximately 855 pairs - of the fragment M "of" HindIII restriction of SPV (23) synthesized by polymerase chain reaction using primers 5 'DNA GAAGCATGCCCGTTCTTATCAATAGTTTAGTCGAAAATA- 3 'and 5'-CATAAGATCTGGCATTGTGTTATTATACTAACAAAAAATAAG-3' to produce a fragment of 855 base pairs with Sphl and BglII ends. Fragment 2 is a fragment of 3002 base pairs of BamHI to PvuII derived from plasmid pJF751 (49) containing the E. coli lacZ gene. Fragment 3 is a fragment of approximately 1150 base pairs of BamHI encoded for the PRV gl gene derived from polymerase chain reaction (PCR) (Sambrook et al., 1989) using the BamHI # 7 DNA fragment of PRV ( pSY 138.- 09.) as a tempering for the PCR reaction. To synthesize the PRV gl, the primer (5'-CCGGATCCGGCGCGCGACGTGACCCGGCTC-3 '; 11 / 95.1) (SEQUENCE ID NO.56) was synthesized from the 5' end of the PRV gl gene and a BamHl site was introduced at the 5'-end. 'of the gene. The primer (5'-CCGGATCCGCGGACGGAGATAAAACGCCACCCCAC-3 '; 11 / 95.2 (SEQUENCE ID No. 57) was synthesized from the 3' end of the PRV gl gene and a BamHI site was introduced at the 3 'end of the gene. digested with BamHl to give a fragment of approximately 1150 base pairs in length corresponding to the PRV gl gene.Fragment 4 is a subfragment of approximately 113 base pairs of the M HindIII fragment of SPV synthesized by polymerase chain reaction using DNA primers 5'-CCGTAGTCGACAAAGATCGACTTATTAATATG-TATGGGAT -.3"'- and - 5' GCCTGAAGCTTCTAGTACAGTATTTACGACTT-TTGAAAT-3 '- to" produce a fragment of 113 base pairs with the SalI and HindIII ends.

Example 44; Homology Vectors Useful for Inserting Alien DNA in a Genomic K Region of HindIII of SPV of a Recombinant Pig Pustular Disease Virus Plasmid 854-90.1 was constructed for the insertion of foreign DNA into the virus of recombinant pustular disease. Plasmid 854-90.1 was constructed by changing the unique EcoRI site within the genomic fragment K of HindlII of SPV (Nucleotides: SEQUENCE ID NO: 1) to a unique Notl restriction site through the use of a DNA linker. The homology vector 854-90.1 contains a region of 1652 base pairs of the SPV DNA upstream of the NotI insertion site and a 5058 base pair region of the SPV DNA downstream of the NotI insertion site. A homology vector containing foreign DNA inserted into the plasmid 854-90.1 is useful when it is combined with the DNA of pig pustular disease virus by RECOMBINATION OF HOMOLOGOUS for the construction of the recombinant pig pustular disease viruses.

Plasmid 855-37.5 was constructed for insertion of foreign DNA into a recombinant pig pustular disease virus. Plasmid 855-37.5 was constructed by inserting a restriction fragment of approximately 1875 base pairs Dra I into a K HindIII genome fragment of pig pustular disease virus from plasmid 854-90.1 containing the unique NotI insertion site , within the PNEB193 plasmid. The homology vector 855-37.5 contains a region of approximately 881 base pairs of SPV DNA upstream of the NotI insertion site and a region of approximately 994 base pairs of the SPV DNA downstream of the NotI insertion site. The total size of the homology vector 855-37.5 is approximately 3.9 kb making it ideal for the insertion of two or more foreign genes into the homology vector and by homologous recombination into a recombinant pig pustular disease virus.

Plasmid 847-42.2C was constructed for the insertion of foreign DNA into a recombinant pig pustular disease virus. Plasmid 847-42.2C was constructed for the insertion of the uidA gene into the unique EcoRI site within the genomic K HindIII fragment of SPV. The uidA gene is under the control of the synthetic pox promoter, EP2. The extraneous foreign DNA is inserted upstream of the uidA gene into unique restriction sites Notl, Sfil and Xhol.

Plasmid 847-42.7B was constructed for the insertion of foreign DNA into a recombinant pig pustular disease virus. Plasmid 847-42.2C was constructed for the insertion of the uidA gene into the unique EcoRI site within the genomic fragment. K HindIII de. SPV .. The uidA gene is "under the control of the synthetic initial promoter., EP2. The extra foreign DNA is inserted downstream of the uidA gene into the unique restriction sites Notl, Sfil and Xhol.

S-SPV-120 S-SPV-120 is a virus of pig pustular disease that expresses two foreign genes. The gene for E. coli β-galactosidase (lacZ) was inserted into a single Accl restriction site in the OlL ORF of the M HindIII fragment of SPV. The gene for E. coli β-glucuronidase (uidA) was inserted into a single Notl site (Notl linkers inserted into a unique EcoRI restriction site within a region of approximately 3.2 kb (SEQUENCE ID NO: 1) of fragment K of 6.7 kb SPV HindIII The lacZ gene is under the control of the synthetic late promoter (LP1), the uidA gene is under the control of the synthetic initial promoter (EP2).

S-SPV-120 was derived from S-SPV-003 (Cepa Kasza). This was achieved using the homology vector 847-42.2C (see above) and the S-SPV-0s3 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was examined with respect to the EXAM EXPRESS SPV RECOMBINANT ß-galactosidase and ß-glucuronidase (BLUOGAL AND CPRG ESSAYS) and EXAMINATION FOR HERPES VIRUSES , RECOMBINANT EXPRESSING GENES ENZYMATIC MARKERSV. He' . final result of red plaque and blue plate purification was t the recombinant virus designated S-SPV-120. This virus was tested for β-galactosidase and β-glucuronidase expression, purity, and insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods. After three initial purification runs, all the plates were observed to be blue indicating that the virus was pure, stable, and was expressing the foreign genes.

The S-SPV-120 is useful for inserting sequences of Additional foreign DNA within the recombinant pig pustular disease virus using white bale selection in the presence of BLUOGAL or X-GLUC for selection, from the insertion of foreign DNA into the unique Accl restriction site in the OlL open reading frame of the M HindIII fragment of SPV, and the unique EcoRI restriction site within a region of approximately 3.2 kb of the 6.7 kb SPV HindIII K-fragment.

Some examples of recombinant pig pustular disease viruses expressing foreign DNA at the single Accl restriction site in the OlL ORF of the HindIII M fragment and the unique EcoRI restriction site within a region of approximately 3.2 kb of the HindII K fragment of SPV of 6.7 kb are: recombinant SPV expressing influenza virus hemagglutinin. "of pig, neuraminidase, and nucleoprotein, * - recombinant SPV" ^ expressing ORF 5 ORF 6"of porcine reproductive respiratory disease virus, recombinant SPV expressing ORF 2, ORF 3, ORF 4, ORF 5 and ORF 6 of the porcine productive respiratory disease virus, the recombinant SPV expressing the envelope of feline immune deficiency virus, recombinant SPV expressing feline leukemia virus and envelope of feline immune deficiency virus and feline leukemia virus; recombinant SPV expressing glycoprotein B, glycoprotein D and bovine rhinotracheitis glycoprotein I fecciosa.

Additional examples of foreign DNA insertion sites in the recombinant pig pustular disease virus are exemplified, but are not limited to one or more of the following: the unique Accl restriction site in the OlL ORF of the M fragment of the HindIII of SPV; the unique restriction site Ndel in the OlL ORF of the M HindIII fragment of SPV (See example S-SPV-052); the unique BglII restriction site within the Bglll to HindIII subfragment of 2.0 kb of the M fragment of HindIII SPV (see example S-SPV-047); the unique EcoRI restriction site within a region of approximately 3.2 kb of the 6.7 kb SPV HindIII fragment (see example S-SPV-059); the XhoI restriction site within the J HindIII fragment of SPV (see example S-SPV-064); the unique BglII restriction site within the MaHiñdlII fragment "of SPV (see example S-SPV-062); the EcoRV restriction site within the N HindIII fragment of SPV (see example S-SPV-060); SnaBI restriction within the N HindIII SPV fragment (see example S-SPV-061).

Example 45; Recombinant Pig Pustular Disease Virus Expressing Pig Influenza Virus Genes in HindIII M Insertion Sites of SPV v K Hind II of SPV.

A virus of pustular pig disease expresses four foreign genes. The gene for hemagglutinin (HA) of swine influenza virus (SIV) (H1N1) and the gene for E. coli β-galactosidase (lacZ) were inserted into the open reading frame 617-48.1 of SPV (a site of restriction Notl has replaced a single Accl restriction site). The gene for influenza virus neuraminidase (NA) pig (SIV) and the gene for E. coli β-glucuronidase (uidA) were inserted into a single Notl site (the Notl linkers inserted into a single EcoRI restriction site within a region of approximately 3.2 kb (SEQUENCE ID NO.1) of the 6.7 kb SPV HindIII K fragment The SIV HA (H1N1) gene ^ jj 10 is under the control of the late synthetic / initial promoter (LP2EP2), the NA gene of SIV is under the control of the synthetic late / initial promoter (LP2EP2), the lacZ gene is under the control of the synthetic late promoter (LP1) and the uidA gene is under the control of the synthetic initial promoter (EP2). - "-" '.- The recombinant pig pustular disease virus expressing pig influenza virus genes at the K insertion sites of SPV HindIII and SPV HindIII M is derived from S-SPV-065 (Kasza strain). This is achieved using the homology vector (with the SIV and E. coli DNA genes of uidA inserted into a single Notl site in a plasmid 885-37.5 (see above) and the S-SPV-065 virus in the RECOMBINATION PROCEDURE HOMOLOGOUS TO GENERATE RECOMBINANT SPV The transfection supply was examined by the SPV EXAMINATION RECOMBINANT EXPRESSING β-galactosidase or β-glucuronidase (BLUOGAL AND CPRG ESSAYS) and RECOMBINANT HERP VIRUS EXPRESSING ENZYMATIC MARKER GENES). The final result of the purification of red plaque and blue plaque is the recombinant pig pustular disease virus. This virus was tested for the expression of β-galactosidase and β-glucuronidase, purity, and insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of purification, all the plates observed are blue indicating that the virus is pure, is stable, and is expressing foreign genes.

The recombinant pig pustular disease virus expressing the pig influenza virus genes at the K insertion sites of; HindIII- of SPV- and M HindIII of SPV is useful as a vaccine in "the" pig in "against" SIV infection and is also useful for the expression of the HA and NA proteins of SIV.

S-SPV-121 S-SPV-121 is a pig pustular disease virus that expresses at least one foreign gene. The gene for hemagglutinin (HA) from swine influenza virus (SIV) (H1N1) was inserted into a single Notl site (the Notl linkers inserted into a unique EcoRI restriction site within a region of approximately 3.2 kb (SEQUENCE ID NO. 1) of the 6.7 kb HindIII K-fragment K. The SIV HA gene is under the control of the synthetic late / initial promoter (LP2EP2).

S-SPV-121 is derived from S-SPV-059 (strain Kasza). This was achieved by using the homology vector with the HA gene of SIV at a unique NotI site in the plasmid 855.37.5 (see above) and the virus S-SPV-059 in the PROCEDURE OF RECOMBINATION OF HOMOLOGOUS TO GENERATE RECOMBINANT SPV. The transfection supply was examined by the REVIEW FOR RECOMBINANT SPV EXPRESSING ENZYMATIC MARKERS GENES (X-GLUC ESSAYS). The final result of the white plate purification is recombinant virus designated S-SPV-121. This virus is tested for the absence of β-glucuronidase expression, purity, and insert stability by multiple passes2 monitored by the blue plate assay. as described in Materials and Methods. After three initial rounds of purification, all the plates observed are white indicating that the virus is pure, stable, and is expressing foreign genes.

S-SPV-121 is useful as a vaccine in pigs against SIV infection. S-SPV-121 is also useful for the expression of the SIV HA protein.

S-SPV-122 S-SPV-122 is a virus of pig pustular disease that expresses two foreign genes. The gene for pig influenza virus (SIV) (HA) (H1N1) and neuranidase hemagglutinin (NA) was inserted into a single Notl site (the linkers Notl inserted into a unique EcoRI restriction site within a region of approximately 3.2 kb (SEQUENCE ID NO.1) of the 6.7 kb SPV HindIII K fragment .. / The SIV HA gene is under the control of the late promoter / initial synthetic (LP2EP2). and the SIV NA gene is under the control of the synthetic initial / late promoter (EP2LP2).

-The S-SPV-122 is derived from S-SPV-059 (strain Kasza). This was achieved by using the homology vector with the SIV HA and NA gene in a unique NotI site in the plasmid "855-37.5 (see above) and the virus S-SPV-059 in the PROCEDURE OF RECOMBINATION OF HOMOLOGOUS TO GENERATE RECOMBINANT SPV. The transfection supply was examined by the REVIEW FOR RECOMBINANT SPV EXPRESSING ENZYMATIC MARKERS GENES. The final result of the white plate purification is recombinant virus designated S-SPV-122. This virus is tested for the absence of β-glucosnidase expression, purity, and insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods.

After three initial rounds of purification, all the plates observed are white indicating that the virus is pure, stable, and is expressing foreign genes.

S-SPV-122 is useful as a vaccine in pigs against SIV infection. S-SPV-122 is also useful for the expression of the HA and NA protein of SIV.

Example 46; Recombinant Pig Pustular Disease Virus Expressing Genes- of the "Respiratory Syndrome" and "Porcine Reproductive Virus in the Insertion Sites K of HindII of SPV v M of HindIII of SPV.

A recombinant pig pustular disease virus expresses four foreign genes ^. The gene for ORF 5 of the virus of the s? D d? Qm & Porcine Respiratory and Reproductive System (PRRS) and the gene for E. coli ß-galactosidase (lacZ) were inserted into the open reading frame 617-48.1 of SPV (a single Notl restriction site has replaced a single Accl restriction site). The gene for ORF 6 of porcine reproductive and respiratory syndrome virus (PRRS) and the gene for E. coli β-glucuronidase (uidA) were inserted into the unique Notl site (the Notl linkers inserted into a unique EcoRI restriction site within from a region of approximately 3.2 kb (SEQUENCE ID NO.1) of the 6.7 kb SPV HindIII K fragment The PRRS ORF 5 gene is under the control of the late synthetic / initial promoter (LP2EP2), the ORF 6 gene of PRRS is under the control of the synthetic late / initial promoter (LP2EP2), the lacZ gene is under the control of the synthetic late promoter (LP1) and the uidA gene is under the control of the synthetic initial promoter (EP1) .

The recombinant pig pustular disease virus expressing the porcine reproductive and respiratory syndrome virus genes at the K insertion sites of HindIII of SPV and M of HindIII of SPV was derived from S-SPV-095 (strain Kasza). This was achieved by using the homology vector (with the ORF 6 genes of PRRS and E. coli uidA in a unique Notl site in the plasmid 855-37.5 (see above) and the S-SPV-095 virus in the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE RECOMBINANT SPV The transfection supply was examined by the RECOMBINANT SPV EXAMINATION EXPRESSING β-galactosidase or β-glucuronidase "(BLUOGAL ESSAYS AND CPRG) -" and RECOMBINANT HERPES VIRUS EXAMINATION "EXPRESSING ENZYMATIC MARKERS GENES) . The final result of the purification of red plaque and blue plaque is the recombinant pig pustular disease virus. This virus was tested for the expression of β-galactosidase and β-glucuronidase, with respect to purity, and stability of the insertion by multiple passes monitored by the blue plate assay as described in Materials and Methods. After three initial passes of the purification, all the plates observed are blue indicating that the virus is pure, stable, and expressing foreign genes.

The recombinant pig pustular disease virus expresses four foreign genes. The gene for ORF 6 of the porcine reproductive respiratory syndrome virus (PRRS) and the gene for E. coli β-galactosidase (lacZ) are inserted into the ORV 617-48.1 of the SPV (a single Notl restriction site has replaced a site of Accl restriction only). The gene for ORF 5 of porcine reproductive and respiratory syndrome virus (PRRS) and the gene for E. coli β-glucuronidase (uidA) were inserted into a single Notl site (Notl linkers inserted into the unique EcoRI restriction site within a region of approximately 3.2 kb (SEQUENCE ID NO.1) of the 6.7 kb HindIII SPV K fragment The PRRS ORF 6 gene is under the control of the synthetic late / initial promoter (LP2EP2), the PRRS ORF 5 gene is under the control of the synthetic late / initial promoter (LP2EP2), the -lacZ gene is under the control of the synthetic late promoter (LP1) and the uidA gene is under the control of the synthetic initial promoter (EP2).

Recombinant pig pustular disease virus expressing porcine reproductive and respiratory syndrome virus genes at the K insertion sites of HindIII of SPV and M of HindIII of SPV are derived from S-SPV-084 (strain Kasza). This was achieved using the homology vector (with the ORF 5 genes of PRRS and the E. coli uidA inserted in a unique Notl site in the plasmid 855-37.5 (see above) and the S-SPV-084 virus in the PROCEDURE OF RECOMBINATION OF HOMOLOGOUS TO GENERATE RECOMBINANT SPV The transfection supply is examined by the RECOMBINANT SPV EXAMINATION EXPRESSING β-galactosidase or β-glucuronidase (BLUOGAL AND CPRG TESTS) and RECOMBINANT HERPES VIRUS EXAMINATION EXPRESSING ENZYMATIC MARKERS GENES). The final result of the purification of red plaque and blue plaque is the recombinant pig pustular disease virus. This virus is tested for the expression of β-galactosidase and β-glucuronidase, of purity, and of stability inserted by multiple passages monitored ~ pdr the blue plate assay as described in Materials and Methods. After three initial rounds of purification, all the plates observed are blue indicating that the virus is pure, stable, and expressing the foreign genes. ae ..jr c '? . ' - ': • "< • ce .J: 1 E1 ge." »: J ?? Y-; ... - "-" - The "virus" - gives "disease -" - pustular - of - recombinant pig expressing the porcine reproductive and respiratory syndrome virus genes in the insertion sites K HindIII of SPV and M of HindIII of SPV is useful as a vaccine in pigs against PRRS infection and is also useful for the expression of the ORF 5 protein and PRRS ORF 6.

Example 47; Recombinant Pig Pustular Disease Virus Expressing Bovine Viral Diarrhea Virus Type 1 and Type 2 Genes in HindIII K Insertion Sites of SPV and HindIII M of SPV.

S-SPV-132 S-SPV-132 virus is a recombinant pig pustular disease virus which expresses four foreign genes. The gene for glycoprotein 53 (gp53) of bovine viral diarrhea virus type 1 (BVDV-1) and the gene for E. coli β-galactosidase (lacZ) are inserted into the ORF 617-48.1 of SPV (a restriction site). Only Notl has replaced a single Accl restriction site). The gene for glycoproteins -53 1gp53) of viral diarrhea virus obovino ^ type -2 tBVDV-2-) and the gene-for E. coli β-glucuronidase (uidA) are inserted into a single Notl site (Notl linkers are inserted into a single EcoRI restriction site within a region of approximately 3.2 kb (SEQUENCE ID NO.1) of the HindIII K fragment of SPV of 6.7 kb). The gp53 gene of BVDV-1 and the gp53 gene of BVDV-2 are under the control of the synthetic late / initial promoter (LP2EP2), the lacZ gene is under the control of the synthetic late promoter (LP1) and the uidA gene is under the control of the control of the synthetic initial promoter (EP2).

S-SPV-132 is derived from S-SPV-051 (Kasza strain). This was achieved using the homology vector (with the gp53 genes of BVDV-2 and E. coli uidA inserted into a unique Notl site in the plasmid 855-37.5 (see above)) and the S-SPV-051 virus in the PROCEDURE OF RECOMBINATION OF HOMOLOGOUS TO GENERATE RECOMBINANT SPV. The transfection supply is screened by EXAMINATION RESPECTING RECOMBINANT SPV EXPRESSING β-galactosidase or β-glucuronidase (BLUOGAL AND CPRG ESSAYS AND EXAMINATION FOR ENZYMATIC MARKERS GENES EXPRESSING RECOMBINANT HERP VIRUSES). The final result of the purification of red plaque and blue plaque is recombinant pig pustular disease virus. This virus is tested for β-galactosidase and β-glucuronidase expression, for purity, and for insert stability through multiple passes monitored by the blue plate assay as described in Materials and Methods. After the initial three rounds of purification, all the plates observed are blue indicating that the virus is pure, stable, and expressing foreign genes.

S-SPV-132 is useful as a vaccine in pigs against BVDV infection and is also useful for the expression of gp53 of BVDV-1 and gp53 BVDV-2.

S-SPV-134 The virus of S-SPV-134 is a virus of pig pustular disease that expresses four foreign genes. The gene for ORF 6 of pig reproductive respiratory syndrome virus (PRRS) and the gene for E. coli β-galactosidase (lacZ) were inserted into a unique Notl restriction site (Notl linkers inserted within a site of Accl restriction unique in the ORL of OlL del- fragment M -del-HindIII of the SPV) .- The gene for ORF 5 of the porcine reproductive respiratory syndrome virus (PRRS) and the gene for E. coli ß-glucuronidase (uidA) were inserted into a unique NotI site (the NotI linkers inserted into a unique EcoRI restriction site within a region of approximately 3.2 kb of the HindIII K fragment). SPV of 6.7 kb). The ORF 6 gene of the porcine reproductive respiratory syndrome virus (PRRS) is under the control of the synthetic late / initial promoter (LP2EP2), the ORF 5 gene of the porcine reproductive and respiratory syndrome virus (PRRS) is under control of the late / synthetic initial promoter (LP2EP2). The lacZ gene is under the control of the synthetic late promoter (LP1) the uidA gene is under the control of the synthetic initial promoter (EP2).

S-SPV-134 is derived from S-SPV-084 (Kasza strain). This was achieved using the homology vector 855-52.31 and the S-SPV-084 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was examined by EXAMINATION TO EXPRESS SPV RECOMBINANT ß-glucuronidase (REVIEW FOR RECOMBINANT HERP VIRUS EXPRESSING ENZYMATIC MARKERS GENES). The final result of blue plate purification was the recombinant virus designated S-SPV-134. This virus was tested for the expression of β-galactosidase and β-glucuronidase, for purity, and insert stability through multiple passes monitored by the blue plate assay as described in .. Materials and Methods. After the three initial rounds of purification, all the plates observed are blue indicating that the virus is pure, stable, and is expressing the foreign genes.

To confirm the expression of the gene products ORF 5 and ORF 6 the porcine reproductive respiratory syndrome virus (PRRS), the cells were infected with S-SPV-134 and the samples of the infected cell lysates were subjected to SDS polyacrylamide gel electrophoresis. The gel was stained and analyzed using the WEST STAIN PROCEDURE. An anti-PRRS serum from the polyclonal pig (NVSL) was used to detect the expression of PRRS-specific proteins. Cell lysate from cells infected with S-SPV-134 exhibited bands corresponding to 26 kd and 18 kd, which is the expected size of protein ORF 5 and ORF 6 of SIV. A 40 kd band representing a heterodimer between the ORF 5 protein and ORF 6, was also seen under non-reducing conditions suggesting the formation of a disulfide-linked complex between the ORF 5 and ORF 6 proteins. The assay described here was carried out in ESK-4 cells, indicating that ESK-4 cells would be a suitable substrate for the production of recombinant SPV vaccines.

S-SPV-134 is a recombinant pig pustular disease virus expressing the PRRS ORF 5 and ORF 6 proteins and is useful as a vaccine in pigs against PRRS infection. S-SPV-134 is also useful for the expression of the PRRS ORF 5 and ORF 6 proteins.

VECTOR OF HOMOLOGY 855-52.31. The homology vector 855-52..31.to -insert the foreign DNA-was used in the SPV. This incorporates a marker gene of E. coli β-glucuronidase (uidA), and the ORF 5 gene of porcine reproductive and respiratory syndrome virus PRRS) flanked by SPV DNA. When this homology vector was used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV, a virus containing DNA encoded for foreign genes results. Note that the β-glucuronidase marker gene (uidA) is under the control of a synthetic early pustular disease promoter (EP2) and the ORF 5 gene of porcine reproductive and respiratory syndrome virus (PRRS) is under the control of the promoter of late / initial synthetic pustular disease (LP2EP2). The homology vector was constructed using DN? standard recombinants (22 and 30), by joining the restriction fragments of the following sources with the appropriate synthetic DNA sequences. Plasmid 855-52.31 was constructed using plasmid 847-42.7C. This plasmid was previously constructed by inserting the uidA gene into the unique EcoRI site within the genomic K HindIII fragment of SPV. The uidA gene is under the control of the synthetic initial promoter (Ep2). The PRRS ORF 5 gene was then inserted into a unique Notl site located upstream of the uidA gene resulting in the plasmid 855-52.31. The transcriptional and translational orientation of the ORF 5 gene of PRRS is the same as the uidA gene.

The PRRS .gen -ORF 5 is- a fragment of approximately 603 base pairs of EcoRI to BamHl- synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) (15, 42) using RNA from the strain of reference PRRS NVSL. The upstream primer (5'-GAAGGATCCTAAGGACGACCCCATTGTTCCGCTG-3 ') is synthesized from the 5' end of the PRRS ORF 5 gene and introduces an EcoRI site at the 5 'end of the gene. The downstream primer was (5'-GCGGATCCTTGTTATGTGGCATATTTGACAAGGTTTAC-3 ') synthesized from the 3' end of the PRRS ORF 5 gene, introduced a BamH1 site at the 3 'end of the gene, and used for reverse transcription and chain reaction of polymerase The PCR product was digested with EcoRI and BamHI to give a fragment of 603 base pairs in length corresponding to the PRRS ORF 5 gene.

S-SPV-136 The virus of S-SPV-136 is a virus of pig pustular disease that expresses four foreign genes. The gene for ORF 6 of pig reproductive respiratory syndrome virus (PRRS) and the gene for el-.E. coli β-galactosidase (lacZ) were inserted into a unique Notl restriction site (the Notl linkers inserted within a single Accl restriction site in the OlL ORF of the M fragment of the SPV HindIII). The gene for ORF 5 of porcine reproductive respiratory syndrome virus (PRRS) and the gene for E. coli β-glucuronidase (uidA) were inserted into a Notl site. unique (the linkers-1 Notl. inserted- in a-, unique EcoRI restriction site within a region of approximately 3.2 kb of the KV HindIII fragment of SPV of 6.7 kb). The ORF 6 gene of the porcine reproductive respiratory syndrome virus (PRRS) is under the control of the synthetic late / initial promoter (LP2EP2), the ORF 5 gene of the porcine reproductive and respiratory syndrome virus (PRRS) is under the control of the late synthetic / initial promoter (LP2EP2). The lacZ gene is under the control of the synthetic late promoter (LP1) the uidA gene is under the control of the synthetic initial promoter (EP2).

S-SPV-136 is derived from S-SPV-084 (Kasza strain). This was achieved using the homology vector 855-52.43 and the S-SPV-084 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was examined by EXAMINATION TO EXPRESS RECOMBINANT SPV ß-glucuronidase (RECOMBINANT HERPES VIRUS EXAMINATION EXPRESSING GENEZING MARKERS). The final result of blue plate purification was the recombinant virus designated S-SPV-136. This virus was tested for the expression of β-galactosidase and β-glucuronidase, for purity, and insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods. After the initial three rounds of purification, all the stored plates are blue indicating that the virus is pure, stable, or and is "expressing the - genes" foreign.

To confirm the expression of the gene products ORF 5 and ORF 6 the porcine reproductive respiratory syndrome virus (PRRS), the cells were infected with S-SPV-136 and the samples of the infected cell lysates were subjected to gel electrophoresis of polyacrylamide SDS. The gel was stained and analyzed using the WEST STAIN PROCEDURE. An anti-PRRS serum from the polyclonal pig (NVSL) was used to detect the expression of PRRS-specific proteins. Cell lysate from cells infected with S-SPV-136 exhibited bands corresponding to 26 kd and 18 kd, which is the expected size of protein ORF 5 and ORF 6 of SIV. A 40 kd band representing a heterodimer between the ORF 5 protein and ORF 6, was also seen under non-reducing conditions suggesting the formation of a disulfide-linked complex between the ORF 5 and ORF 6 proteins. The assay described here was carried out in ESK-4 cells, indicating that ESK-4 cells would be a suitable substrate for the production of recombinant SPV vaccines. - - - S-SPV-136 is a recombinant pig pustular disease virus expressing ORF 5 and ORF 6 proteins.

PRRS and is useful as a vaccine in pigs against PRRS infection. S-SPV-136 is also useful for the expression of ORF 5 and ORF 6 proteins of PRRS- VECTOR OF HOMOLOGY 855-52.43. The homology vector 855-52.43 was used to insert the foreign DNA into the SPV. This incorporates a marker gene of E. coli β-glucuronidase (uidA), and the ORF 5 gene of porcine reproductive and respiratory syndrome virus PRRS) flanked by the SPV DNA. When this homology vector was used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV, a virus containing DNA encoded for foreign genes results. Note that the β-glucuronidase marker gene (uidA) is under the control of a synthetic early pustular disease promoter (EP2) and the ORF 5 gene of porcine reproductive and respiratory syndrome virus (PRRS) is under the control of the promoter of late / initial synthetic pustular disease (LP2EP2). The homology vector was constructed using standard recombinant DNA techniques (22 and 30), by joining the restriction fragments of the following sources with the appropriate synthetic DNA sequences. Plasmid 855-52.43 was constructed using plasmid 847-42.7C. This plasmid was previously constructed by inserting the .uidA gene into the EcoRI Unique site within the genomic K HindIII fragment of SPV. The uidA gene is under the control of the synthetic initial promoter (Ep2). The PRRS ORF 5 gene was then inserted into a unique Notl site located upstream of the uidA gene resulting in the plasmid 855-52,31- .. The transcriptional and translational orientation of the. gene: PRRS ORF 5 is the same as the gene The ORF 5 gene of PRRS is a fragment of approximately 603 base pairs of EcoRI to BamH1 synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) (15)., 42) using RNA from the PRRS NVSL reference strain. The upstream primer (5'-GAAGGATCCTAAGGACGACCCCATTGTTCCGCTG-3 ') is synthesized from the 5' end of the PRRS ORF 5 gene and introduces an EcoRI site at the 5 'end of the gene. The primer down was (5'-GCGGATCCTTGTTATGTGGCATATTTGACAAGGTTTAC-3 ') synthesized from the 3' end of the PRRS ORF 5 gene, introduced a BamH1 site at the 3 'end of the gene, and used for reverse transcription and chain reaction of polymerase The PCR product was digested with EcoRI and BamHI to give a fragment of 603 base pairs in length corresponding to the PRRS ORF 5 gene.

S-SPV-157 The virus of S-SPV-157 is a virus of pig pustular disease that expresses three foreign genes. -The gene stops; Neuraminidase (NA) of swine influenza virus (SIV) (H1N1) and the gene for E. coli β-galactosidase (lacZ) were inserted into a unique Notl restriction site (Notl linkers inserted at a single Accl restriction site in the OlL ORF of the HindIII fragment M from SPV). The gene for haemagglutinin (HA) from swine influenza virus (SIV (HINl) - seY Séréó at a single Notl site (Notl linkers inserted at a unique EcoRI restriction site within a region of approximately 3.2 kb of the K fragment of SPV HindIII of 6.7 kb) The NA gene is under the control of the late synthetic / initial promoter (LP2EP2) The HA gene is under the control of the synthetic late / initial promoter (LP2EP2) and the lacZ gene is under the control of the synthetic late promoter (LP1).

S-SPV-157 was derived from S-SPV-121 (Kasza strain). This was achieved using the homology vector 807-84.35 and the S-SPV-121 virus and the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was examined by the RECOMBINANT SPV EXAMINATION EXPRESSING ß-galactosidase (BLUOGAL AND CPRG TESTING AND RECOMBINANT HERPES VIRUS EXAMINATION EXPRESSING ENZYMATIC MARKERS GENES). The final result of the red plaque purification was the recombinant virus designated S-SPV-157. This virus was tested for β-galactosidase expression, purity, and insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of purification, all the plates observed are blue indicating that the virus is pure, is stable, and is expressing foreign genes.

. To confirm the expression of the HA and NA gene products of the SIV, the cells were infected with S-SPV-157 and the samples of the infected cell lysates and of the culture supernatants were subjected to gel electrophoresis. polyacrylamide SDS. The gel was stained and analyzed using the WEST STAIN PROCEDURE. A polyclonal goat anti-NA serum or a polyclonal goat anti-HA serum was used to detect the expression of specific SIV proteins. The cell lysate of the cells infected with S-SPV-157 exhibited bands corresponding to 64 kd and 52 kd, which are the expected size of the HA and NA protein of SIV.

S-SPV-157 was tested for the expression of SIV-specific antigens using the PLATE EXAMINATION BLACK FOR EXPRESSION OF GENE GENE IN RECOMBINANT SPV. It was shown that the polyclonal goat anti-HA serum or the polyclonal anti-SIV reacts specifically with the S-SPV-157 plates and not with the negative control plates S-SPV-001. All the plates observed from S-SPV-157 reacted with both sera indicating that the virus was stably expressing foreign SIV genes. The assays described here were carried out on ESK-4 cells, indicating that ESK-4 cells would be a suitable substrate for the production of recombinant vaccines from SPV.

The .S-SPV l57. It is a virus of pustular disease-of recombinant pig expressing the proteins HA and NA "de-SIV-y ^ is useful as a vaccine in pigs against the infection of SIV.S-SPV-157 is also useful for the expression of the HA and NA proteins of the SIV.

VECTOR OF HOMOLOGY 807-84.35. The homology vector 807-84.35 was used to insert the foreign DNA into the SPV.

This incorporates a marker gene for E. coli β-galactosidase (lacZ) and the neuraminidase (NA) gene for swine influenza virus (SIV) flanked by the SPV DNA. When this homology vector was used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV, a virus containing the DNA encoded for foreign genes results. Note that the β-galactosidase marker gene (lacZ) is under the control of a synthetic late pustular disease promoter (LP1) and the SIV NA gene is under the control of the late synthetic / initial pustular disease promoter (LP2EP2) . The homology vector was constructed using standard recombinant DNA techniques (22 and 30), by "joining the restriction fragments of the following sources with the appropriate synthetic DNA sequences." The plasmid vector was derived from a restriction fragment of approximately 2972 base pairs HindIII to BamH1 from pSP64 (promega). is a restriction subfragment of approximately 1484 base pairs of BglII to Accl of the M fragment of SPV HindIII (23) .Fragment 2 is a fragment of approximately 1414 base pairs of EcoRl- to BglII from the SIV "synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) (15, 42) using RNA from the SIV H1N1 strain (NVSL) .The primer above (5 '-AATGAATTCAAATCAAAAAATAATAACCATTGGGTCAAT-3,) is synthesized of the 5 'end of the SIV NA gene and introduces an EcoRI site at the 5' end of the gene.The primer down was (5'-GGAAGATCTACTTGTCAATGGTGAATGGCAGATCAG-3 ') is synthesized from the 3' end of the SIV NA gene, A BglII site was located at the 3 'end of the gene, and was used for a reverse transcription and polymerase chain reaction. The PCR product was digested with EcoRI and BglII to give a fragment of 1414 base pairs in length corresponding to the NA gene of SIV. Fragment 3 is a restriction fragment of approximately 3010 base pairs of BamHI to PuvII from plasmid pJF751 (11). Fragment 4 is a restriction subfragment of approximately 2149 base pairs Accl to HindIII of the HindIII restriction M fragment of SPV (23). The Accl site in the SPV homology vector was converted to a unique Notl site using synthetic linkers.

S-SPV-158 -_ .-. _. .

The virus of S-SPV-158 is a virus of pig pustular disease that expresses three foreign genes. The gene for nucleoprotein (NP) of swine influenza virus (SIV) (H1N1) and the gene for E. coli -.galactosidase (lacZ) ~ were inserted into a Not? Restriction site. unique (the "Nstl inserted" linkers: in a single Accl restriction site in the OlL ORF of the M HindIII fragment of SPV). The genes for hemagglutinin (HA) from swine influenza virus (SIV) (H1N1) and neuraminidase (NA) (H1N1) were inserted into a single Notl site (Notl linkers inserted into a unique EcoRI restriction site within a region of approximately 3.2 kb of the KV fragment HindIII of 6.7 kb SPV). The NA gene is under the control of the late synthetic / initial promoter (LP2EP2). The HA gene is under the control of the synthetic late / initial promoter (LP2EP2) and the lacZ gene is under the control of the synthetic late promoter (LP1).

S-SPV-158 was derived from S-SPV-122 (strain Kasza). This was achieved using the homology vector 807-41.03 and the S-SPV-122 virus and the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was examined by the RECOMBINANT SPV EXAMINATION EXPRESSING β-galactosidase (BLUOGAL AND CPRG TESTING AND RECOMBINANT HERPES 'VIRUS EXAMINATION EXPRESSING ENZYMATIC MARKERS GENES). The final result of the red plaque purification was the recombinant virus designated S-SPV-158 .. This virus was tested for the β-galactosidase expression, the purity, and the insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of purification, all plaques-observed are blue indicating that the virus is pure, stable, expressing foreign genes.

