AU7215900A - Recombinant fowlpox viruses and uses thereof - Google Patents

Description

Q:0pcr\EJ'h\Dm bba\3639.px. ynvdivage .34.dm-g/120 -1- Regulation 3.2

AUSTRALIA

Patents Act 1990 COMPLETE SPECIFICATION FOR A DIVISIONAL PATENT

(ORIGINAL)

o e* °e oo.

Name of Applicant: Actual Inventors: Address for Service: Invention Title: SYNTRO CORPORATION Mark D. COCHRAN, David E. JUNKER and Philip A.

SINGER

DAVIES COLLISON CAVE, Patent Attorneys, Level 3, 303 Coronation Drive, Milton, Queensland, 4064, Australia "Recombinant fowlpox viruses and uses thereof' Details of Parent Application No: 64819/96 The following statement is a full description of this invention, including the best method of performing it known to us: WO 96/40880 PCT/US96/11187 la RECOMBINANT FOWLPOX VIRUSES AND USES THEREOF Within this application several publications are referenced by arabic numerals within parentheses. Full citations for these references may be found at the end of the specification immediately preceding the claims. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this invention pertains.

BACKGROUND OF THE INVENTION 20 The present invention relates to recombinant fowlpox virus useful in live vaccine to protect fowl against Newcastle disease virus and fowlpox virus.

The ability to isolate DNA and clone this isolated DNA into bacterial plasmids has greatly expanded the approaches available to make viral vaccines. The method used to make the present invention involve modifying cloned DNA sequences by insertions, deletions and single or multiple base changes. The modified DNA is then 30 inserted into a viral genome, and the resulting virus may then be used in a vaccine to elicit an immune response in a host animal and provide protection to the animal against disease.

Fowlpox virus (FPV) is a member of the poxviridiae family of viruses. There are two subfamilies in this classification, and they are differentiated based upon WO 96/40880 PCT/US96/11187 -2the host range (vertebrate or invertebrate) of the virus.

Among the vertebrate poxviruses, there is serological cross reactivity to group specific antigens that has aided in classification of the viruses into six genera, and FPV has been placed in the avipoxvirus genera along with seven additional poxviruses that primarily infect birds. In general, poxviruses are the largest of the animal viruses and can be visualized with the light microscope. Under the electron microscope, the virus takes on a biscuit like or oval shaped appearance. The principal chemical components of the poxviruses are protein (90% by weight), deoxyribonucleic acid (DNA) and lipid but in FPV the lipid component is -1/3 of the dry weight. Polyacrylamide gel electrophoresis (PAGE) of solubilized virions indicates that there are >100 different proteins associated with the viruses that include: structural polypeptides, enzymes associated with translation of messenger ribonucleic acid (mRNA) enzymes involved in RNA synthesis, and enzymes associated with 20 DNA replication. The genome of poxviruses consists double-stranded DNA that varies in base composition (32% G+C to 64% G+C) and length (140 kilobasepairs [kb] to 280 kb for FPV) depending upon individual virus. The complete nucleotide sequence of the vaccina virus (VV) 25 genome has recently been determined, and most of the essential genes have been found to lie.within the highly S* conserved middle region of the genome while nonessential *functions seem to map nearer to the termini of the DNA.

The poxviruses are unique in their propensity to 30 replicate within the cytoplasmic space of the infected cell, and in the case of VV, mature virus particles are moved out of the assembly areas and into the periphery of the cell where additional membrane encapsulation occurs.

With FPV, the assembled viral particles become associated with a dense viral-derived protein matrix that occludes the virus in the form of cellular inclusions that may help protect the virion from lytic activities. Depending WO 96/40880 PCT/US96/1 1187 upon the specific poxvirus and strain (from 1% to 30% of different mature VV strains) varying levels of mature virus can be found extracellularly, but the majority of the virus population remains associated with the cell at the end of the growth cycle.

Fowlpox is unique throughout the world, but because its host-range is limited to birds it is not considered to be a public health hazard. All chickens can be infected by the virus with a resulting decline in the growth rate of the bird and temporary decreases in egg production.

Usually, transmission of FPV occurs through physical contact of injured skin, but there are reports that the virus is also transmitted via arthropod vectors. After an incubation period of four to ten days, the disease is typically manifested in the following ways: skin lesions in non-feathered areas, lesions of the nasal passages, and lesions of the mouth. A normal FPV infection usually lasts three to four weeks, and afterward the bird is 20 conferred life-long immunity to the disease.

eeo Currently, conventionally derived FPV vaccines are being used in commercial settings to provide protection to *l chickens and turkeys. Typically, the vaccine viruses are attenuated by serial passage in cell culture selecting for strains that have altered growth and/or virulence o properties. The modified live vaccine is prepared by growth in vitro in chicken embryo fibroblast cells or by growth on the chorioallantoic membrane of the chicken 30 embryo. The vaccine virus is given to birds subcutaneously.

The present invention concerns the use of FPV as a vector for the delivery of specific vaccine antigens to poultry.

The idea of using live viruses as delivery systems for antigens (vectoring) has a long history that is associated with introduction of the first live viral WO 96/40880 PCT/US96/I 1187 vaccines. The antigens that were delivered were not foreign but were naturally expressed by the live virus in the vaccine. The use of viruses to deliver foreign antigens in the modern sense became obvious with the recombinant DNA studies. The vaccinia virus was the vector and various antigens from other disease causing pathogens were the foreign antigens, and the vaccine was created by genetic engineering. While the concept became obvious with these disclosures, what was not obvious were the answers to more practical questions concerning what makes the best candidate viral vector and what constitutes the best foreign gene or gene to deliver. In answering these questions, details of the pathogenicity, site of replication or growth, the kind of elicited immune response, expression levels for the virus and foreign gene of interest (GOI), its suitability for genetic engineering, its probability of being licensed by regulatory agencies, etc. are all factors in the configuration. The prior art does not teach these 20 questions of utility.

0r *0 0 0 *0 *0 *00* 4 0 0e 4 *5 *0*0 *0*0 The presently preferred method for creating recombinant poxviruses uses a plasmid of bacterial origin that contains at least one cassette consisting of a poxvirus promoter followed by the gene of interest. The cassette(s) is flanked by poxvirus genomic DNA sequences that direct the gene of interest to the corresponding homologous nonessential region of the viral genome by homologous recombination. Cells are initially infected 30 with the wild-type virus, and shortly thereafter the plasmid DNA is introduced into the infected cells. Since poxviruses have their own RNA polymerase and transcriptional apparatus, it is necessary that the gene of interest be regulated by a promoter of poxvirus origin. There are three characteristic poxvirus promoters that are differentiated based upon their temporal regulation of gene expression relative to the WO 96/40880 PCT/US96/11187 infective cycle of the virus: early, intermediate and late expression. Each promoter type can be identified by a typical consensus sequence that is -30 bp in length and specific to each promoter type. In vaccinia virus, some viral genes are regulated by tandem early/late promoters that can be used by the virus to continually express the downstream gene throughout the infective cycle.

It is generally agreed that poxviruses contain nonessential regions of DNA in various parts of the genome, and that modifications of these regions can either attenuate the virus, leading to a non-pathogenic strain from which a vaccine may be derived, or give rise to genomic instabilities that yield mixed populations of virus. The degree of attenuation of the virus is important to the utility of the virus as a vaccine.

Insertions or deletions which cause too much attenuation or genetic deletions which cause too much attenuation or genetic instability of the virus will result in a vaccine 20 that fails to elicit an adequate immune response.

Although several examples of deletions/insertions are known for poxviruses, the appropriate configuration is not readily apparent.

25 Thus far, gene expression from foreign genes of interest have been inserted into the genome of poxviruses has been obtained for five different pox viruses: vaccinia, canary pox, pigeon pox, raccoon pox and fowlpox. Vaccinia virus is the classically studied poxvirus, and it has been used 30 extensively to vector foreign genes of interest; it is the subject of U.S. Patents 4,603,112 and 4,722,848.

Raccoon pox (Esposito, et al., 1988) and Canary pox (Taylor, et al., 1991) have bene used to express antigens from the rabies virus. 'More recently, FPV has been used to vector a number of different foreign gene of interest, and is the subject of patent applications (EPA 0 284 416, PCT WO 89/03429, PCT WO 89/12684, PCT WO 91/02072, PCT WO WO 96/40880 PCT/US96/ 1187 -6- 89/03879, PCT etc.). However, these publications do not teach the vectored antigen configuration, the FPV insertion sites, or the promoter sequences and the arrangement of the present invention.

A foreign gene of interest targeted for insertion into the genome of FPV can be obtained from any pathogenic organism of interest. Typically, the gene of interest will be derived from pathogens that cause diseases in poultry that have an economic impact on the poultry industry. The genes can be derived from organisms for which there are existing vaccines, and because of the novel advantages of the vectoring technology the FPV derived vaccines will be superior. Also, the gene of interest may be derived from pathogens for which thee is currently no vaccine but where there is a requirement for control of the disease. Typically, the gene of interest encodes immunogenic polypeptides of the pathogen, and may represent surface proteins, secreted proteins and structural proteins.

go a. 25 3 One relevant avian pathogen that is a target for FPV vectoring in the present invention is Infectious Laryngotracheitis virus (ILT). ILT is a member of the herpesviridiae family, and this pathogen causes an acute disease of chickens which is characterized by respiratory depression, gasping and expectoration of bloody exudate.

Viral replication is limited to cells of the respiratory tract, where in the trachea the infection gives rise to tissue erosion and hemorrhage. In chickens, no drug has been effective in reducing the degree of lesion formation or in decreasing clinical signs. Vaccination of birds with various modified forms of the ILT virus derived by cell passage and/or tedious regimes of administration have conferred acceptable protection in susceptible chickens. Because of the degree of attenuation of current ILT vaccines, care must be taken to assure that WO 96/40880 PCT/US96/11187 -7the correct level of virus is maintained; enough to provide protection, but not enough to cause disease in the flock.

An additional target for the FPV vectoring approach is Newcastle disease, an infectious, highly contagious and debilitating disease that is caused by the Newcastle disease virus (NDV), a single-stranded RNA virus of the paramyxovirus family. The various pathotypes of NDV (velongic, mesogenic, lentogenic) differ with regard to the severity of the disease, the specificity and symptoms, but most types seem to infect the respiratory system and the nervous system. NDV primarily infects chickens, turkeys and other avian species. Historically, vaccination has been used to prevent disease, but because of maternal antibody interference, life-span of the bird and route of administration, the producer needs to adapt immunization protocols to fit specific needs.

20 Marek's disease of poultry is a lymphoproliferative tumor producing disease of poultry that primarily affects the peripheral nervous system and other visceral tissues and organs. Marek's disease exists in poultry producing countries throughout the world, and is an additional target described by the present invention for a FPV-based vectored vaccine. The causative agent of Marek's disease is a cell associated gammaherpesvirus that has been designated as Marek's disease virus (MDV). Three classes of viruses have been developed as conventional vaccines for protecting chickens against Marek's disease: attenuated serotype 1 MDV, herpesvirus of turkeys (HVT), and naturally avirulent serotype 2 isolates of MDV.

Protection obtained with these vaccines is principally directed toward the tumorigenic aspect of the disease.

The occurrence of excessive Marek's disease losses in such conventionally vaccinated flocks has led to the requirement for forming admixtures of the various vaccine WO 96/40880 PCT/US96/11187 types. Such. polyvalent vaccines while generally ore effective in disease control, complicate the vaccine regime.

WO 96/40880 PCT/US96/11187 -9- SUMMARY OF THE INVENTION This invention provides a recombinant fowlpox virus comprising a foreign DNA sequence inserted into the fowlpox virus genomic DNA, wherein the foreign

DNA

sequence is inserted within a non-essential region of the fowlpox virus genomic DNA and is capable of being expressed in a fowlpox virus infected host cell.

The invention further provides homology vectors, vaccines and methods of immunization.

e *ee WO 96/40880 PCT/US96/11187 BRIEF DESCRIPTION OF THE FIGURES Fiqures 1A-1C: Detailed description of the SfiI fragment insert in Homology Vector 502-26.22. The diagram shows the orientation of DNA fragments assembled in the cassette. The origin of each fragment is described in the Materials and Methods section. The sequences located at the junctions between each fragment and at the ends of the marker gene are shown, including junction A (SEQ ID NO: 15), junction B (SEQ ID NO: 16), junction C (SEQ ID NO: 17), and junction D (SEQ ID NO: 18). The restriction sites used to generate each fragment are indicated at the appropriate junction. The location of the NDV F and HN genes is shown.

Numbers in parenthesis refer to amino acids, and restriction sites in brackets I[ indicate 20 the remnants of sites which were destroyed during construction.

Figures 2A-2D: Detailed description of fowlpox virus S-FPV-099 and S-FPV-101 and the DNA insertion in Homology Vector 751-07.D1. Diagram showing the orientation of DNA fragments assembled in plasmid 751-07.D1. The origin of each fragment is indicated in the table.