To confirm the expression of the HA, NA, and NP gene products of the SIV, the cells were infected with S-SPV-158 and the samples of the infected cell lysates and of the culture supernatants were subjected to gel electrophoresis. of polyacrylamide SDS. The gel was stained and analyzed using the WEST STAIN PROCEDURE. A polyclonal goat anti-NA serum, a polyclonal goat anti-HA serum or a polyclonal goat anti-NP serum was used to detect the expression of the specific SIV proteins. The cell lysate of cells infected with S-SPV-158 exhibited bands corresponding to 64 kd, 52 kd and 56 kd, which are the expected size of the protein HA, NA and NP of SIV.

S-SPV-158 was tested for the expression of SIV-specific antigens using the BLACK PLATE EXAMINATION FOR EXPRESSION OF GENE GENE IN RECOMBINANT SPV. The polyclonal goat anti-HA serum, the polyclonal pig anti-SIV or the polyclonal goat anti-NP were shown to react specifically with the S-SPV-158 plates and not with the negative control plates S-SPV-001 . All the observed plates of S-SPV-158 reacted with both sera indicating that the virus was stably expressing foreign SIV genes. The assays described here were carried out on ESK-4 cells, indicating that ESK-4 cells would be a suitable substrate for the production of recombinant SPV vaccines.

S-SPV-158 is a recombinant pig pustular disease virus expressing the SIV HA, NA and NP proteins and is useful as a vaccine in pigs against SIV infection. S-SPV-158 is also useful for the expression of the HA, NA and NP proteins of SIV.

VECTOR OF HOMOLOGY 807-41.03. The homology vector 807-41.03 was used to insert the foreign DNA into the SPV.

This incorporates a marker gene of E. coli β-galactosidase (lacZ) and the nucleoprotein gene (NP) of swine influenza virus (SIV) flanked by the SPV DNA. When this homology vector was used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE RECOMBINANT SPV, it is a virus containing the DNA encoded for foreign genes. Note that the β-galactosidase marker gene (lacZ) is under the control of a synthetic late pustular disease promoter (LP1) and the SIV NA gene is under the control of the late synthetic / initial pustular disease promoter (LP2EP2) . The homology vector was constructed using standard recombinant DNA techniques (22 and 30), by joining the restriction fragments of the following sources with the appropriate synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2972 base pairs HindIII to BamH1 from SP64 (promega) - * * to El- fragment 1 is a restriction subfragment of approximately 1484 base pairs from BglII to Accl. of the M HindIII fragment of SPV (23). Fragment 2 is a fragment of approximately 1501 base pairs of EcoRI to EcoRI of the SIV NP gene synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) (15, 42) using RNA from the H1N1 strain of SIV (NVSL). The upstream primer (5 '-CATGAATTCTCAAGGCACCAAACGATCATATGAGA-3') is synthesized from the 5 'end of the SIV NP gene and introduces an EcoRI site at the 5' end of the gene. The down primer was (5'-ATTTGAATTCAATTGTCATACTCCTCTGCATTGTCT-3 #) is synthesized from the 3 'end of the SIV NP gene, introduces an EcoRI site at the 3' end of the gene, and was used for a reverse transcription and chain reaction of polymerase The PCR product was digested with EcoRI to give a fragment of 1501 base pairs in length corresponding to the NP gene of SIV. Fragment 3 is a restriction fragment of approximately 3010 base pairs of BamHI to PuvII from plasmid pJF751 (11). Fragment 4 is a restriction subfragment of approximately 2149 base pairs Accl to HindIII of the HindIII restriction M fragment of SPV (23). The Accl site in the SPV homology vector was converted to a unique Notl site using synthetic linkers.

S-SPV-217 The virus of S-SPV-217 is a virus of pig pustular disease which expresses four "foreign" genes .- The gene for the ORF 5 of the pig respiratory reproductive syndrome virus (PRRS) and the gene for E coli β-galactosidase (lacZ) were inserted into a unique Notl restriction site (the linkers Notl inserted into a single Accl restriction site in the OlL ORF of the M fragment of the SPV HindIII). The gene for ORF 6 of porcine reproductive respiratory syndrome virus (PRRS) and the gene for E. coli β-glucuronidase (uidA) were inserted into a unique Notl site (the Notl linkers inserted at a unique EcoRI restriction site within a region of approximately 3.2 kb of the HindIII K fragment). SPV of 6. 7 kb). The ORF 6 gene of porcine reproductive respiratory syndrome virus (PRRS) is under the control of the synthetic initial promoter (EP1), the ORF 5 gene of porcine reproductive and respiratory syndrome virus (PRRS) is under the control of the initial promoter synthetic (EP2). The lacZ gene is under the control of the synthetic late promoter (LP1) the uidA gene is under the control of the synthetic initial promoter (EP2).

S-SPV-217 is derived from S-SPV-174 (Kasza strain). This was achieved using. he. -vector.-of homology and virus S-SPV-174 in the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE RECOMBINANT SPV. The transfection supply was examined by EXAMINATION TO EXPRESS SPV RECOMBINANT ß-glucuronidase (REVIEW FOR RECOMBINANT HERP VIRUS EXPRESSING ENZYMATIC MARKERS GENES) .-. The final result of the purification of blue plaque was "virus -relevant: designated S-SPV-217. This virus was tested for the expression of β-galactosidase and β-glucuronidase, for purity, and stability of insert through multiple passes monitored by the blue plate assay as described in Materials and Methods.

S-SPV-217 is a recombinant pig pustular disease virus expressing the ORF 5 and ORF 6 proteins of PRRS and is useful as a vaccine in the pig against PRRS infection. S-SPV-134 is also useful for the expression of ORF 5 and ORF 6 proteins of PRRS.

S-SPV-218 The virus of S-SPV-218 is a virus of pig pustular disease that expresses four foreign genes. The gene for ORF 5 of pig reproductive respiratory syndrome virus (PRRS) and the gene for E. coli β-galactosidase (lacZ) were inserted into a unique Notl restriction site (Notl linkers inserted within a site of single Accl restriction in the OlL ORF of the M fragment of the SPV HindIII). The gene for t 'the ORF 6 of porcine reproductive respiratory syndrome virus (PRRS) and the gene for E. coli β-glucuronidase (uidA) were inserted into a single Notl site (the Notl linkers inserted into a unique EcoRI restriction site within a region of approximately 3.2 kb of the HindIII K fragment). SPV of; 6.7 kb). The ORF 6 gene of the respiratory syndrome virus ! Porcine reproductive system (PRRS) is under the control of the synthetic late promoter (LP1), the ORF5 gene of porcine reproductive and respiratory syndrome virus (PRRS) is under the control of the synthetic initial promoter (EP2). The lacZ gene is under the control of the synthetic late promoter (LP1) the uidA gene is under the control of the synthetic initial promoter (EP2).

S-SPV-218 is derived from S-SPV-174 (strain Kasza). This was achieved using the homology vector and the S-SPV-174 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE TO GENERATE RECOMBINANT SPV. The transfection supply was examined by EXAMINATION TO EXPRESS SPV RECOMBINANT ß-glucuronidase (REVIEW FOR RECOMBINANT HERP VIRUS EXPRESSING ENZYMATIC MARKERS GENES). The final result of blue plate purification was the recombinant virus designated S-SPV-218. This virus was tested for the expression of β-galactosidase and β-glucuronidase, for purity, and insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods.

S-SPV-218 is a recombinant pig pustular disease virus expressing the ORF 5 and ORF 6 proteins of PRRS and is useful as a vaccine in swine against PRRS infection. S-SPV-134 is also useful for the expression of the ORF 5-and ORF 6 proteins of the -PRRS.

S-SPV-195 S-SPV-195 is a virus of pig pustular disease that expresses a foreign gene. The full-length gene encoding the transmembrane and surface protein subunits for FeLV (SU + TM) and the gene for E. coli β-galactosidase (lacZ) were inserted into a unique Notl restriction site (Notl linkers inserted in a single Accl restriction site in the OlL ORF of the M HindIII fragment of SPV). The envelope gene of FeLV is under the control of the synthetic initial promoter (EP1) and the lacZ gene is under the control of the synthetic late promoter (LP1).

The S-SPV-195 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the 911-4.Al homology vector and the S-SPV-001 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was examined by the RECOMBINANT SPV EXAMINATION EXPRESSING β-galactosidase. (BLUOGAL AND CPRG ESSAYS AND EXAMINATION FOR RECOMBINANT HERP VIRUSES EXPRESSING ENZYMATIC MARKERS GENES). The final result of the red plaque purification was the recombinant virus designated S-SPV-195. This virus was tested for the expression of β-galactosidase and is currently under multiple passes for. determine the purity and stability. - - - - S-SPV-195 was assayed for the expression of gp70, on FeLV, using the BLACK PLATE EXAMINATION FOR EXPRESSION OF GENE GENE IN RECOMBINANT SPV. The monoclonal mouse anti-FeLV gp70 was shown to react specifically with the S-SPV-195 plates and not with the negative control plates of S-SPV-001. All the S-SPV-195 plates observed reacted with the monoclonal antibody indicating that the virus was stably expressing the foreign FeLV gene. The assays described herein can be carried out in ESK-4 cells, indicating that ESK-4 cells would be a suitable substrate for the production of recombinant SPV vaccines.

S-SPV-195 is a recombinant pig pustular disease virus expressing FeLV envelope proteins and is useful as a vaccine in cats against feline leukemia infection. S-SPV-195 is also useful for the expression of the FeLV protein.

VECTOR OF HOMOLOGY 911-4.Al. The homology vector 911-4. l was used to insert foreign DNA into the SPV. This incorporates a marker gene of E. coli β-galactosidase (lacZ), and the envelope gene of full length FeLV flanked by the DNA of the-SPV. When this homology vector was used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV, a virus containing DNA encoded for foreign genes results. Note that the β-galactosidase marker gene (lacZ) is under the control of a synthetic late pustular disease (LP1) promoter and the envelope gene of FeVL is under the control of the synthetic initial pustular disease promoter (EP1). The homology vector was constructed using standard recombinant DNA techniques (22 and 30), by joining the restriction fragments of the following sources with the appropriate synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2272 base pairs HindIII to BamH1 from pSP64 (promega). Fragment 1 is a restriction subfragment of approximately 1484 base pairs BglII to Acc of the M fragment of SPV HindIII (23). Fragment 2 is a fragment of approximately 1929 base pairs EcoRi to BamHl of the envelope gene of FeLV synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) (15, 42) using the FeLV cDNA of p61E , subtype A of strain FeLV / FAIDs. The primer upstream (5 '-CGTCGGATCCGGACACAGCCCCAGCTTAGACGATC-3') is synthesized from the 5 'end of the FeLV envelope gene and introduces an EcoRI site at the 5' end of the gene. The downstream primer (5'-CGTCGGATCCGGGGACRAAATGGAATCATACA-3 ') is synthesized from the 3' end of the FeLV envelope gene and introduces a BamH1 site at the 3 'end of the gene. These primers were used for reverse transcription and polymerase chain reaction by CLONING WITH THE "CHAIN" REACTION OF "POLYMERASE The PCR product 'was digested with EcoRI and BamHI to give a fragment of approximately 1929 base pairs in length that correspond to the FeLV envelope gene.Fragment 3 is a restriction fragment of about 3010 base pairs of BamHI to PvulI of plasmid pJS751 (11). Fragment 4 is a restriction subfragment of approximately 2149 base pairs Accl to HindIII of the M restriction fragment of HindIII SPV (23). The Accl site in the SPV homology vector was converted to a Notl site using synthetic linkers.

S-SPV-205 S-SPV-205 is a pig pustular disease virus that expresses four foreign genes. The gene for feline leukemia virus gag / protease (FeLV), the gene for E. coli β-galactosidase (lacZ) were inserted into a Notl restriction site (the Notl linkers inserted into a single Accl restriction site in the OlL ORF of the HindIII M fragment from SPV). The gene for the envelope FeLV and ß-glucuronidase (uidA) were inserted into a NotI site (the NotI linkers inserted into a unique EcoRI restriction site within a region of approximately 3.2 kb of the 6.7 kb SPV HindIII K-fragment) . The gag / protease FeLV gene is under the control of the synthetic late / initial promoter (LP2EP2) and the envelope gene of feline leukemia virus is under the control of the synthetic initial promoter (EP1). The lacZ gene is under the control of the synthetic late promoter LP1 and the uidA gene is under the control of the synthetic initial pig pustular disease promoter, EP2.

The S-SPV-205 was derived from S-SPV-089 (Cepa Kasza). This was achieved using the homology vector 905-31.Al and the S-SPV-089 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was examined by the RECOMBINANT SPV EXAMINATION EXPRESSING β-glucuronidase (X-GLUC and RECOMBINANT HERPES VIRUS EXAMINATION EXPRESSING ENZYMATIC MARKERS GENES). Recombinant plaques expressing the marker gene were shown to be positive for β-glucuronidase by detecting blue / green plaque and were designated as SPV 205.

This virus was tested for the expression of β-glucuronidase, the purity and the stability of the insert by multiple passages monitored by the blue / green plate assay as described in Materials and Methods. After three initial rounds of passes, all the plates observed are blue / green indicating that the virus is pure. Analysis of the expression of the envelope and gag genes of feline leukemia virus and the analysis of -stability are; e -progress. -- .to -' - - -, -"- _.,_._-. VECTOR OF HOMOLOGY 905-31.Al. The homology vector 905-31.Al was used to insert the foreign DNA in SPV089. This incorporates a marker gene for E. coli β-glucuronidase (uidA), and the envelope gene for FeLV flanked by the SPV DNA. When this homology vector was used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV, a virus containing DNA encoded for foreign genes results. Note that the ß-glucuronidase marker gene (uidA) is under the control of an initial synthetic pustular disease (EP2) promoter and the FeVL envelope gene is under the control of a single and separate synthetic initial pustular disease promoter ( EP1). The homology vector was constructed using standard recombinant DNA techniques (22 and 30), by joining the restriction fragments of the following sources with the appropriate synthetic DNA sequences. Plasmid 905-31.Al was constructed using plasmid 847-42C. This plasmid was previously constructed by inserting the uidA gene into the unique EcoRI site within the genomic K HindIII fragment of SPV. The envelope gene of FeLV was then inserted into the unique Notl site located upstream of the uidA gene resulting in plasmid 905-31.Al. The FeLV envelope gene is a fragment of approximately 1929 base pairs of EcoRI to BamH1 synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) (15, 42) using the FeLV cDNA of p61Estrain FeLV / FAIDs subtype A. The upstream primer (5 'CGTCGGATCCGGACCCGGACAGCCCCAGCTTAGACGATC-3') is synthesized from the 5 'end of the FeLV envelope gene and introduces an EcoRI site at the 5' end of the gene. The downstream primer (5'-CGTCGGATCCGGGGACTAAATGGAATCATACA-3 ') is synthesized from the 3' end of the FeLV envelope gene, and introduces the BamH1 site at the 3 'end of the gene. These primers were used for reverse transcription and polymerase chain reaction. The PCR product was digested with EcoRi and BamHl to give a fragment of approximately 1929 base pairs in length corresponding to the envelope gene of FeLV.

S-SPV-197 S-SPV-197 is a virus of pig pustular disease that expresses a foreign gene. The full length envelope gene of feline leukemia virus, subtype A (FeLV) and the gene encoded E. coli β-glucuronidase (uidA) were inserted into a unique Notl restriction site (Notl linkers inserted at a restriction site Single Accl in the OlL open reading frame of the HindIII M fragment of SPV). The gene for the feline leukemia virus envelope was inserted into a unique NotI site (the NotI linkers inserted at a unique EcoRI restriction site within a region of approximately 3.2 kb of the 6.7 kb SPV HindIII K-fragment). The envelope gene is under the control of a synthetic initial promoter (EP2J and the uidA gene is under the control of a single and separate synthetic initial promoter (EP2).

S-SPV-197 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 905-31.Al and the S-SPV-001 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was screened by the RECOMBINANT SPV EXAMINATION EXPRESSING β-glucuronidase (X-GLUC and RECOMBINANT HERPES VIRUS EXAMINATION EXPRESSING ENZYMATIC MARKERS GENES). The final product of the blue / green purification was the recombinant virus designated S-SPV-197.

This virus was tested for the expression of β-glucuronidase, the purity and the stability of the insert by multiple passages monitored by the blue plate assay as described in Materials and Methods. After the three initial rounds of purification, all the plates observed were blue / green indicating that the virus is pure, stable and expressing the foreign genes.

To confirm the expression of the foreign gene product of feline leukemia virus envelope, the cells were infected with S-SPV-197 and the samples of the infected cell lysates were subjected to SDS polyacrylamide gel electrophoresis. The gel was stained and analyzed using the WEST STAIN PROCEDURE. -A mouse monoclonal anti-FeLV gp70 antibody was used to detect the expression of the gp70 specific protein of FeLV. The cell lysate of the infected S-SPV-197 cells exhibited bands corresponding to 85 kda and 70 kda which are the expected sizes for the envelope protein of unprocessed feline leukemia virus and the envelope surface protein of gp70 processed The 70 kda protein product was predominant in cell lysates.

S-SPV-197 was tested for expression of the feline leukemia virus envelope, gp70, using the BLACK PLATE EXAMINATION OF EXPRESSION OF GENE GENE IN RECOMBINANT SPV. The monoclonal mouse anti-FeLV gp70 was shown to react specifically with the S-SPV-197 plates and not with the S-SPV-001 negative control plates. All S-SPV-197 plates observed reacted with the monoclonal antibody indicating that the virus was stably expressing the envelope gene of feline leukemia virus. The assays described here were carried out on ESK-4 cells, indicating that ESK-4 cells would be a suitable substrate for the production of recombinant SPV vaccines.

S-SPV-197 is a recombinant pig pustular disease virus expressing FeLV envelope proteins and is useful as a vaccine in expenses against feline leukemia infection. S-SPV-197 is also useful for the expression of the envelope protein of FeLV. - _ ___ .- -.-. >; . VECTOR OF HOMOLOGY 905-31.Al. The homology vector 905 -31.Al was used to insert the foreign DNA into the SPV. This incorporates a marker gene of E. coli β-glucuronidase (uidA), and the envelope gene of FeLV flanked by the SPV DNA. When this homology vector was used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE RECOMBINANT SPV results a virus containing DNA encoded for foreign genes. Note that the β-glucuronidase marker gene (uidA) is under the control of a synthetic initial pustular disease promoter (EP2) and the FeLV envelope gene is under the control of a single and separate synthetic initial pustular disease promoter ( EP1). The homology vector was constructed using standard recombinant DNA techniques (22 and 30), by joining the restriction fragments of the following sources with the appropriate synthetic DNA sequences. Plasmid 905-31.Al was constructed using plasmid 847-42.2C. This plasmid was previously constructed by inserting the uidA gene into the unique EcoRI site within the genomic K HindIII fragment of SPV. The FeLV envelope gene was then inserted into the unique Notl site located upstream of the uidA gene resulting in plasmid 905-31.Al. * The FeLV envelope gene is a fragment of approximately 1929 base pairs of EcoRI to BamHl synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) - (1-5, - 42) using the cDNA of FeLV of p61E, -cepa FeLV / FAIDs subtype A. The upstream primer (5'CGTCGGATCCGGACCCCCGCTTAGACGATC-3 ') is synthesized from the 5' end of the FeLV envelope gene and introduces an EcoRI site at the 5 'end of the gene. The downstream primer (5'-CGTCGGATCCGGGGACTAAATGGAATCATACA-3 ') is synthesized from the 3' end of the FeLV envelope gene, and introduces the BamH1 site at the 3 'end of the gene. These primers were used for reverse transcription and polymerase chain reaction. The PCR product was digested with EcoRi and BamHl to give a fragment of approximately 1929 base pairs in length corresponding to the envelope gene of FeLV.

S-SPV-198 S-SPV-198 is a pig pustular disease virus that expresses two foreign genes. The full-length envelope gene of feline leukemia virus, subtype A (FeLV) and the gene encoding E. coli β-glucuronidase (uidA) were inserted into a unique Notl restriction site (Notl linkers inserted at a restriction site Single Acc in the OlL ORF of the M fragment of HindIII of SPV). The gene for the FeLV envelope was inserted into the unique NotI site (the Notl linkers inserted into a unique EcoRI restriction site within a region of approximately 3.2 kb of the 6.7 kb SPV HindIII K-fragment). The β-glucuronidase gene is under the control of the initial synthetic pustular disease promoter, EP2. The envelope gene of feline leukemia virus is lowered. Promoter of initial / late synthetic pustular disease EP1. Note that the two gene / promoter cassettes are oriented in opposite directions, to avoid a possible homologous recombination between the elements of the identical promoter (EP2).

The S-SPV-198 was derived from S-SPV-001 (strain Kasza). This was achieved using the homology vector 860-2.A5 and the S-SPV-001 virus in the RECOMBINANT PROCEDURE HOMOLOGOUS TO GENERATE RECOMBINANT SPV. The transfection supply was examined by the RECOMBINANT SPV EXAMINATION EXPRESSING β-GLUCORONIDASE (X-GLUC AND EXAMINATION FOR RECOMBINANT HERP VIRUS EXPRESSING ENZYMATIC MARKERS GENES). Recombinant plaques expressing the marker gene were shown to be positive for β-glucuronidase by blue / green plate detection and are designated SPV-198.

S-SPV-198 is in the process of purification, analysis of foreign gene expression and stability using black plate and western blot assays, as described in Materials and Methods. The assays described here are carried out in ESK-4 cells, indicating that ESK-4 cells would be a suitable substrate for the production of recombinant SPV vaccines.

; S-SPV-1"9ß-is a recombinant pig pustular disease virus by expressing the protein from FeLV and is useful as a vaccine in cats against feline leukemia infection. it is also useful for the expression of the protein on the feline leukemia virus.

VECTOR OF HOMOLOGY 860-2.A5. The homology vector 860-2.A5 was used to insert the foreign DNA into the SPV. It incorporates a marker gene for E. coli β-glucuronidase (uidA), and the envelope gene for feline leukemia virus flanked by the SPV DNA. When this homology vector was used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR RECOMBINANT SPV GENERATION, a virus containing the DNA encoded for foreign genes results. Note that the β-glucuronidase marker gene (uidA) is under the initial synthetic pustular disease (EP2) promoter and the feline leukemia virus envelope gene is under the control of a synthetic initial / late pustular disease promoter (LP2) / EP2). The homology vector was constructed using standard recombinant DNA techniques (22 and 30), by joining the restriction fragments of the following sources with the appropriate synthetic DNA sequences. Plasmid 860-2.A5 was constructed using plasmid 847-42.2C. This plasmid was previously constructed by inserting the uidA gene into the unique EcoRI site with the genomic K HindIII fragment of SPV. The feline leukemia virus envelope gene was then inserted into a unique Notl site located upstream of the uidA gene resulting in * * in plasmid 8 £ 0-2.A5. - - The envelope gene of feline leukemia virus is a fragment of approximately 1929 base pairs of EcoRI to BamH1 synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) (15, 42) using the leukemia virus cDNA feline p61E, subtype A, strain FeLV / FAIDs (received from deposit NIAIDS, category # 109). The upstream primer (5 'CGTCGGATCCGGACAGCCCCAGCTTAGACGATC-3') synthesized from the 5 'end of the feline leukemia virus envelope gene and introduces an EcoRI site at the 5' end of the gene. The primer down introduces an EcoRI site at the 5 'end of the ge. The downstream primer (5 '-CGTCGGATCCGGGGACTAAATGGAATCATACA-3') is synthesized from the 3 'end of the feline leukemia virus envelope gene, and introduces a BamH1 site at the 3' end of the gene. These primers were used for reverse transcription and polymerase chain reaction. The PCR product was digested with EcoRi and BamHl to give a fragment of approximately 1929 base pairs in length corresponding to the envelope gene of feline leukemia virus.

S-SPV-206 S-SPV-206 is a pig pustular disease virus that expresses four foreign genes. The gene for the IVF envelope and the gene for E. coli β-galactosidase (lacZ) were inserted into a restriction site.1 Notl-only (the Notl-linkers inserted into a single Accl restriction site in the reading frame open OlL of the HindIII M fragment of SPV). The gene for the FIV gag / protease and the gene for E. coli β-glucuronidase (uidA) were inserted into the unique Notl site (the Notl linkers inserted into the unique EcoRI restriction site within a region of approximately 3.2 kb of the 6.7 kb SPV HindIII K-fragment). The IVF gag / protease and the envelope genes are under the control of identical late synthetic / initial promoters (LP2EP2). The lacZ gene is under the control of the synthetic late promoter (LP1) and the uidA gene is under the control of the synthetic initial promoter (EP2).

S-SPV-206 was derived from S-SPV-048. This was achieved using the homology vector 903-11.4 and the S-SPV-048 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was examined by the RECOMBINANT SPV EXAMINATION EXPRESSING β-GLUCORONIDASE (X-GLUC ESSAYS AND EXAMINATION FOR RECOMBINANT HERP VIRUS EXPRESSING ENZYMATIC MARKERS GENES). The final result of the blue / green purification was the recombinant virus designated S-SPV-206. This virus was tested for β-glucuronidase expression, for purity, and for insert stability by means of multiple passes monitored by the blue / green plate assay as described in Materials and Methods. After the three rounds of initial passage, all the plates observed were blue / green indicating that the virusera pure, stable and. is -expressing the genes of others.

To confirm the expression of FIV envelope and gag / protease gene products, the cells were infected with S-SPV-206 and samples of the infected cell lysates and culture supernatants were subjected to electrophoresis. SDS polyacrylamide gel. The gel was stained and analyzed using the WEST STAIN PROCEDURE. A polyclonal cat anti-FIV PPR serum or a monoclonal mouse anti-FIVgag (P24) antiserum was used to detect the expression of gag-specific proteins and of on-FIV. The lysate of cells infected with SPV-206 exhibited bands corresponding to the expected size bands of the envelope and gag / protease proteins of FIV.

S-SPV-206 was assayed for the expression of the gag / protease specific antigen of FIV using the BLACK PLATE EXAMINATION FOR EXPRESSION OF GENE GENE IN RECOMBINANT SPV. The monoclonal mouse gag / anti-FIV antibody (P24) was shown to react specifically with the S-SPV-206 plates and not with the negative control plates S-SPV-001. All the plates observed from S-SPV-206 reacted with this antibody indicating that the virus was stably expressing the foreign gene of gag / protease from FIV. The assays described here were carried out on the ESK-4 cells, indicating that the ESK-4 cells would be suitable substrate for the production of recombinant vaccines. ---.:.- • __ 1 - S-SPV-206 is a recombinant pig pustular disease virus expressing the envelope and gag / protease proteins of FIV and is useful as a vaccine in cats against FIV infection. S-SPV-206 is also useful for the expression of FIV envelope and gag / protease genes.

VECTOR OF HOMOLOGY 913-11.4. The homology vector 913-11.4 was used to insert the foreign DNA in SPV 048. This incorporates a marker gene E. coli β-glucuronidase (uidA), and an IVF gag / protease gene flanked by SPV DNA.

When this homology vector was used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE SPV RECOMBINANT, it was a virus containing DNA encoded for foreign genes. Note that the uidA marker gene is under the control of a synthetic initial pustular disease promoter (EP2) and the IVF gag / protease is under the control of a synthetic initial / late pustular disease promoter (LP2EP2). These two promoter / gene cassettes were oriented in opposite directions with the adjacent promoters, but in opposite orientations to avoid homologous recombination between the identical EP2 promoter elements. The homology vector was constructed using standard recombinant DNA techniques (22 and 30), by joining the restriction fragments from the following sources with the appropriate synthetic DNA sequences. Plasmid 913-11.4 was constructed using plasmid 847-42.2C. This plasmid was previously constructed by inserting the uidA gene into the unique EcoRI site within the genomic K HindIII fragment of SPV. The uidA gene is under the control of the synthetic initial promoter (EP2). The FIV gag / protease gene was then inserted into the unique Notl site located upstream of the uidA gene resulting in plasmid 913-11.4.

The FIV gag / protease gene was synthesized by reverse transcription (RT) and the polymerase chain reaction (PCR) (15, 42) using the cDNA of the FIV strain PPR.

The upstream primer (5'GCGTGAATTCGGGGAATGGACAGGGGCGAGAT-3 ') is synthesized from the 5' end of the IVF gag / protease gene and introduces an EcoRI site at the 5 'end of the gene. The down primer was (5'GAGCCAGATCTGCTCTTTTTACTTTCCC-3 ') is synthesized from the 3' end of the IVF gag / protease gene, introduces a BglII site at the 3 'end of the gene, and was used for the reverse transcription and reaction of polymerase chain. "The PCR product was digested with EcoRi and BglII to give a fragment of approximately 1839 base pairs in length corresponding to the gag / protease gene of FIV.

S-SPV-200 . S-SPV-200 is a pig pustular disease virus that expresses three foreign genes. The genes for the gag / protease virus immunity 'feline deficiency (FIV) and the gene and the full length envelope for E. coli β-galactosidase (lacZ) were inserted into a unique Notl restriction site (the Notl linkers inserted in a single Accl restriction site in the OlL open reading frame of the HindIII M fragment SPV). The FIV gag / protease genes and the envelope are under the control of the identical synthetic initial / initial promoter (LP2EP2).

The lacZ gene is under the control of the synthetic late promoter (LPl).

The S-SPV-200 was derived from the S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 904-63.B7 and the S-SPV-001 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was examined by the RECOMBINANT SPV EXAMINATION EXPRESSING β-galactosidase (BLUOGAL AND CPRG ESSAYS AND RECOMBINANT HERPES VIRUS EXAMINATION EXPRESSING ENZYMATIC MARKERS GENES). The final result of the red plaque purification was the recombinant virus designated S-SPV-157. This virus was tested for the expression of β-galactosidase by the blue plate assay as described in Materials and Methods. The analysis of the purity, and the stability of the insert by multiple passes is in progress and will be monitored by the blue plate assay as described in Materials and Methods.

S-SPV-200 is a recombinant pig pustular disease virus expressing the FIV gag / protease proteins and the FIV envelope is useful as a vaccine in the pig against SIV infection. S-SPV-200 is also useful for the expression of the gag / protease proteins and the envelope of FIV.

VECTOR OF HOMOLOGY 904-63.B7. The homology vector 904-63.B87 was used to insert the foreign DNA into the SPV. This incorporates a marker gene of E. coli β-galactosidase (lacZ) and the genes of gag / protease and envelope of feline immunodeficiency virus (FIV) flanked by the SPV DNA. When this homology vector was used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE RECOMBINANT SPV, a virus containing DNA encoded for the foreign genes was found. Note that the β-galactosidase marker gene (lacZ) is under the control of the synthetic late pig pustular disease promoter (LP1) and the gag / protease and envelope genes of IVF are under the control of late pustular disease promoters. initial synthetic separated but identical (LP2EP2). The FIV envelope and promoter cassettes of FIV and gag / protease of FIV are oriented in opposite directions in a way that the transcription of the gag / protease and envelope genes run towards each other to avoid the possibility of homologous recombination between identical promoters. The homology vector was constructed using standard recombinant DNA techniques (22 and 30), by attaching the restriction fragments of the following sources with the appropriate synthetic DNA sequences. The plasmid vector was derived from a HindIII to BamH1 restriction fragment of approximately 2972 base pairs of pSP64 (promega). Fragment 1 is a sub-fragment of approximately 1484 base pairs BglII to Acc of the M fragment of SPV HindIII (23). Fragment 2 is a fragment of approximately 2580 base pairs of EcoRI to BglII from the envelope gene of FIV synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) (15.42) using cDNA from the PPR strain of FIV. The upstream primer (5'-GCCCGGATCCTATGGCAGAAGGGTTTGCAGC-3 ') is synthesized from the 5' end of the envelope gene and introduces a BamHI site at the 5 'end of the gene. The primer down (5'CCGTGGATCCGGCACTCCATCATTCCTCCTC-3 ';) is synthesized from the 3' end of the envelope gene, introduces a BamH1 site at the 3 'end of the gene, and was used for reverse transcription and polymerase chain reaction. The PCR product was digested with BamHl to give a fragment of 2580 base pairs in length corresponding to the envelope gene of FIV. Fragment 3 is a fragment of approximately 1839 base pairs EcoRI to BglII of the gag / FIV protease gene synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) (15 and 42) using cDNA of the FPR strain PPR. The upstream primer (5'-GCGTGAATTCGGGGAATGGACAGGGGCGAGAT-3 ') is synthesized from the 5' end of the FIV gag / protease gene and introduces an EcoRI site at the "5'-end of the gene.The primer downward was. r -GAGCCAGATCTGCTCTTTTTACTTTCCC-3 ') is synthesized from the 3' end of the IVF gag / protease gene, introduces a BglII site at the 3 'end of the gene, and was used for reverse transcription in the polymerase chain reaction. PCR was digested with EcoRI and BglII to give a fragment of approximately 1839 base pairs in length corresponding to the IVF gag / protease gene.Fragment 4 is a restriction fragment of approximately 3010 base pairs of BamHI to PvuII from plasmid pJF751 ( 11) Fragment 5 is a restriction sub-fragment of approximately 2149 base pairs Accl to HindIII of the HindIII restriction M fragment of SPV (23) The Accl site in the SPV homology vector was converted to the unique Notl site. using linkers if ntéticos.

S-SPV-207 S-SPV-207 is a pig pustular disease virus that expresses four alien genes. The gene for gag / protease FIV and the gene for E. coli β-galactosidase (lacZ) were inserted into a unique Notl restriction site (the Notl linkers inserted at a single Accl restriction site in the OlL open reading frame of the fragment M HindIII of SPV). The gene for the FIV envelope and the gene for E. coli β-glucuronidase (uidA) was inserted into a unique Notl site (the Notl linkers inserted into an EcoRI restriction site within a region of approximately 3. "2 kb of the 'fragment K of HindIII of; SPV of 6.7 kb). The gag / protease gene of FIV is under the control of the initial / late promoters (LP2EP2). The lacZ gene is under the control of the constitutive SPV promoter, OlL. The envelope gene of FIV is under the control of the synthetic initial pustular disease promoter (EP1) and the uidA gene is under the control of the synthetic initial promoter (EP2).

S-SPV-207 was derived from S-SPV-046. This was achieved using the homology vector 911-96.A2 and the virus S-SPV-046 in the HOMOLOGOUS RECOMBINATION PROCEDURE GENERATE RECOMBINANT SPV. The transfection supply was examined by the RECOMBINANT SPV EXAMINATION EXPRESSING β-GLUCORONIDASE (X-GLUC ESSAYS AND EXAMINATION FOR RECOMBINANT HERP VIRUS EXPRESSING ENZYMATIC MARKERS GENES). The final result of the blue / green purification was the recombinant virus designated S-SPV-207. The initial virus purifications were assayed for β-glucuronidase expression, by blue / green plaque assay as described in Materials and Methods. The final purification and analysis of expression of foreign genes is in progress.

S-SPV-207 is a recombinant pig pustular disease virus expressing the envelope and gag / protease FIV proteins and is useful as a vaccine in cats against feline immune deficiency virus infection. S-SPV-207 is also useful for the expression of FIV envelope and gag / protease genes.

VECTOR OF HOMOLOGY 911-96.A2. The homology vector 911-96.A2 was used to insert the foreign DNA in SPV 046. This incorporates a marker gene of E. coli β-glucuronidase (uidA), and an envelope gene of FIV flanked by the SPV DNA . When this homology vector was used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE RECOMBINANT SPV, a virus containing DNA encoded for foreign genes was found. Note that the uidA marker gene is under the control of the synthetic initial pustular disease (EP2) promoter and the envelope of feline immune deficiency virus is under the control of the initial synthetic pustular disease promoter (EP1). The homology vector was constructed using standard recombinant DNA techniques (22 and 30), by joining the restriction fragments from the following sources with the appropriate synthetic DNA sequences. Plasmid 911-96.A2 was constructed using plasmid 847-42.2C. This plasmid was previously constructed by inserting the uidA gene into the unique EcoRI site within the genomic K-HindIII fragment of SPV. The uidA gene is under the control of the synthetic initial promoter (EP2). The FIV envelope gene was inserted into the unique Notl site located upstream of the uidA gene resulting in plasmid 911-96.A2.

- The envelope gene of the immunity deficiency virus -feline was synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) (15, 42) using cDNA of the PPR strain of the feline immune deficiency virus. The upstream primer (5 '-GCCCGGATCCTATGGCAGAAGGGTTTGCAGC-3') is synthesized from the 5 'end of the envelope FIV gene and introduces a BamHI site at the 5' end of the gene. The down primer was used for reverse transcription and the polymerase chain reaction. The PCR product was digested with BamHl to give a fragment of approximately 2580 base pairs in length corresponding to the gag / protease gene of FIV.

S-SPV-142 S-SPV-142 is a virus of pig pustular disease that expresses three foreign genes. The genes for the E2 glycoprotein of bovine viral diarrhea virus type 1 (BVDV1) and the gene for E. coli β-galactosidase (lacZ) were inserted into a single Notl restriction site (Notl linkers inserted at a restriction site Single Accl in the OlL open reading frame of the HindIII M fragment of SPV). The genes for the bovine viral diarrhea virus type 1 E1 glycoprotein (BVDV1), the bovine viral diarrhea virus E2 glycoprotein E2 (BVDV2) and the E. coli β-glucuronidase marker gene (uidA) were inserted into the unique BamHl, Notl and PstI sites respectively (sites originating from a synthetic polylinker linker inserted at a unique EcoRI restriction site within a region of approximately 3.2 kb of the 6.7 kb SPV HindIII K-fragment). The E2 genes are under the control of the synthetic late / initial promoter (LP2EP2), the E ™ gene and the lacZ gene are under the control of the synthetic late promoter (LP1) and the uidA gene is under the control of the synthetic initial promoter (EP2) ).