The sequences located at each of the junctions 30 between fragments is also shown. Figures 2A-2D show the sequences located at Junction A (SEQ ID NO: (SEQ ID NO: C (SEQ ID NO: D (SEQ ID NO: and E (SEQ ID NO: between fragments and the sequences located at the junctions. The restriction sites used to generate each fragment as well as synthetic linker sequences which are used to join the fragments are described for each junction. The WO 96/40880 PCT/US96/11187 20 20 25 -11location of several gene coding regions and regulatory elements is also given. The following two conventions are used: numbers in parentheses, refer to amino acids, and restrictions sites in brackets, indicate the remnants of sites which are destroyed during construction. The following abbreviations are used: fowlpox virus (FPV), chicken interferon (cIFN), Escherichia coli coli), pox synthetic late promoter 2 early promoter 2 (LP2EP2), pox synthetic late promoter 1 (LPI), base pairs polymerase chain reaction

(PCR).

Fiqures 3A-3D: Detailed description of fowlpox virus S-FPV-100 and the DNA insertion in Homology Vector 751-56.C1.

Diagram showing the orientation of DNA fragments assembled in plasmid 751-56.C1. The origin of each fragment is indicated in the table. The sequences located at each of the junctions between fragments is also shown. Figures 3A-3D show the sequences located at Junction A (SEQ ID NOS: (SEQ ID NO: C (SEQ ID NO: D (SEQ ID NO: and E (SEQ ID NO: between fragments and the sequences located at the junctions. The restriction sites used to generate each fragment as well as synthetic linker sequences which are used to join the fragments are described for each junction. The location of several gene coding regions and regulatory elements is also given. The following two conventions are used: numbers in parentheses, refer to amino acids, and restrictions sites in brackets, indicate the remnants of sites which are destroyed during construction. The following abbreviations are used: fowlpox virus (FPV), chicken myelomoncytic growth factor (cMGF), Escherichia coli coli), pox synthetic late promoter 2 early promoter 2 (LP2EP2), pox synthetic late promoter 1 (LP1), base pairs WO 96/40880 PCT/US96/1 1187 -12polymerase chain reaction (PCR).

WO 96/40880 PCT/US96/11187 -13- DETAILED DESCRIPTION OF THE INVENTION This invention provides a recombinant fowlpox virus comprising a foreign DNA sequence inserted into the fowlpox virus genomic DNA, wherein the foreign

DNA

sequence is inserted within a 2.8 kB EcoRI fragment of the fowlpox virus genomic DNA and is capable of being expressed in a fowlpox virus infected host cell.

In one embodiment the foreign DNA sequence is inserted within a SnaBI restriction endonuclease site within the approximately 2.8 kB EcoRI fragment of the fowlpox virus genomic DNA.

This invention provides a recombinant fowlpox virus comprising a foreign DNA sequence inserted into the fowlpox virus genomic DNA, wherein the foreign

DNA

sequence is inserted within a 3.5 kB EcoRI fragment of *the fowlpox virus genomic DNA and is capable of being expressed in a fowlpox virus infected host cell.

In one embodiment the recombinant fowlpox virus the foreign DNA sequence is inserted within a Hpal restriction endonuclease site within the approximately 25 3.5 kB EcoRI fragment of the fowlpox virus genomic

DNA.

The present invention provides a recombinant fowlpox virus comprising a foreign DNA sequence inserted into the fowlpox virus genomic DNA, wherein the foreign

DNA

30 sequence is inserted within a 4.2 kB EcoRI fragment of the fowlpox virus genomic DNA and is capable of being expressed in a fowlpox virus infected host cell.

In one embodiment of the recombinant fowlpox virus foreign DNA sequence is inserted within a Mlul restriction endonuclease site within the approximately 4.2 kB EcoRI fragment of the fowlpox virus genomic

DNA.

WO 96/40880 PCT/US96/11187 -14- The invention provides a recombinant fowlpox virus comprising a foreign DNA sequence inserted into the fowlpox virus genomic DNA, wherein the foreign DNA sequence is inserted within a non-essential region of the fowlpox virus genomic DNA and is capable of being expressed in a fowlpox virus infected host cell.

In one embodiment this invention provides a recombinant fowlpox virus wherein the foreign DNA sequence is inserted into an open reading frame within the nonessential region the fowlpox virus genomic DNA.

For purposes of this invention, "a recombinant fowlpox virus capable of replication" is a live fowlpox virus which has been generated by the recombinant methods well known to those of skill in the art, the methods set forth in HOMOLOGOUS RECOMBINATION PROCEDURE

FOR

GENERATING RECOMBINANT FPV in Materials and Methods and 20 has not had genetic material essential for the replication of the recombinant fowlpox virus deleted.

The invention further provides a foreign DNA sequence or foreign RNA which encodes a polypeptide. Preferably, the 25 polypeptide is antigenic in the animal. Preferably, this antigenic polypeptide is a linear polymer of more than amino acids linked by peptide bonds which stimulates the animal to produce antibodies.

30 The invention further provides a recombinant fowlpox virus capable of replication which contains a foreign DNA encoding a polypeptide which is a detectable marker.

Preferably the detectable marker is the polypeptide E.

coli 0-galactosidase or E. coli beta-glucuronidase.

In one embodiment of the recombinant fowlpox virus the foreign DNA sequence encodes a cytokine. In another WO 96/40880 PCT/US96/11187 embodiment the cytokine is chicken myelomonocytic growth factor (cMGF) or chicken interferon (cIFN). Cytokines include, but are not limited to: transforming growth factor beta, epidermal growth factor family, fibroblast growth factors, hepatocyte growth factor, insulin-like growth factor, vascular endothelial growth factor, interleukin 1, IL-1 receptor antagonist, interleukin-2, interleukin-3, interleukin-4, interleukin-5, interleukin- 6, IL-6 soluble receptor, interleukin-7, interleukin-8, interleukin-9, interleukin-10, interleukin-ll, interleukin-12, interleukin-13, angiogenin, chemokines, colony stimulating factors, granulocyte-macrophage colony stimulating factors, erythropoietin, interferon, interferon gamma, c-kit ligand, leukemia inhibitory factor, oncostatin M, pleiotrophin, secretory leukocyte protease inhibitor, stem cell factor, tumor necrosis factors, and soluble TNF receptors. These cytokines are from humans, bovine, equine, feline, canine, porcine or avian.

25 e •oo oo This invention provides a recombinant fowlpox virus further comprising a newcastle disease virus hemagglutinin (NDV HN), or a newcastle disease virus fusion (NDV F).

Antigenic polypeptide of a human pathogen which are :derived from human herpesvirus include, but are not limited to: hepatitis B virus and hepatitis C virus hepatitis B virus surface and core antigens, hepatitis

C

virus, human immunodeficiency virus, herpes simplex virus-1, herpes simplex virus-2, human cytomegalovirus, Epstein-Barr virus, Varicella-Zoster virus, human herpesvirus-6, human herpesvirus-7, human influenza, measles virus, hantaan virus, pneumonia virus, rhinovirus, poliovirus, human respiratory syncytial virus, retrovirus, human T-cell leukemia virus, rabies virus, mumps virus, malaria (Plasmodium falciparum), WO 96/40880 PCT/US96/11187 -16- Bordetella pertussis, Diptheria, Rickettsia prowazekii, Borrelia berfdorferi, Tetanus toxoid, malignant tumor antigens.

The antigenic polypeptide of an equine pathogen can derived from equine influenza virus, or equine herpesvirus. In one embodiment the antigenic polypeptide is equine influenza neuraminidase or hemagglutinin.

Examples of such antigenic polypeptide are equine influenza virus type A/Alaska 91 neuraminidase, equine influenza virus type A/Prague 56 neuraminidase, equine influenza virus type A/Miami 63 neuraminidase, equine influenza virus type A/Kentucky 81 neuraminidase, equine influenza virus type A/Kentucky 92 neuraminidase equine herpesvirus type 1 glycoprotein B, equine herpesvirus type 1 glycoprotein D, Streptococcus equi, equine infectious anemia virus, equine encephalitis virus, equine rhinovirus and equine rotavirus.

S 20 The present invention further provides an antigenic polypeptide which includes, but is not limited to: hog *e cholera virus gEl, hog cholera virus gE2, swine influenza virus hemagglutinin, neuromanidase, matrix and nucleoprotein, pseudorabies virus gB, gC and gD, and PRRS 25 virus ORF7.

a. SFor example, the antigenic polypeptide of derived from infectious bovine rhinotracheitis virus gE, bovine respiratory syncytial virus equine pathogen can derived from equine influenza virus is bovine respiratory syncytial virus attachment protein (BRSV bovine respiratory syncytial virus fusion protein (BRSV F), bovine respiratory syncytial virus nucleocapsid protein (BRSV bovine parainfluenza virus type 3 fusion protein, and the bovine parainfluenza virus type 3 hemagglutinin neuraminidase WO 96/40880 PCT/US96/ 1187 -17- The present invention provides a recombinant fowlpox virus wherein the foreign DNA sequence encodes an antigenic polypeptide which is derived or derivable from a group consisting of: feline immunodeficiency virus gag, feline immunodeficiency virus env, infectious laryngotracheitis virus glycoprotein B, infectious laryngotracheitis virus gI, infectious laryngotracheitis virus gD, infectious bovine rhinotracheitis virus glycoprotein G, infectious bovine rhinotracheitis virus glycoprotein E, pseudorabies virus glycoprotein pseudorabies virus II glycoprotein B, pseudorabies virus III glycoprotein C, pseudorabies virus glycoprotein

E,

pseudorabies virus glycoprotein H, marek's disease virus glycoprotein A, marek's disease virus glycoprotein

B,

marek's disease virus glycoprotein D, newcastle disease virus hemagglutinin or neuraminadase, newcastle disease virus fusion, infectious bursal disease virus VP2, infectious bursal disease virus VP3, infectious bursal disease virus VP4, infectious bursal disease virus 20 polyprotein, infectious bronchitis virus spike, g: infectious bronchitis virus matrix, and chick anemia virus.

The present invention provides a recombinant fowlpox 25 virus wherein the foreign DNA sequence is under control of a promoter. In one embodiment the foreign DNA sequence J is under control of an endogenous upstream poxvirus o* promoter. In another embodiment the foreign DNA sequence is under control of a heterologous upstream promoter. In 30 another embodiment the promoter is selected from a group *s consisting of: synthetic pox viral promoter, pox synthetic late promoter 1, pox synthetic late promoter 2 early promoter 2, pox 01L promoter, pox I4L promoter, pox I3L promoter, pox I2L promoter, pox IlL promoter, pox EO1R promoter, HCMV immediate early, BHV-1.1 VP8, marek's disease virus glycoprotein A, marek's disease virus glycoprotein B, marek's disease virus glycoprotein

D,

WO 96/40880 PCT/US96/11187

OS

SO

-18laryngotracheitis virus glycoprotein I, infectious laryngotracheitis virus glycoprotein B, and infectious laryngotracheitis virus gD.

The present invention also provides a recombinant fowlpox virus designated S-FPV-097. The S-FPV-097 has been deposited on February 25, 1994 pursuant to the Budapest Treaty on the International Deposit of Microorganisms for the Purposes of Patent Procedure with the Patent Culture Depository of the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland 20852 U.S.A. under ATCC Accession No. VR 2446.

The present invention also provides a vaccine which comprises an effective immunizing amount of the recombinant virus designated S-FPV-097 and a suitable carrier. The vaccine may contain either inactivated or live fowlpox virus S-FPV-097, although live virus is presently preferred. The present invention also provides 20 a method of immunizing an animal, particularly poultry, against disease caused by fowlpox virus, Newcastle disease virus and infectious laryngotracheitis virus.

This method comprises administering to the animal an effective immunizing dose of the vaccine of the present invention. The vaccine may be administered by any of the methods well known to those skilled in the art, for example, by intramuscular, intraperitoneal, intravenous or intradermal injection. Alternatively, the vaccine may be administered intranasally, orally, or ocularly.

The present invention also provides a recombinant fowlpox virus designated S-FPV-095. The present invention also provides a vaccine which comprises an effective immunizing amount of the recombinant virus designated S- FPV-095 and a suitable carrier. The vaccine may contain either inactivated or live fowlpox virus S-FPV-095, although live virus is presently preferred. The present 0o 0* 0o o WO 96/40880 PCT/US96/1187 -19invention also provides a method of immunizing an animal, particularly poultry, against disease caused by fowlpox virus, Newcastle disease virus and infectious laryngotracheitis virus. This method comprises administering to the animal an effective immunizing dose of the vaccine of the present invention. The vaccine may be administered by any of the methods well known to those skilled in the art, for example, by intramuscular, intraperitoneal, intravenous or intradermal injection.

Alternatively, the vaccine may be administered intranasally, orally, or ocularly.

The present invention also provides a recombinant fowlpox virus designated S-FPV-074. The present invention also provides a vaccine which comprises an effective immunizing amount of the recombinant virus designated

S-

FPV-074 and a suitable carrier. The vaccine may contain either inactivated or live fowlpox virus S-FPV-074, although live virus is presently preferred. The present 20 invention also provides a method of immunizing an animal, particularly poultry, against disease caused by fowlpox virus and Newcastle disease virus. This method comprises administering to the animal an effective immunizing dose of the vaccine of the present invention. The vaccine may 25 be administered by any of the methods well known to those skilled in the art, for example, by intramuscular, intraperitoneal, intravenous or intradermal injection.

Alternatively, the vaccine may be administered intranasally, orally, or ocularly.

The present invention also provides a recombinant fowlpox virus designated S-FPV-081. The present invention also provides a vaccine which comprises an effective immunizing amount of the recombinant virus designated

S-

FPV-081 and a suitable carrier. The vaccine may contain either inactivated or live fowlpox virus S-FPV-081, although live virus is presently preferred. The present WO 96/40880 PCT/US96/11187 invention also provides a method of immunizing an animal, particularly poultry, against disease caused by fowlpox virus and Marek's disease virus. This method comprises administering to the animal an effective immunizing dose of the vaccine of the present invention. The vaccine. may be administered by any of the methods well known to those skilled in the art, for example, by intramuscular, intraperitoneal, intravenous or intradermal injection.

Alternatively, the vaccine may be administered intranasally, orally, or ocularly.

The present invention also provides a recombinant fowlpox virus designated S-FPV-085. The present invention also provides a vaccine which comprises an effective immunizing amount of the recombinant virus designated

S-

FPV-085 and a suitable carrier. The vaccine may contain either inactivated or live fowlpox virus S-FPV-085, although live virus is presently preferred. The present invention also provides a method of immunizing an animal, 20 particularly poultry, against disease caused by fowlpox virus, Newcastle disease virus, infectious laryngotracheitis virus and Marek's disease virus. This method comprises administering to the animal an effective immunizing dose of the vaccine of the present invention.

25 The vaccine may be administered by any of the methods well known to those skilled in the art, for example, by intramuscular, intraperitoneal, intravenous or intradermal injection. Alternatively, the vaccine may be administered intranasally, orally, or ocularly.

The present invention also provides a recombinant fowlpox virus designated S-FPV-082, S-FPV-083, S-FPV-099,

S-FPV-

100, and S-FPV-101.

Suitable carriers for use with the recombinant fowlpox virus vaccines of the present invention are those well WO 96/40880 PCT/US96/11187 -21known in the art and include proteins, sugars, etc. One example of such a suitable carrier is a physiologically balanced culture medium containing one or more stabilizing agents such as stabilized, hydrolyzed proteins, lactose, etc.

An "effective immunizing amount" of the recombinant viruses of the present invention is an amount within the range of 102-109 PFU/dose. Preferably, the effective immunizing amount is from about 10'-105 PFU/dose for the live virus vaccine. Preferable, the live vaccine is created by taking tissue culture fluids and adding stabilizing agents such as stabilized, hydrolyzed proteins.

*o *ooooo* WO 96/40880 PCT/US96/11187 -22- MATERIAL AND METHODS PREPARATION OF FOWLPOX VIRUS STOCK SAMPLES. Fowlpox virus samples were prepared by infecting chicken embryo fibroblast (CEF) cells at a multiplicity of infection of 0.01 PFU/cell in a 1:1 mixture of HAM's F10 medium and Medium 199 (F10/199) containing 2 mM glutamine and antibiotics (referred to as CEF negative medium). Prior to infection, the cell monolayers were washed once with CEF negative medium to remove fetal bovine serum. The FPV contained in the initial inoculum (0.5 ml for 10 cm plate; 10 ml for T175 cm flask) was allowed to absorb onto the cell monolayer for two hours, being redistributed every half hour. After this period, the original inoculum was brought up to an appropriate final volume by the addition of complete CEF medium

(CEF

negative medium plus 2% fetal bovine serum). The plates were incubated at 37 0 C in 5% CO, until cytopathic effect was complete. The medium and cells were harvested, 20 frozen at -70 0 C, thawed and dispensed into 1.0 ml vials and refrozen at -70 0 C. Virus titers typically range between 108 and 10 7 PFU/ml.

PREPARATION OF FPV DNA. For fowlpox virus DNA isolation, 25 a confluent monolayer of CEF cells in a T175 cm 2 flask was ''infected at a multiplicity of 0.1 and incubated 4-6 days until the cells were showing 100% cytopathic effect. The infected cells were harvested by scraping into the medium and centrifuging at 3000 rpm for 5 minutes in a clinical centrifuge. The medium was decanted, and the cell pellet S' was gently resuspended in 1.0 ml PBS (per T175) and subjected to two successive freeze-thaws (-70°C to 37 0

C)

After the last thaw, the cells (on ice) were sonicated two times for 30 seconds each with 45 seconds cooling time in between. Cellular debris was removed by centrifuging (Sorvall RC-5B Superspeed Centrifuge) at 3000 rpm for 5 minutes in an HB4 rotor at 4 0 C. FPV WO 96/40880 PCT/US96/11187 -23virions, present in the supernatant, were pelleted by centrifugation at 15,000 rpm for 20 minutes at 4 0 C in a SS34 rotor (Sorvall) and resuspended in 10mM Tris (pH This fraction was then layered onto a 36% sucrose gradient (w/v in 10 mM Tris pH 7.5) and centrifuged (Beckman L8-70M Ultracentrifuge) at 18,000 rpm for minutes in a SW41 rotor at 4 0 C. The virion pellet was resuspended in 1.0 ml of 10 mM.Tris pH 7.5 and sonicated on ice for 30 seconds. This fraction was layered onto a 20% to 50% continuous sucrose gradient and centrifuged at 16,000 rpm for 60 minutes in a SW41 rotor at 4oC. The FPV virion band located about three quarters down the gradient was harvested, diluted with 20% sucrose and pelleted by centrifugation at 18,000 rpm for 60 minutes in a SW41 rotor at 4 0 C. The resultant pellet was then washed once with 10 mM Tris pH 7.5 to remove traces of sucrose and finally resuspended in 10mM Tris pH 7.5. FPV DNA was then extracted from the purified virions by lysis (four hours at 600C) following the addition of EDTA, SDS, 20 and proteinase K to final concentrations of 20 mM, and 0.5 mf/ml, respectively. After digestion, three phenol-chloroform extractions were conducted and the sample precipitated by the addition of two volumes of absolute ethanol and incubated at -20 0 C for 30 minutes.

The sample was then centrifuged in an Eppendorf minifuge for five minutes at full speed. The supernatant was decanted, and the pellet air dried and rehydrated in 0.01 M Tris pH 7.5, ImM EDTA at 4 0

C.

MOLECULAR BIOLOGICAL TECHNIQUES. Techniques for the manipulation of bacteria and DNA, including such procedures as digestion with restriction endonucleases, gel electrophoresis, extraction of DNA from gels, ligation, phosphorylation with kinase, treatment with phosphatase, growth of bacterial cultures, transformation of bacteria with DNA, and other molecular biological methods are described by Maniatis et al (1982) and WO 96/40880 PCT/US96/11187 -24- Sambrook et al (1989).

with minor variation.

Except as noted, these were used DNA SEQUENCING. Sequencing was performed using the BRL Sequenase Kit and 3 S-dATP (NEN). Reactions using both the dGTP mixes and the dITP mixes were performed to clarify areas of compression. Alternatively, compressed areas were resolved on formamide gels. Templates were double-stranded plasmid subclones or single stranded M13 subclones, and primers were either made to the vector just outside the insert to be sequenced, or to previously obtained sequence. Sequence obtained was assembled and compared using Dnastar software. Manipulation and comparison of sequences obtained was performed with Superclone and Supersee programs from Coral Software.

STRATEGY FOR THE CONSTRUCTION OF SYNTHETIC POX VIRAL PROMOTERS. For recombinant fowlpox vectors synthetic pox promoters offer several advantages including the ability 20 to control the strength and timing of foreign gene expression. We chose to design four promoter cassettes EP1 (SEQ ID NO:8, LP1 (SEQ ID NO:9), EP2 (SEQ ID and LP2 (SEQ ID NO:11) based on promoters that have been defined in the vaccinia virus (Bertholet et al. 1986, 25 Davidson and Moss, 1989a, and Davidson and Moss, 1989b) Each cassette was designed to contain the DNA sequences defined in vaccina flanked by restriction sites which Could be used to combine the cassettes in any order or 'combination. Initiator methionines were also designed into each cassette such that inframe fusions could be made at either EcoRI or BamHi sites. A set of translational stop codons in all three reading frames and an early transcriptional termination signal (Earl, et al., 1990) was also engineered downstream of the inframe fusion site. DNA encoding each cassette was synthesized according to standard techniques and cloned into the appropriate homology vectors.

WO 96/40880 PCT/US96/1187 cDNA CLONING PROCEDURE. cDNA cloning refers to the methods used to convert RNA molecules into DNA molecules following state of the art procedures. Applicants' methods are described in (Gubler and Hoffman, 1983).

Bethesda Research Laboratories (Gaithersburg, MD) have designed a cDNA Cloning Kit that is very similar to the procedures used by applicants, and contains a set of reagents and protocols that may be used to duplicate our results.

For cloning virus mRNA species, a host cell line sensitive to infection by the virus was infected at 5-10 plaque forming units per cell. When cytopathic effect was evident, but before total destruction, the medium was removed and the cells were lysed in 10 mls lysis buffer (4 M guanidine thiocyanate, 0.1% antifoam A, 25 mM sodium citrate pH 7.0, 0.5% N-lauroyl sarcosine, 0.1 M betamercaptoethanol). The cell lysate was poured into a 2 sterilized Dounce homogenizer and homogenized on ice 8-10 20 times until the solution was homogenous. For RNA purification, 8mls of cell lysate were gently layered over 3.5 mls of CsC1 solution (5.7 M CsC1, 25 mM sodium citrate pH 7.0) in a Beckman SW41 centrifuge tube. The samples were centrifuged for 18 hrs at 20 0 C at 36000 rpm 25 in a Beckman SW41 rotor. The tubes were put on ice and the supernatants from the tubes were carefully removed by aspiration to leave the RNA pellet undisturbed. The pellet was resuspended in 400 Al glass distilled water, and 2.6 mls of guanidine solution (7.5 M guanidine-HCl, 25 mM sodium citrate pH 7.0, 5 mM dithiothreitol) were added. Then 0.37 volumes of 1 M acetic acid were added, followed by 0.75 volumes of cold ethanol and the sample was put at -20 0 C for 18 hrs to precipitate RNA. The precipitate was collected by centrifugation in a Sorvall centrifuge for 10 min at 4 0 C at 10000 rpm in an SS34 rotor. The pellet was dissolved in 1.0 ml distilled water, recentrifuged at 13000 rpm, and the supernatant WO 96/40880 PCT/US96/11187 -26saved. RNA was re-extracted from the pellet 2 more times as above with 0.5 ml distilled water, and the supernatants were pooled. A 0.1 volume of 2 M potassium acetate solution was added to the sample followed by 2 volumes of cold ethanol and the sample was put at -20 0

C

for 18 hrs. The precipitated RNA was collected by centrifugation in the SS34 rotor at 4 0 C for 10 min at 10000 rpm. The pellet was dissolved in 1 ml distilled water and the concentration taken by adsorption at A260/280. The RNA was stored at -70 0

C.

mRNA containing polyadenylate tails (poly-A) was selected using oligo-dT cellulose (Pharmacia #27 5543-0). Three mg of total RNA was boiled and chilled and applied to a 100 mg oligo-dT cellulose column in binding buffer (0.1 M Tris pH 7.5, 0.5 M LiCI, 5 mM EDTA pH 8.0, 0.1% lithium dodecyl sulfate). The retained poly-A+ RNA was eluted from the column with elution buffer (5 mM Tris pH 7.5, 1 mM EDTA pH 8.0, 0.1% sodium dodecyl sulfate). This mRNA 20 was reapplied to an oligo-dT column in binding buffer and eluted again in elution buffer. The sample was precipitated with 200 mM sodium acetate and 2 volumes cold ethanol at -20 0 C for 18 hrs. The RNA was resuspended in 50 1l distilled water.

GTen Ag poly-A+ RNA was denatured in 20 mM methyl mercury hydroxide for 6 min at 22 0 C. P-mercaptoethanol was added to 75 mM and the sample was incubated for 5 min at 220C.