S-SPV-142 was derived from S-SPV-051 (strain Kasza). This was achieved using the homology vector 870-4.6A and the S-SPV-051 virus in the RECOMBINATION PROCEDURE HOMOLOGOUS TO GENERATE RECOMBINANT SPV. The E2 gene of BVDV type 1 the lacZ gene in the M site of HindIII were and were present in the S-SPV-051 virus. The transfection supply was examined by the RECOMBINANT SPV EXAMINATION EXPRESSING β-GLUCORONIDASE (X-GLUC ESSAYS AND EXAMINATION FOR RECOMBINANT HERP VIRUS EXPRESSING ENZYMATIC MARKERS GENES). The final result of the green plate purification was the recombinant virus designated S-SPV-142. This virus was tested for β-glucuronidase expression, purity, and insert stability by multiple passes monitored by the green plate assay as described in Materials and Methods. After four initial rounds of purification, all the plates observed are green indicating that the virus is pure, stable and expressing the foreign genes. - | J '"=," ß ™ -cae "daaaa Y taa -." - "; -.-" -. - "" ": - To confirm the expression of the" E2 gene products of BVDV type 2 and E ™ 3 type 1, the cells infected with S-SPV-142 and the samples of the cell lysates infected and culture supernatants were subjected to SDS polyacrylamide gel electrophoresis. The gel was stained and analyzed using the WEST STAIN PROCEDURE. A monoclonal mouse anti-E1 ^ serum or a monoclonal mouse anti-E2 (type 2) was used to detect the expression of BVDV-specific proteins. Cell lysate of S-SPV-142 infected cells exhibited bands corresponding to 53 kd and 42 kd, which is the expected size of glycoprotein E2 (53 kd) but slightly smaller than the expected size of the glycoprotein E ™ 3 (48 kd).

S-SPV-142 was assayed for the expression of BVDV-specific antigens using the BLACK PLATE EXAMINATION FOR EXPRESSION OF GENE GENE IN RECOMBINANT SPV. The monoclonal mouse anti-E2 serum was shown to react specifically with the S-SPV-142 plates and not with the S-SPV-001 negative control plates. All the observed plates of S-SPV-142 reacted with both the E2 type 1 serum and the E2 type 2 indicating that the virus was stably expressing the foreign genes of BVDV E2. No reagent is currently available and reacts specifically with the E1 ™ * glycoprotein in the black plate assay. The assays described here were carried out in ESK-4 cells, indicating that ESK-4 cells would be a suitable substrate for the production of recombinant vaccines "of SPV.

S-SPV-142 is a recombinant pig pustular disease virus expressing the E2 glycoproteins of BVDV types 1 and 2 and the globin protein E1113 type 1 and is useful as a vaccine in cattle against BVDV infection.

VECTOR OF HOMOLOGY 874-4.6A. The homology vector 874-4.6A was used to insert foreign DNA into the SPV. This incorporates a marker gene of E. coli β-glucuronidase (uidA), and the E ™ 3 gene of bovine viral diarrhea virus (BVDV) type 1 and the E2 gene of BVDV type 2 flanked by the SPV DNA. When this homology vector was used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV, a virus containing the DNA encoded for the foreign genes was found. Note that the β-glucuronidase marker gene (uidA) is under the control of the initial synthetic pustular disease promoter (EP2), the Er s gene is under the control of the late synthetic pustular disease promoter (LP1) and the BVDV E2 gene is under the control of the late synthetic / initial pustular disease promoter (LP2EP2). The homology vector was constructed using the standard recombinant DNA techniques (22 and 30), by joining the restriction fragments of the following sources with the appropriate synthetic DNA sequences. The plasmid 874-4.6A was constructed using plasmid 847-90.1A._ - This plasmid was previously 'constructed by inserting the E2 gene of BVDV type 2 under the control of the late synthetic / initial promoter (LP2EP2) into a unique Notl site flanked for the EP2-uidA cassette from the Notl site. The Notl site originated from the synthetic polylinker inserted into the unique EcoRI site of the genomic fragment K HindIII of the SPV. The EP2-uidA cassette had previously been inserted into the unique PstI site within the same polylinker. The E1113 gene from BVDV was inserted into the rhombus end (filled with a Klenow reaction) of the BamH1 site at the 3 'end of the E2 gene resulting in plasmid 874-4.6A.

The transcriptional and translational orientation of the E1"5 gene was the reverse of the E2 and uidA genes.

The Em3 gene of BVDV is a fragment of approximately 744 base pairs (63 bp signal sequence + 681 bp coding sequence) from EcoRI to BamH1 synthesized by reverse transcription (RT) and polymerase chain reaction using RNA from the strain of BVDV1-Singer. The i m p r i m a d r a r i a r i a r (5 '-CCATGAATTCGCTGGAAAAAGCATTGCTGGCATGGGC-3') is synthesized from the 5 'end of the Ema gene signal sequence of the BVDV and introduces an EcoRI site at the 5' end of the gene. The primer down (5'TTCGGATCCTTACGCGTATGCTCCAAACCACGT-3 ') is synthesized from the 3' end of the E3 ™ gene and introduces a BamHl site at the 3 'end of the -gen. The PCR product was digested with EcoRi and BamHl to give a fragment of 744 base pairs in length corresponding to the E1 ™ 3 gene of BVDV 1.

S-SPV-187 S-SPV-187 is a virus of pig pustular disease that expresses two foreign genes. The gene for Newcastle disease virus F (NDV) and the gene for E. coli β-glucuronidase (uidA) were inserted into the unique Notl site (the Notl linkers inserted into a unique EcoRI restriction site within a region approximately 3.2 kb of the KV fragment HindIII of 6.7 kb SPV). The NDV F gene is under the control of the synthetic initial / late promoter (EP1 / EP2) and the uidA gene is under the control of the synthetic initial promoter (EP2).

S-SPV-187 was derived from S-SPV-001 (Cepa Kasza). This was achieved using the homology vector 894-21.25 and the S-SPV-001 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was examined by the RECOMBINANT SPV EXAMINATION EXPRESSING β-glucuronidase (BLUOGAL AND CPRG ESSAYS AND RECOMBINANT HERPES VIRUS EXAMINATION EXPRESSING ENZYMATIC MARKERS GENES). The final result of blue plate purification was the recombinant virus designated S-SPV-187. This virus was tested for "de-ß-glucuronidase" expression, for the purity and stability of the insert by multiple passes monitored by the blue plate assay as described in Materials and Methods. After the five initial rounds of purification, all the plates observed are blue indicating that the virus is pure, stable and expressing foreign genes.

S-SPV-187 was assayed for the expression of specific NDV antigens using the BLACK PLATE EXAMINATION FOR EXPRESSION OF GENE GENE IN RECOMBINANT SPV. The monoclonal mouse anti-NDV F was shown to react specifically with the S-SPV-187 plates and not with the S-SPV-003 negative control plates. All the observed plates of S-SPV-187 reacted with the monoclonal antibody indicating that the virus was stably expressing the foreign NDV genes. The assays described here were carried out on ESK-4 cells, indicating that ESK-4 cells would be a suitable substrate for the production of recombinant SPV vaccines.

S-SPV-187 is a recombinant pig pustular disease virus expressing the NDV F protein and is useful as a vaccine in chickens against NDV F infection.

S-SPV-187 is also useful for the expression of the F protein of the NDV.

VECTOR OF HOMOLOGÍ 05WITH CONTAINING GENE TOO? uidA; VECTOR OF HOMOLOGY 894-21.25. The homology vector 894-21.25 was used to insert the foreign DNA into the SPV. This incorporates a marker gene for E. coli β-glucuronidase (uidA), and the NDV F gene flanked by the SPV DNA. When this homology vector was used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE RECOMBINANT SPV, a virus containing DNA encoded for the foreign genes was found. Note that the β-glucuronidase marker gene (uidA) is under the control of the synthetic initial pustular disease promoter (EP2) and the NDV F gene is under the control of a synthetic initial / late pustular disease promoter (EP1 / EP2 ). The homology vector was constructed using the standard recombinant DNA techniques (22 and 30), by joining the restriction fragments of the following sequences with the appropriate synthetic DNA sequences. The plasmid 894-21.22 was constructed using the plasmid 847-42.7C and the plasmid 493-91.11. Plasmid 847-42.7C was previously constructed by inserting the uidA gene into the unique EcoRI site within the K genomic fragment of SPV HindIII. The uidA gene is under the control of the synthetic initial promoter (EP2). Plasmid 493-11.1 was previously constructed and contains the EP1 / EP2 promoter upstream of the coding region of the F NDV gene, a fragment of approximately 2100 base pairs derived from the full-length molecular clone _ (5025F). The EP1 / LP2-NDV F cassette was then inserted into a single Notl site located upstream of the uidA gene resulting in a plasmid 894-21.25. The transcriptional and translational orientation of the F gene of NDV is opposite to that of the uidA gene.

S-SPV-188 S-SPV-188 is a pig pustular disease virus that expresses four foreign genes. The gene for HN of Newcastle disease virus (NDV) and the gene for E. coli β-galactosidase (lacZ) were inserted into a single Notl restriction site (Notl linkers inserted into a single Accl restriction site in the OlL open reading frame of the M HindIII fragment of SPV). The gene for F Newcastle disease virus (NDV) and the gene for E. coli β-glucuronidase (uidA) were inserted into a single Notl site (the Notl linkers inserted into a unique EcoRI restriction site within a region of approximately 3.2 kb of the KV HindIII fragment of 6.7 kb SPV). The HN gene of NVD is under the control of the synthetic initial / late promoter (EP1 / LP2). The F gene of the NDV is under the control of the synthetic initial / late promoter (EP1 / EP2). The lacZ gene is under the control of the synthetic late promoter (LP1), the uidA gene is under the control of the synthetic initial promoter (EP2). c SrSPy-3.88: was derived ^ from S-SPV-009 (Kasza Strain, "which contains EP1 / LP2-NDV HN_y _LPl-lacZ at site 003.

This was achieved using the homology vector 894-21.25 and the S-SPV-009 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE TO GENERATE RECOMBINANT SPV. The transfection supply was examined by the RECOMBINANT SPV EXAMINATION EXPRESSING β-glucuronidase (BLUOGAL AND CPRG TESTING and EXAMINATION FOR RECOMBINANT HERPES VIRUS EXPRESSING MARKER GENES ENZYMATICS). The final result of the blue plate purification was the recombinant virus designated S-SPV-188. This virus was tested for the expression of β-glucuronidase, the purity, and the stability of the insert by multiple passes monitored by the blue plate assay as described in Materials and Methods. After five initial rounds of purification, all plaques were observed to be blue indicating that the virus is pure, stable and is expressing foreign genes.

S-SPV-188 was tested for the expression of specific NDV antigens using the BLACK PLATE EXAMINATION FOR EXPRESSION OF GENE GENE IN RECOMBINANT SPV. The monoclonal mouse anti-NDV F and the monoclonal mouse anti-NDV HN were shown to react specifically with the S-SPV-188 plates and not with the S-SPV-003 negative control plates. All the observed plates of S-SPV-188 reacted with the monoclonal antibodies indicating that the virus was stably expressing the foreign NDV genes. -The assays described here were carried out on ESK-4 cells, indicating that ESK-4 cells would be a suitable substrate for the production of recombinant SPV vaccines.

EXPRESSION IN RECOMBINANT SPV. The monoclonal mouse anti-NDV f and the monoclonal mouse anti-NDV HN were shown to react specifically with the S-SPV-188 plates and not with the S-SPV-003 negative control plates. All the plates observed S-SPV-188 reacted with the monoclonal antibodies indicating that the virus was stably expressing the foreign NDV genes. The assays described here were carried out on ESK-4 cells, indicating that ESK-4 cells would be a suitable substrate for the production of recombinant SPV vaccines.

S-SPV-188 is a virus of pustular disease of recombinant pig expressing the HN and F proteins of NDV and is useful as a vaccine in chickens against infection NDV. S-SPV-188 is also useful for the expression of NDV HN and F proteins.

VECTOR OF HOMOLOGY 059 CONTAINING GENE YEAR AND UIDA; VECTOR OF HOMOLOGY 894-21.25. The homology vector 894-21.25 was used to insert the foreign DNA into the SPV. This incorporates a marker gene E. coli β-glucuronidase (uidA), and the NDV F. gene flanked by SPV DNA. When this homology vector was used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV, a virus containing the DNA encoded for the foreign genes was found. Note that the β-glucuronidase marker gene (uidA) is .20 under the control of the initial synthetic pustular disease promoter (EP2) and the NDV F gene is under the control of a synthetic initial / late promoter (EP1 / LP2). The homology vector was constructed using standard recombinant DNA techniques (22 and 30), by joining the fragments of Restriction of the following sources with the appropriate synthetic DNA sequences. Plasmid 894-21.22 was constructed 4Í7 using plasmid 847-42.7C and plasmid 493-91.11. Plasmid 847-42.7C was previously constructed by inserting the uidA gene into the unique EcoRI site within the fragment . genomic K of HindIII of SPV. The uidA gene is under the control of the initial promoter (EP2). Plasmid 493-11.1 was previously constructed and contains the EP1 / EP2 promoter upstream of the coding region of the NDV F gene, a fragment of approximately 2100 base pairs derived from the full-length molecular clone (5025F). The NDV F cassette of EP1 / LP2 was then inserted into a single Notl site located upstream of the uidA gene resulting in a plasmid 894-21.25. The transcriptional and translational orientation of the F gene of NDV is opposite to that of the uidA gene. i - - - - 'S-SPV-148 i The virus of S-SPV-148 is a virus of pig pustular disease that expresses two aj genes. The gene in the truncated D glycoprotein (gD) of bovine herpes virus (BHV-1) and the gene for E. coli β-galactosidase (lacZ) were inserted into a unique Notl restriction site (the Notl linkers inserted into a single Accl restriction site in the OlL ORF of the M HindIII fragment of SPV). The gD gene is under the control of the synthetic late / initial promoter (LP2 / EP2) and the lacZ gene is under the control of the synthetic late promoter (LP1).

S-SPV-148 was derived from S-SPV-001 (strain Kasza). This was achieved using the homology vector 859-52.30 and the S-SPV-001 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was examined by the RECOMBINANT SPV EXAMINATION EXPRESSING β-galactosidase (BLUOGAL ESSAYS AND CPRG). The final result of the red plaque purification was the recombinant virus designated S-SPV-148. This virus was tested for β-galactosidase expression, purity, and insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods. After the initial three rounds of purification, all the plates observed are blue indicating that the virus is pure, stable, and expresses the foreign genes. • - - "" '"" "=."; - "'- - To confirm the expression of the gD gene product of BHV-1, the cells were infected with S-SPV-148 and the samples of the infected cell lysates and the culture supernatants were subjected to gel electrophoresis of SDS polyacrylamide The gel was stained and analyzed using the WEST STAIN PROCEDURE, a polyclonal bovine anti-BHV-1 serum was used to detect the expression of the BHV-1 specific proteins. infected cells of S-SPV-148 exhibited bands corresponding to 60 kd, which is the expected size of the truncated gD protein of BHV1.

S-SPV-148 is a recombinant pig pustular disease virus expressing the gD protein of BHV-1 and is useful as a vaccine in cows against BHV-1 infection. S-SPV-148 is also useful for the expression of the gD protein of BHV-1. Infections of bovine rhinotracheitis virus (D IBR) glycoprotein D having a suppressed transmembrane domain enhances the immune response against the IBD gD and improves the efficiency of the vaccine.

VECTOR OF HOMOLOGY 859-52.30. The homology vector 859-52.30 was used to insert the foreign DNA into the SPV. This incorporates a marker gene of E. coli β-galactosidase (lacZ) and the gene of glycoprotein D (gD) of truncated bovine herpes virus flanked by the. SPV DNA. When this: homology vector was used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE A RECOMBINANT SPV, a virus containing the DNA encoded for the foreign genes was found. Note that the β-galactosidase marker gene (lacZ) is under the control of the synthetic late pustular disease promoter (LP1) and the truncated BHV-1 gD gene is under the control of the late / initial synthetic pustular disease promoter (LP2EP2 ). The homology vector was constructed using standard recombinant DNA techniques (22 and 30), by joining the restriction fragments of the following sources with the appropriate synthetic DNA sequences. The plasmid vector was derived from a restriction fragment of approximately 2972 base pairs HindIII to BamH1 from pSP64 (promega). Fragment 1 is a restriction subfragment of approximately 1484 base pairs of BglII to Acc of the M fragment of SPV HindIII (23). Fragment 2 is a fragment of approximately 1086 base pairs of EcoRI to BamH1 of the truncated gD gene of BHV-1 synthesized by polymerase chain reaction (PCR) (15, 42) using the genomic fragment fragment of BHV Cooper strain -l. The upstream primer (5 '-CGGAATTCACAAGGGCCGACATTGGCC-3') is synthesized from the 5 'end of the gD gene of BHV-1 and introduces an EcoRI site at the 5' end of the gene. The primer down was (5'-GCTGGGATCCACGGCGTCGGGGGCCGCGGGCGT-3 ') is synthesized from the 3' end of the gD gene of BHV-I; introduces a BamHl site at the 3 'end of the gene. The PCR product was digested with EcoRI and BamHl to give a fragment of approximately 1086 base pairs in length corresponding to -gen-truncated "gD of BHV-1 - Fragment 3 is a restriction fragment" of approximately 3010 base pairs of BamH1 to PvuII from plasmid pJF751 (eleven) . Fragment 4 is a restriction subfragment of approximately 2149 base pairs Accl to HindIII of the HindIII M restriction fragment of SPV (23). The Accl site in the SPV homology vector was converted to a unique Notl site using the synthetic linkers.

S-SPV-186 The virus of S-SPV-186 is a virus of pig pustular disease that expresses two foreign genes. The gene for hemoglutinin (HA) of canine distemper virus (CDV) and the gene for E. coli β-glucuronidase (uidA) were inserted into a site Single Notl (the Notl linkers inserted into the unique EcoRI restriction site within a region of approximately 3.2 kd of the 6.7 kb SPV HindIII K fragment) .- The HA gene is under the control of the synthetic late promoter (LP2), and the uidA gene is under the control of the synthetic initial promoter (EP2).

S-SPV-186 was derived from S-SPV-001 (Kasza strain). This was achieved using the homology vector 899-20 and the S-SPV-001 virus in the RECOMBINATION PROCEDURE HOMOLOGOUS TO GENERATE RECOMBINANT SPV. The transfection supply was examined by the SPV EXAM RECOMBINANT EXPRESSING β-glucuronidase (X-GLUC). The final result of the red plaque purification was the recombinant virus designated S-SPV-186. This virus was tested for β-glucuronidase expression, purity, and insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of purification, all the plates observed are blue indicating that the virus is pure, stable, and expressing foreign genes.

To confirm the expression of the HA gene product of CDV, the cells were infected with S-SPV-186 and samples of the infected cell lysates and culture supernatants were subjected to SDS polyacrylamide gel electrophoresis. The gel was stained and analyzed using the WEST STAIN PROCEDURE. A polyclonal dog anti-CDV serum was used to detect the expression of the CDV-specific protein. The cell lysate of SPV-186 infected cells exhibiting bands corresponding to 70 kd, which is the expected size of the CDV HA protein.

? JSl * S-SPV-186 is a pustular disease virus-of recombinant pig expressing the "protein CDV HA and is useful as a vaccine in dogs against CDV infection." S-SPV-186 also it is useful for the expression of the HA protein of CDV.

VECTOR OF HOMOLOGY 899-20. The homology vector 899-20 was used to insert the foreign DNA in the SPV. This incorporates a marker gene for E. coli β-glucuronidase (uidA) and the hemagglutinin (HA) gene for canine distemper virus (CDV) flanked by SPV DNA. When this homology vector was used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV, a virus containing DNA encoded for foreign genes was found. Note that the β-glucuronidase marker gene (uidA) is under the control of a synthetic initial pustular disease (EP2) promoter and the CDV HA gene is under the control of the synthetic late pustular disease (LP2) promoter. The homology vector was constructed using standard recombinant DNA techniques (22 and 30). The HA gene of CDV is a fragment of approximately 1875 base pairs of BglII synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) (15, 42) using CDV RNA (challenge strain NVSL) . The upstream primer (5'-GAAGATCTAATGCTCTCCTACCAAGACAAGGTGGGTGCCT-3 ') is synthesized from the 5' end of the CDV HA gene and introduces a BglII site at the 5 'end of the gene. The downstream primer., was (5 '- GAAGATCTTCAAGGTTTTGAACGGTCACATGAGAATCTT-3') is synthesized from the 3 'end of the CDV HA gene, introduces a BglII site at the 3' end of the gene and was used for the polymerase chain reaction and reverse transcription. The PCR product was digested with BglII to give a fragment of 1875 base pairs in length corresponding to the HA gene of CDV.

S-SPV-185 The virus of S-SPV-185 is a virus of pig pustular disease that expresses five foreign genes. The gene for bovine herpes virus glycoprotein D (gD) BHV-1 and the gene for E. coli β-galactosidase (lacZ) were inserted into a unique Notl restriction site (Notl linkers inserted into an Accl restriction site). unique in the open reading frame OlL of the HindIII fragment M from SPV). The gene for bovine cytokine interleukin-12 (bIL-12) p40, p35 and the gene for E. coli β-glucuronidase (uidA) were inserted into a site Single Notl (the Notl linkers inserted into a unique EcoRI restriction site within a region of approximately 3.2 kb of the KV HindIII fragment of 6.7 Kb SPV). The gD gene is under the control of the late synthetic / initial promoter (LP2 / EP2). The bIL-12 p40 and p35 genes are under the control of the synthetic late promoter (LP2 and LP1), the uidA gene is under the control of the synthetic initial promoter (EP2) and the lacZ gene is under the control of the synthetic late promoter. (LPl) ¡- • - -_ - _. - .- - - The S-SPV-185 was derived from the S-SPV-148 (strain Kasza).

This was achieved using the homology vector 870-56 and the virus S-SPV-148 in the HOMOLOGO RECOMBINATION PROCEDURE FOR GENERATE RECOMBINANT SPV. The transfection supply was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING β-glucuronidase (X-GLUC). The final result of the red plaque purification was the recombinant virus designated S-SPV-185. This virus was tested for β-glucuronidase expression, purity, and insert stability by multiple passes monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of purification, all the plates observed are blue indicating that the virus is pure, stable, and is expressing the foreign genes.

To confirm the expression of gD of BHV-l and bIL-12 of p40, p35 gene products, cells were infected with S-SPV-185 and samples of the infected cell lysates and culture supernatants were subjected to SDS polyacrylamide gel electrophoresis. The gel was stained and analyzed using the WEST STAIN PROCEDURE. A polyclonal goat anti-hll-12 and a polyclonal bovine anti-BHV serum were used to detect the expression of gD specific proteins of BHV-1 and bIL-12. The lysate of cells infected with S3-SPV-185 exhibited bands that correspond to 60 kd, 40kd and 35 kd which is the expected size of the gD-truncated gene of BHV-l and of the p40 and p35 proteins of bIL-12 .

S-SPV-185 was assayed for the expression of specific bIL-12 antigens using the BLACK PLATE EXAMINATION FOR EXPRESSION OF GENE GENE IN RECOMBINANT SPV. The polyclonal goat anti-hIL-12 serum was shown to react specifically with the S-SPV-185 plates and not with the S-SPV-148 negative control plates. All the observed plates of S-SPV-185 reacted with the serological reagent indicating that the virus was stably expressing the foreign cattle genes. The assays described here were carried out on ESK-4 cells, indicating that ESK-4 cells would be a suitable substrate for the production of recombinant SPV vaccines.

S-SPV-185 is a recombinant pig pustular disease virus that expresses bovine antigen proteins and is useful as a vaccine in cows against viral infection. S-SPV-185 is also useful for the expression of the gD proteins of BHV-1, bIL-12 p40 and p35. A vaccine containing S-SPV-185 stimulates cell-mediated immunity and improves the growth of the animal's weight gain.

VECTOR OF HOMOLOGY 870-56. The homology vector 870-56 was used to insert the foreign DNA into the SPV. This incorporates a marker gene of E. coli β-glucuronidase (uidA) and the genes p40"and p35 of bovine cytokine interleukin-12 (" blL-12) flanked by SPV DNA When this homology vector was used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE RECOMBINANT SPV, it is a virus containing DNA encoded for foreign genes. Note that the ß-glucuronidase marker gene (uidA) is under the control of the synthetic initial pustular disease (EP2) promoter and the bovine cytokine interlucin-12 (bIL-12) genes under the control of the promoters of Synthetic late pustular disease (LP2 and LP1). The homology vector was constructed using standard recombinant DNA techniques (22 and 30), by joining the restriction fragments of the following sources with the appropriate synthetic DNA sequences. Plasmid 870-56 was constructed using plasmid 847-42.2C. This plasmid was previously constructed by inserting the uidA gene into the unique EcoRI site within the K genomic fragment of SPV HindIII. The uidA gene is under the control of the synthetic initial promoter (EP2). The bIL-12 genes were then inserted into a unique Notl site upstream of the uidA gene resulting in a plasmid 870-56. The transcriptional and translational orientation of the bIL-12 genes are the same as those of the uidA gene.

The bIL-12 p40 gene is a fragment of approximately 984 base pairs BamHl to BamHi synthesized by polymerase adenovirus reaction (PCR) (15, 42) using DNA of the bIL-12"gene containing the plasmid. The upstream primer (5 '-CGTCGGATCCAATGCACCCTCAGCAGTTGGTC-3') is synthesized from the 5 'end of the bIL-12 p40 gene and introduces a BamH1 site at the 5' end of the gene. The down primer was (5'-GTTGGATCCTAACTGCAGGACACAGATGCCC-3 ') is synthesized from the 3' end of the bIL-12 p40 gene, introduces a BamHI site at the 3 'end of the gene. The PCR product was digested with BamHl to give a fragment of 984 base pairs in length corresponding to the bIL-12 p40 gene. The bIL-12 p35 gene is a fragment of approximately 665 base pairs BglII to BgIII synthesized by polymerase chain reaction (PCR) (15, 42) using the plasmid DNA containing the IL-12 gene. The upstream primer (5'-GTCAGATCTAATGTGCCCGCTTCGCAGCCTCCTCCTCATA-3 ') is synthesized from the 5' end of the bIL-12 p35 gene and introduces a BglII site at the 5 'end of the gene. The downstream primer (5'-CTCAGAGATCTAGGAAGAACTCAGATAGCTCA-3 ') is synthesized from the 3' end of the bIL-12 p35 gene, introducing a BglII site at the 3 'end of the gene. The PCR product was digested with BglII to give a fragment of 665 base pairs in length corresponding to the p35 bIL-12 gene.

S-SPV-184 The virus of S-SPV-184 is a virus of pig pustular disease that expresses five foreign genes. The gene for bovine herpes virus glycoprotein D (gD) BHV-1- and the gene for E. coli β-galactosidase (lacZ) were inserted into a unique Notl restriction site (Notl linkers inserted at a restriction site Single Accl in the OlL open reading frame of the HindIII M fragment of SPV). The gene for p40 and p35 of bovine cytokine interleukin-12 (bIL-12) and the gene for E. coli β-glucuronidase (uidA) were inserted into a single Notl site (the Notl linkers inserted into a unique EcoRI restriction site within a region of approximately 3.2 kb of the KV HindIII fragment of SPV of 6.7 Kb). The gD gene is under the control of the late synthetic / initial promoter (LP2 / EP2). The bIL-12 p40 gene is under the control of the synthetic late promoter (LP2), the bIL-12 p35 gene is under the control of an internal ribosomal entry site (IRES), the uidA gene is under the control of the synthetic initial promoter (EP2) and the lacZ gene is under the control of the synthetic late promoter (LP1).

S-SPV-184 was derived from S-SPV-148 (strain Kasza).

This was achieved using the homology vector 870-46 and the S-SPV-148 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection strain was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING β-glucuronidase (X-GLUC). The final result of the red plaque purification was the recombinant virus designated S-SPV-184. This virus was tested for the expression of β-glucuronidase, for purity, and the stability in insert by multiple passes monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of purification, all the plates observed are blue indicating that the virus is pure, stable, and expresses the foreign genes.

To confirm the expression of the gD gene products of BHV-1 and bIL-12 p40 and p35, the cells are infected with S-SPV-184 and samples of the infected cell lysates and culture supernatants were subjected to electrophoresis of SDS polyacrylamide gel. The gel was stained and analyzed using the WEST STAIN PROCEDURE. A polyclonal goat anti-BHV and polyclonal anti-hll-12 bovine serum were used to detect the expression of the gD specific proteins of BHV-1 and bIL-12. The lysate of cells infected with S-SPV-184 exhibited bands corresponding to 60 kd, 40 kd and 35 kd, which is the expected size of the truncated gD proteins of BHV-1, bIL-12 p40 and p35.

S-SPV-184 was assayed for the expression of SIV-specific antigens using the BLACK PLATE EXAMINATION FOR EXPRESSION OF GENE GENE IN RECOMBINANT SPV. The polyclonal goat anti-hIL-12 serum was shown to react specifically with the S-SPV-184 plates and not with the S-SPV-148 negative control plates. All the observed plates of S-SPV-184 reacted with the serological reagent indicating that the virus was stably expressing the foreign cattle genes. The assays described here were carried out on ESK-4 cells, indicating that ESK-4 cells would be a suitable 'substrate' for the production of recombinant SPV vaccines.

S-SPV-184 is a recombinant pig pustular disease virus expressing bovine antigen proteins and is useful as a vaccine in cows against viral infection. S-SPV-184 is also useful for the expression of BHV-1 gD and the proteins of bIL-23 p40 and p35. A vaccine containing S-SPV-184 stimulates cell-mediated immunity and improves the growth and weight gain of the animal.

VECTOR OF HOMOLOGY 870-46. The homology vector 870-46 was used to insert the foreign DNA in the SPV.

This incorporates a marker gene of E. coli β-glucuronidase (uidA) and the p40 and p35 genes of bovine cytokine interleukin-12 (blL-12) flanked by SPV DNA. When this homology vector was used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE RECOMBINANT SPV, is a virus containing the DNA encoded for foreign genes. Note that the β-glucuronidase marker gene (uidA) is under the control of an initial synthetic pustular disease (EP2) promoter and the bovine cytokine interlucin-12 (bIL-12) genes are under the control of the promoter of synthetic late pustular disease (LP2). The homology vector was constructed using the standard recombinant DNA techniques (22 and 30), by joining the wave restriction fragments following sources with the appropriate synthetic DNA sequences. Plasmid 870-46 was constructed using plasmid 847.42.2C. This plasmid was previously constructed by inserting the uidA gene into the unique EcoRI site within the K genomic fragment of SPV HindIII. The uidA gene is under the control of the synthetic initial promoter (EP2). The bIL-12 genes were then inserted into a unique Notl site located upstream of the uidA gene resulting in plasmid 870-46. The transcriptional and translational orientation of the bIL-12 genes are the same as those of the uidA gene.

The bIL-12 p40 gene is a fragment of approximately 984 base pairs BamHI to BamHI synthesized by polymerase chain reaction (PCR) (15, 42) using the plasmid DNA containing the IL-12 gene. The upstream primer (5 '-CGTCGGATCCAATGCACCCTCAGCAGTTGGTC-3') was synthesized from the 5 'end of the bIL-12 p40 gene and introduces a BamH1 site at the 5' end of the gene. The down primer was (5'-GTTGGATCCTAACTGCAGGACACAGATGCCC-3 ') is synthesized from the 3' end of the bIL-12 p40 gene, introduces a BamHI site at the 3 'end of the gene. The PCR product was digested with BamHl to give a fragment of 984 base pairs in length corresponding to the bIL-12 p40 gene. The IRES sequence is a fragment of 509 base pairs synthesized by PCR using Novagen® DNA. The upstream primer (5 '-AATGGCGCGCCGGTTATTTTCCACCATA-3') was synthesized from the ~ 5 'end of the IRES and introduced an AscI site at the 5' end. The primer down was (5'-GTGGGATCCATATTATCATCGTGTTTTTC-3 ') is synthesized from the 3' end of the IRES, introduces a BamHI site at the 3 'end of the gene. The PCR product was digested with AseI and BamHl to give a fragment of 509 base pairs in length corresponding to the IRES sequence. The bIL-12 p35 gene is a fragment of approximately 665 base pairs of BgIII to AscI synthesized by polymerase chain reaction (PCR) (15, 42) using DNA from the plasmid containing the IL-12 gene. The upstream primer (5'-GTCAGATCTAATGTGCCCGCTTCGCAGCCTCCTCCTCATA-3 ') is synthesized from the 5' end of the bIL-12 gene of p35 and introduces a BglII site at the 5 'end of the gene. The primer down was (5'-CCTGGCGCGCCTAGGAAGAACTCAGATA-3 ') is synthesized "from the 3' end of the bIL-12 p35 gene, introduces an AscII site at the 3 'end of the gene. The PCR product was digested with BglII and AseI to give a fragment of 665 base pairs in length corresponding to the bIL-12 p35 gene.

S-SPV-183 The virus of S-SPV-183 is a virus of pig pustular disease that expresses two foreign genes. The gene for fusion (F) of canine distemper virus (CDV) and the gene for E. coli β-glucuronidase (uidA) was inserted into a unique Notl site (Notl linkers inserted into a single-EcoRi-restriction site within a region of approximately 3.2 kb of the SPV HindIII K fragment of 6.7 Kb) The F gene is under the control of the synthetic late promoter (LP1) and the uidA gene is under the control of the synthetic initial promoter (EP2).

The S-SPV-183 was derived from S-SPV-001 (strain Kasza).

This was achieved using the homology vector 888-81 and the S-SPV-001 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was examined by EXAMINATION FOR RECOMBINANT SPV EXPRESSING β-glucuronidase (X-GLUC). The final result of blue plate purification was the recombinant virus designated S-SPV-183. This virus was tested for the expression of β-glucuronidase, the purity, and the stability of the insert by multiple passes monitored by the blue plate assay as described in Materials and Methods. After the three initial rounds of purification, all the plates observed are blue indicating that the virus is pure, stable, and expresses the foreign genes.

To confirm the expression of the CDV F gene product, the cells were infected with S-SPV-183 and the samples of the infected cell lysates and the culture supernatants were subjected to SDS polyacrylamide gel electrophoresis. The gel was stained and analyzed using the WEST STAIN PROCEDURE. A polyclonal dog anti-CDV serum was used to detect the expression of the protein specific CDV. The cell-lysate of the cells infected with S-SPV-183 exhibited a band corresponding to 60 kd, which is the expected size of the CDV protein.

S-SPV-183 is a pustular disease virus of recombinant pig expressing the F protein of CDV is useful as a vaccine in dogs against CDV infection. The S-SPV-183 is also useful for the expression of the F protein of CDV.

VECTOR OF HOMOLOGY 888-81. The homology vector 888-81 was used to insert the foreign DNA into the SPV.

This incorporates a marker gene of E. coli β-glucuronidase (uidA) and the fusion gene (F) of canine distemper virus (CDV) flanked by SPV DNA. When this homology vector was used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE RECOMBINANT SPV, a virus containing DNA encoded for foreign genes was found. Note that the β-glucuronidase marker gene (uidA) is under the control of a synthetic initial pustular disease promoter (EP2) and the canine distemper virus fusion (f) gene is under the control of a disease promoter synthetic late pustule (LP1). The homology vector was constructed using the standard recombinant DNA techniques (22 and 30), by joining the restriction fragments of the following sources with the appropriate synthetic DNA and sequences. Plasmid 888--81 was constructed using plasmid 847.42.2C. This plasmid was previously constructed by inserting the uidA gene into the unique EcoRI site within the K genomic fragment of SPV HindIII. The uidA gene is under the control of the synthetic initial promoter (EP2). The CDV F gene is inserted into a unique Notl site located upstream of the uidA gene resulting in plasmid 888.81. The transcriptional and translational orientation of the F gene of CDV is the same as that of the uidA gene.

The F gene of CDV is a fragment of approximately 2000 base pairs BamHl synthesized by reverse transcription (RT) and polymerase chain reaction (PCR) (15, 42) using RNA for the CDV (challenge strain NVSL). The upstream primer (5 '-CGGGATCCCATGCACAGGGGAATFCCCCAAAAGCTCCACC-3') is synthesized from the 5 'end of the CDV F gene and introduces a BamH1 site at the 5' end of the gene. The down primer was (5 '-CGGGATCCTCAGAGTGATCTCACATAGGATTTCGAAGTTC-3') is synthesized from the 3 'end of the CDV F gene, introduces a BamH1 site at the 3 'end of the gene and was used for reverse transcription and polymerase chain reaction. The PCR product was digested with BamHl to give a fragment of 2000 base pairs in length corresponding to the F gene of CDV.

S-SPV-165 The virus of S-SPV-165 is a virus of pig pustular disease that expresses three genes, foreign. The genes-for p35 and p40 of bovine cytokine interleukin-12 (IL-12 and the gene for E. coli β-glucuronidase (uidA) were inserted into a single Notl site (Notl linkers inserted into a unique EcoRI restriction site within a region of approximately 3.2 kb of the HindIII K fragment of SPV of 6.7 Kb.) The p40 gene is under the control of the synthetic late promoter (LP2), the p35 gene is under the control of the synthetic late promoter (LP1) and the uidA gene is under the control of the synthetic initial promoter (EP2).

S-SPV-165 was derived from S-SPV-001 (strain Kasza). This was achieved using the homology vector 870-56 and the S-SPV-001 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was examined by EXAMINATION TO EXPRESS SPV RECOMBINANT ß-glucuronidase (X-GLUC). The final result of blue plate purification was the recombinant virus designated S-SPV-165. This virus was tested for the expression of β-glucuronidase, the purity, and the stability of the insert by multiple passes monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of purification, all the plates observed are blue indicating that the virus is pure, stable, and is expressing foreign genes.

To confirm the expression of the bIL-12 gene products, the cells were infected with S-SPV-165 and the samples of the infected cell lysates and the culture supernatants were subjected to SDS polyacrylamide gel electrophoresis. The gel was stained and analyzed using the WEST STAIN PROCEDURE. A polyclonal goat anti-human IL-12 serum (hIL-12) was used to detect the expression of specific bIL-12 proteins. The cell lysate of the cells infected with S-SPV-165 exhibited bands corresponding to 40 kd and 35 kd, which is the expected size of the bIL-12 p40 and p35 proteins, respectively.

S-SPV-165 was assayed for the expression of specific IL-12 antigens using the BLACK PLATE EXAMINATION FOR EXPRESSION OF GENE GENE IN RECOMBINANT SPV. A polyclonal goat anti-hIL-12 antiserum was shown to react specifically with the S-SPV-165 plates and not with the S-SPV-001 negative control plates. All the observed plates of S-SPV-165 reacted with the serological reagent indicating that the virus was stably expressing the foreign genes bIL-12. The assays described here were carried out on ESK-4 cells, indicating that ESK-4 cells would be a suitable substrate for the production of recombinant SPV vaccines.

S-SPV-165 is a recombinant pig pustular disease virus expressing the proteins, p40 and p35 of blL-12 and is useful. Like a vaccine in. the -vacas against viral infection. S-SPV-165 is also useful for the expression of bIL-12 proteins. A vaccine containing S-SPV-165 stimulates cell-mediated immunity and improves growth and weight gain of the animal.

VECTOR OF HOMOLOGY 870-56. The homology vector 870-56 was used to insert the foreign DNA into the SPV. This incorporates a marker gene of E. coli β-glucuronidase (uidA) and the p40 and p35 genes of bovine cytokine interleukin-12 (blL-12) flanked by SPV DNA. When this homology vector was used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV, a virus containing the DNA encoded for the foreign genes results. Note that the β-glucuronidase marker gene (uidA) is under the control of a synthetic initial pustular disease promoter (EP2) and the bovine cytokine interlucin-12 (bIL-12) genes are under the control of the promoters of Synthetic late pustular disease (LP2 and LP1). The homology vector was constructed using standard recombinant DNA techniques (22 and 30), by joining the restriction fragments of the following sources with the appropriate synthetic DNA sequences. Plasmid 870-56 was constructed using plasmid 847-42.2C. This plasmid was previously constructed by inserting the uidA gene into the unique EcoRI site within the K genomic fragment of SPV HindIII. The uidA gene is under the control of the synthetic initial promoter (EP2-). The bIL-12 genes were then inserted into a unique Notl site located upstream of the uidA gene resulting in plasmid 870-56. The transcriptional and translational orientation of the bIL-12 genes is the same as that of the uidA gene.

The bIL-12 p40 gene is a fragment of approximately 984 base pairs BamHl to BamHi synthesized by polymerase chain reaction (PCR) (15, 42) using DNA from the plasmid containing the IL-12 gene. The upstream primer (5 '-CGTCGGATCCAATGCACCCTCAGCAGTTGGTC-3') is synthesized from the 5 'end of the pIL gene of bIL-12 and introduces a BamHI site at the 5' end of the gene. The down primer was (5'-GTTGGATCCTAACTGCAGGACACAGATGCCC-3 ') is synthesized from the 3' end of the pIL bIL-12 gene, introduces a BamHI site at the 3 'end of the gene. The PCR product was digested with BamHl to give a fragment of 984 base pairs in length corresponding to the p40 gene of bIL-12. The p35 gene of bIL-12 is a fragment of approximately 665 base pairs of BglII to BgIII synthesized by polymerase chain reaction (PCR) (15, 42) using the plasmid DNA containing the IL-12 gene. Primer up (5 '-GTCAGATCTAATGTGCCCGCTTCGCAGCCTCCTCCTCATA-3') synthesizes from the 5 'end of the gene p35 BIL-12 and introduces a BglII site at the 5' end of the gene. The down primer was (5'-CTCAGAGATCTAGGAAGAACTCAGATAGCTCA-3 ') is synthesized from the 3' end of the p35 gene of bIL-12, introduces a -BglII site at the 3 'end of the gene. . The PCR product was digested with BglII to give a fragment of approximately 665 base pairs in length corresponding to the p35 gene of bIL-12.

S-SPV-164 The virus of S-SPV-164 is a virus of pig pustular disease that expresses three foreign genes. The genes for p35 and p40 bovine interleukin-12 cytokine (IL-12 and the gene for E. coli beta-glucuronidase (uidA) were inserted into a unique NotI site (NotI linkers inserted into the one unique restriction site EcoRI into from a region of approximately 3.2 kb of the KV HindIII fragment of 6.7 Kb SPV.) The p40 gene is under the control of the synthetic late promoter (LP2), the p35 gene is under the control of an internal ribosomal entry site (IRES) ), and the uidA gene is under the control of the synthetic initial promoter (EP2).

S-SPV-164 was derived from S-SPV-001 (strain Kasza). This was achieved using the homology vector 870-46 and the virus S-SPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection supply was examined by EXAMINATION TO EXPRESS SPV RECOMBINANT ß-glucuronidase (X-GLUC). The final result of blue plate purification was the recombinant virus designated S-SPV-164. This virus was tested for the expression of β-glucuronidase, < of the purity, and the stability of the insert through multiple passes monitored by the blue plate assay as described in Materials and Methods. After three initial rounds of purification, all the plates observed are blue indicating that the virus is pure, stable, and is expressing foreign genes.

To confirm the expression of the bIL-12 gene products, the cells were infected with S-SPV-164 and the samples of the infected cell lysates and the culture supernatants were subjected to SDS polyacrylamide gel electrophoresis. The gel was stained and analyzed using the WEST STAIN PROCEDURE. A polyclonal goat anti-human IL-12 serum (hIL-12) was used to detect the expression of specific bIL-12 proteins. The cell lysate of cells infected with S-SPV-164 exhibited bands corresponding to 40 kd and 35 kd, which is the expected size of the bIL-12 p40 and p35 proteins, respectively.

S-SPV-164 was tested for the expression of specific antigens IL-12 using the BLACK PLATE EXAMINATION FOR EXPRESSION OF GENE GENE IN RECOMBINANT SPV. A polyclonal goat anti-hIL-12 antiserum was shown to react specifically with the S-SPV-164 plates and not with the S-SPV-001 negative control plates. All the observed plates of S-SPV-164 reacted with the serological reagent indicating that the virus was stably expressing the foreign genes bIL-12. The assays described here were carried out in ESK-4 cells, indicating that ESK-4 cells would be a suitable substrate for the production of recombinant SPV vaccines.

S-SPV-164 is a recombinant pig pustular disease virus expressing blL-12 p40 and p35 proteins and is useful as a vaccine in cows against viral infection. S-SPV-164 is also useful for the expression of bIL-12 proteins. A vaccine containing S-SPV-164 stimulates cell-mediated immunity and improves the growth and weight gain of the animal.

VECTOR OF HOMOLOGY 870-46. The homology vector 870-46 was used to insert the foreign DNA in the SPV. This incorporates a marker gene of E. coli β-glucuronidase (uidA) and the p40 and p35 genes of bovine cytokine interleukin-12 (blL-12) flanked by the SPV DNA. When this homology vector was used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE RECOMBINANT SPV, a virus containing the DNA encoded for foreign genes was found. Note that the β-glucuronidase marker gene (uidA) is under the control of the initial synthetic pustular disease promoter (EP2) and the bovine cytokine interlucin-12 (bIL-12) genes are under the control of the pustular disease promoter Synthetic latex (LP2). The homology vector was constructed using the standard recombinant DNA techniques (22 and 30), by joining the restriction fragments of the following sources with the appropriate synthetic DNA sequences. Plasmid 870-46 was constructed using plasmid 847.42.2C. This plasmid was previously constructed by inserting the uidA gene into the unique EcoRI site within the K genomic fragment of SPV HindIII. The uidA gene is under the control of the synthetic initial promoter (EP2). The bIL-12 genes were then inserted into a unique Notl site located above the uidA gene resulting in plasmid 870-46. The transcriptional and translational orientation of the bIL-12 genes are the same as those of the uidA gene.

The bIL-12 p40 gene is a fragment of approximately 984 base pairs of BamHI to BamHI synthesized by polymerase chain reaction (PCR) (15, 42) using DNA from the plasmid containing the IL-12 gene. The upstream primer (5 '-CGTCGGATCCAATGCACCCTCAGCAGTTGGTC-3') was synthesized from the 5 'end of the bIL-12 p40 gene and introduces a BamH1 site at the 5' end of the gene. The down primer was (5'-GTTGGATCCTAACTGCAGGACACAGATGCCC-3 ') is synthesized from the 3' end of the bIL-12 p40 gene, and introduces a BamHl site at the 3 'end of the gene. The PCR product was digested with BamHl to give a fragment of 984 base pairs in length corresponding to the bIL-12 p40 gene. The IRES sequence is a fragment of 509 base pairs synthesized by PCR using the DNA of Novagen®. The primer up- (S '-AATGGCGCGCCGGTTATTTTCCACCATA-3') is synthesized from the 5 'end of the IRES and introduces an Ase-site! at -extreme 5 and the downward primer was (5'-GTGGGATCCATATTATCATCGTGTTTTTC-3 ') is synthesized from the 3' end of the IRES and introduces a BamH1 site at the 3 'end of the gene. The PCR product was digested with AseI and BamHl to give a fragment of 509 base pairs in length corresponding to the IRES sequence. The bIL-12 p35 gene is a fragment of approximately 665 base pairs of BgIII to AscI synthesized by polymerase chain reaction (PCR) (15, 42) using DNA from the plasmid containing the IL-12 gene. The upstream primer (5'-GTCAGATCTAATGTGCCCGCTTCGCAGCCTCCTCCTCATA-3 ') is synthesized from the 5' end of the bIL-12 gene of p35 and introduces a BglII site at the 5 'end of the gene. The primer down was (5'-CCTGGCGCGCCTAGGAAGAACTCAGATA-3 ') is synthesized from the 3' end of the bIL-12 p35 gene, introduces an AscI site at the 3 'end of the gene. The PCR product was digested with BglII and AseI to give a fragment of 665 base pairs in length corresponding to the bIL-12 p35 gene.

S-SPV-176 The virus of S-SPV-176 is a virus of pig pustular disease that expresses four foreign genes. The gene for bovine respiratory syncytial virus glycoprotein (G) and the gene for E. coli β-galactosidase (lacZ) were inserted into a -Notl restriction site. The only gene in the open-label OlL restriction site of the HindIII M fragment of SPV.) The gene for the bovine respiratory syncytial fusion (F) virus. and the gene for E. coli β-glucuronidase (uidA) were inserted into a unique Notl site (the Notl linkers inserted at a unique EcoRI restriction site within a region of approximately 3.2 kb of the KV HindIII fragment of SPV of 6.7. kb) The gene for the bovine respiratory syncytial virus G glycoprotein is under the control of the synthetic late / initial promoter (LP2EP2) .The gene for the bovine respiratory syncytial (F) virus is under the control of the synthetic late promoter ( LPl) The lacZ gene is under the control of the synthetic late promoter (LPl), the uidA gene is under the control of the synthetic initial promoter (EP2).

S-SPV-176 was derived from S-SPV-020 (strain Kasza). This was accomplished using the homology vector 888-38.9 and the S-SPV-020 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The transfection strain was examined by the RECOMBINANT SPV EXAMINATION EXPRESSING ß-glucuronidase ... (REVIEW FOR RECOMBINANT HERP VIRUS EXPRESSING ENZYMATIC MARKERS GENES). The final result of the blue plate purification was the recombinant virus designated S-SPV-176. This virus was tested for the expression of β-galactosidase and β-glucuronidase, the purity, and the stability of. insert through multiple passes monitored by the blue plate assay as described in Materials and Methods ^ After three initial rounds of purification, all plates observed are blue indicating that the virus is pure, stable, and expressing foreign genes.

To confirm the expression of the products of fusion gene (F) and glycoprotein (G) of bovine respiratory syncytial virus, the cells were infected with S-SPV-176 and the samples of the infected cell lysates were subjected to electrophoresis of SDS polyacrylamide gel. The gel was examined and analyzed using the WEST STAIN PROCEDURE. The bovine anti-FITC (Accurate Chemicals) or a specific Mab F (Mab 19) was used to detect the expression of specific BRSV proteins. The cell lysate of cells infected with S-SPV-176 exhibited bands corresponding to 80 kd to 90 kd and 70 kd which is the expected size of the products of fusion gene (F) and glycoprotein (G) of the bovine respiratory syncytial virus. The assay described here was carried out on ESK-4 cells indicating that ESK-4 cells would be a suitable substrate for the production of recombinant SPV vaccines.

S-SPV-176 is a recombinant pig pustular disease virus expressing the ORF 5 and ORF 6 proteins of PRRS and is useful as a vaccine in pigs against PRRS infection. - S-SPV-134 is also useful for the expression of ORF 5 and ORF 6 proteins of PRRS.

VECTOR OF HOMOLOGY 888-38.9. The homology vector 888-38.9 was used to insert the foreign DNA into the SPV. This incorporates a marker gene E. coli β-glucuronidase (uidA) and the fusion gene (F) of bovine respiratory syncytial virus flanked by the SPV DNA. When this homology vector was used according to the RECOMBINATION PROCEDURE OF HOMOLOGOUS TO GENERATE RECOMBINANT SPV, a virus containing the DNA encoded for the foreign genes was found. Note that the β-glucuronidase marker gene (uidA) is under the control of a synthetic early pustular disease (EP2) promoter and the bovine respiratory syncytial virus (F) fusion gene is under the control of the late pustular disease promoter synthetic (LPl). The homology vector was constructed using standard recombinant DNA techniques (22 and 30), by joining the restriction fragments of the following sources with the appropriate synthetic DNA sequences. Plasmid 888-38.9 was constructed using plasmid 847-42.7C. This plasmid was previously constructed by inserting the uidA gene into the unique EcoRI site within the K genomic fragment of SPV HindIII. The uidA gene is under the control of the synthetic initial promoter (EP2). The fusion gene (F) of bovine respiratory syncytial virus was then inserted into a downstream primer (5 'CTCTGGATCCTACAGCCATGAGGATGATCATCAGC-3') which is synthesized from the 3 'end of the fusion gene (F), introduces a BamH1 site into the 3 'end of the gene, and was used for reverse transcription and polymerase chain reaction. The PCR product was digested with BamHl to give a fragment of 1723 base pairs in length corresponding to the fusion gene (F).

S-SPV-143 S-SPV-143 is a virus of pig pustular disease that expresses three foreign genes. The genes for the E2 glycoprotein of bovine viral diarrhea virus type 1 (BVDV1) and the gene for E. coli β-galactosidase (lacZ) were inserted into a single Notl restriction site (Notl linkers inserted at a restriction site Single Acc in the OlL ORF of the M fragment of HindIII of SPV). The genes for • bovine viral diarrhea virus type 1 glycoprotein E (BVDV1), bovine viral diarrhea virus type E2 glycoprotein E2 (BVDV2) and the E. coli β-glucuronidase marker gene (uidA) were inserted into a site BamHl, Notl and a PstI site respectively (sites originating from a synthetic polylinker linker inserted at a unique EcoRI restriction site within a region of approximately 3.2 kb 10 (SEQUENCE ID NO.) Of the HindIII fragment K of 6.7 kb SPV ). The E gene and the lacZ gene are under the control of the synthetic late promoter (LP1), and the uidA gene is under the control of the synthetic initial promoter.

S-SPV-143 was derived from S-SPV-051 (Kasza strain). This was achieved using the homology vector 874- 06.20B and the S-SPV-051 virus in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV. The E2 gene of BVDV type 1 and the lacZ gene in the M site of HindIII were already present in the virus S-SPV-051. The transfection supply was examined by the RECOMBINANT SPV EXAMINATION EXPRESSING β-GLUCORONIDASE (X-GLUC ESSAYS AND EXAMINATION FOR RECOMBINANT HERP VIRUS EXPRESSING ENZYMATIC MARKERS GENES). The final result of the purification of green plaque was the virus recombinant designated S-SPV-143. The virus was tested for β-glucuronidase expression, for purity, and for insert stability by multiple passes monitored by the green plate assay as described in Materials and Methods. After four initial rounds of purification, all the plates observed are green indicating that the virus is pure, stable and expressing the foreign genes.

To confirm E2 expression of type 2 BVDV and type E gene products, cells were infected with S-SPV-143 and samples of infected cell lysates were subjected to polyacrylamide gel electrophoresis. SDS. The gel was stained and analyzed using the WEST STAIN PROCEDURE. A monoclonal mouse anti-E2 (type 2) of monoclonal mouse anti-E serum (type 1) was used to detect the expression of BVDV-specific proteins. The cell lysate of the cells infected with S-SPV-143 exhibited bands corresponding to 53 kd and 42 kd, which is the expected size of glycoprotein E2 (53 kd) but slightly smaller than the expected size of the glycoprotein E (48 kd).

S-SPV-143 was assayed for the expression of BVDV-specific antigens using the BLACK PLATE EXAMINATION FOR GENE EXPRESSED IN RECOMBINANT SPV. The monoclonal mouse anti-E2 serum was shown to react specifically with the S-SPV-143 plates and not with the negative control plates S-SPV-001. All the observed plates of S-SPV-143 reacted with both a type 1 E2 and a type 2 E2 serum indicating that the virus was stably expressing the genes • outside of BVDV E2. No reagent is currently available that specifically reacts with E. glycoprotein in the black plate assay. The assays described here were carried in ESK-4 cells, indicating that ESK-4 cells would be a suitable substrate for the production of recombinant SPV vaccines.

S-SPV-143 is a pustular disease virus ^^ of recombinant pig expressing the E2 glycoproteins of BVDV of types 1 and 1 and type 1 of glocoprotein E and is useful as a vaccine in cattle against BVDV infection.

VECTOR OF HOMOLOGY 874-06.20B. The homology vector 874-06.20B was used to insert the foreign DNA into the SPV. This incorporates a marker gene of E. coli β-glucuronidase (uidA), and the E gene of bovine viral diarrhea virus (BVDV) type 1 and the E2 gene of BVDV type 2 flanked by the SPV DNA.

When this homology vector was used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT SPV, a virus containing the DNA encoded for the foreign genes results. Note that the β-glucuronidase marker gene is under the control of the initial pustular disease promoter Synthetic (EP2), the E gene is under the control of the late synthetic pustular disease promoter (LP1) and the BVDV E2 gene is under the control of the late synthetic / initial pustular disease promoter (LP2EP2). The homology vector was constructed using the standard recombinant DNA techniques (22 and 30), by joining the restriction fragments of the following sources with the appropriate synthetic DNA sequences. Plasmid 874-06.20B was constructed using plasmid 847-90.2B. This plasmid was previously constructed by inserting the E2 gene of BVDV type 2 under the control of the late synthetic / initial promoter (LP2EP2) at a unique NotI site flanked by the EP2-uidA cassette from the NotI site. The Notl site originated from the synthetic polylinker inserted into the unique EcoRI site of the genomic fragment K HindIII of the SPV. The EP 2 cassette of uidA has been previously inserted in the rounded end resulting in the plasmid 874-06.20B. The translational orientation of the E gene is the same as that of the E2 and uidA genes.

The BVDV gene is a fragment of approximately 744 base pairs (signal sequence of 63 bp + 681 bp coding sequence) EcoRI to BamH1 synthesized by reverse transcription (RT) and polymerase chain reaction using RNA from the BVDVl strain -Singer. The upstream primer (5 '-CCATGAATTCGCTGGAAAAAGCATTGCTGGCATGGGC-3'; 8 / 96.3) is synthesized from the 5 'end of the BVDV E gene signal sequence and introduces an EcoRI site at the 5' end of the gene. The primer down (5'TTCGGATCCTTACGCGTATGCTCCAAACCACGT-3 '; 8 / 96.4) is synthesized from the 3 'end of the E gene and introduces a BamH1 site at the 3' end of the gene. The PCR product was digested with EcoRi and BamHl to give a fragment of 744 base pairs in length corresponding to the E gene of BVDV 1.