The reaction mixture for first strand cDNA synthesis in 0.25 ml contained 1 *gg oligo-dT primer (P-L Bio- *'to chemicals) or 1 Ag synthetic primer, 28 units placental ribonuclease inhibitor (Bethesda Research Labs #5518SA), 100 mM Tris pH 8.3, 140 mM KC1, 10 mM MgC12, 0.8 mM dATP, dCTP, dGTP, and dTTP (Pharmacia), 100 microcuries 32Plabeled dCTP (New England Nuclear #NEG-013H), and 180 units AMV reverse transcriptase (Molecular Genetics Resources #MG 101). The reaction was incubated at 420C WO 96/40880 PCT/US96/11187 -27for 90 min, and then was terminated with 20 mM EDTA pH The sample was extracted with an equal volume of phenol/chloroform and precipitated with 2 M ammonium acetate and 2 volumes of cold ethanol -20 0 C for 3 hrs. After precipitation and centrifugation, the pellet was dissolved in 100 pl distilled water. The sample was loaded onto a 15 ml G-100 Sephadex column (Pharmacia) in buffer (100 mM Tris pH 7.5, 1 mM EDTA pH 100 mM NaC1). The leading edge of the eluted DNA fractions were pooled, and DNA was concentrated by lyophilization until the volume was about 100 Al, then the DNA was precipitated with ammonium acetate plus ethanol as above.

The entire first strand sample was used for second strand reaction which followed the Gubler and Hoffman (1983) method except that 50 pg/ml dNTP's, 5.4 units DNA polymerase I (Boerhinger Mannheim #642-711), and 100 units/ml E. coli DNA ligase (New England Biolabs #205) in 20 a total volume of 50 microliters were used. After second strand synthesis, the cDNA was phenol/chloroform extracted and precipitated. The DNA was resuspended in yl distilled water, treated with 1 Ag RNase A for min at 22 0 C, and electrophoresed through a 1% agarose gel (Sigma Type II agarose) in 40 mM Tris-acetate buffer pH 6.85. The gel was strained with ethidium bromide, and DNA in the expected size range was excised from the gel and electroeluted in 8 mM Tris-acetate pH 6.85.

Electroeluted DNA was lyophilized to about 100 30 microliters, and precipitated with ammonium acetate and ethanol as above. The DNA was resuspended in 20 #l water.

Oligo-dC tails were added to the DNA to facilitate cloning. The reaction contained the DNA, 100 mM potassium cacodylate pH 7.2, 0.2 mM dithiothreitol, 2 mM CaCl 2 80 pjmoles dCTP, and 25 units terminal WO 96/40880 PCT/US96/1187 -28deoxynucleotidyl transferase (Molecular Genetic Resources #S1001) in 50 pl. After 30 min at 37oC, the reaction was terminated with 10 mM EDTA, and the sample was phenol/chloroform extracted and precipitated as above.

The dC-tailed DNA sample was annealed to 200 ng plasmid vector pBR322 that contained oligo-dG tails (Bethesda Research Labs #5355 SA/SB) in 200 pi of 0.01 M Tris pH 0.1 M NaC1, 1 mM EDTA pH 8.0 at 650C for 2 min and then 57 0 C for 2 hrs. Fresh competent E. coli DH-1 cells were prepared and transformed as described by Hanahan (1983) using half the annealed cDNA sample in twenty 200 pl aliquots of cells. Transformed cells were plated on L-broth agar plates plus 10 pg/ml tetracycline. Colonies were screened for the presence of inserts into the ampicillin gene using Ampscreen\ (Bethesda Research Labs #5537 UA), and the positive colonies were picked for analysis.

20 HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. This method relies upon the homologous recombination between FPV DNA and the plasmid homology vector DNA which occurs in the tissue culture cells containing both FPV DNA and transfected plasmid homology 25 vector. For homologous recombination to occur, monolayers of CEF cells are infected with S-FPV-001 (A mild fowlpox vaccine strain available as Bio-Pox" from *oooo Agri-Bio Corporation, Gainsville, Georgia) at a multiplicity of infection of 0.01 PFU/cell to introduce replicating FPV DNA synthesis) into the cells. The plasmid homology vector DNA is then transfected into these cells according to the "Infection-Transfection Procedure".

INFECTION-TRANSFECTION PROCEDURE. CEF cells in 6 cm plates (about 80% confluent) were infected with S-FPV-001 at a multiplicity of infection of 0.01 PFU/cell in CEF WO 96/40880 PCT/US96/ 1187 -29negative medium and incubated at 37C in a humidified

CO

2 incubator for five hours. The transfection procedure used is essentially that recommended for Lipofectin Reagent (BRL). Briefly, for each 6 cm plate, micrograms of plasmid DNA were diluted up to 100 microliters with H 2 0. Separately, 50 micrograms of Lipofectin Reagent were diluted to 100 microliters with

H

2 0. The 100 microliters of diluted LipofectinT Reagent were added dropwise to the diluted plasmid DNA contained in a polystyrene, 5 ml, snap cap tube and mixed gently.

The mixture was then incubated for 15-20 minutes at room temperature. During this time, the virus inoculum was removed from the 6 cm plates and the cell monolayers washed once with CEF negative medium. Three mls of CEF negative medium were added to the plasmid DNA/lipofectin mixture and the contents pipetted onto the cell monolayer. Following overnight (about 16 hours) incubation at 37 0 C in a humidified 5% CO, incubator, the o* medium was removed and replaced with 5 ml CEF complete 20 medium. The cells were incubated at 37'C in 5% CO 2 for 3- 7 days until cytopathic effect from the virus was 100%. Virus was harvested as. described above for the preparation of virus stocks. This stock was referred to as a transfection stock and was subsequently screened for 25 recombinant virus by the "Plaque Hybridization Procedure For Purifying Recombinant

FPV".

e*'e PLAQUE HYBRIDIZATION PROCEDURE FOR PURIFYING

RECOMBINANT

FPV. CEF cell monolayers were infected with various 30 dilutions of the infection/transfection viral stocks, .e overlaid with nutrient agarose media (equal volumes of agarose and 2X M199) and incubated 6-7 days for plaque development to occur. The agarose overlay and plate were marked with the same three asymmetrical dots (India ink) to aid in positioning the Nitrocellulose

(NC)

membrane (cell monolayer) and agarose overlay. The agarose overlay was transferred to the lid of the 10 cm WO 96/40880 PCT/US96/11187 dish and stored at 4'C. The CEF monolayer was overlaid with a pre-wetted (PBS) NC membrane and pressure applied to transfer the monolayer to the NC membrane. Cells contained on the NC membrane were then lysed by placing the membranes in 1.5 ml of 1.5 M NaCl and 0.5 M NaOH for five minutes. The membranes were placed in 1.5 ml of 3 M sodium acetate (pH 5.2) for five minutes. DNA from the lysed cells was bound to the NC membrane by baking at 0 C for one hour. After this period the membranes were prehybridized with a solution containing 6X SSC, 3% skim milk, 0.5% SDS, salmon sperm DNA (50 pg/ml) and incubated at 65 0 C for one hour. Radio-labeled probe DNA (alpha 3 2

P-

dCTP) was added and incubated at 65 0 C overnight (12 hours). After hybridization the NC membranes were washed two times (30 minutes each) with 2X SSC at 65 0 C, followed by two additional washes at 65 0 C with 0.5X SSC. The NC membranes were dried and exposed to X-ray film (Kodak X- OMAT, AR) at -70 0 C for 12 hours. Plaques corresponding to positive signals seen on the autoradiogram were picked eo 20 from the agarose overlay, using a pasteur pipette, and were resuspended into 1 ml of CEF media and stored at 0 C. Typically, 5-6 rounds.of plaque purification were required to ensure purity of the recombinant virus.

SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT

FPV

USING BLACK PLAQUE ASSAYS. To analyze expression of foreign antigens expressed by recombinant fowlpox viruses, monolayers of CEF cells were infected with recombinant FPV, overlaid with nutrient agarose media and incubated for 6-7 days at 37 0 C for plaque development to occur. The agarose overlay was removed from the dish, the cells fixed with 100% methanol for 10 minutes at room temperature and air dried. The primary antibody was diluted to an appropriate concentration with PBS and incubated on the cell monolayer for two hours at room temperature. Unbound antibody was removed from the cells by washing three times with PBS at room temperature.

A

WO 96/40880 PCT/US96/11187 -31horseradish peroxidase conjugated secondary antibody was diluted with PBS and incubated on the cell monolayer for two hours at room temperature. Unbound secondary antibody was then removed by washing the cells three times with PBS at room temperature. The cells were incubated 15-30 minutes at room temperature with freshly prepared substrate solution (100 Ag/ml 4-chloro-lnaphthol, 0.003% H 2 0 2 in PBS). Plaques expressing the correct antigen stain black.

SCREEN FOR RECOMBINANT FPV EXPRESSING ENZYMATIC

MARKER

GENES. When the E. coli 3 -galactosidase (lacZ) or 3glucuronidase (uidA) marker gene was incorporated into a recombinant virus the plaques containing recombinants were visualized by a simple assay. The enzymatic substrate was incorporated (300 Ag/ml) into the agarose overlay during the plaque assay. For the lacZ marker eoo gene the substrates Bluogal (halogenated indolyl-g-Dgalactosidase, Bethesda Research Labs) for blue plaques 20 or CPRG (chlorophenol Red Galactopyranoside, Boehringer mannheim) for red plaques were used. For the uidA marker gene the substrate X-Glucuro Chx (5-bromo-4chloro-3-indolyl-3-D-glucuronic acid Cyclohexylammonium salt, Biosynth AG) was used. Plaques that expressed active marker enzyme turned either red or blue. The plaques were then picked onto fresh cells and purified by further plaque isolation.

RNA ISOLATED FROM CONCANAVALIN A STIMULATED CHICKEN 30 SPLEEN CELLS. Chicken spleens were dissected from 3 week old SPAFAS hatched chicks, washed, and disrupted through a syringe/needle to release cells. After allowing stroma and debri to settle out, the cells were pelleted and washed twice with PBS. The cell pellet was treated with a hypotonic lysis buffer to lyse red blood cells, and splenocytes were recovered and washed twice with PBS.

Splenocytes were resuspended at 5 x 106 cells/ml in RPMI WO 96/40880 PCT/US96/11187 -32containing 5% FBS and 5 Ag/ml Concanavalin A and incubated at 390 for 48 hours. Total RNA was isolated from the cells using guanidine isothionate lysis reagents and protocols from the Promega RNA isolation kit (Promega Corporation, Madison WI). 4pg of total RNA was used in each 1st strand reaction containing the appropriate antisense primers and AMV reverse transcriptase (Promega Corporation, Madison WI). cDNA synthesis was performed in the same tube following the reverse transcriptase reaction, using the appropriate sense primers and Vent® DNA polymerase (Life Technologies, Inc. Bethesda, MD).

HOMOLOGY VECTOR 451-79.95. The plasmid 451-79.95 was constructed for the purpose of inserting the NDV HN gene into FPV. A lacZ marker gene followed by the NDV HN gene was inserted as a cassette into the homology vector 443- 88.14 at the unique SfiI site. The cassette may be constructed utilizing standard recombinant DNA techniques 20 (Maniatis et al., 1982 and Sambrook et al., 1989), by joining restriction fragments from the following sources with the synthetic DNA sequences indicated. The first fragment is the synthetic late promoter LP1 (SEQ ID NO:9). The second fragment contains the coding region of E. coli lacZ and is derived from plasmid pJF751 (Ferrari et al., 1985). Note that the promoter and lacZ gene are S" fused so as to express a hybrid protein consisting of 4 amino acids derived from the synthetic promoter followed by amino acids 10 to 1024 of the lacZ gene. The third fragment is another copy of the synthetic late promoter LP1. the fourth fragment contains the coding region of the NDV HN gene and was derived from the full length HN cDNA clone. Note that the promoter and HN gene are fused so as to express a hybrid protein consisting of 4 amino acids derived from the synthetic promoter followed by amino acids 2 to 577 of the HN gene. Both genes are in the opposite transcriptional orientation relative to the WO 96/40880 PCT/US96/11187 -33- ORFI gene in the parental homology vector.

HOMOLOGY VECTOR 489-21.1. The plasmid 489-21.1 was constructed for the purpose of inserting the NDV HN gene into FPV. The NDV HN gene was inserted as a cassette into the homology vector 443-88.8 at the unique SfiI site. The cassette may be constructed utilizing standard recombinant DNA techniques (Maniatis et al., 1982 and Sambrook et al., 1989), by joining restriction fragments from the following sources with the synthetic

DNA

sequences indicated. The first fragment is the synthetic early/late promoter EP1LP2 (SEQ ID NO:8/SEQ ID NO:11).

The second fragment contains the coding region of the NDV HN gene and was derived from the full length HN cDNA clone. Note that the promoter and HN gene are fused so as to express a hybrid protein consisting of 4 amino acids derived from the synthetic promoter followed by amino acids 2 to 577 of the HN gene. The HN gene is in Sthe opposite transcriptional orientation relative to the 20 ORF in the parental homology vector.

r- HOMOLOGY VECTORS 502-26.22. The plasmid 502-26.22 was constructed for the purpose of inserting the NDV HN and F genes into FPV. The NDV HN and F genes were inserted 25 as a SfiI fragment (SEQ ID NO:12) into the homology vector 443-88.8 at the unique SfiI site. The NDV HN and S" F genes were inserted in the same transcriptional oe o orientation as the ORF in the parental homology vector.