REFERENCES; I. C. Bertholet, et al., EMBO Journal 5, 1951-1957 (1986). 2. R. A. Bhat, et al., Nucleic Acids Research 17, 1159-1176 (1989). 3. D. A. Boyden, et al., Infection and Immunity 57, 3808-3815 (1989). 4. D. B. Boyle and B. E. H. Coupar, Virus Research 10, 343-356 (1988). 5. R. M. Buller, et al., Nature 317, 813-815 (1985). 6. K. J. Cremer, et al., Science 228737-739 (1985). 7. A. J. Davidson and B_ .. Moss, J., Mol. Biol. 210, 749-769 (1989). 8. A. J. Davidson and B. Moss, J. Mol. Biol. 210 771-784 (1989). 9. P. L. Earl, et al., Journal of Virology 64, 2448-2451 (1990). 10. J. J. Esposito, et al., Virology 165, 313 (1988). II. F. A. Ferrari, et al., J. of Bacteriology 161, 556-562 (1985). 12. C. Flexner, et al., Vaccine 8, 17-21 (1990). 13. S. J. Goebel, et al., Virology 179, 247-266 (1990). 14. U. Gubler and B. J. Hoffman, Gene 25, 263-269 (1983). 15. M. A. Innis, and others, PCR Protocols A Guide to Methods and Applications, 84-91, Academic Press, Inc., San Diego (1990). 16. S. Joshi, et al., Journal of Virology. 65, 5524-5530 (1991). 17. L. Kasza, et al., Am. J. Vet. REs. 21, 269-273 (1960). 10 18. L. Kasza, Diseases of S ine, 254-260, Ed. A.D. Leman, and others, The Iowa State University Press, Ames, Iowa (1981). 19. B. G. Klupp and T. C. Mettenleiter, Virology 182, 15 732-741 (1991). 20. U. K. Laemnli, Nature 227, 680-685 (1970). 21. B. Lominiczi, et al., Journal of Virology 49, 970-979 (1984). 22. T. Maniatis, et al., Molecular Cloning: A 20 Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, New York (1982). 23. R. F. Massung, and R.. Moyer, Virology 180, 347-354 (1991). 24. R. F. Massung, and R.. Moyer, Virology 180, 355-25 364 (1991). 25. B. Moss, Science 252, 1662-1667 (1991). 26. E. A. Petrovskis, et al., Journal of Virology 59, 216-223 (1986). 27. A. K. Robbins et al., Journal of Virology 58, 30 339-347 (1986). 28. A. K. Robbins et al., Journal of Virology 61, 2691-2701 (1987). 29. A.C. R. Samson, Journal of Virology 67, 1199-1203 (1986). 30. J. Sambrook, et al., Molecular Cloning A Laboratory Manual Second Edition, Cold Spring Harbor Press, Cold Spring Harbor, New York (1989). 31. Sheffy, et al., Proceedings 65th Annual Meeting of the United States Livestock Association 65, 347-353 (1961). 32. W. M. Schnitzlein and D. N. Tripathy, Virology 181, 727-732, (1991). 33. J. Taylor, et al., Vaccine 9, 190-193, (1991). 34. M. Wachsman, et al., Journal of General Virology 70, 2513-2520 (1989). 35. M. W. Wathen, et al., Journal of Virology 51, 57-62 (1984). 36.. M. Weerasinge, Journal of Virology.65, 5531-553.4. (1991). 37. T. Ben-Porat, et al., Journal of Virology, volume 154, 325-334 (1986). 38. F. Zuckerman, et al., Vaccination and Control of Adjesky's Disease, J. T. Van Oirchot (ed.). Kluwer Academic Publishers, London, pp. 107-117 (1989). 39. Paolette, et al., Journal of Virology, volume 66, pp. 3424-3434 (June, 1992). 40. M. W. Mellencamp, et al., Journal of Clinical Microbiology, volume 27, pp. 2208-2213 (1989) 41. L. A. Herzenberg, et al., Selected Methods in Cellular Immunology, Freeman Publ. Co., San Francisco, 351-372 (1980). 42. Katz et al., Journal of Virology 64, 1808-1811 (1990). 43. Taniguchi, T., and others Biochem. Biophys. Res. Commun. 115 1040-1047 (1983). 44. Cochran, M.D. and Macdonald, R.D., WO 93/02104, published February 4, 1993. 45. Galibert, F., et al., Nature 281, 646-650 (1979). 46. Thomsen, D.R. , and others, Proc. Natl. Acad. Sci. USA 81, 659-663 (1984). 47. Catalog Number 267402, Beckman Instruments, Inc., Fullerton California. 48. Whalley, J.M., et al., Journal of General Virology 57 307-323 (1981). 49. Collet, M.S., et al., Virology 165 200-208 (1988). 50. Schodel, F. et al., Journal of Virology 66, 106-114 (1992). 51. Cochran, M.D. , WO 93/25665, published on December 23, 1993. 52. C.A. Hjerpe, The bovine Respiratory Disease Complex. Ed. By J.L. Howard, Philadelphia, W.B. Saunders Co., 670-680 (1986). 53. F. Fenner, et al., Veterinary Virology. Academic Press, Inc., Orlando Florida, 183-202 (1987). 4. A. Leutz, et al., EMBO Journal 8: 175-182 (1989). 55. M.J. Sekellick, et al., Journal of Interferon Research 14; 71-79 (1994). 56. S.J. Child, et al., Virology 174: 625-629 (1990). 57. G.P. Johnson, et al., Virology 196: 381-401 (1993). 58. R.F. Massung, and others Virolory 201; 215-240 (1994). 60. Child, S.J. and others, Virology 174, 625-629 (1990). 61. T.R. Phillips, et al., J. Virology 64, 4605-4613 (1990). 62. Digby, M.R. , and Lowenthal, J.W. , Journal of Interferon and Cytokine Research 15; 939 (1996). 63. G.J. Winston et al., Proc. Natl. Acad. Sci. USA 90: 1272 (1993). (1) GENERAL INFORMATION: 459 SEQUENCE LIST (i) APPLICANT: Cochran Ph.D., Mark D Junker MS, David E (ii) TITLE OF THE INVENTION: ERUPTIVE OR PULMONARY DISEASE VIRUS OF RECOMBINANT PIG (iii) NUMBER OF SEQUENCES: 101 (iv) CORRESPONDENCE DIRECTION: (A) SENDER: John P. White (B) STREET: 1185 Avenue of the Americas (OR CITY: New York (D) STATE: New York (E) COUNTRY: USA (F) POSTAL CODE: 10036 (v) READY FORM OF COMPUTER: (A) MIDDLE TYPE: Soft disk (B) COMPUTER: IBM compatible PC (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) PROGRAM: Patent in Release # 1.0, version # 1.25 (vi) DATA CURRENT APPLICATION: (A) APPLICATION NUMBER: (B) SUBMISSION DATE: (C) CLASSIFICATION: (viii) ATTORNEY / AGENT INFORMATION: (A) NAME: White, John P. (B) REGISTRATION NUMBER: 28,678 (ix) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: (212) 278-0400 (B) TELEFAX: (212) 391-0526 (C) TELEX: 422523 (2) INFORMATION FOR SEQUENCE ID No. 1: (i) SEQUENCE CHARACTERISTICS: ( A) LENGTH: 3164 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: genomics (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ) ORIGIN OF THE SOURCE: (A) ORGANISM: Swinepox (B) Virus CEPA: Kasza Strain (ix) FEATURE: (A) NAME / KEY: CDS (B) LOCATION: 1..231 (ix) FEATURE: (A) NAME / KEY: CDS (B) LOCATION: 339..1628 (ix) FEATURE: 460 (A) NAME / KEY: CDS (B) LOCATION: 1683..3161 (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 1: AAT CTT CTC AAT TAT GAT AAT TTT TTA AGA TTA AAA AAT TTA GTA ATG 4B Lys Leu Leu Asn Tyr Asp Asn Phe Leu Arg Leu Lys Asn Leu Val Mee 10 1 5 10 15 TAT GGA TCA CAT ATA GAA AAT ATT ATC AAA AAT ACA TAT ATG TAT TAT 96 Tyr Gly Ser His He Glu Asn He He Lys Asn Thr Tyr Met Tyr Tyr 15 20 25 30 TCT AAC ATT GAT AAA GCG ATT TAT GTA ATT ATG AAG CAC TGC AAG AAA 144 Ser Asn He Asp Lys Wing He Tyr Val He Met Lys His Cys Lys Lys 35 40 45 20 CAT AGT TAC TGG ATG AGG ATT CCT ATA GAA ATA CAA CGA TAT ATA TTA 192 His Ser Tyr Trp Met Arg He Pro He Glu He Gln Arg Tyr He Leu 25 50 55 60 TTA CAT TTA ACA ATG AAG GAC TTA TCA ATA ATA CTT AAG TAATAATGTC 241 Leu His Leu Thr Met Lys Asp Leu Ser He He Leu Lys 65 70 75 30 ATAATATTGA AAAAAAATTT TTTTTCTAGT AATGTGGCTA TTATTAGTAG CCCATGAATA 301 CATTTTGGTT ATCGTTTAAA TAGTTTGTAA GAAGGAA ATG GAT AAT ATA AGA AGA 356 ,, - Met Asp Asn He Arg Arg "" 1 5 ATA ATA TCA AAT ATA AAA CAO GAT GAT AAT ATA GCC ACT GAT ATG TTA 404 lie He As As He He Lys Gln Asp? sp Asn He Wing Thr Asp Met Leu ... 0 0 15 20 GCT ACA TTT TTA AGT TCA TCG TTG CAC GTA TTT AAA TTA AAA GAG TTG 452 - Thr Wing Phe Leu Ser Ser Leu His Val Phe Lys Leu Lys Glu Leu 25 • 30 35 5 AAA GAA ATT GTA TTA TTA CTG CTT AAT AAA GGT GCT AAT TTA AAT GGG 500 Lys Glu He Val Leu Leu Leu Leu Asn Lys Gly Wing Asn Leu Asn Gly 40 45 50 0 ATA TCT ATA TAT GAT AAA ACA CCA TTT CAT TGT TAT TTT ACA TTT AAT 548 He Ser He Tyr Asp Lys Thr Pro Phe Hiss Cys Tyr Phe Thr Phe Asn 55 60 65 70 5 ACG AAT GTT ACA ATT AAA GTA ATA AAG TTT CTT IATT TAT CAT GGT GGT 596 Thr Asn Val Thr He Lys Val He Lys Phe Leu He Tyr His Gly Gly 75 80 85 GAC ATT AAC AGT GTA CAT AGA TGT GAC GAC ACC ATA TTG CAT AAA TAC 644 0 Asp lie Asn Ser Val His Arg Cys Gly Asp Thr He Leu His Lys Tyr 90 95 100 CTT GGT AAT GAG AAT ATA GAT TAT AAA GTT GTT GAG TTT TTA ATA AGA 692 Leu Gly Asn Glu Asn He Asp Tyr Lys Val Val Glu Phe Leu He Arg 5 105 110 115 AAA GGA TTT GAT GTA TGT AAA CTA AAT AAT AGT CTG AAG AAT CCT ATT 740 Lya Gly Phe Asp Val Cys Lys Leu Asn Asn Ser Leu Lys Asn Pro I have 120 125 130 CAT ATA TTT ACA ATT AGA CAC ATC AAT AAC ACT AAT TTA AAT ATA TTG 788 His He Phe Thr He Arg His He Asn Asn Thr Asn Leu Asn He Leu 135 140 145 150 AAT TTG CTT TGT TCG CAT ATA AAA CAT GAA TAT AAT AAA AAT G AT GAA 836 Asn Leu Leu Cys Ser His lie Lys His Glu Tyr Asn Lys Asn Asp Glu 155 160 165 ATG ATG TCG ATA TTA AAC ACG ATG TTA AAC TAT TGT CAC GAC TAT 884 Met Met Ser He Leu Asn Thr Met Leu Asn Tyr Cys His Asp Asp Tyr 170 175 180 ACA TGT TTG TCG GCG GTC CCA TAT ACT ATA GAT ATC ACA ACC ATA AAC 932 Thr Cys Phe Ser Wing Val Pro Tyr Thr He Asp He Thr Thr He Asn 185 190 195 TAT AGA GAT AAA TTA GGA TAT TCT CCT GTT GTG TAT GCA TCT ACC ACG 980 Tyr Arg Asp Lys Leu Gly Tyr Ser Pro Val Val Tyr Ala Ser Thr Thr 200 205 210 GAT AAA ACT ATC TTG GTG GAT TAT CTT ATT AAA TTA GGA GCA AAC ATG 1028 Asp Lys Thr He Leu Val Asp Tyr Leu He Lys Leu Gly Wing Asn Met 215 220 225 230 AAC ATA ACA ACG AAC GAT GGT AAT ACA TGT GGT TCG TTT GCT GTA ATG 1076 Asn He Thr Thr Asn Asp Gly Asn Thr Cys Gly Ser Phe Ala Val Met 235 240 245 AAT TGT AAC AGG GAT ATT AAT AGA CTA TTT CTT AAT CAA AAT CCA AAT 1124 Asn Cys Asn Arg Asp He Asn Arg Leu Phe Leu Asn G n Asn Pro Asn 250 255 260 ATA GAA ACT ATA TAT AAT ACA TTG AA G ATA TTA TCG. GAG AAT ATA GTA 1172 He Glu Thr He Tyr Ásn Thr Leu Lys He Leu Ser GÍu Asn He Val 265 270 - - - 275 TTC ATA GAC GTA TGT GAT GTA CGT ACG AAT ATG GTT AAA AAA ATA CTA 1220 Phe He Asp Gly Cys Asp Val Arg Thr Asn Met Val Lys Lys He Leu 280 285 290 ATG TAC GGA TTT ACT TTA GAT CCA CTA TTT TAC AAG AAC CAC GAT ATC 1268 Met Tyr Gly Phe Thr Leu Asp Pro Leu Phe Tyr Lys Asn His Asp He 295 300 305 310 ATT GTT GAA TAT TTT TCA AGT ATT AAA AAG TAT AAT AAT ATT ATT 1316 He Val Glu Tyr Phe Ser Ser He Lys Lys Tyr Asn Lys He He 315 '320 325 TTA CA CA ATG ATC GAT AAA ATT GGG AAT AGA TCC GTA TAC GAT ATT 1364 Leu Gln Met He Asp Glu Lys He Gly Asn Arg Ser Val Tyr Asp He 330 335 340 ATA TTT ACT AAA TCA AAT ACA GGT ATG GAT GTT AGA TAT GTA TGT AAT 1412 He Phe Thr Lys Ser Asn Thr Gly Met Asp Val Arg Tyr Val Cys Asn 345 350 355 GAT ATC ATT ATA AAA TAT GCA AGT GTT AAA TAT TAT GAT TCT TTA ATA 1460 Asp He He He Lys Tyr Ala Ser Val Lys Tyr Tyr Gly Ser Leu He 360 365 370 AAA CGT TTG ATA TAT CAT T CT AAG AAA AGG AAG CGA AAT ATA TTA AAA 1508 Lys Arg Leu He Tyr His Ser Lys Lys Arg Lys Arg Asn He Leu Lys 375 380 385 390 GCT ATA CAT GCG ATG GAG AAT AAC ACA ACC TTG TGG AAT TAC CTA CCA 1SS6 Wing He His Wing Met Glu Asn Asn Thr Thr Leu Trp Asn Tyr Leu Pro 395 400 405 TTG GAA GTA AAA ATG TAT ATT ATG GAT TTC TTA CCC GAT ACT GAT ATA 1604 Leu Glu Val Lys Met Tyr He Met Asp Phe Leu Pro Asp Thr Asp He 5 1i 415 420 ACT AAC ATT CTT TTT ATG AAA AAA TGAAAATATA TACATAAGAC AGGGAAT CC 1658 Thr Asn He Leu Phe Met Lys Lys 425 430 10 TATTGTTTTT TTATATAGGG GAAA ATG GAT AAT CTA TAC CGA TAT ATT ACT 1709 Met Asp Asn Leu Tyr Arg Tyr He Thr 1 5 GTA TCC GAT ACA GTG GAC GTA GAT AAT GTA AGA AAA TTA TTA TCT TCG 1757 Val As Asp Thr Val Asp Val Asp Asn Val Arg Lys Leu Leu Ser Ser 10 15 20 25 20 TGT AAT ATC GAC GTC GTC TCT ACA ATA TTT CAA AAA TAT CTT CAT AGA 1805 Cys Asn He Asp Val Val Ser Thr He Phe Gln Lys Tyr Leu His Arg 30 35 40 AAC GAT ATT AAA TTA GAT ATC GTT GAA GAG TTT GTG AAT AAC GGA GCT 1853 25 Asn Asp He Lys Leu Asp He Val Glu Glu Phe Val Asn Asn Gly Ala 45 50 55 AAA CTG AAT GGG AAA GAT TTT AAC GAT AAA AAT ATA CCA TTG TGT ACA 1901 Lys Leu Asn Gly Lys Asp Phe Asn Asp Lys Asn He Pro Leu Cys Thr ü 60 65 70 TTA TTA TCT AAT AAA TTC ATA GAT TAT AAT AGT GCC ATC GAT ATA ACA 1949 Leu Leu Being Asn Lys Phe He Asp Tyr Asn Being Wing He Asp He Thr 35 75 80 85? GT TTT ATG ATT ACA CAT GGA GCG GAT ATA AAT AAG AGA AT AAG GAT 1997 Being Phe Met He Thr Sis Gly Wing Asp He Asn Lys Arg Asn Lys? Sp 90 95 100 105 40 GGG CGT ACT CCT ATA TTT TGT TTA CTA CAT AAT TCT ACA TTA AAT AAT 2045 Gly Arg Thr Pro He Phe Cys Leu Leu His Asn Ser Thr Leu Asn Asn 110 115 120 45 TTA GAA TTT GTA TCT TTT ATG ATA GAC CAT GGT GCA GAT ATT ACA ATA 2093 Leu Glu Phe Val Ser Phe Met He Asp His Gly Wing Asp He Thr He 125 130 135 GTT GAT GGA TTC GGG TTC ACA TCA TTA CAA ATA TAT TTA CAÁ TCA TCA 2141 50 Val Asp Gly Phe Gly Phe Thr Ser Leu Gln He Tyr Leu Gln Ser Ser 140 • 145 150 AAT GTA CA TTA GAT TTG GTT GAG TTA TTG ATA CAA AAG GGG GTC GAT 2X89 5t? Sn Val Gn Leu Asp.Leu Val Glu Leu Leu He Gln Lys Gly Val Asp 155 160 165 GTA AAT ATA CAT AAT AAT TGT TTC TAT TAT AAT ACA TTA CAT TGT TAT 2237 Val Asn He His Asn Asn Trp Phe Tyr Tyr Asn Thr Leu His Cyß Tyr 60 170 175 180 185 ATA AAG AAA AAT TAT AAC CGT ATT AAT ATG GAT ATT ATA AAA TAT ATA 2285 Lys Lys Asn Tyr Asn Arg He Asn Met Asp He He Lys Tyr He 190 195 200 65 ATG GAC AAT GGA TTT ACA ATT AAT GAG AAT AAA TTT ACC AAA TCA ACA 2333 Het Asp Asn Gly Phe Thr He Asn Glu Asn Lys Phe Thr Lys Ser Thr 205 210 215 TTT TTA GAT ATA TTG GTA TCA ATT ATT GAT AGT AAA AAC TTT GAC TCA 2381 Phe Leu Asp He Leu Val Ser He He Asp Ser Lys Asn Phe Asp Ser 220 225 230 AAC GTT GTT GAT TTT ATA TTA AAA TAT ATT GAT ATT AAT GAA AAG AAT 2429 Asn Val Val Asp 'Phe Lie Leu Lys Tyr He Asp He Asn Glu Lys Asn 235' 240 245 ATT TTT GAT TTT ACG CCA TTA TAC TGT TCT GTA GAT GAT AAT AAT GAA 2 77 He Phe Asp Phe Thr Pro Leu Tyr Cys Ser Val Asp Wing Asn Asn Glu 250 255 260 265 AAG ATG TGT TCT TAT TTA CTA AAA AAG AAT GCA GAC CCT AAT ATT ATC 2525 Lys Met Cys Ser Tyr Leu Leu Lys Lys Asn Wing Asp Pro Asn He He 270 275 280 ACA GTA TTT GGT GAA ACG TGT ATA CTA ACA GCT ATC AAT AAT CAT AAT 2573 Thr Val Phe Gly G? U Thr Cys He Leu Thr Ala He Asn Asn His Asn 285 290 295 AAA AAT ATA TTA TAT AAA CTA TTA AAT TAT GAT ATA ATA TA TA 2621 Lys Asn He Leu Tyr Lys Leu Leu Asn Tyr Asp He Asp He Asn Thr 300 305 310 ATC CAA AAT ACA TTA TTT AAA CTG GAA CAA GAT ATT ATT AAC TCT ACC 2669 He Gln Asn Thr Leu Phe Lys Leu Glu Gln Asp He He Asn Ser Thr 315 320 325 ATA GAT ACT TAC TAT TAT AAT AAT CTT GTT AAA AAA GAA CAT TTT ATA 2717 He Asp Thr Tyr Tyr Tyr Asn Asn Leu Val Lys Lys Glu His Phe He 330 335 340 345 AAA TTA TTT CTA GCC TAC AT? GTT AAG AG TAT GAA AAA AAT AT? GG? 2765 Lys Leu Phe Leu Ala Tyr He Val Lys Arg Tyr Glu Lys? Sn He Gly 350 35S 360? T? TTA TTT CTT GAT TAT CCC ACT CTT GGT GAA TAT TTC GTG AAA TTT 2813 He Leu Phe Leu Asp Tyr Pro Thr Leu Gly Glu Tyr Phe Val Lys Phe 365 370 375 ATA GAT ACG TGT ATG ATG GAA ATA TTT GAG? TG ??? TC? GAT AAG GCT 2861 He Asp Thr Cys Met Met Glu He Phe Glu Met Lys Ser Asp Lys Wing 380 385 390 GGT AAT ACG GAT ATA TAT TCT ATT ATA TTT ACG AAT AAG TAT ATT CCT 2909 Gly Asn Thr Asp He Tyr Ser He He Phe Thr Asn Lys Tyr He Pro 395 400 405 ATC CCA TAT ATA ACG TGT A? AAG CTA A? G AAA TAC GA? TTC TTT GTT 2957 Lie Pro Tyr He Thr Cys Lys Lys Leu Lys Lys Tyr Glu Ser Phe Val 410 419 420 425 GTA TAT GGA ACC GAA ATA AAA TCA ATA ATA AAA TCT TCA AAG ATT AGA 3005 Val Tyr Gly Thr Glu. He Lys Ser He He Lys Ser Ser Lys He Arg 430 435 440 TAT GCG AGT GTT ATA AAA GTA ACG GAG TAT ATC ACA TCT ATC TGT TCG 3053 Tyr Ala Ser Val He Lys Val Thr Glu Tyr He Thr Ser He Cys Ser 445 450 455 GAA ACT AGT TTA TGG AAC AGC ATC CCA ATT GAG AT? AAA CAT AAG 3101 Glu Glu Thr Ser Leu Trp Asn Ser He Pro He Glu He Lys His Lys 460 465 470 ATT ATT AAT AAT ATA AAT AAT CAT GAT ATG TAT ATA TTA TAT AAA AAT 3149 He He As Asn As Asn His Asp Met Tyr He Leu Tyr Lys Asn 475 480 485 AGA AAA AAA AAA TAA 3 64 Arg Lys Lys Lys 490 (2) INFORMATION FOR SEQUENCE ID No. 2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 77 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 2: Lys Leu Leu Asn Tyr Asp Asn Phe Leu Arg Leu Lys Asn Leu Val Met 1 5 10 15 Tyr Gly Ser His He Glu Asn He lie Lys Asn Thr Tyr Met Tyr Tyr 20 25 30 Ser Asn He Asp Lys Wing He Tyr Val He Met Lys His Cys Lys Lys 35 40 45 His Ser Tyr Trp Met Arg He Pro He Glu He Gln Arg Tyr He Leu 50 55 60 Leu His Leu Thr Met Lys, Asp Leu Ser He He Leu Lys (2) 65INFORMATION FOR L.75ECUENCE ID No. 3:75 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 430 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: - proteine '' (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 3: Met Asp Asn He Arg Arg He He Ser Asn He Lys Gln Asp Asp Asn 1 5 10 15 He Wing Thr Asp Met Leu Wing Thr Phe Leu Being Ser Leu His Val 20 25 30 Phe Lys Leu Lys Glu Leu Lys Glu He Val Leu Leu Leu Asu Lys 35 * 40 45 Gly Wing Asn Leu? Sn Gly He Ser He Tyr Asp Lys Thr Pro Phe Hiß 50 55 60 Cys Tyr Phe Thr Phe Asn Thr Asn Val Thr He Lys Val He Lys Phe 65 70 75 80 Leu He Tyr His Gly Gly Asp He Asn Ser Val His Arg Cys Gly? Sp 85 90 95 Thr He Leu His Lys Tyr Leu Gly? Sn Glu? Sn He? Sp Tyr Lys Val 100 05 110 Val Glu Phe Leu He? Rg Lys Gly Phe? Sp Val Cys Lys Leu? Sn? Sn 115 120 125 Ser Leu Lys? Sn Pro He His He Phe Thr He? Rg His He? Sn? Sn 130 135 140 Thr Asn Leu Asn He Leu Asn Leu Leu Cys Ser His He Lys His Glu 145 150? C c 155 160 Leu Asn 175 Thr He Pro Val Val Tyr? The Ser Thr Thr Asp Lys Thr He Leu Val Asp Tyr Leu He 210 215 220 15 Lys Leu Gly Wing Asn Met Asn He Thr Thr Asn Asp Gly Asn Thr Cys 225 230 235 240 Gly Ser Phe Ala Val Met Asn Cys Asn? Rg? Sp He? Sn? Rg Leu Phe 245 250 255 Leu Asn Gln Asn Pro Asn He Glu Thr He Tyr? Sn Thr Leu Lys He 260 265 270 25 Leu Ser Glu? Sn He Val Phe He? Sp Gly Cys? Sp Val? Rg Thr Asn 275 280 285 • Met Val Lys Lys He Leu Met Tyr Gly Phe Thr Leu Asp Pro Leu Phe 290 295 300 30 Tyr Lys Asn His Asp He He Val Glu Tyr Phe Ser Ser He Lys 305 310 315 320 Lys Tyr? Sn Lys He He Leu Gln Met He Asp Glu Lys He Gly Asn 325 330 335 Arg Ser Val Tyr Asp He He Phe Thr Lys Ser Asn Thr Gly Met Asp 340 - "" 345"- ~ 35Q 40 Val Arg Tyr Val Cys Asn Asp He He He Lys Tyr Ala Ser Val Lys 355 360 365 Tyr Tyr Gly Ser Leu He Lys Arg Leu He Tyr His Ser Lys Lys Arg 45 370 375 380 Lys Arg Asn He Leu Lys Wing He His Wing Met Glu Asn? Sn Thr Thr 385 390 395 400 < 50 Leu Trp? Sn Tyr Leu Pro Leu Glu Val Lys Met Tyr He Met Asp Phe 405 410 415 Leu Pro? Sp Thr fep He Thr? Sn He Leu Phe Met Lys Lys 420 425 430 55 (2) INFORMATION FOR THE SEQUENCE? ID No. 4: (i) SEQUENCE CHARACTERISTICS: 60 (A) LENGTH: 493 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein 65 (i) SEQUENCE DESCRIPTION: SEQUENCE ID No. 4: Met Asp Asn Leu Tyr Arg Tyr He Thr Val Ser Asp Thr Val? Sp Val 1 5 10 5 Asp Asn Val Arg Lys Leu Leu Ser Ser Cys Asn lie Asp Val Val Ser 20 25 30 Thr He Phe G n Lys Tyr Leu His Arg? sn? sp He Lys Leu? sp He. 35 40 45 Val Glu Glu Phe Val? Sn? Sn Gly? The Lys Leu? Sn Gly Lys? Sp Phe 50 55 60 Asn Asp Lys Asn He Pro Leu Cys Thr Leu Leu Ser Asn Lys Phe He 65 70 75 80 Asp Tyr? Sn Ser? La He? Sp He Thr Ser Phe Met He Thr His Gly 85 90 95? La? Sp He? Sn Lys Arg Asn Lys Asp Gly Arg Thr Pro He Phe Cys 100 IOS 110 Leu Leu His? Sn Ser Thr Leu? Sn? Sn Leu Glu Phe Val Ser Phe Met 115 120 125 He Asp His Gly Wing Asp He Thr He Val Asp Gly Phe Gly Phe Thr 130 135 140 Ser Leu G n He Tyr Leu Gln Ser Ser Asn Val Gln Leu Asp Leu Val 145 150 155 160 Glu Leu Leu He Gln Lys Gly Val Asp Val? Sn He His? Sn? Sn Trp 165 170 17S Phe Tyr Tyr? Sn Thr Leu His Cys Tyr He Lys Lys? Sn Tyr? Sn? Rg 180 185 190 He? Sn Met? Sp He He Lys Tyr lie Met Asp Asn Gly Phe Thr II * 195 200 205 Asn Glu Asn Lys Phe Thr Lys Ser Thr Phe Leu? Sp He Leu Val Ser 210 215 220 He He? Sp Ser Lys? Sn Phe? Sp Ser? Sn Val Val? Sp Phe He Leu 225 230 235 240 Lys Tyr He? Sp He? Sn Glu Lys? Sn He Phe? Sp Phe Thr Pro Leu 245 250 255 Tyr Cys Ser Val? Sp Wing Asn? Sn Glu Lys Met Cys Ser Tyr Leu Leu 260 265 270 t Lys Lys? Sn? La? Sp Pro? Sn He He? Nr Val Phe Gly Glu Thr Cys 275 280 285 He Leu Thr? La He Asn Asn His Asn Lys? Sn He Leu Tyr Lys Leu 290 295 300 Leu ? sn Tyr? sp He? sp He? sn Thr He Gln? sn Thr Leu Phe Lys 305 310 315 320 Leu Glu Gln? Sp He He? Sn Ser Thr He? Sp Thr Tyr Tyr Tyr? Sn 325 330 335 Asn Leu Val Lys Lys Glu His Phe He Lys Leu Phe Leu? The Tyr He 340 345 350 Val Lys? Rg Tyr Glu Lys? Sn He Gly He Leu Phe Leu? Sp Tyr Pro 355 360 365 Thr Leu Gly Glu Tyr Phe Val Lys Phe He? S Thr Cys Met Met Glu 370 375 380 467 He Phe Glu Met-'Lys Ser Asp Lys Ala Gly Asn Thr Asp He Tyr Ser 385 390 395 400 He He Phe Thr Asn Lys Tyr He Pro He Pro Tyr He Thr Cys Lys 405 410 415 Lys Leu Ly3 Lys Tyr Glu Ser Phe Val Val Tyr Gly Thr Glu He Lys 420 425 430 Ser He He Lys Ser Ser Lys He Arg Tyr Ala Ser Val lie Lys Val 435 440 445 Thr Glu Tyr He Thr Ser He Cys Ser Glu Glu Thr Ser Leu Trp Asn 450 455 460 Ser He Pro He Glu He Lys His Lys He He? Sn? Sn He? Sn? Sn 465 470 475 480 His Asp Met Tyr He Leu Tyr Lys Asn Arg Lys Lyß Lyß 485 490 (2) INFORMATION FOR L? SECUENCI? ID No. 5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 3295 base pairs (B) TYPE: nucleic acid (C) CEPA: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: RNA (genomic) (iii) HYPOTHETICAL: NO (ÍV) ANTI-SENTIDO ^? KT "" '7 -Y ""' - (vi) ORIGIN OF THE SOURCE: (A) ORGANISM: Porcine Reproductive and Respiratory Virus (B) CEPA: IA- 2 Strain (NVSL) (ix) FEATURE: (A) NAME / KEY: CDS (B) LOCATION: 47..814 (ix) FEATURE: (A) NAME / KEY: CDS (B) LOCATION: 670..1431 ( ix) FEATURE: (A) NAME / KEY: CDS (B) EOCACION: 1215.17481 (ix) CHARACTERISTIC: (A) NAME / KEY: CDS (B) LOCATION: 1762.2361 (ix) FEATURE: (A) NAME / KEY: CDS (B) LOCATION: 2349.2870 (ix) FEATURE: (A) NAME / KEY: CDS (B) LOCATION: 2863..3231 (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 5: GTA ATG GAT AT.G GTT GAT TAT ATA TCT ACT AAC ATT CTT AAA TAC CAT 3003 Val Met Asp Met Val Asp Tyr He Ser Thr Asn He Leu Lys Tyr His 430 * 435 440 A ?? C? A TT? TAT G? T AA? TG? GT? CG TTT GAA TAT AAA CGA GAT ATT 3051 Lys Gln Leu Tyr Asp Lys Met Ser Thr Phe Glu Tyr Lys Arg Asp He 445 450 455 AAA TCA TGT AAA TGC TCG AT? TGT TCC GAC TCT AT? ? CA C? T CAT ATA 3099 Lys Ser Cys Lys Cys Ser lie Cys Ser Asp Ser He Thr His His He 460 465 470 475 TAT GA? ? C ACA TCA TGT? T? T TAT AAA TCT ACC GAT? AT G? T CTT 3147 Tyr Glu Thr Thr Ser Cys He? Sn Tyr Lys Ser Thr? Sp? Sn? Sp Leu 480 485 490 ATG ATA GTA TTG TTC AAT CTA ACT AGA TAT TTA ATG CAT GGG ATG AT? 3195 Met He Val Leu Phe? Sn Leu Thr? Rg Tyr Leu Met His Gly Met He 495 500 505 CAT CCT A? T CTT? TA? GC GT? AA? GG? TGG GGT CCC CTT ATT GGA TTA 3243 His Pro Asn Leu He Ser Val Lys Gly Trp Gly Pro Leu He Gly Leu 510 515 520 TTA ACG GGT GAT? T? GGT? TT ?? T TT? AAA CTA TAT TCC ACC ATG? AT 3291 Leu Thr Gly Asp He Gly He Asn Leu Lys Leu Tyr Ser .Thr Met? Sn 525 530 535 ATA AAT GGG CTA CGG TAT GGA ATT ACG TTA TCT TCA TAC GAT ATG 3339 He Asn Gly Leu Arg Tyr Gly Asp He Thr Leu Ser Ser Tyr Asp Met 540 545 550 555 AGT AAT A ?? TT? GTC TCT? TT? TT ?? T ACA CCC AT? TAT GAG TTA AT? 3387 Ser Asn Lys Leu Val Ser He He? Sn Thr Pro He Tyr Glu Leu He 560 565 570 CCG TTT? CT? C? TGT TGT TCA CTC A? T GAA T? T T? T TCA A ?? ? TT GTG 3435 Pro Phe Thr Thr Cys Cys Ser Leu Asn Glu Tyr Tyr Ser Lys He Val 575 580 585 ATT TTA ATA ATA GTT ATT TTA GAA TAT ATG ATA TCT ATT ATA TTA TAT 3483 He Leu He Asn Val He Leu Glu Tyr Met He Ser He He Leu Tyr 590 595 600 AGA ATA TTG ATC GTA A ?? ? G? TTT ?? T AAC ATT ??? GA? TTT? TT TC? 3531? Rg He Leu He Val Lys? Rg Phe Asn Asn He Lys Glu Phe He Ser 605, 610 615 AAA GTC GTA ?? T? CT GT? CT? G ?? TC? TCA GGC AT? T? T TTT TGT C? G 3579 Lys Val Val? Sn Thr Val Leu Glu Ser Ser Gly He Tyr Phe Cys Gln 620 625 630 635? TG CGT GT? C? T G ?? CAA ATT G? A TTG GAA ATA GAT GAG CTC ATT ATT 3627 Met Arg Val His Glu Gln He Glu Leu Glu He Asp Glu Leu He He 640 645 650? AT GGA TCT ATG CCT GTA C? G CTT? TG CAT TTA CTT CTA A? G GT? GCT 3675? Sn Gly Ser Met Pro Val Gln Leu Met His Leu Leu Leu Lys Val? 655 660 665 ACC ATA ATA TTA GAG GAA ATC A? GAA ATA TAACGT? TTT TTTCTTTT ?? 3725 Thr He He Leu Glu Glu He Lys Glu He 670 675 ATAAATAAA? ? T? CTTTTTT TTTT? AAC ?? GGGGTGCT? C CTTGTCTAAT TGTATCTTGT 3785 ATTTTGGATC TG? TGCAAGA TTATT? AAT? ? TCGTATGA? AGTAGT? G AT? TAGTTTA 384 * MISSING AT THE TIME OF PUBLICATION 15 20 25 30 35 40 45 50 55 60 65 70 75 Pro Phe Thr Leu Ser? Sn Tyr? Rg? Rg Ser Tyr Glu? The Phe Leu Ser 65 70 75 80 Gln Cys Gln Val Asp He Pro Thr Trp Gly Thr Lys His Pro Leu Gly - • 85 90 95 Met Phe Trp His His Lys Val Ser Thr Leu He Asp Glu Met Val Ser 0 100 105 110 Arg Arg Met Tyr Arg He Met Glu Lys Ala Gly Gln Ala Ala Trp Lys 115 120 125 S Gln Val Val Ser Glu Ala Thr Leu Ser Arg He Ser Ser Leu Asp Val 130 135 140 0 Val Ala His Phe Gln His Leu Ala Ala He Glu Ala Glu Thr Cys Lys 145 150 155 160 Tyr Leu Wing Being Arg Leu Pro Met Leu His Asn Leu Arg Met Thr Gly 165 170 175 5 Being Asn Val Thr He Val Tyr Asn Ser Thr Leu His Gln Val Phe Wing 180 185 190 0 He Phe Pro Thr Pro Gly Ser Arg Pro Lys Leu His Asp Phe Gln Gln 195 200 205 Trp Leu He Wing Val His Ser Ser He Phe Ser Ser Val Wing Wing Ser 5 210 215 220 Cys Thr Leu Phe Val Val Leu Trp Leu Arg Val Pro He Leu Arg Thr 225 230 235 240 0 Val Phe Gly Phe Arg Trp Leu Gly Wing He Phe Leu Ser Asn Ser Gln 245 250 255 (2) INFORMATION FOR SEQUENCE ID No. 7: (i) SEQUENCE CHARACTERISTICS: 0 (A) LENGTH: 254 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein 5 (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 7: Q Met Val Asn Ser Cy * s T her Phe Leu His He? E Leu Cys Cys Ser Phe 1 15 Leu Tyr Ser Leuu CCyyss'CCyyss AAllaa VVaall VVaall Ala ßly Ser Asn Thr Thr Tyr 220 2255 30 5 Cys Phe Trp Phe Pro Leu Val Arg Gly Asn Phe Ser Phe Glu Leu Thr 35 40 45 0 Val Asn Tyr Thr Val Cys Pro Pro Cys Leu Thr Arg Gln Wing Wing Wing 55 60 Glu Wing Tyr Glu Pro Gly Arg Ser Leu Trp Cys Arg He Gly Tyr? Sp 5 ° 75 80 Arg Cys Gly Glu? p? sp His? sp Glu Leu Gly Phe Met Val Pro Ser 85 90 9S Gl Leu Ser Ser Glu Gly His Leu Thr Ser Val Tyr? the Trp Leu? la 1 ¿> ? IOS not Phe Leu Ser Phe Ser Tyr Thr? Gln Phe His Pro Glu He Phe Gly "115_" 120 125 He Gly? Sn Val Ser? Rg Val Tyr Val? Sp He Glu His Gln Leu He 130 135 140 He Be Wing Val Phe Gln Thr Tyr Tyr ßln His Gln Val Asp Gly Gly 165 170 175 Asn Trp Phe His Leu Glu Trp Leu Arg Pro Phe Phe Ser Trp Leu 180 185 190 Val Leu Asn Val Ser Trp Phe Leu? Rg? Rg Ser Pro? La? Sn His Val 195 200 205 Ser Val Arg Val Leu Gln Thr Leu Arg Pro Thr Pro Pro Gln Ars Gln 210 215 220 Wing Leu Leu Being Ser Lys Thr Ser Val? Leu Gly He? Thr Ar 225 230 235 240 Pro Leu Arg? Rg Phe Wing Lys Ser Leu Ser Wing Val Aro Ring 245 250 (2) INFORMATION FOR L? SECUENCI? ID No. 8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 178 amino acids __., -. - »- (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 8: Met Ala Ala Ser Leu Leu Phe Leu Met Val Gly Phe Lys Cys Leu Leu 1 S 10 15 Val Ser Gln? The Phe? The Cys Lys Pro Cys Phe Ser Ser Ser Leu? La. 20 25 30 «? S He Lys Thr? Sn Thr Thr? La? The Ser Phe Ala Val Leu Gln 35 * 40 45 i Asp He Ser Cys Leu" Arg His Arg Asn Ser? La Ser Glu? La He? Rg 50 55 60 Lys He Pro Gln Cys Arg Thr Wing He Gly Thr Pro Val Tyr He Thr 65 70 75 80 Thr Thr Ala? Sn Val Thr? Sp Glu? Sn Tyr Leu His Ser Ser Asp Leu 85 90 95 Leu Met Leu Ser Ser Cys Leu Phe Tyr Wing Ser Glu Met Ser Glu Lys 100 105 110 Gly Phe Lys Val Val Phe Gly Asn Val Ser Gly He Val Wing Val Cys 115 120 125 Val Asn Phe Thr Ser Tyr Val Gln His Val? Rg Glu Phe Thr Gl? Arg 130 135 140 Ser Leu Met Val Asp His Val Arg Leu Leu His Phe Met Thr Pro Glu 45 ^ 150 155 160 Thr Met Arg Trp Wing Thr Val Leu? The Cys Leu Phe? The He Leu Leu 165 170 175 Ala He (2) INFORMATION FOR SEQUENCE ID No. 9: (i). SEQUENCE CHARACTERISTICS: (A) LENGTH: 200 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (i) SEQUENCE DESCRIPTION: SEQUENCE ID No. 9: Met Leu Gly Lys ys Leu Thr Wing Gly Cys Cys Ser Arg Leu Leu Ser 1 5 10 is Leu Trp Cys He Val Pro Phß Cys Phe Wing Val Leu Val Asn Wing Asn 20 25 30 Being Asn Being Ser His Leu Gln Leu He Tyr Asn Leu Thr Leu Cys 35 40 45 ßlu Leu Asn Gly Thr Asp Trp Leu Ser Asn Lys Phe Asp Trp Wing Val 50 55. 60 Glu be Phe Val He Phe Pro Val Leu Thr His He Val Ser Tyr Gly 65 70 75 80 Ala Leu Thr Thr Ser His Phe Leu Asp Thr Val Ala Leu Val Thr Val 85 90 95 Be Thr Wing Gly Phe Val His Gly? Rg Tyr Val Leu Ser Ser He Tyr 100 105 110 Wing Val Cys Wing Leu Wing Wing Leu Thr Cys Phe Val He? Rg Phe? The 115 120 125 Lys? Sn Cys Met Ser Trp? Rg Tyr Ser Cys Thr? Rg Tyr Thr? Sn Phe 130 135 140 Leu Leu Asp Thr Lys Gly Arg Leu Tyr Arg Trp Arg Ser Pro Val He 145 150 155 160 He Glu Lys Arg Gly Lys Val Glu Val Glu Gly His Leu He Asp Leu 165 170 17S Lys Arg Val Val Leu? Sp Gly Ser Val Ala Thr Pro He Thr Arg Val 180 185 190 Ser Ala Glu Gln Trp Gly Arg Pro. 195 200 (2) INFORMATION FOR SEQUENCE ID No. 10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 174 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 10: Met Gly Ser - Ser Leu Asp Asp Phe Cys Tyr Asp Ser Thr Ala Pro Gln 1 . 5 10 15 Lys Val Leu Leu Wing Phe Ser He Thr Tyr Thr Pro Val Met He Tyr 20 25 30 Wing Leu Lys Val Ser Arg Gly Arg Leu Leu Gly Leu Leu His Leu Leu 35 40 45 He Phe Leu Asn Cys Wing Phe Thr Phe Gly Tyr Met Thr Phe? The His 50 55 60 Phe Gln Ser Thr? Sn Lys Val? The Leu Thr Met Gly? The Val Val? 65 65 75 75 Leu Leu Trp Gly Val Tyr Ser? He He Glu Thr Trp Lys Phe He Thr 85 90 95 Ser Arg Cys Arg Leu Cys Leu Leu Gly Arg Lys Tyr He Leu Wing Pro 100 ios 110 Wing His His Val Glu Ser Wing Wing Gly Phe His Pro He Ala Wing Asn 115 120 125 Asp Asn His Wing Phe Val Val Arg Arg Pro Gly Ser Thr Thr Val Asn 130 135 140 Gly Thr Leu Val Pro Gly Leu Lys Gly Leu Val Leu Gly Gly Arg Lys 145 150 155 160 Wing Val Lys Gln Gly Val Val Asn Leu Val Lys Tyr Wing Lys 165 170 (2) INFORMATION FOR SEQUENCE ID No. 11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 123 amino acids (B) TYPE: amino acid i (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 11: Met Pro Asn Aan Asn Gly Lys Gln Gln Lys? rg L s Lys Gly? sp Gly 1 5 10 15 Gln Pro Val? Sn G n Leu Cys ain Mßt Leu Oly Lys II * lie Wing ßin 20 25 30 Gln Asn Gln Ser Arg Qly Lys Gly Pro Gly Lys Lys Aßn Lys Lyß Lys 3S 40 45 Asn Pro Glu Lys Pro Hiß Phß Pro Leu Ala Thr Glu Aßp? Sp Val Arg 50 55 60 His His Phe Thr Pro Ser Glu Arg Gln Leu Cys Leu Ser Ser He Gln 65 70 75 80 Thr Wing Phe Asn Gln Gly Al »Gly Thr Cyß Thr Leu Ser Asp Ser Oly 85 90 9S 100 105 110 Arg Leu He Arg Val Thr Ala Ser Pro Pro Wing 115 120 (2) INFORMATION FOR SEQUENCE ID No. 12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 37 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 12: GCGGATCCGG CGCGCCGGAT TTTCCTACAT CTACACT 37 (2) INFORMATION FOR SEQUENCE ID No. 13 1 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18"base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) ) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 13: CTAAAATTGA ATTGTAAT 18 (2) INFORMATION FOR SEQUENCE ID No. 14: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 14: TTGGCGCGCC CTAGSTCTGT GTAGTTGATT GATTTG 36 (2) INFORMATION FOR SEQUENCE ID No. 15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 15: TACGGCGCGC CGGGAAATGC TAAAGCCAAG CCCACA 36 (2) INFORMATION FOR SEQUENCE ID No. 16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 16: TTCGGATCCT GCTCAGACAG TATTGTGTAT GTTATCAAGA GC 42 (2) INFORMATION FOR THIS SEQUENCE ID No. 17: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 17: CCATGAATTC CTTCCCTGAA TGCAAGGAGG GCTTC 35 (2) INFORMATION FOR SEQUENCE ID No. 18: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 18: CGGGATCCTC ACCCGGGCAG CGCGCTGTA 29 (2) INFORMATION FOR SEQUENCE ID No. 19: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) DESCRIPTION OF SEQUENCE: SEQUENCE ID No. 19: CGGAATTCAC AAGGGCCGAC ATTGGCC 27 (2) INFORMATION FOR SEQUENCE ID No. 20: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) DESCRIPTION OF SEQUENCE: SEQUENCE ID No. 20: ATCGGGATCC CGTTATTCTT CGCTGATGGT GG 32 (2) INFORMATION FOR SEQUENCE ID No. 21: • 10 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) CEPA: double 15 (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: DNA. { genomics) (iii) HYPOTHETICAL: NO 20 (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 21: ATCGGAATTC GCGGTGCCTG TTGCTCTGGA TG 32 (2) INFORMATION FOR THE SEQUENCE ID No. 22: 35 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) CEPA: double 40 (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO 45 (iv) ANTI-SENSE: NO 50 (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 22: CTTCGGATCC TCATGCCCCC CCGACGTCGG CCATC 35 55 (2) INFORMATION FOR * THE SEQUENCE? ID No. 23: 60 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) CEPA: double 65 (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA ( gendmica) (iii) HYPOTHETICAL: NO 70 (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 23: TCATGAATTC GGCCGCTCGC GGCGGTGCTG AACGC 35 (2) INFORMATION FOR SEQUENCE ID No. 24: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 24: CGGGATCCCT AGGGCGCGGA GCCGAGGGC 29 (2) INFORMATION FOR SEQUENCE ID No. 25: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 25: CGGAATTCAG GCCCGCTGGG GCGAGCGTGG. 30 (2) INFORMATION FOR SEQUENCE ID No. 26: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 3537 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) DESCRIPTION OF SEQUENCE: SEQUENCE ID No. 26:TCATGCCCCC CCGACGTCGG CCATC 35 (2) INFORMATION FOR SEQUENCE ID No. 27: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 27: TCATGAATTC CGCCGCTCGC GGCGGTGCTG AACGC 35 (2) INFORMATION FOR SEQUENCE ID No. 28: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 28: CGGGATCCTT AATATAATTT TCTAGGTGCT AGTTG 35 (2) INFORMATION FOR SEQUENCE ID No. 29: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 base pairs (B) TYPE: * nucleic acid (C) CEPA: double '(D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (i) SEQUENCE DESCRIPTION: SEQUENCE ID No. 29: CGGAATTCGA TGAGTGATGG AGCAGTTCAA 30 (2) INFORMATION FOR THE SEQUENCE ID No. 30: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 30: CGGGATCCTT AATATAATTT TCTAGGTGCT AGTTG 35 (2) INFORMATION FOR SEQUENCE ID No. 31: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE ISSUE: SEQUENCE ID No. 31: CGGAATTCGA TGAGTGATGG AGC? GTTCA? 30 (2) INFORMATION FOR SEQUENCE ID No. 32: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendptica) (iii) HYPOTHETICAL * NO i (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 32: CGGGATCCTT AATATAATTT TCTAGGTGCT AGTTG 35 (2) INFORMATION FOR SEQUENCE ID No. 33: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (i) SEQUENCE DESCRIPTION: SEQUENCE ID No. 33: CGGAATTCTA TGTGTTTTTT TATAGGACTT 30 (2) INFORMATION FOR SEQUENCE ID No. 34: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 34: CGGGATCCTT AATATAATT TCTAGGTGCT AGTTG 35 (2) INFORMATION FOR SEQUENCE ID No. 35: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 35: CGGAATTCTA TGTGTTTTTT TATAGGACTT 30 (2) INFORMATION FOR SEQUENCE ID No. 36: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 36: CGTCAGATCT CAGGAGGTCA TAAGATGCCA TTAG_35_(2) INFORMATION FOR SEQUENCE ID No. 37: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 37: CGTTGAATTC GATGACTTGC CAGACTTACA ACTTG 35 (2) INFORMATION FOR SEQUENCE ID No. 38: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENTIQO: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 38: CGTCGAATTC GATGTCTGGA GCCTCTAGTG GGA 33 (2) INFORMATION FOR SEQUENCE ID No. 39: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 39: CGTCGGATCC GGCTCAAATA GCCGATACTC TTCTT 35 (2) INFORMATION FOR SEQUENCE ID No. 40: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) CEPA:, double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 40: CGTCGAATTC AATGGA? AGT CCA? CGCACC CAAA 35 (2) PAR INFORMATION? L? SECUENCI? ID No. 41: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA. { gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO i (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 41: CGTCGGATCC GGGGACTAA? TGGAATCATA CA 32 (2) INFORMATION FOR SEQUENCE ID No. 42: (i) CHARACTERISTICS OF SEQUENCE: (A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) STRAIN: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO . { xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 42: CGGGSSTTCG GGGTCGTCCT TAGATGACTT CTGCC 35 (2) INFORMATION FOR SEQUENCE ID No. 43: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 38 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO. { iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 43: GCGGATCCTT GTTATGTGGC ATATTTGAC? AGGTTTAC 38 (2) INFORMATION FOR SEQUENCE ID No. 44: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 37 base pairs (B) TYPE: nucleic acid (C) STRAIN: double (D) TOPOLOGY: linear (ii) TYPE DE ?: DNA Molecule (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO '(xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 44: AATGAATTCG AAATGGGGTC CATGCAAAGC CTTTTTG 37 (2) INFORMATION FOR SEQUENCE ID No. 45: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 38 base pairs (B) TYPE: nucleic acid (C) STRAIN: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 45: CAAGGATCCC ACACCGTGTA ATTCACTGTG AGTTCG 36 (2) INFORMATION FOR SEQUENCE ID No. 46: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 37 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 46: GTCGAATTCG CCAAATAACA ACGGCAAGCA GCAGAAG 37 (2) INFORMATION FOR SEQUENCE ID No. 47: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO . { xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 47: CAAGGATCCC AGCCCATCAT GCTGAGGGTG ATG 33 (2) INFORMATION FOR SEQUENCE ID No. 48: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 38 base pairs (B) TYPE: nucleic acid (C) STRAIN: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (ÍV) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 48: TTCGAATTCG GCTAATAGCT GTACATTCCT CCATATTT 38 (2) PAR INFORMATION? L? SECUENCI? ID No. 49: (i) SEQUENCE C? RISTERS ?: (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA. { gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO . { xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 49: GGGGATCCT? TCGCCGT? CG GC? CTG? GGG 30 (2) INFORMATION FOR THE SEQUENCE T? DO NOT. '50: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 34 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) ) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 50: CCGAATTCGG CTGCGTCCCT TCTTTTTCCTC ATßG 34 (2) INFORMATION FOR SEQUENCE ID No. 51: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 38 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA. { genomics) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 51: CTGGATCCTT CAAATTGCCA ACAGAATGGC AAAAAGAC 38 (2) INFORMATION FOR SEQUENCE ID No. 52: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE DE MOLECUL ?: DN? . { genomic) (iii) HYPOTHETICAL: NO (iv)? NTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE? ID No. 52: TTGAATTCGT TGGAGAAATG CTTGACCGCG GGC 33 (2) INFORMATION FOR SEQUENCE ID 53: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 34 base pairs. { B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 53: GAAGGATCCT AAGGACGACC CCATTGTTCC GCTG 34 (2) INFORMATION FOR SEQUENCE ID No. 54: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO 10 MISSING AT THE TIME OF PUBLICATION 20 25 30 35 40 45 50 55 60 65 70 75 (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 54: ATGAAGGCCC TGTACCCCGT CACGA 25 (2) INFORMATION FOR SEQUENCE ID No. 55: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 31 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 55: CGGGATCCGG CTACAGGGCG TCGGGGTCCT C 31 (2) INFORMATION FOR SEQUENCE ID No. 56: (i) SEQUENCE CHARACTERISTICS: (?) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) CEP ?: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 56: CCGGATCCGG CGCGCGACGT GACCCGGCTC 30 (2) INFORMATION FOR SEQUENCE ID No. 57: '(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 34 base pairs. { B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO 225 230 235 240 Asn Met Phe Pro Wing He He Pro Ser Val Asn Asp Phe He Ser Thr 245 250 255 Val Val * Asp "Lys Asp Arg Leu He Asn Met Tyr Gly He Lys Cys Val 260 265 270 Wing Met Phe Ser Tyr Asp He Asn Met He Asp Leu Glu Ser Leu Asp 275 280 285 Asp Ser Asp Tyr He Phe He Glu Lys Asn He Ser He Tyr Asp Val 290 295 300 Lys Cys Arg Asp Phe Wing Asn Met He Arg Asp Lys Val Lys Arg Glu 305 310 315 320 Lys Asn Arg He Leu Thr Thr Lys Cys Glu Asp He He Arg Tyr He 325 330 335 Lys Leu Phe Ser Lys Asn Arg He Asn Asp Glu Asn Asn Lys Val Glu 340 345 350 Glu Val Leu He His He? Sp? Sn Val Ser Lys? Sn? Sn Lys Leu Ser 355 360 365 Leu Ser? Sp He Ser Ser Leu Met? Sp Gln Phe? Rg Leu? Sn Pro Cys 370 375 380 Thr He? Rg? Sn He Leu Leu Ser Ser? The Thr He Lys Ser Lys Leu 385 390 395 400 Leu? The Leu? Rg? The Val Lys Asn Trp Lys Cys Tyr Ser Leu Thr Asn 405 410 415 f! Val Ser Met Tyr Lys Lys He Lys Gly Val He Val Met? Sp Met Val 420 425 430 Asp Tyr He Ser Thr Asn He Leu Lys Tyr His Lys Gln Leu Tyr Asp 435 440 445 Lys Met Ser Thr Phe Glu Tyr Lys Arg Asp He Lys Ser Cys Lys Cys 450 455 460 Ser He Cys Ser Asp Ser He Thr His His He Tyr Glu Thr Thr Ser 465 470 475 480 Cys He Asn Tyr Lys Ser Thr? Sp? Sn? Sp Leu Met He Val Leu Phe 485 490 495 Asn Leu Thr Arg Tyr Leu Met His Gly Met He His Pro Asn Leu- He 500 505 510 Ser Val Lys Gly Trp Gly Pro Leu He Gly Leu Leu Thr Gly Asp He 515 520 525 ßly He? Sn Leu Lys Leu Tyr Ser Thr Met ? sn He? sn Gly Leu Arg 530 * 535 • 540 Tyr Gly? sp He Thr Leu Ser Ser Tyr? sp Mßt Ser? sn Lys Leu Val 545 550 555 560 Ser He He? Sn Thr Pro He Tyr Glu Leu He Pro Phe Thr Thr Cys 565 570 575 Cys Ser Leu? Sn Glu Tyr Tyr Ser Lys He Val He Leu He? Sn Val 580 585 590 He Leu Glu Tyr Met He Ser He He Leu Tyr? Rg He Leu He Val 595 600 605 Lys? Rg Phe Asn Asn He Lys Glu Phe He Ser Lys Val Val Asn Thr 610 615 620 Val Leu Glu Ser Ser Gly He Tyr Phe Cys Gln Met? Rg Val His Glu 625 630 635 640 Gln He Glu Leu Glu He? Sp Glu Leu He He? Sn Gly Ser Met Pro (PEGAR SEQUENCES PAGE 370) (2) INFORMATION FOR SEQUENCE ID No. 59: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 34 base pairs (B) TYPE: "nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) ) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 59: TCGAAGATCT TCTCATGCAA AGGTGGAACC GTTC 34 (2) INFORMATION FOR SEQUENCE ID No. 60: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 34 base pairs (B) TYPE: nucleic acid (C) CEPA: double. { D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (XÍ) SEQUENCE DESCRIPTION: SEQUENCE ID No. 60: TCGAAGATCT CATGCCTATG TTC? CCATCC ACAC 34 (2) PAR INFORMATION? SEQUENCE ID No. 189i (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 3942 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ORIGIN OF THE SOURCE: (A) ORGANISM: Swinepox (B) virus CEPA: Kasza (ix) FEATURE: (A) NAME / KEY: CDS (B) LOCATION: 1.369 (ix) FEATURE: (A) NAME / KEY: CDS (B) LOCATION: 370.597 (ix) FEATURE: (A) NAME / KEY: CDS (B) LOCATION: 598..1539 (ix) FEATURE: (A) NAME / KEY: CDS (B) LOCATION: 1675..3708 (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: Complement (3748.-3942 ) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 189: TGT TTG TTC ATT A? T ?? G ATß GGT GGA GCT ATT ATA GA? TAC AAG ATA 48 Cys Leu Phe He Asn Lys Mee ßly ßly Ala He He ßlu Tyr Lys He 1 5 10 15 96 144 192 240 288 336 GAT GAT GTC GAT ACG TCA TTA TTT A? T GTA TA ?? TG G? T ??? TTG T? T 384? Sp? Sp Val? Sp Thr Ser Leu Phe? Sn Val Met? Sp Lys Leu Tyr 115 120 1 5 GCG GC? ? T? TTC GGC GTT TTT? TG? C? TCT ??? G? T G? T G? T TTT ?? T 432? The? The He Phe Gly Val Phe Met Thr Ser Lys? Sp? Sp? Sp Phe? Sn 10 15 20 ?? C TTT ATA GA? GT GT? To TCT GT? TTA AC? G? T? C? TC? TCT ?? T 480 Asn Phe He Glu Val Val Lys Ser Val Leu Thr Asp Thr Ser Ser Asn 25"30 35 CAT AC? AT? TCG TCG TCC AAT A? T AAT AC? TGG? T? T? T? TA TTT CT? 528 His Thr He Ser Ser Ser? Sn? Sn? Sn Thr Trp He Tyr He Phe Leu. 40 45 50 GCG ATA TTA T T GGT GTT ATG GT? TT? TT? GTT TTT ATT TTG TAT TTA 576? The He Leu Phe Gly Val Met Val Leu Leu Val Phe He Leu Tyr Leu 55 60 65 AAA GTT ACT AAA CCA ACT TAAATG GAG GAA GCA G? T AAC CAA CTC GTT 624 Lys Val Thr Lys Pro Thr Met Glu Glu Wing Asp Asn Gln Leu Val 70 75 1 5 'TTA AAT AGT ATT AGT GCT? G? GC? TT? ?? G GC? TTT TTT GT? TCT ??? 672 Leu Asn Ser He Ser? La? Rg Ala Leu Lys Ala Phe Phe Val Ser Lys 10 15 20 25 ATT AAT GAT ATG GTC GAT G? TT? GTT? CC AA? ??? T? T CC? CCA AAG 720 He Asn Asp Met Val? Sp Glu Leu Val Thr Lys Lys Tyr Pro Pro Lys 30 35 40 AAG AAA TCA CA? ? T? ? AA CTC? T? GAT AC? CG? ? TT CCT? TT G? T CTT 768 Lys Lys Ser Gln He Lys Leu He? Sp Thr Arg He Pro He Asp Leu 45 50 55 ATT AAT C ?? C ?? TTC GTT ??? ? GA TTT? AA CT? GAA A? T T? T ??? AT 816 He Asn Gln Gln Phe Val Lys Arg Phe Lys Leu Glu Asn Tyr Lys Asn 60 65 70 GGA ATT TTA TCC GTT CTT ATC A? T? GT TTA GTC GAA A? T? TT? C TTT 864 Gly He Leu Ser Val Leu He? Sn Ser Leu Val ßlu? Sn? Sn Tyr Phe 75 80 85 G ?? C ?? G? T GGT ??? CTT AAT AGC? GT GAT ATT GAT GAA TTA GTG. CTC 912 Glu Gln Asp Gly Lys Leu Asn Ser As Asp He Asp ßlu Leu Val Leu 90 95 100 105 CCT 960 Pro ??? 1008 Lyß C ?? 1056 Gln GAT 1104 Asp CT? 11S2 Leu 185 TCT GAT GAT CTT TTG AAT AT? CTT CGT G ?? GA TTA TTT AG? TGT CC? 1200 Ser? S Asp Leu Leu Asn He Leu? Rg Glu? Rg Leu Phe? Rg Cys Pro 190 195 200 CAG GTT AAA GAT AAT ACT ATT TCT AGA ACA CGT CTA TAT GAT TAT TTT 1248 Gln Val Lys Asp Asn Thr He Ser Arg Thr Arg Leu Tyr Asp Tyr Phe 205 210 215 ACT AG? GTG TC? AAG AAA GA? G ?? GCG ??? ? T? T? C GTT? T? TTG ??? 1296 Thr? Rg Val Ser Lys Lys Glu Glu? Lys He Tyr Val He Leu Lys 220 -r 225 230 GAT TTA AAG ATT GCT G? T? T? CTC GGT? TC G ?? ? CA GTA ACG AT? GG? 1344 Asp Leu Lys ne Asp He Leu Gly He Glu Thr Val Thr He Gly 235 240 245 TCA TTT GTA TAT ACG AAA TAT AGC ATG TTG ATT AAT TC? ? TT TCG TCT 1392 Ser Phe Val Tyr Thr Lys Tyr Ser Met Leu He? Sn Ser He Ser Ser 250 255 260 265 AAT GTT GAT? G? T? T TC? ??? ? GG TTC C? T GAC TCT TTT TAT GA? G? T 1440? Sn Val Asp Arg Tyr Ser Lys Arg Phe His Asp Ser Phe Tyr Glu Asp 270 275 280 ATT GCG G ?? TTT? T? AAG G? T AAT GAA AA? ? TT ?? T GT? TCC? G? GTT 1488 He Ala Glu Phe He Lys Asp Asn Glu Lys He Asn Val Ser Arg Val 285 290 295 GTT GAA TGC CTT ATC GTA CCT AAT ATT AAT ATA GAG TTA TTA ACT GA? 1536 Val Glu Cys Leu He Val Pro? Sn He? Sn He Glu Leu Leu Thr Glu 300 305 310 T? GT? T? T? T ??? TG? TTG TTTTT? T ?? T GTTTGTTATC GC? TTTAGTT TTGCTGT? TG 1596 GTT? TC? T? T? C? TTTTTAA GGCCGT? T? TG? T ??? TGAA A? T? T? T ?? CT? CTT? TTTT 1656.

TGTTAGTAT? ? T? AC? C? ATG CCG TCG TAT ATG TAT CCG ?? ß ?? C OCA? G? 1707 Met Pro Ser Tyr Met Tyr Pro Lys? Sn? The Arg i 5 10 AAA GTA ATT TCA AAG ATT ATA TCA TTA CA CTT GAT ATT AAA AAA CTT 1755 Lys Val He Ser Lys He He Ser Leu Gln Leu? Sp He Lys Lys Leu 15 20 25- CCT AAA A ?? T? T ATA AT AT AT TTA GAA TTT GGT CTA CAT GGA AAT 1803 Pro Lys Lys Tyr He Asn Thr Met Leu Glu Phe Gly Leu His Gly Asn 30 35 40 CTA CCA GCT TGT ATG TAT A? G? T GCC GT? TCA TAT G? T? T? ?? T 1851 Leu Pro Wing Cys Met Tyr Lys Asp Wing Val Ser Tyr Asp He Asn Asn 45 50 55 AT? ? G? TTT TTA CCT TAT A? T TGT GTT ATG GTT A ?? GAT TTA? T? T 1899 He? Rg Phe Leu Pro Tyr Asn Cys Val Met Val Lys? Sp Leu He Asn 60 t 65 70 75 * I GTt ATA AI I TCA TCA TCT GTA ATA GAT ACT AGA TTA CAT CAA TCT GTA 1947 Val He Lys Be Ser Val Ser Asp Thr? Rg Leu His Gln Ser Val 80 85 90 TT? AAA CAT CGT AG? GCG TT? ? T? G? T T? C GGC G? T C ?? G? C? TT? TC 1995 Leu Lys His Arg Arg Ala Leu He Asp Tyr Gly Asp Gln Asp He He 95 100 IOS ACT TTA ATG ATC ATT A? T ?? G TT? CT? TCG? TA GAT AT AT? TCC T? T 2043 Thr Leu Met He He? Sn Lys Leu Leu Ser He? Sp? Sp He Ser Tyr 110 115 120 ATA TTA GAT AAA AAA ATA ATT CAT GTA ACA AAA AT? TT? AAA ATA GAC 2091 He Leu Asp Lys Lys He He Hi Hi Val Thr Lys He Leu Lys He Asp 125 130 135 CCT ACA GTA GCC ?? T TCA ?? C? TG ??? CTG? AT AAG AT? G? G CTT GT? 2139 Pro Thr Val? La? Sn Ser? Sn Met Lys Leu? Sn Lys He Glu Leu Val 140 145 150 155.