A detailed description of the SfiI is shown in Figures 30 1A-1C. The inserted SfiI fragment may be constructed utilizing standard recombinant DNA techniques (Maniatis et al. and Sambrook et al., 1989), by joining restriction fragments from the following sources with the synthetic DNA sequences indicated in Figures 1A-1C. Fragment 1 is approximately 1811 base pair AvaII to NaeI restriction fragment of the full length NDV HN cDNA clone (BI strain). Fragment 2 is an approximately 1812 base pair WO 96/40880 PCT/US96/11187 -34- BamHI to PstI restriction fragment of the full length NDV F cDNA (Bl strain). Fragment 3 is an approximately 235 base pair PstI and Scal restriction fragment of the plasmid pBR322.

HOMOLOGY VECTOR 502-27.5. The plasmid 502-27.5 was constructed for the purpose of inserting the NDV F gene into FPV. A LacZ marker gene followed by the NDV F gene was inserted as a cassette into the homology vector 443- 88.14 at the unique SfiI site. The cassette may be constructed utilizing standard recombinant DNA techniques (Maniatis et al., 1982 and Sambrook et al., 1989), joining restriction fragments from the following sources with the synthetic DNA sequences indicated. The first fragment is the synthetic late promoter LP1 (SEQ ID NO:9). The second fragment contains the coding region of E. coli LacZ and is derived from plasmid pJF751 (Ferrari et al., 1985). Note that the promoter and LacZ gene are fused so as to express a hybrid protein consisting of 4 20 amino acids derived from the synthetic promoter followed by amino acids 10 to 1024 of the LacZ gene. The third fragment is the synthetic early/late promoter EP1LP2 (SEQ ID NO:8/SEQ ID NO:11). The fourth fragment contains the coding region of the NDV F gene and was derived from the full length F cDNA clone. Note that the promoter and F gene are fused so as to express a hybrid protein consisting of 4 amino acids dervied from the synthetic promoter followed by 10 amino acids derivied from the F gene 5' untranslated region followed by amino acid 1 to S 30 544 of the F gene. Both genes are in the opposite transcriptional orientation relative to the ORF in the parental homology vector.

HOMOLOGY VECTOR 586-36.6. The plasmid 586-36.6 was constructed for the purpose of inserting the infectious laryngotracheitis virus (ILT) gB and gD genes into the FPV. An E. coli -glucuronidase uidA marker gene WO 96/40880 PCT/US96/11187 preceeded by the ILT gB and gD genes was inserted as a cassette into the homology vector 451-08.22 at the unique Sfil site. The cassette may be constructed utilizing standard recombinant DNA techniques (Maniatis et al., 1982 and Sambrook et al., 1989), by joining restriction fragments from the following sources with the synthetic DNA sequences indicated. The first fragment is the synthetic early/late promoter EP1LP2 (SEQ ID NO:8/SEQ

ID

NO:11). The second fragment contains the coding region of ILT gB and is dervied from an approximately 3000 base pair ILT virus genomic EcoRI fragment. Note that the promoter and gB gene are fused so as to express the complete coding region of the gB gene (amino acids 1- 883). The third fragment is the synthetic early/late promoter EP1LP2 (SEQ ID NO:8/SEQ ID NO:11). The fourth fragment contains the coding region of the ILT gD gene (SEQ ID NO:19) and was derived from an approximately 2060 base pair EcoRI to BclI restriction sub-fragment of the ILT KpnI genomic restriction fragment #8 (10.6 KB). Note 20 that the promoter and gD gene are fused so as to express a hybrid protein consisting of 3 amino acids dervied from the synthetic promoter followed by amino acids 3 to 434 of the gD gene. The fifth fragment is the synthetic late promoter LP1 (SEQ ID NO:9). The last fragment contains the coding region of E. coli uidA and is derived from plasmid pRAJ260 (Clonetech). Note that the promoter and uidA gene are fused so as to express a hybrid protein consisting of 3 amino acids derived from the synthetic promoter followed by amino acids 1 to 602 of the uidA 30 gene. All three genes are in the opposite transcriptional orientation relative to ORF1 in the parental homology vector.

HOMOLOGY VECTOR 608-10.3. The plasmid 608-10.3 was constructed for the purpose of inserting the Marek's Disease virus (MDV) gD and gB genes into FPV. A LacZ marker gene preceeded by the MDV gD and gB genes was WO 96/40880 PCT/US96/11187 -36inserted as a cassette into the homology vector 443-88.14 at the unique SfiI site. The cassette may be constructed utilizing standard recombinant DNA techniques (Maniatis et al., 1982 and Sambrook et al., 1989), by joining restriction fragments from the following sources with the synthetic DNA sequences indicated. The first fragment is the synthetic late/early promoter LP2EP2 (SEQ ID NO:11/SEQ ID NO:10). The second fragment contains the coding region of MDV gD and is derived from an approximately 2177 base pair NcoI to SalI sub-fragment of the MDV BglII 4.2 KB genomic restriction fragment (Ross, et al., 1991). Note that the promoter and gD are fused so as to express a hybrid protein consisting of 3 amino acids derived from the synthetic promoter followed by amino acids 3 to 403 of the gD gene. The third fragment is the synthetic early/late promoter EP1LP2 (SEQ ID NO:8/SEQ ID NO:11). The fourth fragment contains the coding region of the MDV gB gene and was derived from an approximately 3898 base pair SalI to EcoRI genomic MDV 20 fragment (Ross, et al., 1989). Note that the promoter and gB gene are fused so as to express a hybrid protein consisting of.3 amino acids derived from the synthetic promoter followed by amino acids 3 to 865 of the gB gene.

The fifth fragment is the synthetic late promoter LP1 (SEQ ID NO:9). The sixth fragment contains the coding region of E. coli LacZ and is derived from plasmid pJF751 (Ferrari, et al., 1985). Note that the promoter and LacZ gene are fused so as to express a hybrid protein consisting of 4 amino acids derived from the synthetic 30 promoter followed by amino acids 10 to 1024 of the LacZ gene. All three genes are in the opposite transcriptional orientation relative to ORF1 in the parental homology vector.

HOMOLOGY VECTOR 538-51.27. The plasmid 538-51.27 was constructed for the purpose of inserting the genes for Infectious Bronchitis virus (IBV) Massachusetts Spike WO 96/40880 PCT/US96/ 1187 -37protein (Mass Spike) and Massachusetts Matrix protein (Mass Matrix) into FPV. A lacZ maiker gene and the genes for IBV Mass Spike and Mass Matrix were inserted as a cassette into the homology vector 443-88.14 at the unique SfiI site. The inserted SfiI fragment is constructed utilizing standard recombinant DNA techniques (Maniatis et al., 1982 and Sambrook et al., 1989), by joining restriction fragments from the following sources. The first fragment is the synthetic early/late promoter EP1LP2 (SEQ ID NO: 8/ SEQ ID NO: 11). The second fragment contains the coding region for the IBV Mass Spike gene and (amino acids 3--1162) is derived from an approximately 3500 base pair BsmI to PvuI IBV cDNA fragment. The third fragment is the synthetic early/late promoter EP1LP2 (SEQ ID NO: 8/ SEQ ID NO: 11). The fourth fragment contains the coding region for the IBV Mass Matrix gene (amino acids 1-232) and is derived from approximately 1500 base pair XbaI to Spel IBV cDNA fragment. The fifth fragment is the synthetic late 20 promoter LP1 (SEQ ID NO: The sixth fragment contains the coding region of E. coli lacZ and is derived from plasmid pJF751 (Ferrari, et al. 1985).

HOMOLOGY VECTOR 622-49.1. The plasmid 622-49.1 was constructed for the purpose of inserting the IBV Massachusetts (Mass) Nucleocapsid gene into FPV. A uidA marker gene and the IBV Mass Nucleocapsid gene was inserted as a cassette into the homology vector 451-08.22 at the unique SfiI site. The inserted SfiI fragment was constructed utilizing standard recombinant DNA techniques (Maniatis et al., 1982 and Sambrook et al., 1989), by joining restriction fragments from the following sources.

The first fragment is the synthetic early/late promoter EP1LP2 (SEQ ID NO: 8/ SEQ ID NO: 11). The second fragment contains the coding region for the IBV Mass Nucleocapsid gene and is derived from an approximately 3800 base pair PstI to IBV cDNA fragment. The third fragment is the synthetic late promoter LP1 (SEQ ID NO: WO 96/40880 PCT/US96/11187 -38- The fourth fragment contains the coding region of E.

coli uidA and is derived from plasmid pRAJ260 .(Clonetech).

HOMOLOGY VECTORS 584-36.12. The plasmid 584-36.12 was constructed for the purpose of inserting the NDV HN and F genes into FPV. The NDV HN and F genes were inserted as a SfiI fragment into the homology vector 443-88.14 (see example 1B) at the unique SfiI site. The NDV HN and F genes were inserted in the same transcriptional orientation as the ORF in the parental homology vector.

A detailed description of the SfiI fragment is shown in Figures 1A-1C. The inserted SfiI fragment was constructed utilizing standard recombinant DNA techniques (Maniatis et al, 1982 and Sambrook et al, 1989), by joining restriction fragments from the following sources with the synthetic DNA sequences indicated in Figures 1A-1C.

Fragment 1 is an approximately 1811 base pair AvaII to NaeI restriction fragment of the full length NDV HN CDNA 20 clone (B1 strain). Fragment 2 is an approximately 1812 base pair BamHI to PstI restriction fragment of the full length NDV F cDNA (B1 strain). Fragment 3 is an approximately 235 base pair PstI to Scal restriction fragment of the plasmid pBR322.

HOMOLOGY VECTOR 694-10.4. The plasmid 694-10.4 was constructed for the purpose of inserting the infectious laryngotracheitis virus (ILTV) gB and gD genes into FPV.

An E.coli /-glucuronidase uidA marker gene preceded by 30 the ILTV gB and gD genes was inserted as a cassette into the homology vector 451-08.22 at the unique SfiI site.

The cassette was constructed utilizing standard recombinant DNA techniques (Maniatis et al, 1982 and Sambrook et al, 1989), by joining restriction fragments from the following sources with the synthetic DNA sequences indicated. The first fragment is the synthetic early/late promoter EP1LP2 (SEQ ID NO:8/SEQ ID NO:11).

WO 96/40880 PCT/US96/11187 -39- The second fragment contains the coding region of ILTV gB and is derived from an approximately 3000 base pair ILT virus genomic EcoRI fragment. Note that the promoter and gB gene are fused so as to express the complete coding region of the gB gene (animo acids 1-883). The third fragment is the synthetic early/late promoter EP1LP2 (SEQ ID NO:8/SEQ ID NO:11). The fourth fragment contains the coding region of the ILTV gD gene and was derived from an approximately 2060 base pair EcoRI to BclI restriction sub-fragment of the ILTV KpnI genomic restriction fragment #8 (10.6 KB). Note that the promoter and gD gene are fused so as to express a hybrid protein consisting of 3 amino acids derived from the synthetic promoter followed by amino acids 3 to 434 of the gD gene. The fifth fragment is the synthetic late promoter LP1 (SEQ ID NO:9). The last fragment contains the coding region of E.coli uidA and is derived from plasmid pRAJ260 (Clonetech). Note that the promoter and uidA gene are fused so as to express a hybrid protein consisting of 3 20 amino acids derived from the synthetic promoter followed by amino acids 1 to 602 of the uidA gene.