GAT GTA ATA ACA TCA AT? CCT AAG TCT TCC TAT TAT TAT TAT AAT 2187 Asp Val He Thr Ser He Pro Lys Ser Ser Tyr Thr Tyr Leu Tyr Asn * 160 165 170 ?? T? TG? TC? TT G? T CTC G? T? C? TT? TT? T? T TT? TCC G? T GC? TTC 2235 Asn Met He? Le Asp Leu Asp Thr Leu Leu Tyr Leu Ser Asp Wing Phe 175 180 185 CAC AT? CCC CCC? C? C? T? T? TC? TT? CGT TC? CTT? G? G? T? T? C 2283 His Pro Pro Thr His He Ser Leu Arg Ser Leu Arg Asp He Asn 190 195 200 AGG ATT ATT GAA TTG CTT AAA AAA TAT CCG AAT AAT A? T? TT? TT G? T 2331? Rg He He Glu Leu Leu Lys Lys Tyr Pro? Sn? Sn? Sn He He? Sp 205 210 215 I T? T ATA TCC GAT AGC ATA AA? TCA A? T? GT TCA TTC ATT CAC ATA CTT 2379 Tyr He Ser Asp Ser He Lys Ser Asn Ser Ser Phe He His He Leu 220 225 230 235 CAT ATG AT? ? T? TCA AAT ATG TTT CCT GCT AT? ATC CCT AGT GTA AAC 2427 His Met He He Be As Met Met Phe Pro Wing He He Pro Ser Val Asn 240 245 250 GAT TTT ATA TCT ACC GTA GTT GAT AAA GAT CGA CTT ATT AT ATG T? T 2475? Sp Phe He Ser Thr Val Val? Sp Lys? sp? rg Leu He? sn Met Tyr 255 260 265 GGG ATT ?? G TGT GTT GCT ATG TTT TCG TAC GAT ATA ATC ATG ATC GAT 2523 Gly He Lys Cys Val Wing Met Phe Ser Tyr Asp He? sn Met He Asp 270 275 280 TTA G? G TC? TT? G? T G? C TC? G? T T? C ? T? TTT? T? G ?? ??? ?? TA 2571 Leu Glu Ser Leu Asp Asp Ser Asp Tyr He Phe He Glu Lys Asn He 285 290 295 TCT AT? T? C G? C GTT? AA TGT AG? G? T TTT GCG ?? T? TG? TT? G? G? T 2619 Ser He Tyr? Sp Val Lys Cys? Rg? Sp Phe? La? Sn Met He? Rg? Sp 300 305 310 315 ?? G GTT ?? A? G? GAA AAG AAT AGA AT? TT? ? CT ACG AA? TGT G ?? GAT 2667 Lys Val Lys Arg Glu Lys Asn Arg He Leu Thr Thr Lys Cys Glu sp 320 325 330 ATT AT? ? G? T? T? T? ??? TT? TTC? GT ??? ?? T? G? ? T? ?? C G? T G ?? 2715 | He He? Rg Tyr He Lys Leu Phe Ser Lys? Sn Arg He Asn? Sp Glu. { 335 ', 340, 345 AAT A? T ?? G GTG G? G G? G GTG TTG? T? C? T? TT G? T ?? T GT? TCT ??? 2763? Sn? Sn Lys Val Glu Glu Val Leu He His He? Sp? Sn Val Ser Lys 350 355 360 ?? T ?? T AAA TT? TC? CTG TCT G? T? T? TC? TCT TTA ATG G? T C ?? TTT 2811Asn Asn Lys Leu Ser Leu As Asp Be Ser Leu Met Asp Gln Phe 365 370 375 CGT TTA A? T CC? TGT? CC ATA AGA A? T? T? TT? TT? TCT TC? GC? CT 2859 Arg Leu Asn Pro Cys Thr He Arg Asn He Leu Leu Ser Be Wing Thr 380 385 390 395 ATA AAA TCA AAA CTA TTA GCG TTA CGG GCA GTA AAA AAC TGG A ?? TGT 2907 He Lys Ser Lys Leu Leu? The Leu Arg Wing Val Lys Asn Trp Lys Cys 400 405 410 TAT TCA TTG ACA AAT GTA TCA ATG TAT AA? ? AA AT? ? ß GGT GTT ATC 2955 Tyr Ser Leu Thr Asn Val Ser Met Tyr Lys Lys He Lys Gly Val He 415 420 425 GTA ATG G? T? TG GTT G? T T? T? T? TCT? CT A? C? TT CTT AA? T? CC? T 3003 Val Met Asp Met "Val Asp Tyr He Ser Thr Asn He Leu Lys Tyr His 430 * 435 440 AAA CAA TTA TAT GAT AAA ATG AGT ACG TTT GAA TAT AAA CGA GAT ATT 3051 Lys Gln Leu Tyr Asp Lys Met Ser Thr Phe Glu Tyr Lys Arg Asp He 445 450 455 AA? TC? TGT? AA TGC TCG? T? TGT TCC G? C TCT? T?? C? C? T CAT AT? 3099 Lys Ser Cys Lys Cys Ser He Cys Ser? Sp Ser He Thr His His He 460 465 470 475 TAT GAA AC?? C? TC? TGT ATA A? TT? T ??? TCT? CC G? T ?? T GAT CTT 3147 Tyr Glu Thr Thr Ser Cys He Asn Tyr Lys Ser Thr Asp Asn Asp Leu 480 485 490 ATG ATA GTA TTG TTC A? T CT? ? CT? G? T? T TT? ? TG C? T GGG? TG? T? 3195 Met He Val Leu Phe? Sn Leu Thr? Rg Tyr Leu Met His Gly Met He 495 500 505 CAT CCT AAT CTT AT? ? GC GT? AAA GGA TGG GGT CCC CTT ATT GGA TT? 3243 His Pro? Sn Leu He Ser Val Lys Gly Trp Gly Pro Leu He Gly Leu 510 515 520. TT? ? CG GGT G? T? T? GGT? TT ?? T TT? ??? CT? T? T TCC? CC? T? T 3291 Leu Thr Gly Asp He Gly He Asn Leu Lys Leu Tyr Ser .Thr Met Asn 525 530. 535 ATA AAT GGG CTA CGG T? T GGA GAT ATT ACG TT? TCT TC? T? CG? T ATG 3339 He Asn Gly Leu? Rg Tyr Gly? Sp He Thr Leu Ser Ser Tyr? Sp Met S40 545 550 555 AGT AAT AAA TTA GTC TCT ATT ATT AAT ACA CCC ATA TAT GAG TTA ATA 3387 Ser Asn Lys Leu Val Ser He He Asn Thr Pro He Tyr Glu Leu He 560 565 570 CCG TTT ACT? C? TGT TGT TCA CTC AAT GAA TAT T? T TCA A ?? TT GTG 3435 Pro Phe Thr Thr Cys Cys Ser Leu? Sn Glu Tyr Tyr Ser Lys He Val 575 580 585? TT TT? ? T? ?? GTT? TT TT? .GAA TAT ATG? T? TCT? TT? T? TT? TAT 3483 He Leu He Asn Val He Leu Glu Tyr Met He Ser He He Leu Tyr 590 595 600 AGA ATA TTG ATC GTA AAA AGA TTT AAT AAC ATT AAA GAA TTT ATT TCA 3531 Arg He Leu He Val Lys Arg Phe Asa Asn He Lys Glu Phe He Ser 605 «610 615« A ?? GTC GT? ?? T? CT GT? CTA GAA TCA TC? GGC? T? T? T TTT TGT C? G 3579 Lys Val Val Asn Thr Val Leu Glu Ser Ser Gly He Tyr Phe Cys Gln 620 '625 630 635 ATG CGT GT? CAT GA? C ?? ? TT G? A TTG G ?? ? T? G? T G? G CTC? TT? TT 3627 Met? Rg Val His Glu Gln He Glu Leu Glu He? Sp Glu Leu He He 640 645 650 AAT GGA TCT ATG CCT GTA CAG CTT ATG C? T TT? CTT CT? ?? G GT? GCT 3675? Sn Gly Ser Met Pro Val Gln Leu Met His Leu Leu Leu Lys Val? 655 660 665? CC? T? ? T? TTA GAG GAA ATC A? A GAA AT? TAACGT? TTT TTTCTTTT? A 3725 Thr He He Leu Glu Glu He Lys Glu He 670 675 ATAAAT ???? ATACTTTTTT TTTT ??? C ?? GGGGTGCT? C CTTGTCT ?? T TGT? TCTTGT 3785 ATTTTGGATC TGATGC ?? G? TT? TT ??? TA ATCGT? TG ?? ?? GT? GT? G? T? T? GTTT? 3845 TATCGTTACT GGACATGATA TTATGTTTAG TTAATTCTTC TTTGGCATGA ATTCTACACG 3905 TCGGACAAGG TAATGTATCT ATAATGGTAT AAAGCTT 3942 (2) INFORMATION FOR SEQUENCE ID No. 190: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 122 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ií) TYPE OF MOLECULE: peptide (xi) ) SEQUENCE DESCRIPTION: SEQUENCE ID No. 190: Cys Leu Phe l As As Lys Met Gly Gly Ala He He Olu Tyr Lys II * 1 5 10 15 Pro Gly Ser Lys Ser He Thr Lys Ser He Ser Glu Glu Leu Glu? Sn 20 25 30 Leu Thr Lys? Rg? Ap Lyß Pro He Ser Lys He He Val He Pro He 35 40 45 Val cys Tyr? Rg Asn? The Asn Ser II * Lys Val Thr Ph * Ala Lau Lys SO 55 £ 0 Lys Phe II * He Aßp Lys Glu Phe Ser Thr? Sn Val ll * Asp Val? Sp 65 70 75 80 Gly Lys His Glu Lys Met Ser Met? Sn Glu Thr Cys Glu ßlu? Sp Val 85 - 90 - 95-? The Arg Gly Leu Gly He II *? S Leu Glu? Sp Glu Cys II * Glu Glu 100 105 110? Sp? Sp Val? Sp Thr S * r L «u Ph *? Sn Val _Ü5 120 (2) INFORMATION P? R? L? SECUENCI? ID No. 191: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 75 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein. { xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 191: Met Asp Lyß Leu Tyr Ala Wing He Phe Gly Val Phß Met Thr Ser Lys 1 5 10 15 Asp? Sp? Sp Phe? Sn? Sn Phe He Glu Val Val Lys Ser Val Leu Thr 20 25 30? Sp Thr Ser Ser? Sn His Thr He Ser Ser Ser? Sn? Sn? Sn Thr Trp 35 40 45 He Tyr He Phe Leu? The He Leu Phe Gly Val Met Val Leu Leu Val 50 55 60 Phe He Leu Tyr Leu Lys Val Thr Lys Pro Thr 65 70 75 (2) INFORMATION FOR SEQUENCE ID No. 192: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 313 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ü) TYPE OF MOLECULE: protein ( xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 192: Met Glu Glu? La? Sp? Sn Gln Leu Val Leu? Sn Ser He Ser? La? Rg 1 5 10 15 Ala Leu Lys Ala Phe Phe Val Ser Lys He Asn Asp Met Val? Sp Glu 20 25 30 Leu Val Thr Lys Lys Tyr Pro Pro Lys Lys Ser Gln He Lys Leu 35 40 45 He? Sp Thr? Rg He Pro He? Sp Leu He? Sn Gln Gln Phe Val Lys 50 55 60? Rg Phe Lys Leu Glu? Sn Tyr Lys? Sn Gly He Leu Ser Val Leu He 65 70 75 80? Sn Ser Leu Val Glu? Sn Asn Tyr Phe Glu Gln Asp Gly Lys Leu Asn 85 90 95 Being Ser Asp He Asp Glü Leu Val Leu Thí Aspóle "Glu Lys Xys lie 100 105 110 Leu Ser Leu He Pro Arg Cys Ser Pro Leu Tyr He? Sp He Ser Asp 115 120 125 Val Lys Val Leu Wing Ser Arg Leu Lys Lys Ser Ala Lys Ser Phe Thr 130 135 140 Phe? Sn? Sp His Glu Tyr He He Gln Ser? Sp Lys He Glu Glu Leu 145 150 155 160 He Asn Ser Leu Ser Arg Asn His Asp He He Leu Asp Glu Lys Ser 165 170 175 Ser He Lys Asp Ser He Tyr He Leu Ser? Sp? Sp Leu Leu? Sn He 180 * 185 190 Leu? Rg Glu? Rg Leu Phe? Rg Cys Pro Gln Val Lys? Sp? Sn Thr He 195 200 205 Ser? Rg Thr? Rg Leu Tyr Asp Tyr Phe Thr Arg Val Ser Lys Lys Glu 210 215 220 Glu Wing Lys He Tyr Val He Leu Lys? Sp Leu Lys He Wing Asp He 225 230 235 240 Leu Gly He Glu Thr Val Thr He Gly Ser Phe Val Tyr Thr Lys Tyr l 2i45e 2- > Sen0 i25c5e Being Met Leu He Asn Being As Asn Val Asp Arg Tyr Being Lys 260 265 • 270 Arg Phe His Asp Being Phe Tyr Glu Asp He Wing Glu Phe He Lys Asp 275 280 285 Asn Glu Lys II * Asn Val Ser Arg Val Val Glu Cys Leu He Val Pro 290 * 295 300 Asn He Asn He Glu Leu Leu Thr Glu 305. "310 (2) INFORMATION FOR SEQUENCE ID No. 193: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 677 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (i) ) SEQUENCE DESCRIPTION: SEQUENCE ID No. 193: Met Pro Ser Tyr Met Tyr Pro Lys Asn Wing Arg Lys Val He Ser Lys 1 S 10 15 He He Ser Leu Gln Leu Asp He Lys Lys Leu Pro Lys Lys Tyr He 20 25 30 Asn Thr Met Leu Glu Phe Gly Leu His Gly Asn Leu Pro Wing Cys Met 35 40 45 Tyr Lys? Sp Wing Val Ser Tyr Asp He Asn Asn He Arg Phe Leu Pro 50 55 60 Tyr Asn Cys Val Met Val Lys Asp Leu He Asn Val Ile Lys Ser Ser 65 70 75 80 Ser Val He Asp Thr Arg Leu His Gln Ser Val Leu Lys His Arg Arg 85 90 95 Leu? Sp Thr Leu Leu Tyr Leu Ser? Sp? The Phe Hia He Pro Pro Thr 180 185 190 His He Ser Leu? Rg Ser Leu? Rg? Sp He? Sn? Rg He He Glu Leu 195 200 205 Leu Lys Lys Tyr Pro? Sn? Sn? Sn He He? Sp Tyr He Ser? Sp Ser 210 215 220 He Lys Ser Asn Ser Ser Phe He His He Leu His Met He He Ser 225 230 235 240 Asn Met Phe Pro? The He He Pro Ser Val Asn Asp Phe He Ser Thr 245 250 255 Val Val Asp Lys Asp Arg Leu He Asn Met Tyr Gly He Lys Cys Val 260 265 270 Wing Met Phe Ser 'Tyr? Sp He? Sn Met He Asp Leu Glu Ser Leu Aso 275 * 280 285 Asp Ser Asp Tyr He Phe He Glu Lys Asn He Ser He Tyr Asp Val 290 295 300 Lys Cys Arg Asp Phe Wing Asn Met He Arg Asp Lys Val Lys Arg Glu 305 310 315 320 Lys Asn Arg He Leu Thr Thr Lys Cys Glu Asp He He Arg Tyr He 325 330 335 Lys Leu Phe Ser Lys Asn Arg He Asn Asp Glu Asn Asn Lys Val Glu 340 345 350 Glu Val Leu He His As Asn Asn Val Ser Lys Asn Asn Lys Leu Ser 355 360 365 Leu Ser Asp Be Ser Leu Met Asp Gln Phe Arg Leu Asn Pro Cys 370 375 380 Thr He Arg Asn He Leu Leu Being Wing Thr He Lys Ser Lys Leu 385 390 395 400 Leu Ala Leu Arg Ala Val Lys Asn Trp Lys Cys Tyr Ser Leu Thr Asn 405 410 415 Val Ser Met Tyr Lys Lys He Lys Gly Val He Val Met Asp Met Val 420 425 430? Sp Tyr He Ser Thr? Sn He Leu Lys Tyr His Lys Gln Leu Tyr? Sp 435 440 445 Lys Met Ser Thr Phe Glu Tyr Lys? rg? sp He Lys Ser Cys Lys Cys 450 455 460 Ser He Cys Ser Asp Ser He Thr His His He Tyr Glu Thr Thr Ser 465 470 475 480 Cys He Asn Tyr Lys Ser Thr Asp Asn Asp Leu Met He Val Leu Phe 485 490 495 Asn Leu Thr Arg Tyr Leu Met His Gly Met He His Pro Asn Leu He 500 505 510 «Ser Val Lys Gly Trp Gly Pro Leu He Gly Leu Leu Thr Gly Asp He 515 520 525 Gly He Asn Leu Lys Leu Tyr Being Thr Met Asn He Asn Gly Leu Arg 530 535 540 Tyr Gly Asp He Thr Leu Being Ser Tyr ? sp Met Ser Asn Lys Leu Val 545 550 555 560 Ser He He Asn Thr Pro He Tyr Glu Leu He Pro Phe Thr Thr Cys 565 570 575 Cys Ser Leu Asn Glu Tyr Tyr Ser Lys He Val He Leu He Asn Val 580 585 590 He Leu Glu Tyr Met He Ser He He Leu Tyr Arg He Leu He Val 595 600 605 Lys Arg Phe Asn Asn He Lys Glu Phe He Ser Lys Val Val Asn Thr 610 ^ 615 620 Val Leu -Glu- Ser Ser Gly He Tyr Phe Cys Gln Met Arg Val His Glu 625 630 635 640 Gln He Glu Leu Glu He Asp Glu Leu He He Asn Gly Ser Met Pro 645 650 655 Val Gln Leu Met His Leu Leu Leu Lys Val Wing Thr He He Leu Glu 660 665 670 Glu He Lys Glu He 675 (2) INFORMATION FOR SEQUENCE ID No. 194: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 64 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 194: Lys Leu Tyr Thr He He Asp Thr Leu Pro Cys Pro Thr Cys Arg He 1 5 10 15 His Wing Lys Glu Glu Leu Thr Lys His Asn He Met Being Ser Asn Asp 20 25 30 He Asn Tyr He Tyr Tyr Phe Phe He? Rg Leu Phe? Sn? Sn. Leu_Ala 35 40 5 Ser? S Pro Lys Tyr Lys He Gln Leu? Sp Lys Val? The Pro Leu Val 50 55 60 (2) INFORMATION FOR SEQUENCE ID No. 195: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 583 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ORIGIN OF THE SOURCE: (A) ORGANISM: Swinepox virus (B) CEPA: Kasza (C) INDIVIDUAL INSULATION: S- SPV-001 (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: 2.583 (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 195: A AGC TTA AGA AAG AAT GTA GGG AAC GAA GAA TAT AGA ACC AAA GAT 46 Ser Leu Arg -Lys Asn Val Gly Asn Glu Glu Tyr Arg Thr Lys Asp 1"5 10 15 TTA TTT" ACT "GCA TTA TGG GTA CCT GAT TTA TTT ATG GAA CGC GTA GA? 94 Leu Phe Thr Ala Leu Trp Val Pro Asp Leu Phe Met Glu Arg Val Glu 20 25 30 AAA GAT GAA GAA TGG TCT CTA ATG TGT CCA TGC GAA TGT CCA GGA TTA 142 Lys Asp Glu Glu Trp Ser Leu Met Cys Pro Cys Glu Cys Pro Gly Leu 35 40 45 TGC GAT GTA TGG GGG AAT GAT TTT AAC A ?? TT? T? T? TA GAA TAC GAA 190 Cys Asp Val Trp Gly Asn Asp Phe Asn Lys Leu Tyr He Glu Tyr Glu 50 '55 60. ACA A? G ?? A AAA ATT A ?? GCG? TC GCT? AA GCA AGA AGT TTA TGG A ?? 238 Thr Lys Lys Lys He Lys? The He? Lys? The Arg Ser Leu Trp Lys 65 70 75 TCT ATT ATC GAG GCT CAA ATA GAA CAGA GGA ACG CCG TAT ATA CTA TAT 286 Ser He He Glu Ala Gln He Glu Gln Gly Thr Pro Tyr He Leu Tyr 80 85 90 95 AAA GAT TCT TGT ?? T AAA A ?? TCC? AT CA? AGC AAT TTG GGA ACÁ? TT 334 Lys? Sp Ser Cys? Sn Lys Lys Ser? Sn Gln Ser? Sn Leu Gly Thr He 100 105 110 AGA TCG AGT? AT CTC TGT ACA GAG ATT AT? CAA TTT AGT A? C GAG GAT 382? Rg Ser Ser? Sn Leu Cys Thr Glu He He Gln Phe Ser? Sn Glu? Sp 115 120 125 GAA GTT GCT GTA TGT AAT CTA GGA TCT ATT TCG TGG AGT A ?? TTT GTT 430 Glu Val Wing Val Cys Asn Leu Gly Ser He Ser Trp Ser Lys Phe Val 130 135 140 AAT AAT A? C GT? TTT ATG TTC GAC AAG TTG AGA ATA ATT? CG ??? TA 478 Asn Asn Asn Val Phe Met Phe Asp Lys Leu Arg He He Thr Lys He 145 150 155. CTA GTT A ?? AAT CTA A? T? AA AT? ? T? GAT ATC? AT TAT CC TAT? GTG 526 Leu Val Lys? Sn Leu? Sn Lys He He? Sp He? Sn Tyr Tyr Pro Val 160 165 170 175? T? G ?? TCG TCT? G? TCT? AT AAG A? A C? T? G? CCC? T? GGT? TC GGG 574 He Glu Ser Ser? Rg Ser? Sn Lys Lys His? Rg Pro He Gly He Gly 180 '185 190 GTT C? G GGT 583 Val Gln Gly (2) INFORMATION FOR SEQUENCE ID No. 196: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 194 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 196: Ser Leu Arg Lys Asn Val Gly? Sn Glu Glu Tyr? Rg Thr Lys? Sp Leu 1 5 10 15 Phe Thr? Leu Trp Val Pro Asp Leu Phe Met Glu Arg Val Glu Lys 20 '25 30 Asp Glu-GluRp Ser Leu Met Cys Pro Cys Glu Cys Pro Gly Leu Cys 35. 40 45 Asp Val Trp Gly Asn Asp Phe Asn Lys Leu Tyr He Glu Tyr Glu Thr 50 55 60 Lys Lys Lys He Lys Wing He Wing Lys Wing Arg Ser Leu Trp Lys Ser "65 70 75 80 He He Glu Wing Gln He Glu Gln Gly Thr Pro Tyr He Leu Tyr Lys 85 90 95 Asp Ser Cys Asn Lys Lys Ser? Sn Gln Ser? Sn Leu Gly Thr He? Rg 100 IOS 110 Ser Ser Asn Leu Cys Thr Glu He He Gln Phe Ser Asn Glu Asp Glu 115 120 125 val Wing Val Cys Asn Leu Gly Ser He Ser Trp Ser Lys Phe Val Asn 130 135 140 Asn Asn Val Phe Met Phe Asp Lys Leu Arg He He Thr Lys He Leu 145 150 155 160 Val Lys Asn Leu Asn Lys He He? sp He? sn Tyr Tyr Pro Val He 165 170 175 Glu Ser Ser? rg Ser? sn Lys Lys His? rg Pro He Gly He Gly Val 180 185 190 Gln Gly (2) INIUKMA IUN FOR SEQUENCE ID No. 197: ( i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 51 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 197: ACAGGAAACA GCTATGACCA TGATTACGAA TTCGAGCTCG CCCGGGGATC T 51 (2) INFORMATION FOR SEQUENCE ID No. 198: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 138 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 198: GTATAGCGGC CGCCTGCAGG ATTTTTTTTTT XTTTTTTTTT TGGCATATAA 60 ATAGATCTGT ATCCTAAAAT TGAATTGTTA TTATCGATAA CGATGGCTGT 120 GCCTGCAAGC CCACAGCA 138 (2) INFORMATION FOR SEQUENCE ID No. 199: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 120 base pairs (B) TYPE: nucleic acid (C) CEPA: ^ double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 199: CTTAGCCCCA AACGCACCTC AGATCCATAA TTAATTAATT TTTATCCCGG CGCGCCTCGA 60 CTCTAGAATT TCATTTTGTT TTTTTCTATG CTATAAATGA ATTCGGATCC CGTCGTTTTA 120 (2) INFORMATION FOR SEQUENCE ID No. 200: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 116 base pairs (B) TYPE: nucleic acid (C) CEPA:, double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (Xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 200: GAAATCCAGC TGAGCGCCGG TCGCTACCAT TACCAGTTGG TCTGGTGTCA AAAAGATCCA 60 TAATTAATTA ACCCGGGTCG AGGCGCGCCG GGTCGACCTG CAGGCGGCCG CTATAC 116 (2) INFORMATION FOR SEQUENCE ID No. 201: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 51 base pairs (B) TYPE: nucleic acid (C CEPA:, double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 201: TAATGTATCT ATAATGGTAT AAAGCTTGTA TTCTATAGTG TCACCTAAAT C 51 (2) INFORMATION FOR SEQUENCE ID No. 202: (i) SEQUENCE CHARACTERISTICS: A) LENGTH: 51 base pairs B) TYPE: nucleic acid C) CEPA:, double D) TOPOLOGY: linear (ii) TYPE OF MOLECULE : DNA (genomic) (Ui) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 202: ACAGGAAACA GCTATGACCA TGATTACGAA TTCGAGCTCG CCCGGGGATC T 51 (2) INFORMATION FOR SEQUENCE ID No. 203: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 141 base pairs (B) TYPE: nucleic acid (C) CEPA: ^ double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 203: GTATAGCGGC CGCCTGCAGG TCGACTCTAG ATTTTTTTTTT TTTTTTTTTTT TGGCATATAA 60 ATAGATCTGT ATCCTAAAAT TGAATTGTAA TTATCGATA? TAAATGAATT CCATGTGCTG 120 CCTCACCCCT GTGCTGGCGC T 141 (2) INFORMATION FOR SEQUENCE ID No. 204: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 120 base pairs (B) TYPE: nucleic acid (C) CEPA: ^ double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (Ui) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 204: TCGCCCGCCT CTGACGCCCC GGATCCATAA TTAATTAATT TTTATCCCGG CGCGCCTCGA 60 CTCTAGAATT TCATTTTGTT TTTTTCTATG CTATAAATGA ATTCGGATCC CGTCGTTTTA 120 (2) INFORMATION FOR SEQUENCE ID No. 205: (i) SEQUENCE CHARACTERISTICS: A) LENGTH: 116 base pairs B) TYPE: nucleic acid C) CEPA: ^ double D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 205: GAAATCCAGC TGAGCGCCGG TCGCTACCAT TACCAGTTGG TCTGGTGTCA AAAAGATCCA 60 TAATTAATTA ACCCGGGTCG? GGCGCGCCG GGTCGACCTG CAGGCGGCCG CTATAC 116 (2) PAR INFORMATION? THE SEQUENCE? ID No. 206: (i) SEQUENCE CHARACTERISTICS: ÍA) LENGTH: 51 base pairs B) TYPE: nucleic acid C) CEPA: ^ double D) TOPOLOGY: linear (ii) MOLECULE TYPE: DN? (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 206: TAATGTATCT ATAATGGTAT AAAGCTTGTA TTCTATAGTG TCACCTAAAT C 51 (2) INFORMATION FOR SEQUENCE ID No. 207t (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 45 base pairs (B) TYPE: nucleic acid C CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (Xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 207: CAAGGAATGG TGCATGCCCG TTCTTATCAA TAGTTTAGTC GAAAA 45 CTCTAGAATT TCATTTTGTT TTTTTCTATG CTATAAATGA ATTCGGATCC CGTCGTTTTA 120 (2) INFORMATION FOR SEQUENCE ID No. 208: (i) SEQUENCE CHARACTERISTICS:! A) LENGTH: 57 base pairs B) TYPE: nucleic acid C) CEPA:, double D) TOPOLOGY: linear (ii) TYPE OF MOLECULE : DNA. { genomics) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 208: TATATAAGCA CTTATTTTTG TTAGTATAAT AACACAATGC CAGATCCCGT CGTTTTA 57 CTCTAGAATT TCATTTTGTT TTTTTCTATG CTATAAATGA ATTCGGATCC CGTCGTTTTA 120 (2) INFORMATION FOR SEQUENCE ID No. 209 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 249 base pairs (B) TYPE: nucleic acid (C) CEPA: ^ double (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 209: TCCAGCTGAG CGCCGGTCGC TACCATTACC AGTTGGTCTG GTGTCAAAAA GATCCATAAT 60 TAATTAACCA GCGGCCGCCT GCAGGTCGAC TCTAGATTTT TTTTTTTTTT TTTTTTGGCA 120 TATAAATAGA TCTGTATCCT AAAATTGAAT TGTAATTATC GATAATAAAT GAATTCGG? T 180 CCATAATTAA TTAATTTTTA TCCCGGCGCG CCGGGTCGAC CTGCAGGCGG CCGCTGGGTC 240 GACAAAGAT 249 (2) INFORMATION FOR SEQUENCE ID No. 210: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 45 base pairs (B) TYPE: nucleic acid (C) CEPA:, double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 210: CAAAAGTCGT AAATACTGTA CTAGAAGCTT GGCGTAATCA TGGTC 45 (2) INFORMATION FOR SEQUENCE ID No. 211: (i) SEQUENCE CHARACTERISTICS: A) LENGTH: 33 base pairs B) TYPE: nucleic acid C CEPA:, double D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 211: CGACGGATCC GAGGTGCGTT TGGGGCTAAG TGC 33 (2) INFORMATION FOR SEQUENCE ID No. 212: (i) SEQUENCE CHARACTERISTICS: ÍA) LENGTH: 36 base pairs B) TYPE: nucleic acid C) CEPA: ^ double D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 212: CCACGGATCC AGCACAACGC GAGTCCCACC ATGGCT 36 (2) INFORMATION PARADLA SEQUENCE ID No. 213: (i) SEQUENCE CHARACTERISTICS: 'IA) LENGTH: 35 base pairs B) TYPE: nucleic acid C CEPA: ^ double D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 213: CCACGAATTC GATGGCTGTG CCTGCAAGCC CACAG 35 (2) INFORMATION FOR SEQUENCE ID No. 214: (i) SEQUENCE CHARACTERISTICS: A] LENGTH: 32 base pairs B) TYPE: nucleic acid C CEPA: "double D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 214: CGAAGATCTG AGGTGCGTTT GGGGCTAAGT GC 32 (2) INFORMATION FOR SEQUENCE ID No. 215: (i) SEQUENCE CHARACTERISTICS:! A | LENGTH: 34 base pairs B) TYPE: nucleic acid C) CEPA: ^ double D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO? (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 215: CGCAGG? TCC GGGGCGTCAG AGGCGGGCGA GGTG 34 (2) INFORMATION FOR SEQUENCE ID No. 216: (i) SEQUENCE CHARACTERISTICS: IA) LENGTH: 32 base pairs B) TYPE: nucleic acid C) CEPA: double D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO > (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 216: GAGCGGATCC TGCAGGAGGA GACACAGAGC TG 32 (2) INFORMATION FOR SEQUENCE ID No. 217: (i) SEQUENCE CHARACTERISTICS: 5 (A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) CEPA: ^ double (D) TOPOLOGY: linear • 10 (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO 15 (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 217: GCGCGAATTC CATGTGCTGC CTCACCCCTG TG 32 twenty (2) INFORMATION FOR SEQUENCE ID No. 218: 25 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 34 base pairs (B) TYPE: nucleic acid 30 (C) CEPA: ^ double (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: DNA (gendmica) • 35 (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO 40 (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 218: CGCAGGATCC GGGGCGTCAG AGGCGGGCGA GGTG 34 45 (2) INFORMATION FOR SEQUENCE ID No. 219: (i) SEQUENCE CHARACTERISTICS: 50 (A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) CEPA: ^ double (D) TOPOLOGY: linear 55 (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO 60 (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 219: 65 GGGGAATTCA ATGCAACCCA CCGCGCCGCC CC 32 (2) INFORMATION FOR SEQUENCE ID No. 220: 70 (i) SEQUENCE CHARACTERISTICS: ÍA) LENGTH: 32 base pairs B) TYPE: nucleic acid C) CEPA:, double D) TOPOLOGY: linear (ii) TYPE OF MOLECULE : DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 220: GGGGATCCT AGGGCGCGCC CGCCGGCTCG CT 32 (2) INFORMATION FOR SEQUENCE ID No. 221: (i) SEQUENCE CHARACTERISTICS:! A) LENGTH: 5785 base pairs B) TYPE: nucleic acid C) CEPA:, only D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (Xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 221: (i) SEQÜENCE DESCRIPTION: SEQ ID NO: 221: ?? GCTTAAG? AAGAATGTAG GGA? CGAAG? ? T? T? ß ?? CC ??? G? TTT? T TTACTGCATT 60 ATGGGTACCT GATTTATTTA TGGAACGCGT AGAAAAAGAT GAAGAATGGT CTCTAATGTG 120 TCCATGCGAA TGTCC? GGAT TATGCG? TGT? TGGGGGAAT GATTTTAACA? ATTATAT? T 180 AGAATACGAA ACAAAG? ?? AAATTAAAGC G? TCGCTAAA GCAAGAAGTT TATGG ??? TC 240 TATTATCGAG GCTCA ?? T? G AAC ?? GG ?? C GCCGTATAT? CT? T? T? AAG? TTCTTGT ?? 300 T ??? AAATCC AATCAAAGCA ATTTGGGA? C ?? TT? G? TCG? GT ?? TCTCT GTACAGAG? T 360; TATACAATTT? GT? CG? GG? TG? GTTGC TGT? TGTA? T CT? GG? TCT? TTTCGTGG? G ; 420 TAAATTTGTT AATAATA? CG T? TTTATGTT CGAC? GTTG? GAAT ?? TT? CG ?? AAT? CT 480? GTTAAAAAT CTAA? TAA ?? T? ATAGATAT CAATTATTAT CCAGTG? T? G AATCGTCT? G 540? TCTAATAAG AAACAT? G? C CCAT? GGT? T CGGTGTTC? G GGTTTGGCTG? TGTGTTT? T 600 ATTATTGGGC TATGCATTCG ATAGCGA? G? GC ?????? TTAAATATAC ??? TTTCCGA 660 A? CAATAT? T TATGCCGCAC T? G ATCT? G TTGCG ?? CT? GCT ???? TTT? CGGACCTT? 720 TG? GACATAT AACGATTCTC CAGCGAGTAA5 ^ GTATTCTA C ?? TATGAT? TGTGGTT? AA 780 GAACCCAACA GATTTATGGG ATTGGAATG? ? CTAAAAA? G? GAATT? AT? C? CATGGATT 840 GAGAAATAGC CTTCTA? TAG CACC? ATGCC TACTGC? TCT? C? TCTCAA? T? TTAAGT ?? 900 TAATGAGTCC ACCGAACCAT AT? CTAGCAA TATATATAC? ? GAAG? GT? T T? TCTGGAGA 960 TTTTC? GGTT GTAAATCC? C ACCTATTG? G? GAACT ?? T? ? GT? G ??? T? TGTGG ?? T ?? 1020 TG? C? TAA? G? ATACAATTG TGTT? CATAA TGGTTCT? TT C ?? C? TTT? G? TTT? CC? G? 1080 TAATATAAAA CCAATATATA AAACGGTTTG GGAGATATCT CCAAAATGTA TTTTAGAAAT 1140 GGCAGCCG? C AGAGGTGCGT TTAT? G? TCC AAGTC ?? TC? ? TG? C ?? TAT AT? T? G? T ?? 1200 TCCT? C? T? C GCAAAACTG? CCAGT? TGC? TTTTT? CGG? TGGAG? TTGG GGCT? AAA? C 1260 TGGG? TGT? T TATATGAGAA CAA? TCGGC ATCAAATCCT AT? AAATTC? C? GTTGAGTG 1320 TAGTA? TTGT TCTGCAT? AT TTTTATA ??? TGAAATACT ATCTCATGTA TCTTAATATA 1380 TTAAAAATGC GTAAA? GTGG C? TTCC ???? C ?? CCCGTTC CC ???? AAG? TT? TGTTC ?? 1440? CTG? T ?? T? ATAA ???? C? ACA ?? T ?? C? ? CGTGTTC? G ?? GTCGTTG? GTATCTTA ?? 1500 TC? CT ?? GT? AGAGCACCGA A ??? TGT? T? G ??? TGT ?? TATT ?? CGCC TTCTC ?? T? T 1560 CCTTCTTGTT C? TCG? TAAC T? TT ?? TTT? ? C? G? CT? TC? TC? TCT ?? TGACATCT 1620? C? T? T? T? G C? TT? G ?? TG TG? GTCT ??? ? T? T? C ?? G? ? T ????? G ?? TGAAAGTAG? 1680, TCGTT? GATC AATATTTTTT AAA? ATTACK CTTACTGCAG C ?? GTCCT? T ?? TGT? TC ?? 1740 * TT? TT? GATT GTATAT? TTC TAATATT? G? GAT ?? T ??? C ATAT? CCCCC TTCCTT? TC? 1800 AATATATCTA TATCGGACTT AGAAG? GAA? ? CGCTT ?? CC? GGGGTGTTT GTTCATTA? T 1860 A? G? TGGGTG GAGCTATT? T? GAATAC ?? G ATACCTGGTT CCAAATCTAT A? C? AAATCT 1920 ATTTCCGAAG AACTAGAAAA TTTAAC ??? G CG? G? T? ? C A ?? T? TCT ?? ? ATTAT? GTT 1980 ATTCCTATTG TATGTTACAG AAATGCAAAT AGTATAAAGG TTACATTTGC ACTAAAAAAG 2040 TTTATC? T? G ATAAGG? GTT TAGTACA? AT GTAAT? GACG TAG? TGGTAA ACATGAAAA? 2100 ATGTCCATGA ATGAAACATG CGAAG? GG? T GTTGCT? G? G G? TTGGG ?? T T? T? G? TCTT 2160 GAAGATGAAT GCATAGAGGA AGATG? TGTC GATACGTC? T TATTTAATGT ATAAATGGAT 2220 AAATTGTATG CGGCAATATT CGGCGTTTTT ATGACATCTA AAGATG? TGA TTTTAATAAC 2280 TTTATAGAAG TTGTAAAATC TGTATTA? C? G? T? C? TC? T CT ?? TC? T? C AATATCGTCG 2340 TCCAATAATA ATACATGGAT ATATATATTT CTAGCG? T? T? TTTGGTGT TATGGTATT? 2400 TTAGTTTTTA TTTTGTATTT AAAAGTTACT A? CC ?? CTT ?? ATGGAGGA? GCAG? T ?? C 2460 C? ACTCGTTT T ??? T? GT? T T? GTGCT? GA GCATT ?? AGG C? TTTTTTGT? TCT? AAATT 2520 AATGAT? TGG TCGATG ?? TT? GTT? CC ??? AA? T? TCCAC C ??? G ?? GAA ATC? C ??? T? 2580 AAACTCATAG ATACACGAAT TCCTATTGAT CTTATTAATC AACA? TTCGT TAAAAG? TTT 2640 AAACTAGAA? ? TT? T ????? TGGAATTTT? TCCGTTCTTA TC ?? T? GTTT? GTCG ??? AT 2700 AATTACTTTG A? C ?? G? TGG TAA? CTT ?? T? GC? GTGAT? TTGATG ?? TT? GTGCTC? CA 2760 GAC? TAGAG? ???? G? TTTT ATCGTTGATT CCTAGATGTT CTCCTCTTT? T? TAG? T? TC 2820 AGTGACGTTA AAGTTCTCGC ATCTAGGTTA AAAAAGTGCT AA? TC? TTT? CGTTT ?? TGA 2880 TC? TG? AT? T AT? T? C ?? T CTG? T ?? A? T? G? GG ?? TTA? T ??? T? GTT T? TCT? GAAA 2940 CCATGAT ? TT? T? CT? G? TG? AAAA? GTTC TATT ??? G? C AGC? T? T? T? T? CT? TCTGA 3000"TGATCTTTTG A? T? T? CTTC GTGAAAGATT ATTT? G? TGT CC? C? GGTT? AAG? T ?? T? C 3060 TATTTCTAG? ? CACGTCTAT ATGATTATTT TACT? GAGTG TCAA? G? AAG ?? G ?? GCG ?? 3120? ATATACGTT AT? TTG ??? G? TTT ?? AGAT TGCTGAT? TA CTCGGT? TCG? AAC? GT ?? C 3180 G? TAGGATCA TTTGTAT? T? CG ??? T? T? G C? TGTTG? TT ?? TTC ?? TTT CGTCTAATGT 3240 TGATAGATAT TCAAAAAGGT TCCATGACTC TTTTT? TG ?? G? T? TTGCGG? ATTTATAA? 3300 GGAT? ATGA? ? AAATTAATG TATCCAGAGT TGTTGAATGC CTTATCGT? C CT ?? T? TT? A 3360 0Z9 * S8 OXYXX? And? X? YX? YYYYXOX YXOXY? X? OX XYXYO? XYDX XOXOOYOOYO OXOO? YX ?? X 09S * YY? YDXYDD? And? XYYOYXYY YYYXOYOXXY XXY ??? XYXY XYOYYXYXX? XYOYYOXOXY 08 005 * YYDOYXOYYX XYXY? OYXYY OYYYYDYOYY Y? XXOOY? XY OYOYXXYDXY XY? OOOXXXX SL or *** 09Z * OODXYYX? XO OXOOXXXOXY XYYYOXYXY? XYOXYXYDXX DYXYOYDXXY DXXYDXXO? 09002 * X 'Y? YOXYY? YX YOOYXYOOOX YXYXYXXYOX XYXXYXYYXY YXYYODDXYX YYY? YYXXDO ss 0 * 1 * XXYYDXXYXX YOOYOYYYXY XYOYOYXXOY OXXDDYXXYO XYXYXYDYOY DODDDD? XYO 080 * os YOOXXYOOXY OOOXYXXXYX YXXYXXYOYX YDOXOXYDXX YOXYDXYXYY X? YXYXYXXX OEO * s * YXYOYXYXOO XXOXDYYXOO YXYYOXYO? Y XYYXOXYO? X OXXOOYOYXY O? XYYOXOY 096 € YYOXYDYY? D XXYYDDOYXO YDYXDDDYOY XY ??? YXXYX YY ?? YDYYXO XYDXXY? XY? or * 006C YYY? YXYOYX XYXYXYXOOX YXYXYOX? OY XYOOXYXD? X XYYXYYXXY DXYOXY? XXX OYOXYXXYOY O? YOXYDOOO OYXXYOYX ?? XXOODYDYXD OXYOYYYYXX YXOXOXYYOX 08eye YOYXXYO? XO YXYOYXY? XO XDXYDX? DX? YY? XYXXDXY YYXYYXXXYO Y? YXXOOXYX OZLZ XOXDXXYYXY XXODYXXXXX YDYYXYX ?? X Y ?? X? X? DX? XYDXYXODDO X? OYYYXYXO Sz 099 £ XYXOXXOOYO OYXOXYYYOO XYOYXOXOOX XX ?? DVXXDX YOOYXYYYXY XYXYYY ??? X oe oo9e OOXXO? Y ??? ? XXYXYOXXO YYDYXXYOXY XYXX? O? Y? D XXXYYXOYY? YOY? OOO ?? O st or * se? YODDXYXOl? X? XODXODD OXYYDYD ?? X ?? XYXOYXXO XXXXXYXXD? OO ?? X? X? X? YYYDX? Y? XY OXYXYXOOOO OVYXXXXX? O YXYX? OXYXX OOXYXOXDOX OOXYXXOXXX DXYYXYXXXX XOXXYD1Y ?? XYX? X? XO? Y XYYOXOYYXX YXXOYOYXYX s * ts TATATTATTA TCTTCAGCAA CTATAAAATC AAAACTATTA GCGTTACGGG CAGTA? AAAA 4740 CTGGAAATGT TATTCATTGA CAAATGTATC AATGTATAA? AAAATAA? GG. GTGTTATCGT 4800 AATGGATATG GTTGATTATA TATCTACTAA CATTCTTAAA TACCATAAAC AATTATATGA 4860 TAAAATGAGT ACGTTTGAAT ATAAACGAGA TATTAAATCA TGTAAATGCT CGATATGTTC 4920 CGACTCTATA ACACATCATA TATATGAAAC AACATC? TGT ATAAATT? T? AATCTACCG? 4980 TAATG? TCTT ATGAT? GTAT TGTTCAATCT A? CT? G? T? T TT? TGC? TG GG? TG? TACA 5040 TCCTAATCTT ATA? GCGT? A? GGATGGGG TCCCCTTATT GGATTATTAA CGGGTGATAT 5100 AGGTATTAAT TTAAAACTAT ATTCCACCAT GAATATAAAT GGGCTACGGT ATGGAG? T? T 5160 TACGTTATCT TCATACGATA TGAGTA? T? A? TT? GTCTCT? TT? TTAAT? C? CCC TAT? 5220 TG? GTTAAT? CCGTTT? CT? CATGTTGTTC? CTC ?? TG ?? T? TT? TTC ?? ? AATTGTG? T 5280 TTT? TAAAT GTTATTTTAG ?? TATATGAT ATCT? TT? TA TTAT? TAGAA TATTGATCGT 5340 AAAAAGATTT AAT ?? C? TT? ? AGAATTTAT TTCA ??? GTC GT ??? T? CTG T? CT? G ?? TC 5400? TCAGGCATA T? TTTTTGTC? GATGCGTGT ACATGA? C ?? ? TTGAATTGG ??? T? G? TG? 5460 GCTCATTATT ?? TGG? TCT? TGCCTGT? CA GCTT? TGC? T TT? CTTCT ?? ? GGTAGCT? C 5520 C? T ?? T? TT? G? GGAAATCA AAGAA? T? TA ACGT? TTTTT TCTTTTAAAT AAAT? AAAAT 5580 ACTTTTTTTT TTA ?? C ?? GG GGTGCT? CCT TGTCT ?? TTG T? TCTTGT? T TTTGG? TCTG 5640 ATGC ?? G? TT ATT ??? T ?? T CGTATGAAA? ? GTAGTAG? T? TAGTTT? T? TCGTT? CTGG 5700? C? TGATATT ATGTTT? GTT ATTCTTCTT TGGC? TG? T TCT? C? CGTC GG? C ?? GGT? 5760? TGT? TCTAT AATGGTATAA AGCTr 5785 (2) INFORMATION FOR SEQUENCE ID No. 222: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 722 base pairs (B) TYPE: nucleic acid (C CEPA:, Unique _ (D) TOPOLOGY: l ineal (ii) TYPE OF MOLECULE: DNA (genomic) ( iii) HYPOTHETICAL: NO 516 (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 222: TTTTGATTTT ACGCCATTAT ACTGTTCTGT AGATGCAAAT AATGAAGATG TGTTCTTATT 60 TACTAGAGAG ATGC? GACCC TATATT? TC? CAGT? TTTGG TGAACGTGTA T? CTAACAGC 120 TTCAAT? TC? T ?? TCCCCC? TATTAT? T? ? CT? TTAA? T T? TG? T? TAG? T? T? T? T? C 180 T? TCCAAAAT ACATTATTTA AACTGGAACA AGATATTATT ATTACTS TAGATACTT? 240 CT? TTACA? T AATCTTGTT? AAAAAGA? C? TTTTATAAAA TTATTTCT? G CCTACAT? GT 300 -TAAGAGGTAT GA? A? AAAT? TAGGAAT? TT? TTTCTTG? T T? TCCC? CTC TTGGTG? AT? 360 TTTCGTGAAA TTTATAGATA CGTGTATG? T GG ??? T? TTT G? G? TG ??? T C? G? T ?? GGT 420 GGTAAACGGA TATATATTCT ATTAT? TTT? CGAATAAGTA TATTCCTATC CCATAT? T ?? 480 CGTGTAA ??? GCT ??? GAA? TACG ?? TCCT TTGTTGT? T? TGGAACCGAA? TAAA? TCA? 540 TAATAAA? TC TTCA ?? GATT AGATATGCG? GTGTT? T ??? GTA? CGGAG TATATC? C T 600 CT? TCTGTTC GG ?? G ??? CT AGTTTATGG? ? C? GC? TCCC? TTG? GAT? AAAC? TAAGA 660 TTATTAATAA TATAAACAAT CATGAT? TGT AT? T? TTATA T? AAAAT? GA A? AAA? AAAT 720 AA 722 (2) INFORMATION FOR SEQUENCE ID No. 223: (i) SEQUENCE CHARACTERISTICS:! A) LENGTH: 234 base pairs B) TYPE: nucleic acid C) CEPA: Punic D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 223: AAACAATGCG CTTTAATATC A? AC? TGCAG GTGGAATAGG ATTGTCGATA AGTAATATAC 60 GAGCTAAGGG TACTTATATA TCCGGTATAA ACGGCAAATC TATGGT? T? G TACCTATGTT 120 AAGAATATAT AATAACACAG TTAGATATAT TAATCAGGGA GGTGATAAAA GACCAGGAGC 180 A? TGTCG? TT T? CC ?? TATAG? TGGC? CGC TGATAT? TTC G? TTTTCT ?? GCTT 234 (2) INFORMATION FOR SEQUENCE ID No. 224: (i) SEQUENCE CHARACTERISTICS: ÍA) LENGTH: 1025 base pairs B) TYPE: nucleic acid C) CEPA:, only D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (Xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 224: (Xi) SEQUENCE DESCRIPTION: SEQ ID NO -.224: GGTTGCTCCT A? CTTA? TAA GAT? ATCCAC C? AG? TAGTT TTATCCGTGG TAG? TGCATA 60"C? CA? C? GG? G? T? TCCT? ATTT? TCTCT? T? GTTT? TG GTTGTG? T? T CT? T? GT? T? 120 - .TGGG? CCGCC G ???? C? TG TATA? TCGTC GTG? C ?? T? G TTT ?? C? TCG TGTTT ?? T? T 180 CGACATC? TT TC? TC? TTTT T? TT? T? TTC? TGTTT? T? TGCGAAC ??? GC ??? TTC ?? 240 T? T? TTT? AA TTAGTGTT? T TGATGTGTCT AATTGTA ?? T? T? TG ?? T? G? TTCTTC? G 300 ACTATT? TTT? GTTT ??? T? CATCA? ATCC TTTTCTT? TT ????? CTCA? C ?? CTTT? T? 360 'ATCTAT? TTC TC? TT? CCA? GGTATTTATG CAATATGGTG TCTCC? C? TC T? TGT? CACT 420 GTTAATGTCA CCACC? TG? T AA? T? AGAA? CTTTATTACT TT? ATTGTA? C? TTCGT? TT 480 AAATGT ???? TA? C? ATG? A? TGGTGTTTT? TC? T? T? T? G? T? TCCC? TT TT? TT? GC 540? CCTTT? TT? ? GC? GT? T? ? T? C? TTTC TTTC? CTCT TTT ATTTA? ? T? CGTGC ?? 600 CGATGA? CTT A? AA? TGT? G CTAACATATC AGTGGCT? T? TT? TC? TCCT GTTTT? T? TT 660 TG? T? TT? TT CTTCTT? TAT TATCCATTTC CTTCTT? C ?? ? CT? TTTAAA CGAT ?? CC ?? 720 AATGTATTCA TGGGCTACT? ATAATAGCCA CATTACTAGA AAAAAAATTT TTTTTCAATA 7S0 TTATGACATT ATTACTTAAG TATTATTGAT AAGTCCTTCA TTGTTAAATG TAATAATATA 840 TATCGTTGTA TTTCTATAGG AATCCTCATC CAGT ACTAT GTTTCTTGCA GTGCTTCATA 900 ATTACATAAA TCGCTTTATC AATGTTAGAA TAATACATAT ATGTATlpT GATAATATTT 960 'TCTATATGTG ATCCATACAT TACTAAATTT TTTAATCTTA AAAAATTATC ATAATTGAGA 1020 - AGCTT 1025 (2) INFORMATION PAKA sequence 1-J MO . ¿(I) SEQUENCE CHARACTERISTICS: (A) LENGTH: 305 base pairs (B) TYPE: nucleic acid (C) CEPA: .double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) ) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 225: AAGCTTGG? T G? GC? ATAAG AGT? TACA ?? ATTTAGTGTT TC ?? TTCGCT C? TGG? TCAG 60 AAGT? G ?? T? T? T? GGTC ?? T? CG? F? TG? GATTTTTA ?? T? T? T? CCT? TTC? TGATA 120 AGTTTG? TGT GTTTTT ??? T? AGCAC? T? C TATCGT? TGT? CTT? GAG? T AAA? TAAAGA 180 AATCAGACC? C? GATATGTA ATGTTTGG? T TTTGGTT? TT T? TCTC? TTG G ??? TGTGTT 240"ATATTCG? TA AGG ?? C? TC? T? TGTCTGTT TCT? TG? TTC? GG? GG ?? TT ACC ??? CG? A 300 TTCCA 305 (2) INFORMATION FOR SEQUENCE ID No. 226: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1721 base pairs (B) TYPE: nucleic acid (C CEPA: public (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iü) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO 5 19 (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: 1..1721 (D) OTHER INFORMATION: (XÍ) SEQUENCE DESCRIPTION: SEQUENCE ID No. 226: ATG ?? T TCG G? T CCG GC? ? T? CT? TT? GTC TTG CT? TGT? C? TTT ACA 48 Met? Sn Ser? Sp Pro? The He Leu Leu Val Leu Leu Cys Thr Phe Thr 1 5 10 15? CC GCA A? T GC? G? C? CA TT? TGT? T? GGT T? C C? T GC? ? AT A? T TC? 96 Thr? La? Sn? The Asp Thr Leu Cys He Gly Tyr His Wing Asn Asn Ser 25 30 ACT GAC? CT GTT G? C? C? GT? CT? G ?? ?? G ?? T GT? ? C? GT? ? C? DC 144 Thr? Sp Thr Val? Sp Thr Val Leu Glu Lys? Sn Val Thr Val Thr His 35 40 45 TCT GTT? AC CTT CTA GA? G? C? G? C? T ?? C GGG ??? CT? TGT? AA CTA 192 Ser Val Asn Leu Leu Glu Asp Arg His Asn Gly Lys Leu Cys Lys Leu 50 55 60 AG? Gss GT? GCC CC? TTG C? T TTG GGT ??? TGT ?? C? TT GCT GGA TGG 240 Arg Gly Val Wing Pro Leu His Leu Gly Lys Cys Asn He Wing Gly Trp 65 70 75 80 CTC CTG GGA ?? C CCA GAG TGT G ?? TT? CT? TTC? C? GCA? GC TC? TGG 288 Leu Leu Gly? Sn Pro Glu Cys Glu Leu Leu Phe Thr? The Ser Ser Trp 85 90 95 TCT TAC ATT GTG GAA AC? TCT AAT TCA GAC AAT GGG AC? TGT TAC CCA 336 Ser Tyr He Val Glu Thr Ser Asn Ser Asp Asn Gly Thr Cys Tyr Pro 100 105 110 GGA G? T TTC? TC ?? T T? T G ?? G? G CT? ? G? GAG CAG TTG? GC TCA GTG 384 * Gly Asp Phe He Asn Tyr Glu Glu Leu Arg Glu Gln Leu Ser Ser Val 115 120 125 TCA TCA TTT GAA AG? TTT G? G? T? TTC CCC ?? G GC? AGT TCA TGG CCC 432 Ser Ser Phe Glu Arg Phe Glu He Phe Pro Lys? The Ser Ser Trp Pro 130 135 140 AAT CAT GA? ? CG AAC? TA GGT GTG ACG GC? GC? TGT CCT T? T GCT GG? 480 Asn His Glu Thr Asn He Gly Val Thr Ala? The Cys Pro Tyr? The Gly 145 150 155 160 GCA A? C AGC TTC TAC AGA AAC TTA ATA TGG CTG GTA AAA AAA GGA A? T 528 Ala? Sn Ser Phe Tyr? Rg? Sn Leu He Trp Leu Val Lys Lys Gly? Sn 165 170 175 TC? TAC CCA A? G CTC? GC ??? TCC TAT ATT ?? C ?? T ?? G G? G ?? G G ?? 576 Ser Tyr Pro Lys Leu Ser Lys Ser Tyr He Asn Asn Lys Glu Lys Glu 180 185 190 GTC CTC GTG CTA, TGG GGC ATT CAC CAT CCA CCT ACC AGT? CT G? C CAA 624 Val Leu Val Leu Trp Gly He His His Pro Pro Thr Ser Thr Asp Gln 195 '200 205 CAA AGT CTC TAC CAG AAT GCA GAT GCC TAT GTT TTT GTG GGG TCA TCA 672 Gln Ser Leu Tyr Gln Asn Wing Asp Wing Tyr Val Phe Val Gly Ser Ser 210 215 220 AAA TAC AAC AAG AAA TTC AAG CCA GAA AT? GCA ACA AGA CCC AAG GTG 720 Lys Tyr Asn Lys Lys Phe Lys Pro Glu He Wing Thr Arg Pro Lys Val 225 230 235 240 AGA GGT CAÁ GCA GGG AG? ? TG AAC TAT TAC TGG ACG CTA GTA AAG CCT 768 Arg Gly Gln Wing Gly Arg Met Asn Tyr Tyr Trp Thr Leu Val Lys Pro 245 250 255 GGA GAC AC? ? T? ? C? TTC GAA GCA ACT GGA A? T CT? GTG GT? DC? ? G? 816 Gly? Sp Thr He Thr Phe Glu? The Thr Gly? Sn Leu Val Val Pro? Rg 260 265 270 TAT GCC TTC GCA ATG AAA AG? GGT TCT GGA TCT GGT ATT ATC? TT TC? 864 Tyr? The Phe? The Met Lys? Rg Gly Ser Gly Ser Gly He He He Ser 275 280 285 G? T? C? DC? GTC CAC GAT TGT ?? ÁGG? CT TGT C? AACA'CCC AAA GGT 912? Sp Thr Pro Val His? Sp Cys? Sn Thr Thr Cys Gln Thr Pro Lys Gly 290 295 300 GCT? T? ?? C? CC AGC CTT CCA TTT CAG AAT ATA CAT CCA GTC ACA ATT 960 Wing He Asn Thr Ser Leu Pro Phe Gln Asn He His Pro Val Thr He 305 310 315 320 GGA GAA TGT CCA AAA TAT GTC AAA AGC AAA TTG AGA ATG GCT ACA 1008 Gly Glu Cys Pro Lys Tyr Val Lys Ser Thr Lys Leu Arg Met? Thr 325 330 335 GG? TT? ? GG ?? T? TC CCCS TCT? TT C ?? TCT? G? GGC CTG TTT GG? GCC 1056 Gly Leu? Rg Asn He Pro Ser He Gln Ser Arg Gly Leu Phe Gly Wing 340 345 350 ATT GCT GGC TTT ATT GAG GGG GGA TGG AC? GG? ? TG? T? G? T GGC TGG 1104 He? The Gly Phe He Glu Gly Gly Trp Thr Gly Met He Asp Gly Trp 355 360 365 TAC GGT TAT CAC CAT CAG AAT GAG C? G GGA TCA GG? T? T GC? GCC G? C 1152 Tyr Gly Tyr His His Gln? Sn Glu Gln Gly Ser Gly Tyr? La? La? Sp 370 375 380 CGA AAG AGC AC? CAG A? T GCC? TT G? C GGG? TC? CT ?? C ?? A GTA A? C 1200 Arg Lys Ser Thr Gln Asn Ala He Asp Gly He Thr Asn Lys Val? Sn 385 390 395 400 TCT GTT ATT GAA AAG ATG AAC ACA CA? TTC? C? GC? GTG GGT AAA GAA 1248 Ser Val He Glu Lys Met Asn Thr Gln Phe Thr Wing Val Gly Lys Glu "" • 405 410 415 TTC AAC CAC CTG GAA AAA AGA AT? GAG AAT TTA AAC AAA AEG GTT GAT 1296 Phe Asn His Leu Glu Lys Arg He Glu Asn Leu Asn Lys Lys Val Asp 420 425 30 GAT GGT TTT CTG GAT GTT TGG ACT TAC AAT GCC GAA CTG TTG GTT CTA 1344 Asp Gly Phe Leu Asp Val Trp Thr Tyr Asn Wing Glu Leu Leu Val Leu 435 440 445 TTG GAA AAT GAA AGA ACT TTG GAT TAT CAC GAT TCA AAT GTG AAG AAC 1392 Leu Glu Asn Glu Arg Thr Leu Asp Tyr His Asp Ser Asn Val Lys Asn 450 45S, 460 CTA TAT GAG AAA GTA AGA AGC CAG CTA? A A? C AAT GCC AAG GA? TT 1440 Leu Tyr Glu Lys Val? Rg Ser Gln Leu Lys? Sn? Sn? The Lys Glu He 465 470 475 80 GG? ? AT GGC TGC TTT GAA TTT TAC CAC A ?? TGT G? T G? C? CG TGC? TG 1488 Gly? Sn Gly Cys Phe Glu Phe Tyr His Lys Cys? Sp? Sp Thr Cys Met 485 490 495 GAG AGC GTC A? A? T GGG? CT T? T GAT TAC CC? ? AA TC CT? GAG GA? 1536 Glu Ser Val Lys? Sn Gly Thr Tyr? Sp Tyr Pro Lys Tyr Ser Glu Glu 500 505 510 GCA AAA CTA A? C? G? GAG G? G ATA G? T GGG GT? ?? G CTG GAA TCA AC? 1584 Wing Lys Leu Asn? Rg Glu Glu He Asp Gly Val Lys Leu Glu Ser Thr 515 520 525 AGG ATT TAC CAG ATT TTG GCG ATC T? T TC? ? CT GTC GCC? GT TCA TTG 1632 Arg He Tyr Gln He Leu Wing He Tyr Ser Thr Val Wing Being Ser Leu 530 535 540 GTA CTG TT? GTC TCC CTG GGG GCA ATC? GT TTC TGG? TG TGC TCC ?? T 1680 * Val Leu Leu Val Ser Leu Gly? La He Ser Phe Trp Met Cys Ser? Sn 545 550 555 560 GGG TCT TTA CAG TGC AG? ? T? TGT? TT T ?? T T? G G? T CC 1721 Gly Ser Leu Gln Cys? Rg He Cys He? Sn. ? 565 570 (2) INFORMATION FOR SEQUENCE ID No. 227: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 573 base pairs (B) TYPE:, nucleic acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 227: Met Asn Ser Asp Pro Ala lie Leu Leu Val Leu Leu Cys Thr Phe Thr 1 5 10 15 Thr? La-? Sn-? La? Sp Thr Leu Cys He Gly Tyr His? La? Sn? Sn Ser? 0 25 30 Thr? Sp Thr Val Asp Thr Val Leu Glu Lys Asn Val Thr Val Thr His 35 40 45 Ser Val Asn Leu Leu Glu Asp Arg His Asn Gly Lys Leu Cys Lys Leu 50 55 60 Arg Gly Val Wing Pro Leu His Leu Gly Lys Cys Asn He Wing Gly Trp 65 70 75 80 Leu Leu Gly Asn Pro Glu Cys Glu Leu Leu Phe Thr? The Ser Ser Trp 85 90 95 Ser Tyr He Val Glu Thr Ser? Sn Ser Asp Asn Gly Thr Cys Tyr Pro 100 105 110 Gly Asp Phe He Asn Tyr Glu Glu Leu Arg Glu Gln Leu Ser Ser Val 115 120 125 Being Ser Phe Glu Arg Phe Glu He Phe Pro Lys Wing Being Ser Trp Pro 130 135 140 Asn His Glu Thr Asn He Gly Val Thr Wing Wing Cys Pro Tyr Wing Gly 145 150 155 160? La? Sn Ser Phe Tyr Arg Asn Leu He Trp Leu Val Lys Lys Gly Asn 165 170 175 Be Tyr Pro Lys Leu Ser Lys Ser Tyr He Asn Asn Lys Glu Lys Glu 180 185 190 Val Leu Val Leu Trp Gly He His His Pro Pro Thr Ser Thr Asp Gln 195 200 205 Gln Ser Leu Tyr Gln? Sn? La? Sp? the Tyr Val Phe Val Gly Ser Ser 210 215 220 Lys Tyr? sn Lys Lys Phe Lys Pro Glu He Wing Thr? rg Pro Lys Val 225 230 235 240? rg Gly Gln? the Gly? rg Met? sn Tyr Tyr Trp Thr Leu Val Lys Pro 245. 250 255 «Gly? Thr He Thr Phe Glu? Thr Gly? Sn Leu Val Val Pro? Rg 260 265 270 Tyr? The Phe? The Met Lys? Rg Gly Ser Gly Ser Gly He He He Ser 275 280 285 \ Asp Thr Pro Val His Asp Cys? Sn Thr Thr Cys Gln Thr Pro Lys Gly 290 295 300? The He? Sn Thr Ser Leu Pro Phe Gln? Sn He His Pro Val Thr He 305 310 315 320 Gly Glu Cys Pro Lys Tyr Val Lys Ser Thr Lys Leu Arg Met Ala Thr 325 330 335 Gly Leu Arg? Sn He Pro Ser He Gln Ser? Rg Gly Leu Phe Gly? 340 345 350 He? La Gly Phe He Glu Gly Gly Trp Thr Gly Met He? Sp Gly Trp 355. 360 365 Tyr Gly Tyr His? Is Gln Asn Glu Gln Gly Ser Gly Tyr Wing Wing ASD 370 - - • 375 380? Rg Lys Ser Thr Gln? Sn? The He? Sp Gly He Thr? Sn Lys Val Asn 385 390 395 400 Ser Val He Glu Lys Met Asn Thr Gln Phe Thr Wing Val Gly Lys Glu 405 410 415 Phe Asn His Leu Glu Lys Arg He Glu Asn Leu Asn Lys Lys Val Asp 420 425 430 Asp Gly Phe Leu Asp Val Trp Thr Tyr Asn Wing Glu Leu Leu Val Leu 435 440 445 Leu Glu? Sn Glu Arg Thr Leu Asp Tyr His Asp Ser Asn Val Lys Asn 450 455 460 Leu Tyr Glu Lys Val Arg Ser Gln Leu Lys Asn Asn Wing Lys Glu He 465 470 475 480 Gly Asn Gly Cys Phe Glu Phe Tyr His Lys Cys Asp Asp Thr Cys Met 485 490 495 Glu Ser Val Lys Asn Gly Thr Tyr? Sp Tyr Pro Lys Tyr Ser Glu Glu 500 505 510 Wing Lys Leu Asn Arg Glu Glu He Asp Gly Val Lys Leu Glu Ser Thr 515 S20 525 Arg He Tyr Gln He Leu Wing He Tyr Ser Thr Val Wing Ser Ser Leu S30 535 540 Val Leu Leu Val Ser Leu Gly Ala He Ser Phe Trp Met Cys Ser "Asn 545 550 555 560 Gly Ser Leu Gln Cys Arg He Cys He Asn Asp 565 570 (2) INFORMATION FOR SEQUENCE ID No. 228: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1414 base pairs (Bj TYPE: nucleic acid (C) CEPA: Punic (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL : NO (iv) ANTI-SENSE: NO (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B LOCATION: 1 ... 1414 (D) OTHER INFORMATION: (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 228: ATG AAT TCA AAT CA? ? AA AT? ? T? ? CC? TT GGG TC? ATC TGT CTG AT? 48 Met? Sn Ser? Sn Gln Lys He He Thr He Gly Ser He Cys Leu He 1 5 10 15 GTT GGA ATA GTT AGT CTA TTA TTG CAG ATA GGA AAT AT? GTC TCG TTA 96 Val Gly He Val - Be Leu Leu Leu Gln He Gly Asn He Val Be Leu 20-, 25 3rd TGG AT? AGC CAT TCA ATT CAG ACT GGA GAA AAA AAC CAC TCT GAG ATA 144 Trp He Ser His Ser He Gln Thr Gly Glu Lys Asn His Ser Glu He 35 40 45 TGC AAC CAA AAT ATC ATT ACA TAT GAA AAC AAC ACA TGG GTG AAC CA 192 Cys Asn Gln Asn He He Thr Tyr Glu Asn Asn Thr Trp Val Asn Gln 50 55 60 ACT TAT GTA AAC ATT AGC AAT ACC AAC ATT GCT GAT GGA CAG GGC GTG 240 Thr Tyr Val Asn He Ser Asn Thr Asn He Wing Asp Gly Gln Gly Val 65 70 75 80 ACT TCA ATTA AT? CT? GCC GGC? AT CCT CTT TGC CCA AT? TT GGG 288 Thr Ser He He Leu? The Gly Asn Pro Pro Leu Cys Pro He He Gly 85 90 95 TGG GCT AT? T? C? GC ??? ?? C A? T? GC? T? AGG? TT GGT CCC ??? GG? 336 Trp? La He Tyr Ser Lys? Sn? Sn Ser He? Rg He Gly Pro Lys Gly 100 105 110 ?? C ATT TTT GTC ATA AAA AAA CCA TCC ATT TCA TGC TCT CAC TTG GAG 384 Asn He Phe Val He Lys Lys Pro Ser He Ser Cys Ser His Leu Glu 115 120 125 TGC A ?? ? CC TTT TTC CTG? CC C ?? GGT GCT TTG CT? TG? C? GG C? T 432 Cys Lys Thr Phe Phe Leu Thr Gln Gly? The Leu Leu Asn Asp? Rg His 130 135 140 CCT AAT GGA ACC GTC A? GG? C? GG? GC CCT T? C CG? ? CC TTA ATG AGC 480 Pro? Sn Gly Thr Val Lys Asp Arg Ser Pro Tyr Arg Thr Leu Met Ser 145 150 155 160 TGC CCG ATC GGT GA? GCT CC? TCT CCG T? T ?? T TC? ? G? TTC GAA TC? 528 Cys Pro He Gly Glu? Pro Pro Pro Tyr? Sn Ser? Rg Phe Glu Ser 165 «170 175 GTT GCT TGG TC? GCA AGT GCA TGC CAT GAT GG? ? TG GG? TGG CT? ? C? 576 Val Wing Trp Wing Wing Wing Cys His Asp Gly Met Gly Trp Leu Thr 180 185 190 ATC GGG ATT TCC GGT CCA GAT A? T GG? GC? GTG GCT GTT TTG? AA TAC 624 He Gly He Ser Gly Pro Asp Asn Gly Wing Val Wing Val Leu Lys Tyr 195 200 205 AAT GGT ATA ATA ACA GAT ACA ATA AAA AGT TGG AGA AAC AAA ATA CTA 672 Asn Gly He He Thr Asp Thr He Lys Ser Trp Arg Asn Lys He Leu 210 215 220 AGA ACA CAA GAG TCA GAA TGT TGT ATA AAC GGT TCA TGT TTT ACT 720? Rg Thr Gln Glu Ser Glu Cys Val Cys He Asn Gly Ser Cys Phe Thr 225 rf 230 235 240 ATA ATG-? CT-GAT GGC CC? ? GC ?? T GGG CAÃ GCC TCG TAC AA? ? T? TTC 768 He Met Thr Asp Gly Pro Being Asn Gly Gln Wing Being Tyr Lys He Phe 245 250 255 CCA GTA CTT TCT ?? T GG? GC? ? AT GGA GTG AAA GGA TTC TC? TTT? GA 1056 Pro Val Leu Ser Asn Gly? The? Sn Gly Val Lys Gly Phe Ser Phe? Rg 340 345 350 TAT GGC A? T GGT GTT TGG? T? GG? ? G? ? CT ??? ? GT? TC? GC TCT? G? 1104 Tyr Gly? Sn Gly Val Trp He Gly? Rg Thr Lys Ser He Ser Ser Arg 355 360 365 AGT GGA TTT GAG ATG ATT TGG GAT CC? A? T GGA TGG ACG GAA ACT GAT 1152 Ser Gly Phe Glu Met He Trp Asp Pro? Sn Gly Trp Thr Glu Thr? Sp 370 «375 380 AGT AGT TTC TCT AT? ?? G C? G G? T? TT? T? GC? TT? ? CT G? T TGG TC? 1200 Ser Ser Phe Ser He Lys Gln? Sp He He? The Leu Thr? Sp Trp Ser 385 390 395 400 GGA TAC AGT GGA AGT TTT GTC CAT CAT CCT G ?? TT? ? C? GGA ATG A? C 1248 Gly Tyr Ser Gly Ser Phe Val Gln His Pro Glu Leu Thr Gly Met? Sni 405 410 415 j TGC ATA AGG CCT TGT TTT TGG GTA G? G TT? ? TC? G? GG? C ?? CCC ?? G 1296 Cys He Arg Pro Cys Phe Trp Val Glu Leu He Arg Gly Gln Pro Lys 420 425 430 GAG AGC ACA ATC TGG ACT? GT GG? ? GC? GC? TT TCT TTC TGT GGC GTG 1344 Glu Ser Thr He Trp Thr Ser Gly Ser Be He Ser Phe Cys Gly Val 435 440 445 GAC AAT GAA ACC GCA AGC TGG TCA TGG CCA GAC GGA GCT GAT CTG CCA 139 Asp Ala Asp Leu Pro TTC ACC? TT GAC AAG TAG ATC T 41 tl. Phe Thr He Asp Lys "« 465 470 (2) INFORMATION FOR SEQUENCE ID No. 229: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 471 base pairs (B) TYPE: nucleic acid (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: protein (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 229: Met Asn Being Asn Gln Lys He He Thr He Gly Being He Cys Leu He 1 5 10 15 Val Gly He Val Ser Leu Leu Leu Gln He Gly Asn He Val Ser Leu 20 25 30 Trp He Ser His Ser Gln Thr Gly Glu Lys Asn His Ser Glu He 35 40 45 Cys Asn Gln Asn He He Thr Tyr Glu? Sn? sn Thr Trp Val Asn Gln. 50 55 60 Thr Tyr Val Asn He Ser? Sn Thr? Sn He? La? Sp Gly Gln Gly Val ' 65 70 75 80 Thr Ser He He Leu? The Gly? Sn Pro Pro Leu Cys Pro He He Gly 85 90 95 1 Trp? The He Tyr Ser Lys Asn Asn Ser He Arg He Gly Pro Lys Gly 100 105 not Asn He Phe Val He Lys Lys Pro Ser He Ser Cys Ser His Leu Glu 115 120 125 Cys Lys Thr Phe Phe Leu Thr Gln Gly Ala Leu Leu Asn Asp Arg His 130 «135 140 Pro Asn Gly Thr Val Lys Asp Arg Ser Pro Tyr Arg Thr Leu Met Ser 145 150 155 160 Cys Pro He Gly Glu Pro Wing Pro Pro Tyr Asn Ser? Rg Phe Glu Ser 165 170 175 Val Wing Trp Wing Wing Wing Cys His Asp Gly Met Gly Trp Leu Thr 180 185 190 Ile G He Ser Gly Pro Asp Asn Gly Wing Val The Val Leu Lys Tyr 195 200 205 Asn Gly He He Thr Asp Thr He Lys Ser Trp Arg Asn Lys He Leu 210 215 220 Arg Thr Gln Glu Ser Glu Cys Val Cys He Asn Gly Ser Cys Phe Thr 225 230 235 240 He Met Thr Asp Gly Pro Gly Asn Ser Ala Gln Ser Tyr Lys Phe I '245 250 255 Lys Gly Lys Met Glu_Lys Lys Ser He He Val Ala Glu Asp Leu Pro Asn Tyr 260 265 270 His Tyr Glu Glu Cys Ser Cys Tyr Pro Asp Thr Gly Lys Val 275 280 285 Val Cys Val Cys Arg Asp Asn Trp His Wing Ser Asn Arg Pro Trp Val 290 295 300 Ser Phe? Sp Gln? Sn Leu Asp Tyr Gln He Gly Tyr He Cys Ser Gly 305 310 315 320 Val Phe Gly Asp Asn Pro Arg Ser Asn Asp Gly Lys Gly Asn Cys Gly 325 330 335 Pro Val Leu Ser Asn Gly Ala Asn Gly Val Lys Gly Phe Ser Phe Arg 340 345 350 Tyr Gly Asn Gly Val Trp He Gly Arg Thr Lys Ser I Ser Ser Arg 355 360 365 Ser Gly Phe Glu Met He Trp Asp Pro Asn Gly Trp Thr Glu Thr? Sp 370 375 380 Ser Ser Phe Ser He Lys Gln? Sp He He? The Leu Thr? Sp Trp Ser 385 390 395 400 Gly Tyr Ser Gly Ser Phe Val Gln His Pro Glu Leu Thr Gly Met? Sn 405 410 415 Cys He Arg Pro Cys Phe Trp Val Glu Leu He? Rg Gly Gln Pro Lys 420,425,430 Glu Ser Thr I Trp Thr Ser Gly Ser Ser've Ser Phe Cys Gly Val 435440445? Sp? Sn Glu Thr? Ser Trp Ser Trp Pro? Sp Gly? La? Sp Leu Pro 450 455 460 Phe Thr He? Sp Lys. He 465 470 (2) INFORMATION FOR SEQUENCE ID No. 230: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1501 base pairs (B) TYPE: nucleic acid (C) CEPA:, unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (gendmica) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B LOCATION: 1..1501 (D) OTHER INFORMATION: (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 230: ATG AAT TCT CAA GGC ACC AAA CGA TCA TAT GAA CAA ATG GAG ACT GGT 48 Met Asn Ser Gln Gly Thr Lys Arg Ser Tyr Glu Gln Met Glu Thr Gly 1 * 5 10 15 * CGC GGG CAG GAA ACA GAT GCC AGA GCA TCT ATC GAA GGA AGA GTC ATG Gln Arg 96 Gly Glu Asp Ala Glu Thr Arg Ala Ser He Arg Val Gly Met 20 25 30 GGT ATT GGA GGA AG ATC? TTC T? C ATC CAA ATG TGC ACT GAA CTC A ?? 144 He Gly Gly He Gly? Rg Phe Tyr He Gln Met Cys Thr Glu Leu Lys 35 40 4S CTC? GT GAC TAT GAG GGA CGA CTA ATT CA? ? AT AGC ATA AC? ATA GAG 192 Leu Ser Asp Tyr Glu Gly Arg Leu He Gln Asn Ser He Thr He Glu 50 55 60 AGA ATG GTG CTC TCT GCT TTT GAT GAG AGA AGG AAT AAA TAC CTA GAA 240 Arg Met Val Leu Ser Ala Phe Asp Glu? Rg? Rg? Sn Lys Tyr Leu Glu 65 70 75 80 GAG CAT CCC AGT GCT GGG A? G GAT CCT AAG A ?? ? CT GGA GGA CCC? T? 288 Glu His Pro Ser? The Gly Lys? Sp Pro Lys Lys Thr Gly Gly Pro He 85 90 95 TAT AG? ? GG GT? G? C GGA AAA TGG ATG AG? G ?? CTC? TC CTT T? T G? C 336 Tyr? Rg Arg Val Asp Gly Lys Trp Met Arg Glu Leu He Leu Tyr? Sp 100 105 110 AAA GA? G ?? ? T? ? GG AGA GTT TGG CGC CA? GC? ?? C ?? T GGT G? G G? T 384 Lys Glu Glu He? Rg Arg Val Trp Arg Gln Ala? Sn? Sn Gly Glu? Sp 115 120 125 GC? ? C? GCC GGT CTT ACT CAC? TC? TG? TT TGG C? C TCC ?? T CTT ?? T Ala Thr Ala Gly Leu Thr His He Met He Trp His Ser Asn Leu Asn 130 135 140 G? T GCC? CC T? T C? G AGA AC? ? G? GCG CTT GTT CGC? CT GG? ? TG GAT 480 Asp Wing Thr Tyr Gln Arg, Thr Arg? Leu Val? Rg Thr Gly Met? Sp 145 ISO 155 160 ccc AGA ATG TGC tcc CTA ATG CAÁ GGT TCA AC? CTT CCC AGA AGG TCT Pro Ara Met Cys Ser Leu Met Gln Gly Ser Thr Leu Pro Arg Arg Ser 165 170 17S GGG GCC GC? GGT GCT GC? GTG ??? GG? GTT GG? ? C? ? T? GC? ? TG G? G Gly? The Wing Gly Ala Wing Val Lys Gly Val Gly Thr He? The Met Glu 180 185 19 ° TTA ATC AGA ATG ATC AAA CGT GGA ATC AAT GAC CGA A? C TTC TGG? GG 624". m Leu He Arg Met He Lys Arg Gly He Asn Asp Arg? Sn Phe Trp? Rg 195 200 2Ó5 GGT G ?? ?? T GG? CG AGG? C? ? GG ATT GCA TAT G ?? ? G? TG TGC ?? T 672 Gly Glu Asn Gly Arg Arg Thr Arg He Ala Tyr Glu Arg Met Cys? Sn 210 215 220 ATT CTC. .A ??. GGA AA? TTT CAG AC? GCT GCC CAG AGG GCA ATG ATG GAT 720 He Leu Lys Gly Lys Phe Gln Thr? Wing Gln Arg Wing Met Met Asp 225 230 235 240 CAA GTA AGA GAA AGT CGA AAC CCA GGA AAC GCT GAA ATT GAA GAT CTC 768 Gln Val Arg Glu Ser Arg Asn Pro Gly Asn Ala Glu He Glu Aso Leu 245 250 255 ATT TTC CTG GCA CGG TCA GCA CTT ATT CTA AGG GGG TCA GTT GC? CAT 816 He Phe Leu Ala Arg Be Ala Leu He Leu? Rg Gly Ser Val Ala His 260 265 270 AAG TCC TGC CTG CCT GCT TGT GTG TAT GGG CTT GCA GTA GC? AGT GGG 864 Lys Ser Cys Leu Pro Wing Cys Val Tyr Gly Leu Wing Val Wing Ser Gly 275 280 285 CAT GAC TTT GA? ? G? G? A GG? T? T TC? CTG GTC GGG? T? G? C CCC TTC 912 His Asp Phe Glu Arg Glu Gly Tyr Ser Leu Val Gly He Asp Pro Phe 290 295 300 A ?? TT? CTT CAÁ A? C? GT C ?? GTG TTC? GC CTG? TC? G? DC? ?? T ?? 960 Lys Leu Leu Gln? Sn Ser Gln Val Phe Ser Leu He? Rg Pro Asn Glu 305 310 315 320 AAC CCA GCT CAC AAG AGT CA? TTG GTG TGG ATG GCA TGC C? T TCT GCT 1008? Sn Pro? His Lys Ser Gln Leu Val Trp Met? La Cys His Ser? La 325 330 335 GC? TTT GAG GAT TTA? G? ? T? TC? ? GT TTC? T? ? G? GGG ?? G ??? GTG 1056? The Phe Glu? Sp Leu? Rg He Ser Ser Phe He? Rg Gly Lys Lys Val 340 345 350 GTT CCA AG? GGA A? G CTT TCC? C? ? G? GGG GTT C? G? TT GCT TCA AAT 1104 Val Pro Arg Gly Lys Leu Ser Thr Arg Gly Val Gln He Ala Ser Asn 355. 360 365 GAG A? T GTG GAA < 5CT ATG G? C TCT? GT? CC CT? ??? CT? ? G? ? GC? G? 1152 Glu Asn Val Glu Ala Met Asp Ser Ser Thr Leu Ly3 Leu Arg Ser Arg 370 375 380 TAT TGG GCC ATA AGG? CC? G? ? GT GG? GGA A? T? CC ?? CA CAG A? G 1200 Tyr Trp? He? Rg Thr? Rg Ser Gly Gly? Sn Thr? Sn Gln Gln Lys 385 390 395 400 GC? TCT GCG GGC C? G ATC AGT GTG CAÁ CCT ACA TTC TCA GTG CAÁ CGG 1248 Wing Being Wing Gly Gln He Ser Val Gln Pro Thr Phe Ser Val Gln Arg 405 410 415 AAT CTC CCT TTT GAA AG? GC? ? CC GTT? TG GCA GCT TTC AGC GGG AAT 1296 Asn Leu Pro Phe Glu Arg Wing Thr Val Met Wing Wing Phe Ser Gly Asn 420 425 430 AAT GAG GGA CGG ACA TCA GAC ATG CGA ACG GAA GTT ATA AGG ATG ATG 1344 Asn Glu Gly Arg'Thr Being Asp Met Arg Thr Glu Val He Arg Met Met -435- 440 445 GAA AGT GCA AÁG CCA GAA GAT TTG TCC TTC CAG GGG CGG GGA GTC TTC 1392 Glu Be Ala Lys Pro Glu Asp Leu Ser Phe Gln Gly Arg Gly Val Phe 450 455 460 GAG CTC TCG GAC GAA A? G GCA ACG AAC CCG ATC GTG CCT TCC TTT GAC 1440 Glu Leu Ser Asp Glu Lys Wing Thr Asn Pro lie Val Pro Ser Phe Asp 465 470 475 480 ATG AGT AAT GAA GGG TCT TAT TTC TTC GGA GAC A? T GC? G? G G? G TAT 1488 Met Ser Asn Glu Gly Ser Tyr Phe Phe Gly Asp Asn Wing Glu Glu Tyr 485 490 495 GAC AAT TGA ATT C .1501? Sp? Sn. He ___ 500 (2) INFORMATION FOR SEQUENCE ID No. 231: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 500 amino acids (B) TYPE:, amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE : protein (xi) SEQUENCE DESCRIPTION: SEQUENCE ID No. 231: Met Asn Ser Gln Gly Thr Lys Arg Ser Tyr Glu Gln Met Glu Thr Gly 1 5 10 15 Gly Glu Arg Gln Asp Wing Thr Glu He Arg? The Ser Val Gly? Rg Met 20 25 30 He Gly Gly He Gly? Rg Phe Tyr He Gln Met Cys Thr Glu Leu Lys 35 40 45 Leu Ser? Sp Tyr Glu Gly? Rg Leu He Gln? Sn Ser He Thr He Glu 50 55 60 Arg Met Val Leu Ser Wing Phe Asp Glu Arg Arg? Sn Lys Tyr Leu Glu 65"70 75 80 Glu His Pro Ser? The Gly Lys? Sp Pro Lys Lys Thr Gly Gly Pro He 85 90 95 Tyr Arg Arg Val Asp Gly Lys Trp Met Arg Glu Leu He Leu Tyr Asp 100 Ios 110 Lys Glu Glu He Arg Arg Val Trp Arg Gln Wing Asn Asn Gly Glu Asp 115 120 125 Wing Thr Wing Gly Leu Thr His He Met He Trp His Ser Asn Leu Asn 130 135 140 Asp Wing Thr Tyr Gln Arg Thr Arg Wing Leu Val Arg Thr Gly Met Asp 145 150 155 160 Pro Arg Met Cys. Be Leu Met Gln Gly Be Thr Leu Pro Arg Arg Ser ^ 165 170 175 Gly Ala'Ala'Gly Wing Wing Val Lys Gly Val Gly Thr He Wing Met Glu 180 185 190 Leu lie Arg Met He Lys Arg Gly He Asn Asp Arg Asn Phe Trp Arg 195 200 205 Gly Glu Asn Gly Arg Arg Thr Arg He Wing Tyr Glu Arg Met Cys Asn 210 215 220 He Leu Lys Gly Lys Phe Gln Thr Wing Wing Gln Arg Wing Met Met? Sp 225 230 235 240 Gln Val? Rg Glu Ser? Rg? Sn Pro Gly Asn Wing Glu He Glu Asp Leu 245 250 255 He Phe Leu Ala Arg Be Ala Leu He Leu Arg Gly Ser Val? La His 260 265 270 Lys Ser Cys Leu Pro Wing Cys Val Tyr Gly Leu Wing Val Wing Ser Gly 27S 280 285 His Asp Phe Glu Arg Glu Gly Tyr Ser Leu Val Gly He Asp Pro Phe 290 295 300 Lys Leu Leu Gln Asn Ser Gln Val Phe Ser Leu He Arg Pro? Sn Glu 305 310 315 320? Sn Pro? La His Lys Ser Gln Leu Val Trp Met? La Cys His Ser Ala 325 330 335 Wing Phe Glu Asp Leu Arg Be Ser Be Phe He Arg Gly Lys Lys Val 340 345 350 Val Pro? Rg Gly Lys Leu Ser Thr? Rg Gly Val Gln He? Ser? Sn 355 360 365 Glu? Sn Val Glu Ala Met Asp Being Thr Leu Lys Leu Arg Being Arg 370 375 380 Tyr Trp? The He? Rg Thr? Rg Being Gly Gly? Sn Thr? Sn Gln Gln Lys 385 390 395 400? The Being? The Gly Gln He Being Val Gln Pro Thr Phe Ser Val Gln? Rg 405 * 410 415? Sn Leu Pro Phe Glu? Rg? The Thr Val Met? The? The Phe Ser Gly? Sn 420 425 430? Sn Glu Gly? Rg Thr Ser? Sp Met? Rg Thr Glu Val He? Rg Met Met 435 440 445 Glu Be Wing Lys Pro Glu Asp Leu Ser Phe Gln Gly Arg Gly Val Phe 450 455 460 Glu Leu Ser Asp Glu Lys Wing Thr? Sn Pro He Val Pro Ser Phe? Sp 465 470 475 480 Met Ser Asn Glu Gly Ser Tyr Phe Phe Gly Asp Asn Wing Glu Glu Tyr 485 490 495 Asp Asn. I have 500

Claims (39)

R E I V I N D I C A C I O N S

1. A recombinant pig pustular disease virus comprising a first foreign DNA inserted into a genome of pig pustular disease virus, wherein the first foreign DNA is inserted into an EcoRI site within a region corresponding to a subfragment of 3.2 kb of the HindIII fragment K which contains both the HindIII and an EcoRI site, of the pig pustular disease virus genome and is expressed in a host cell within which the virus is introduced.

2. A recombinant pig pustular disease virus comprising both a) a first foreign DNA inserted into a genome of pig pustular disease virus, wherein the first foreign DNA is inserted into the EcoRI site within a region corresponding to the subfragment of 3.2 kb of the HindIII K fragment which contains both the HindIII site and an EcoRI, and b) a second foreign DNA inserted into a genome of pig pustular disease virus, where the second foreign DNA is inserted into an Accl site within a region corresponding to the HindIII to BglII subfragment of 3.6 kb of the M fragment of HindIII, and wherein both the first foreign DNA and the second foreign DNA are expressed in a host cell into which the virus is introduced.

3. The recombinant pig pustular disease virus as claimed in clauses 1 or 2 characterized in that the first foreign DNA encodes a polypeptide.

4. The recombinant pig pustular disease virus as claimed in clause 2 characterized in that the second foreign DNA encodes a polypeptide.

5. The recombinant pig pustular disease virus as claimed in clauses 1 or 2 characterized in that the first foreign DNA encodes E. coli β-galactosidase or E. coli jβ-glucuronidase.

6. The recombinant pig pustular disease virus as claimed in clause 2 characterized in that the second foreign DNA encodes E. coli β-galactosidase or E. coli 0-glucuronidase.

7. The recombinant pig pustular disease virus as claimed in clauses 1 or 2 characterized in that the first foreign DNA is under the control of the upstream heterologous promoter.

8. The recombinant pig pustular disease virus as claimed in clause 2 characterized in that the second foreign DNA is under the control of the upstream heterologous promoter.

9. The recombinant pig pustular disease virus as claimed in clauses 7 or 8, characterized in that the promoter is: the viral promoter of synthetic pustular disease, the late synthetic promoter 1 of pustular disease, the initial promoter 2 of pustular disease , the synthetic late promoter 2 promoter 2 of pustular disease, the synthetic pustular disease initial promoter 2, the pustulose disease OlL promoter, the pustular disease I4L promoter, the pustular disease I3L promoter, the pustular disease I2L promoter, the I1L promoter of pustular disease, the ElOR promoter of pustular disease, PRX gX, HSV-1 alpha 4, the internal ribosomal entry site, or the immediately initial HCMV.

10. The recombinant pig pustular disease virus as claimed in clauses 3 or 4, characterized in that the polypeptide is: swine influenza virus haemagglutinin, swine influenza virus neuraminidase, pig influenza virus matrix or the nucleoprotein of swine influenza virus.

11. The recombinant pig pustular disease virus as claimed in clause 2 characterized in that it is designated as S-SPV-120.

12. The recombinant pig pustular disease virus as claimed in clause 1, characterized in that it is designated as S-SPV-121.

13. The recombinant pig pustular disease virus as claimed in clause 1 characterized in that it is designated as S-SPV-122.

14. The recombinant pig pustular disease virus as claimed in clauses 1 or 2 characterized in that the first foreign DNA encodes a cytokine.

15. The recombinant pig pustular disease virus as claimed in clause 2 characterized in that the second foreign DNA encodes a cytokine.

16. The recombinant pig pustular disease virus as claimed in clauses 3 or 4 characterized in that the polypeptide is: pig influenza virus hemagglutinin, pig influenza virus neuraminidase, swine influenza virus matrix, nucleoprotein of pig influenza virus, seudorabies virus glycoprotein B, seudorabies virus glycoprotein C, seudorabies virus glycoprotein D, porcine reproductive respiratory virus ORF 2, porcine reproductive respiratory virus ORF 3, porcine reproductive respiratory virus ORF 4, virus ORF 5 porcine reproductive respiratory, porcine reproductive respiratory virus ORF 6, or porcine reproductive respiratory virus ORF 7.

17. The recombinant pig pustular disease virus as claimed in clause 2 characterized in that it is designated as S-SPV-131.

18. The recombinant pig pustular disease virus as claimed in clause 2, characterized in that it is designated as S-SPV-132.

19. The recombinant pig pustular disease virus as claimed in clauses 3 or 4 characterized in that the polypeptide is: a surface protein of feline leukemia virus, a transmembrane protein of feline leukemia virus, or a virus gag of feline leukemia, a transmembrane protease of feline leukemia virus, a protease / gag of feline immune deficiency virus, an envelope of feline immune deficiency virus, a protease / gag of feline leukemia virus, an envelope of leukemia virus feline, VP2 of canine parvovirus or VP1 / 2 of canine parvovirus.

20. The recombinant pig pustular disease virus as claimed in clause 2 characterized in that it is designated as S-SPV-127.

21. The recombinant pig pustular disease virus as claimed in clause 2, characterized in that it is designated as S-SPV-128.

22. The recombinant pig pustular disease virus as claimed in clause 2 characterized in that it is designated as S-SPV-205.

23. The recombinant pig pustular disease virus as claimed in clause 2, characterized in that it is designated as S-SPV-206.

24. The recombinant pig pustular disease virus as claimed in clause 2, characterized in that it is designated as S-SPV-207.

25. The recombinant pig pustular disease virus as claimed in clauses 3 or 4, characterized in that the polypeptide is: interleukin-12 protein of bovine cytokine, interleukin-12 protein of bovine cytokine, glycoprotein G of initial virus bovine respiratory disease, bovine respiratory syncytial virus fusion, Newcastle disease fusion, Newcastle disease haemagglutinin, infectious rhinotracheitis virus glycofotein D, canine distemper virus fusion, canine distemper virus hemagglutinin, DVHA, virus glycoprotein 45 of bovine viral diarrhea type 1, bovine viral diarrhea virus type 1 glycoprotein 48, type 1 viral bovine diarrhea virus glycoprotein 53, or bovine type 2 viral diarrhea virus glycoprotein 53.

26. The recombinant pig pustular disease virus as claimed in clause 2 characterized in that it is designated as S-SPV-142.

27. The recombinant pig pustular disease virus as claimed in clause 2, characterized in that it is designated as S-SPV-143.

28. The recombinant pig pustular disease virus as claimed in clause 2 characterized in that it is designated as S-SPV-176.

29. The recombinant pig pustular disease virus as claimed in clause 2, characterized in that it is designated as S-SPV-184.

30. The recombinant pig pustular disease virus as claimed in clause 2, characterized in that it is designated as S-SPV-185.

31. The recombinant pig pustular disease virus as claimed in clause 2, characterized in that it is designated as S-SPV-188.

32. The recombinant pig pustular disease virus as claimed in clause 2, characterized in that it is designated as S-SPV-202.

33. A recombinant pig pustular disease virus designated S-SPV-164.

34. A recombinant pig pustular disease virus designated S-SPV-183.

35. A recombinant pig pustular disease virus designated S-SPV-198.

36. A virus of recombinant pig pustular disease designated as S-SPV-200.

37. A recombinant pig pustular disease virus designated S-SPV-217.

38. A vaccine useful for immunizing an animal against the pig pustular disease virus comprising an effective immunizing amount of the recombinant pig pustular disease virus of any of clauses 1, 2 or 32-36 and a suitable carrier.

39. A method for immunizing an animal against a pathogen which comprises administering to the animal an effective immunizing dose of the vaccine as claimed in clause 38. SUMMARY This invention provides a recombinant pig pustular disease virus comprising a foreign DNA inserted into a genome of pig pustular disease virus, wherein the foreign DNA is inserted into a) an Accl site within a region corresponding to a subfragment from HindIII to BglII of 3.2 kb of the HindIII M fragment and b) an EcoRI site within a region corresponding to a 3.2 kb subfragment of the HindIII K fragment which contains both a HindIII and EcoRI site of the genome of the pustular disease virus of pig and is capable of being expressed in a host cell within which the virus is introduced. The invention further provides vaccines and immunization methods of the recombinant pig pustular disease virus.