HOMOLOGY VECTOR 749-75.82. The plasmid 749-75.82 was used to insert foreign DNA into FPV. It incorporates an E.

coli 3-galactosidase (lacZ) marker gene and the infectious bursal disease virus (IBDV) polymerase gene flanked by FPV DNA. When this plasmid was used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV a virus containing DNA coding for the 30 foreign genes results. Note that the 0-galactosidase (lacZ) marker gene is under the control of a synthetic late pox promoter (LP1) and the IBDV polymerase gene is under the control of a synthetic late/early pox promoter (LP2EP2). The homology vector was constructed utilizing standard recombinant DNA techniques (11 and 14), by joining restriction fragments from the following sources with the appropriate synthetic DNA sequences. The plasmid WO 96/40880 PCT/US96/11187 vector was derived from an approximately 2999 base pair EcoRI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1184 base pair EcoRI to SnaBI restriction sub-fragment of the 2.8 kb EcoRI FPV genomic fragment (SEQ ID NO. Fragment 2 is an approximately 2700 EcoRI to AscI restriction fragment synthesized by cDNA cloning and polymerase chain reaction (PCR) from an IBDV RNA template. cDNA and PCR primers CACGAATTCTGACATTTTCAACAGTCCACAGGCGC-3'; 12/93.4) (SEQ ID NO: and 5'-GCTGTTGGACATCACGGGCCAGG-3'; 9/93.28) (SEQ ID NO: were used to synthesize an approximately 1100 base pair EcoRI to BclI fragment at the 5' end of the IBDV polymerase gene. cDNA and PCR primers ACCCGGAACATATGGTCAGCTCCAT-3'; 12/93.2) (SEQ ID NO: and 5'-GGCGCGCCAGGCGAAGGCCGGGGATACGG-3 12/93.3) (SEQ ID NO: were used to synthesize an approximately 1700 base pair BclI to AscI fragment at the 3' end of the IBDV polymerase gene. The two fragments were ligated at the BclI site to form the approximately 2800 base pair EcoRI 20 to BclI fragment. Fragment 3 is an approximately 3002 base pair BamHI to PvuII restriction fragment of plasmid pJF7,51 Fragment 4 is an approximately 1626 base pair SnaBI to EcoRI restriction sub-fragment of the 2.8 kb EcoRI FPV genomic fragment (SEQ ID NO. HOMOLOGY VECTOR 751-07.D1. The plasmid 751-07.D1 was used to insert foreign DNA into FPV. It incorporates an E.

coli 3 -galactosidase (lacZ) marker gene and the chicken interferon (cIFN) gene flanked by FPV DNA. When this 30 plasmid was used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV a virus containing DNA coding for the foreign genes results. Note that the P-galactosidase (lacZ) marker gene is under the control of a synthetic late pox promoter (LP1) and the cIFN gene is under the control of a synthetic late/early pox promoter (LP2EP2). The homology vector was constructed utilizing standard recombinant

DNA

WO 96/40880 PCT/US96/11187 -41techniques by joining restriction fragmen ts from the following sources with the appropriate synthetic DNA sequences. The plasmid vector was derived from an approximately 2999 base pair EcoRI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1626 base pair EcoRI to SnaBI restriction sub-fragment of the 2.8 kb EcoRI FPV genomic fragment (SEQ ID NO. Fragment 2 is an approximately 577 base pair EcoRI to BglII fragment coding for the cIFN gene (17) derived by reverse transcription and polymerase chain reaction (PCR) (Sambrook, et al., 1989) of RNA ISOLATED FROM CONCANAVALIN A STIMULATED CHICKEN

SPLEEN

CELLS. The antisense primer (6/94.13) used for reverse transcription and PCR was CGACGGATCCGAGGTGCGTTTGGGGCTAAGTGC-3' (SEQ ID NO: The sense primer (6/94.12) used for PCR was CCACGGATCCAGCACAACGCGAGTCCCACCATGGCT-3' (SEQ ID NO: The BamHI fragment resulting from reverse transcription and PCR was gel purified and used as a template for a second PCR reaction to introduce a unique EcoRI site at the 5' end and a unique BglII site at the 3' end. The second PCR reaction used primer 6/94.22 CCACGAATTCGATGGCTGTGCCTGCAAGCCCACAG-3'; SEQ ID NO: at the 5' end and primer 6/94.34 CGAAGATCTGAGGTGCGTTTGGGGCTAAGTGC-3'; SEQ ID NO: at the 3' end to yield an approximately 577 base pair fragment.

:i The DNA fragment contains the coding sequence from amino acid 1 to amino acid 193 of the chicken interferon protein (17) which includes a 31 amino acid signal 30 sequence at the amino terminus and 162 amino acids of the mature protein encoding chicken interferon. Fragment 3 is an approximately 3002 base pair BamHI to PvuII restriction fragment of plasmid pJF751 Fragment 4 is an approximately 1184 base pair SnaBI to EcoRI restriction sub-fragment of the 2.8 kb EcoRI FPV genomic fragment (SEQ ID NO. WO 96/40880 PCT/US96/11187 -42- HOMOLOGY VECTOR 751-56.Cl. The plasmid 751-56.C1 was used to insert foreign DNA into FPV. It incorporates an E.

coli -galactosidase (lacZ) marker gene and the chicken myelomonocytic growth factor (cMGF) gene flanked by FPV DNA. When this plasmid was used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV a virus containing DNA coding for the foreign genes results. Note that the f-galactosidase (lacZ) marker gene is under the control of a synthetic late pox promoter (LP1) and the cMGF gene is under the control of a synthetic late/early pox promoter (LP2EP2).

The homology vector was constructed utilizing standard recombinant DNA techniques (11 and 14), by joining restriction fragments from the following sources with the appropriate synthetic DNA sequences. The plasmid vector was derived from an approximately 2999 base pair EcoRI restriction fragment of pSP64 (Promega). Fragment 1 is an approximately 1184 base pair EcoRI to SnaBI restriction sub-fragment of the 2.8 kb EcoRI FPV genomic fragment (SEQ ID NO. Fragment 2 is an approximately 640 base pair EcoRI to BamHI fragment coding for the cMGF gene (16) derived by reverse transcription and polymerase chain reaction (PCR) (Sambrook, et al., 1989) of RNA ISOLATED FROM CONCANAVALIN A STIMULATED CHICKEN SPLEEN 25 CELLS. The antisense primer (6/94.20) used for reverse transcription and PCR was CGCAGGATCCGGGGCGTCAGAGGCGGGCGAGGTG-3' (SEQ ID NO: The sense primer (5/94.5) used for PCR was GAGCGGATCCTGCAGGAGGAGACACAGAGCTG-3' (SEQ ID NO: The BamHI fragment derived from PCR was subcloned into a plasmid and used as a template for a second PCR reaction using primer 6/94.16 SEQ ID NO: at the 5' end and primer 6/94.20 CGCAGGATCCGGGGCGTCAGAGGCGGGCGAGGTG-3'; SEQ ID NO: at the 3' end to yield an approximately 640 base pair fragment. The DNA fragment contains the coding sequence from amino acid 1 to amino acid 201 of the cMGF protein WO 96/40880 PCT/US96/11187 -43- (16) which includes a 23 amino acid signal sequence at the amino terminus and 178 amino acids of the mature protein encoding cMGF. Fragment 3 is an approximately 3002 base pair BamHI to PvuII restriction fragment of plasmid pJF751 Fragment 4 is an approximately 1626 base pair SnaBI to EcoRI restriction sub-fragment of the 2.8 kb EcoRI FPV genomic fragment (SEQ ID NO. Reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that this prior art forms part of the common general knowledge in Australia or any other country.

Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.

WO 96/40880 PCT/US96/11187 -44- Example 1 Sites for Insertion of Foreign DNA into FPV In order to define appropriate insertion sites, a library of FPV EcoRI restriction fragments was generated in the plasmid vector pSP64 (Promega). Several of these restriction fragments were subjected to restriction mapping analysis. Unique blunt cutting restriction endonuclease sites were identified and mapped within the cloned FPV DNA regions. The blunt restriction sites were converted to Not I and Sfi I sites through the use of synthetic DNA linkers (oligo 66.04; GGCGGCCGCGGCCCTCGAGGCCA-3' SEQ ID NO: 1 and oligo 66.05; 5' TGGCCTCGAGGGCCGCGGCCGCC 3' SEQ ID NO: A 3galactosidase (lacZ) marker gene was inserted in each of the potential sites. A plasmid containing such a foreign DNA insert may be used according to the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV to construct a FPV containing the foreign DNA. For this procedure to be successful it is important that the insertion site be in a region non-essential to the replication of the FPV and that the site be flanked with FPV DNA appropriate for mediating homologous recombination between virus and plasmid DNAs. The plasmids containing the lacZ marker gene were utilized in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The generation of recombinant virus was determined by the SCREEN FOR RECOMBINANT FPV EXPRESSING *30 ENZYMATIC MARKER GENES. Three sites were successfully used to generate a recombinant viruses. In each case the resulting virus was easily purified to 100%, clearly defining an appropriate site for the insertion of foreign DNA. The three homology vectors used to define these sites are described below.

Example 1A WO 96/40880 PCT/US96/ 1187 Homoloqc Vector 443-88.8 The homology vector 443-88.8 contains a 3.5 KB FPV genomic EcoRI fragment and is useful for the insertion of foreign DNA into FPV. This EcoRI fragment maps to the approximately 5.5 KB overlap of FPV genomic fragments SalI C and PstI F (Coupar et al., 1990). The NotI/SfiI linker described above was inserted into a unique HpaI site in this fragment. This site is designated the 680 insertion site.

The homology vector 443-88.8 was characterized by DNA sequence analysis. Approximately 1495 base pairs of DNA sequence flanking the HpaI site was determined (SEQ ID NO: This sequence indicates that the open reading frame of 383 amino acids spans the HpaI insertion site.

0! 0 The HpaI site interrupts this ORF at amino acid 226.

This ORF shows no amino acid sequence homology to any known pox virus genes.

Example 1B Homology Vector 443-88.14 The homology vector 443-88.14 contains a 2..8 KB FPV genomic EcoRI fragment and is useful for the insertion of foreign DNA into FPV. The NotI/SfiI linker described above was inserted into a unique SnaBI site in this 30 fragment. This site is designated the 681 insertion site.

The homology vector 443-88.14 was characterized by DNA sequence analysis. The entire sequence of the 2.8 KB fragment was determined (SEQ ID NO: This sequence indicates that the SnaBI site is flanked on one side by a complete ORF of 422 amino acids (ORF1) reading toward the restriction site and on the other side by an WO 96/40880 PCT/US96/I1187 -46incomplete ORF of 387 amino acids (ORF2) also reading toward the restriction site. Both ORF1 and ORF2 share homology with the vaccinia virus MIL gene (ref). The MIL gene shares homology with the vaccinia virus KlL gene which has been shown to be involved in viral host-range functions.

Example IC Homolocy Vector 451-08.22 The homology vector 451-08.22 contains a 4.2 KB FPV genomic EcoRI fragment and is useful for the insertion of foreign DNA into FPV. The NotI/SfiI linker described above was inserted into a unique StuI site in this fragment. A unique MluI site is located approximately 500 base pairs away from the StuI insertion site. This site is designated the 540 insertion site.

20 Example 2

S.

Bivalent Vaccines Against Newcastle Disease and FowlDox Recombinant FPV expressing proteins from NDV make bivalent vaccines protecting against both Marek's Disease and Newcastle disease. We have constructed several recombinant FPV expressing NDV proteins: S-FPV-013 (example 2A), S-FPV-035 (example 2B), S-FPV-041 (example 2C), S-FPV-042 (example 2D), and S-FPV-043 (example 2E).

Example 2A S-FPV-013 S-FPV-013 is a recombinant fowlpox virus that expresses two foreign genes. The gene for E. coli -galactosidase (lacZ gene) and the gene for Newcastle Disease virus WO 96/40880 PCT/US96/1187 -47hemagglutinin-neuraminidase (HN) protein were inserted into the 681 insertion site. The lacZ gene is under the control of a synthetic late promoter LP1 and the HN gene is under the control of the synthetic late promoter LP2.

S-FPV-013 was derived from S-FPV-001. This was accomplished utilizing the homology vector 451-79.95 (see Materials and Methods) and virus S-FPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING

ENZYMATIC

MARKER GENES. The final result of red plaque purification was the recombinant virus designated

S-FPV-

013. This virus was assayed for P-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in the materials and methods. After the initial three rounds of purification all plaques observed were blue indicating that the virus was pure, stable and expressing 20 the marker gene.

S-FPV-013 was assayed for expression of NDV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. An NDV HN specific 25 monoclonal antibody (3-1G-5) was shown to react specifically with S-FPV-013 plaques and not with S-FPV- 001 negative control plaques. All S-FPV-013 observed plaques reacted with the monoclonal antibody antiserum indicating that the virus was stably expressing the NDV foreign gene.

Example 2B S-FPV-035 S-FPV-035 is a recombinant fowlpox virus that express a foreign gene. The Newcastle Disease virus HN gene was inserted at the 680 insertion site (see example 1A). The WO 96/40880 PCT/US96/11187 -48- HN gene is under the control of the synthetic early/late promoter EP1LP2.

S-FPV-035 was derived from S-FPV-001. This was accomplished utilizing the homology vector 489-21.1 (see Materials and Methods) and virus S-FPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the PLAQUE HYBRIDIZATION PROCEDURE FOR PURIFYING RECOMBINANT FPV. The final result of plaque hybridization purification was the recombinant virus designated S-FPV-035.

S-FPV-035 was assayed for expression of NDV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. An NDV HN specific monoclonal antibody (3-1G-5) was shown to react specifically with S-FPV-035 plaques and not with S-FPV- 001 negative control plaques. All S-FPV-035 observed 20 plaques reacted with the monoclonal antibody indicating that the virus was stably expressing the NDV foreign gene.

Example 2C S-FPV-041 S-FPV-041 is a recombinant fowlpox virus that expresses two foreign genes. The gene for E. coli /-galactosidase (lacZ gene) and the gene for Newcastle Disease virus fusion protein were inserted into the 681 insertion site. The lacZ gene is under the control of a synthetic late promoter LP1 and the F gene is under the control of the synthetic early/late promoter EP1LP2.

S-FPV-041 was derived from S-FPV-001. This was accomplished utilizing the homology vector 502-27.5 (see WO 96/40880 PCT/US96/1187 -49- Materials and Methods) and virus S-FPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING

ENZYMATIC

MARKER GENES. The final result of red plaque purification was the recombinant virus designated S-FPV-041. This virus was assayed for 3 -galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in the materials and methods. After the initial three rounds of purification all plaques observed were blue indicating that the virus was pure, stable and expressing the marker gene.

S-FPV-041 was assayed for expression of NDV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN

GENE

EXPRESSION IN RECOMBINANT FPV. An NDV F specific monoclonal antibody (5-3F-2) was shown to react specifically with S-FPV-041 plaques and not with S-FPV- 001 negative control plaques. All S-FPV-041 observed 20 plaques reacted with the monoclonal antibody indicating that the virus was stably expressing the NDV foreign gene.

Example 2D S-FPV-042 S-FPV-042 is a recombinant fowlpox virus that expresses three foreign genes. The gene for E. coli 3galactosidase (lacZ gene) and the gene for Newcastle Disease virus fusion protein was inserted into the 681 insertion site. The lacZ gene is under the control of a synthetic late promoter LP1 and the F gene is under the control of the synthetic early/late promoter EP1LP2.

The Newcastle Disease virus hemagglutinin (HN) gene were inserted at the 680 insertion site. The HN gene is under the control of the synthetic early/late promoter EP1LP2.

WO 96/40880 PCT/US96/11187 S-FPV-042 was derived from S-FPV-035. This was accomplished utilizing the homology vector 502-27.5 (see Materials and Methods) and virus S-FPV-035 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING

ENZYMATIC

MARKER GENES. The final result of red plaque purification was the recombinant virus designated S-FPV-042. This virus was assayed for -galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in the materials and methods. After the initial three rounds of purification all plaques observed were blue indicating that the virus was pure, stable and expressing the marker gene.

S-FPV-042 was assayed for expression of NDV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. Monoclonal antibodies specific for both HN (3-1G-5) and F (5-3F-2) were shown to react specifically with S-FPV-042 plaques and not with SS-FPV-001 negative control plaques. All S-FPV-042 observed plaques reacted with the monoclonal antibodies indicating that the virus was stably expressing the NDV foreign genes.

Example 2E S-FPV-043 S-FPV-043 is a recombinant fowlpox virus that expresses two foreign genes. The genes for Newcastle Disease virus F protein and HN protein were inserted at the 680 insertion site. The F and HN genes are each under the control of a synthetic early/late promoter EP1LP2.

S-FPV-043 was derived from S-FPV-001. This was accomplished utilizing the homology vector 502-26.22 (see WO 96/40880 PCT/US96/I1187 -51- Materials and Methods) and virus S-FPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the PLAQUE HYBRIDIZATION PROCEDURE FOR PURIFYING RECOMBINANT FPV. The final result of plaque hybridization purification was the recombinant virus designated S-FPV-043.. The S-FPV-043 has been deposited pursuant to the Budapest Treaty on the International Deposit of Microorganisms for the Purposes of Patent Procedure with the Patent Culture Depository of the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland 20852 U.S.A. under ATCC Accession No. VR 2395.

S-FPV-043 was assayed for expression of NDV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN

GENE

EXPRESSION IN RECOMBINANT FPV. Monoclonal antibodies specific for both HN (3-1G-5) and F (5-3F-2) were shown to react specifically with S-FPV-043 plaques and not with 20 S-FPV-001 negative control plaques. All S-FPV-043 observed plaques reacted with the monoclonal antibodies antiserum indicating that the virus was stably expressing the NDV foreign genes.

25 TESTING OF RECOMBINANT FPV EXPRESSING NDV ANTIGENS Groups of one day old SPF chicks (HyVac Inc.) were immunized with recombinant fowlpox viruses S-FPV-035,

S-

FPV-041, or S-FPV-043. Non vaccinated controls were also included. Three weeks post-vaccination, the birds were challenged intramuscularly with either virulent NDV or virulent FPV (Table The challenged chicks were observed daily for 14 days for clinical signs and death due to NDV. Non vaccinated control birds showed 100% mortality. S-FPV-043 vaccinated birds showed 100% protection against FPV challenge. Birds vaccinated with S-FPV-035 showed 95% protection compared with 85% seen WO 96/40880 PCT/US96/11187 -52with birds immunized with S-FPV-041. These results suggest that recombinants expressing HN or F alone provide only partial protection. When both NDV proteins are combined into the same virus S-FPV-043, an enhancement of protection against lethal NDV challenge is obtained, resulting in a lower protective dose. The chicks that were challenged with FPV were scored for pox lesions. Non vaccinated control birds showed no protection against FPV lesions. Birds vaccinated with S-FPV-043 were completely protected from FPV lesions.

The duration of immunity conferred by vaccination with S- FPV-043 was examined. A group of SPF chicks was immunized with S-FPV-043 at one day of age and then challenged six weeks post-vaccination with either NDV or FPV. Complete protection was observed against both NDV and FPV challenge in S-FPV-043 vaccinated birds, whereas non vaccinated controls were totally susceptible to both challenge viruses. These results suggest that the duration of immunity afforded by vaccination with S-FPV- 043 would span the life of a broiler bird 6 weeks) i''""The effect of vaccinating hens in lay with the recombinant S-FPV-043 was evaluated by assessing egg 25 production post-vaccination. One group of 50 hens was vaccinated and a second group of 50 hens, housed under conditions identical to the vaccinated group, served as non vaccinated controls. Daily egg production was monitored for four weeks post-vaccination. No differences were observed in egg production between the two groups of hens, indicating this vaccine will not adversely affect egg production in laying hens.

A study was conducted to determine whether S-FPV-043 could actively immunize chicks in the presence of maternal antibodies to both NDV and FPV. Chicks obtained from NDV and FPV immunized flocks were vaccinated with S- WO 96/40880 PCT/US96/11187 -53- FPV-043 and three weeks after vaccination, they were challenged with either virulent NDV or virulent

FPV.

Clinical responses were compared with non vaccinated chicks from the same flock and with non-vaccinated chicks from an antibody negative flock (Table Chicks derived from antibody negative flocks showed 100% mortality after NDV challenge. Protection against NDV challenge, in nonvaccinated chicks known to have maternally derived antibody against NDV, ranged from 30 to 60%. Protection levels increased, to a range of 75 to 85%, when the maternal antibody positive chicks were vaccinated with S- FPV-043 suggesting an active immunization. The increase in NDV protection from 30% to 75% (flock 1) and 55% to (flock 2) clearly demonstrate the ability of S-FPV- 043 to partially overcome maternal antibody to both NDV and FPV. A decrease in FPV protection was observed in flock 1, suggesting some inhibition of FPV replication.

a e a o.

a g 6 WO 96/40880 WO 9640880PCTIUS96/1 1187 -54- Table 1. Immunity conferred by Fowipox recombinant vaccines vectoring different genes from Newcastle disease virus.

Challenge'a

VIRUS

DOSE b

NDV

FPV

FPV/NDV-N

FPV/NDV- F

FPV/NDV-HN+F

8 x 10 5 2 x10 2 x10 NT C

NT

100 100 Controls none a Percent protection following challenge 3 weeks postvaccination b PFU/0.1 ml dose C Not tested

C.

C C C. C C C. C WO 96/40880 WO 9640880PCT/UJS96/1 1187 Table 2. Ability of recombinant vaccine FPV/NDV-HN+F

(S-

FPV-043) to vaccinate chicks with *maternal antibody.

Challenge a History Flock Vaccination Hen Ant ibodyb

NDV

FPV

NDV-HIc NDV ELISA FPV-AGpd Vacc. Con. Vacc. Con.

1 NDV FPV 2 NDV+ FPV 3 NDV only 1:36 1:64 1:92 Neg 1:1738 1:2852 1 :4324 Neg Neg Neg Neg 75 30 90 0 85 55 100 0 30 4 None 80 60 0 95 0 0 Neg aPercent protection following challenge 3 weeks post-vaccination.

b Every flock antibody.

C HI -Hemagglutination Inhibition Assay d AGP -Agar Gel Precipitation Assay S S

S.

5555

S

SUBSTITUTE SHEET (RULE 26) WO 96/40880 PCT/US96/11187 -56- Example 2F S-FPV-074 S-FPV-074 is a recombinant fowlpox virus that expresses two foreign genes. The genes for Newcastle .Disease virus F protein and HN protein were inserted at the 681 insertion site. The F and HN genes are each under the control of a synthetic late/early promoter LP2EP2.

S-FPV-074 was derived from S-FPV-001. This was accomplished utilizing the homology vector 584-36.12 (see Materials and Methods) and virus S-FPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the PLAQUE HYBRIDIZATION PROCEDURE FOR PURIFYING RECOMBINANT FPV. The final result of plaque hybridization purification was the recombinant virus designated S-FPV-074.

S-FPV-074 was assayed for expression of NDV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. Monoclonal antibodies specific for NDV HN (3-1G-5) and F (5-3F-2) were shown to S 25 react specifically with S-FPV-074 plaques and not with S- FPV-001 negative control plaques. All S-FPV-074 observed plaques reacted with the monoclonal antibodies indicating that the virus was stably expressing the NDV foreign genes.

S S S-FPV-074 expresses foreign antigens from NDV. This virus is useful as a multi-valent vaccine against Newcastle Diseases and Fowlpox.

WO 96/40880 PCT/US96/11187 -57- Example 3 Recombinant fowlpox viruses expressing proteins from Marek's disease virus (MDV) make vaccines protecting against both fowlpox virus and Marek's disease virus. We have constructed several recombinant FPV expressing

MDV

proteins: S-FPV-081, S-FPV-082 and S-FPV-085. Of these S-FPV-082 and S-FPV-085 also express proteins from Newcastle disease virus. These viruses are useful for vaccinating against fowlpox virus, Marek's disease virus, and Newcastle disease virus.

S-FPV-085 further expresses proteins from infectious laryngotracheitis virus (ILTV), making them useful as vaccines against

ILTV.

Example 3A S-FPV-081 i S-FPV-081 is a recombinant fowlpox virus that expresses three foreign genes. The gene for E.coli -galactosidase (lacZ gene) and the genes for Marek's Disease virus (MDV) glycoprotein D (gD) and glycoprotein B (gB) were inserted into the 681 insertion site. The lac Z gene is under the control of a synthetic late promoter LP1 and the MDV gD and gB genes are under the control of the synthetic early/late promoters LP2EP2 and EP1LP2 respectively.

S-FPV-081 was derived from S-FPV-001. This was accomplished utilizing the homology vector 608-10.3 (see Materials and Methods) and virus S-FPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING

ENZYMATIC

MARKER GENES. The final result of red plaque purification was the recombinant virus designated S-FPV-081. This WO 96/40880 PCT/US96/1187 -58virus was assayed for 3 -galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in the materials and methods. After the initial three rounds of purification all plaques observed were blue indicating that the virus was pure, stable and expressing the marker gene.

S-FPV-081 was assayed for expression of MDV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. Convalescent sera from MDV infected chickens was shown to react specifically with S-FPV-081 plaques and not with S-FPV-001 negative control plaques. All S-FPV-081 observed plaques reacted with the chicken antiserum indicating that the virus was stably expressing the MDV foreign genes. Western blot assays of infected cell lysates using convalescent sera from MDV-infected chickens indicated that S-FPV-081 was expressing a MDV glycoprotein B and MDV glycoprotein D.

20 S-FPV-081 expresses foreign antigens from MDV. This virus is useful as a multi-valent vaccine against Marek's Disease and Fowlpox.

Example 3B S-FPV-082 S-FPV-082 is a recombinant fowlpox virus that expresses five foreign genes. The genes for Newcastle Disease virus F protein and HN protein were inserted at the 680 insertion site. The F and HN genes are each under the control of a synthetic early/late promoter EP1LP2. The gene for E. coli P-galactosidase (lacZ gene) and the genes for Marek's Disease virus (MDV) gD and gB were inserted into the 681 insertion site. The lacZ gene is under the control of a synthetic late promoter LP1 and the MDV gD and gB genes are under the control of the WO 96/40880 PCT/US96/11187 -59synthetic early/late promoters LP2EP2 and EP1LP2 respectively.

S-FPV-082 was derived from S-FPV-043. This was accomplished utilizing the homology vector 608-10.3 (see Materials and Methods) and virus S-FPV-043 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING

ENZYMATIC

MARKER GENES. The final result of red plaque purification was the recombinant virus designated S-FPV-082. This virus was assayed for -galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in the materials and methods. After the initial three rounds of purification all plaques observed were blue indicating that the virus was pure, stable and expressing the marker gene.

S-FPV-082 was assayed for expression of MDV specific 20 antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. Convalescent sera from MDV infected chickens was shown to react specifically with S-FPV-082 plaques and not with S-FPV-001 negative control plaques. All S-FPV-082 observed plaques reacted 25 with the chicken antiserum indicating that the virus was stably expressing the MDV foreign genes.

S-FPV-082 expresses foreign antigens from NDV and MDV.

This virus will be valuable as a multi-valent vaccine against Newcastle Disease, Marek's Disease and Fowlpox.

Example 3C S-FPV-085 S-FPV-085 is a recombinant fowlpox virus that expresses eight foreign genes. The genes for Newcastle Disease WO 96/40880 PCT/US96/ 1187 virus F protein and HN protein are inserted at the 680 insertion site. The F and HN genes are each under the control of a synthetic early/late promoter EP1LP2. The gene for E.coli 0-galactosidase (lacZ gene) and the genes for Marek's Disease virus (MDV) gD and gB are inserted into the 681 insertion site. The lac Z gene is under the control of a synthetic late promoter LP1 and the MDV gD and gB genes are under the control of the synthetic early/late promoters LP2EP2 and EP1LP2 respectively. The gene for E.coli 0-glucuronidase (uidA gene) and the genes for Infectious Laryngotracheitis virus (ILTV) gD and gB are inserted into the 540 insertion site. The uidA gene is under the control of a synthetic late promoter LP1 and the ILTV gD and gB genes are each under the control of a synthetic early/late promoter EP1LP2.

S-FPV-085 is derived from S-FPV-082. This is accomplished utilizing the homology vector 586-36.6 (see Materials and Methods) and virus S-FPV-082 in the HOMOLOGOUS 20 RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT

FPV.

The transfection stock is screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING ENZYMATIC MARKER GENES. The final result of blue plaque (0-glucuronidase) purification is the recombinant virus designated

S-FPV-

25 085. This virus is assayed for /-glucuronidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in the materials and methods. After the initial three rounds of purification all plaques observed are blue indicating that the virus is pure, stable and expressing the marker gene.

S-FPV-085 is assayed for expression of MDV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. S-FPV-085 expresses foreign antigens from NDV, MDV and ILTV. This virus is useful as a multi-valent vaccine against Newcastle WO 96/40880 PCT/US96/11187 -61- Disease, Marek's Disease, Infectious Laryngotracheitis and Fowlpox.

Example 4 Recombinant fowlpox virus (FPV) expressing proteins from infectious laryngotracheitis virus (ILTV) make vaccines protecting against both FPV and ILTV. We have constructed several recombinant FPV expressing

ILTV

proteins: S-FPV-095, S-FPV-083, and S-FPV-097. Of these, S-FPV-083 and S-FPV-097 also express proteins from Newcastle disease virus (NDV), making them useful as vaccines against NDV as well.

Example 4A S-FPV-095 S-FPV-095 is a recombinant fowlpox virus that expresses 20 three foreign genes. The gene for E.coli 0-glucuronidase (uidA gene) and the genes for Infectious Laryngotracheitis virus (ILTV) glycoprotein D (gD) and glycoprotein B (gB) were inserted into the 540 insertion site. The uidA gene is under the control of a synthetic 25 late promoter LP1 and the ILTV gD and gB genes are each *under the control of a synthetic early/late promoter EP1LP2.

S-FPV-095 was derived from S-FPV-001. This was accomplished utilizing the homology vector 694-10.4 (see Materials and Methods) and virus S-FPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING

ENZYMATIC

MARKER GENES. The final result of blue plaque purification (0-glucuronidase) was the recombinant virus designated S-FPV-095. This virus was assayed for 3- WO 96/40880 PCT/US96/11187 -62glucuronidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in the materials and methods. After the initial three rounds of purification all plaques observed were blue indicating that the virus was pure, stable and expressing the marker gene.

S-FPV-095 was assayed for expression of ILTV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. Antibodies to ILTV gB and gD was shown to react specifically with S-FPV-095 plaques and not with S-FPV-001 negative control plaques. All S- FPV-095 observed plaques reacted with the antiserum indicating that the virus was stably expressing the ILTV foreign genes.

9 9.0999 9t S-FPV-095 expresses foreign antigens from ILTV. This virus is useful as a multi-valent vaccine against Infectious Laryngotracheitis and Fowlpox.

Example 4B S-FPV-083 r r 9 S-FPV-083 is a recombinant fowlpox virus that expresses five foreign genes. The genes for Newcastle Disease virus F protein and HN protein were inserted at the 680 insertion site. The F and HN genes are each under the control of a synthetic early/late promoter EP1LP2. The 30 gene for E. coli 0-glucuronidase (uidA gene) and the genes for Infectious Laryngotracheitis virus (ILT) gD and gB were inserted into the 540 insertion site. The uidA gene is under the control of a synthetic late promoter LP1 and the ILT gD and gB genes are each under the control of a synthetic early/late promoter (EP1LP2).

S-FPV-083 was derived from S-FPV-043.

Thi s was WO 96/40880 PCT/US96/11187 -63accomplished utilizing the homology vector 586-36.6 (see Materials and Methods) and virus S-FPV-043 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING

ENZYMATIC

MARKER GENES. The final result of blue plaque purification was the recombinant virus designated

S-FPV-

083. This virus was assayed for P-glucuronidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in the materials and methods. After the initial three rounds of purification all plaques observed were blue indicating that the virus was pure, stable and expressing the marker gene.

S-FPV-083 was assayed for expression of ILTV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN

GENE

EXPRESSION IN RECOMBINANT FPV. Convalescent sera from ILTV infected chickens was shown to react specifically 20 with S-FPV-083 plaques and not with S-FPV-001 negative control plaques. All S-FPV-083 observed plaques reacted with the chicken antiserum indicating that the virus was stably expressing the ILTV foreign genes.

25 S-FPV-083 expresses foreign antigens from NDV and ILTV.

This virus will be valuable as a multi-valent vaccine against Newcastle Disease, Infectious Laryngotracheitis and Fowlpox.

Example 4C

*O

S-FPV-097 S-FPV-097 is a recombinant fowlpox virus that expresses five foreign genes. The genes for Newcastle Disease virus F protein and HN protein were inserted at the 680 insertion site. The F and HN genes are each under the WO 96/40880 PCT/US96/11187 -64control of a synthetic early/late promoter EP1LP2. The gene for E.coli fl-glucuronidase (uidA gene) and the genes for Infectious Laryngotracheitis virus (ILTV) glycoprotein D (gD) and glycoprotein B (gB) were inserted into the 540 insertion site. The uidA gene is under the control of a synthetic late promoter LP1 and the ILTV gD and gB genes are each under the control of a synthetic early/late promoter EP1LP2.

S-FPV-097 was derived from S-FPV-043. This was accomplished utilizing the homology vector 694-10.4 (see Materials and Methods) and virus S-FPV-043 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING

ENZYMATIC

MARKER GENES. The final result of blue plaque purification was the recombinant virus designated

S-FPV-

097. This virus was assayed for -glucuronidase go expression, purity, and insert stability by multiple 20 passages monitored by the blue plaque assay as described

CCC...

o in the materials and methods. After the initial three' go: rounds of purification all plaques observed were blue 000 indicating that the virus was pure, stable and expressing the marker gene.

S-FPV-097 was assayed for expression of ILTV specific S"o antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. Antibodies to ILTV gB and 0 gD was shown to react specifically with S-FPV-097 plaques 30 and not with S-FPV-001 negative control plaques. All S- 0O 0*00.. FPV-097 observed plaques reacted with the antiserum °00 indicating that the virus was stably expressing the ILTV foreign genes. All S-FPV-097 observed plaques reacted with the chicken antiserum to ILTV indicating that the virus was stably expressing the ILTV foreign genes.

Monoclonal antibodies specific for NDV HN (3-1G-5) and F (5-3F-2) were shown to react specifically with S-FPV-097 WO 96/40880 PCT/US96/ 1187 plaques and not with S-FPV-001 negative control plaques.

All S-FPV-097 observed plaques reacted with the monoclonal antibodies indicating that the virus was stably expressing the NDV foreign genes.

S-FPV-097 expresses foreign antigens from NDV and ILTV.

This virus is useful as a multi-valent vaccine against Newcastle Disease, Infectious Laryngotracheitis and Fowlpox.

WO 96/40880 PCT/US96/11187 -66- Example Recombinant fowlpox virus (FPV) expressing proteins from infectious bronchitis virus (IBV) make vaccines protecting against both FPV and IBV. We have constructed two recombinant FPV expressing IBV proteins: S-FPV-072 and S-FPV-079. Both of these viruses also express proteins from Newcastle disease virus (NDV), making them useful as vaccines against NDV.

Example S-FPV-072 S-FPV-072 is a recombinant fowlpox virus that expresses five foreign genes. The genes for Newcastle Disease virus F protein and HN protein were inserted at the 680 insertion site. The F and HN genes are each under the control of a synthetic early/late promoter EP1LP2. The 20 gene for E.coli 0-galactosidase (lacZ gene) and the genes for Infectious Bronchitis virus (IBV) Massachusetts Spike protein (Mass Spike) and Massachusetts Matrix protein (Mass Matrix) were inserted into the 681 insertion site.

The lac Z gene is under the control of a synthetic late 25 promoter LP1 and the IBV Mass Spike and Mass Matrix genes are each under the control of the synthetic early/late promoter EP1LP2.

S-FPV-072 was derived from S-FPV-043. This was accomplished utilizing the homology vector 538-51.27 (see Materials and Methods) and virus S-FPV-043 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING ENZYMATIC MARKER GENES. The final result of red plaque purification was the recombinant virus designated S-FPV- 072. This virus was assayed for B-galactosidase expression, purity, and insert stability by multiple WO 96/40880 PCT/US96/11187 -67passages monitored by the blue plaque assay as described in the materials and methods. After the initial three rounds of purification, all plaques observed were blue indicating that the virus was pure, stable and expressing the marker gene.

S-FPV-072 was assayed for expression of NDV and IBV specific antigens using the BLACK PLAQUE SCREEN

FOR

FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. Monoclonal antibody 15-88 to the IBV Mass Spike protein was shown to react specifically with S-FPV-072 plaques and not with S- FPV-001 negative control plaques. All S-FPV-072 observed plaques reacted with the monoclonal antibodies indicating that the virus was stably expressing the IBV foreign gene. Western blot assays of infected cell lysates using monoclonal antibody 15-88 to the IBV Mass Spike protein indicated that S-FPV-072 was expressing a 90 kD IBV Mass Spike protein. Monoclonal antibodies specific for both HN (3-1G-5) and F (5-3F-2) were shown to react 20 specifically with S-FPV-072 plaques and not with S-FPV- 001 negative control plaques. All S-FPV-072 observed plaques reacted with the monoclonal antibodies indicating that the virus was stably expressing the NDV foreign genes.

S-FPV-072 expresses foreign antigens from NDV and IBV.

This virus is useful as a multi-valent vaccine against Newcastle Diseases, Infectious Bronchitis, and Fowlpox.

ee Example S-FPV-079 is a recombinant fowlpox virus that expresses seven foreign genes. The genes for Newcastle Disease virus F protein and HN protein were inserted at the 680 insertion site. The F and HN genes are each under the control of a synthetic early/late promoter EP1LP2. The gene for E.coli 0-galactosidase (lacZ gene) and the genes for Infectious Bronchitis virus (IBV) Massachusetts Spike WO 96/40880 PCT/US96/11187 -68protein (Mass Spike) and Massachusetts Matrix protein (Mass Matrix) were inserted into the 681 insertion site.

The lac Z gene is under the control of a synthetic late promoter LP1 and the IBV Mass Spike and Mass Matrix genes are each under the control of the synthetic early/late promoter EP1LP2. The gene for the E. coli 3glucuronidase (uidA) gene and the gene for the IBV Mass Nucleocapsid protein were inserted into the 540 insertion site. The uidA gene is under the control of the synthetic late/early promoter LP2EP2 and the IBV Mass Nucleocapsid gene is under the control of the synthetic early/late promoter EP1LP2.

S-FPV-079 was derived from S-FPV-072. This was accomplished utilizing the Homology Vector 611-49.1 (see Materials and Methods) and virus S-FPV-072 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING

ENZYMATIC

20 MARKER GENES. The final result of red plaque purification was the recombinant virus designated S-FPV- 079. This virus was assayed for B-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described 25 in the materials and methods. After the initial three rounds of purification, all plaques observed were blue indicating that the virus was pure, stable and expressing the marker gene.

S-FPV-079 was assayed for expression of NDV and IBV specific antigens using the BLACK PLAQUE SCREEN FOR FOREIGN GENE EXPRESSION IN RECOMBINANT FPV. Monoclonal antibody 15-88 to the IBV Mass Spike protein was shown to react specifically with S-FPV-072 plaques and not with S- FPV-001 negative control plaques. All S-FPV-079 observed plaques reacted with the monoclonal antibody antiserum to IBV indicating that the virus was stably expressing the WO 96/40880 PCT/US96/11187 -69- IBV foreign gene. Western blot assays of infected cell lysates using monoclonal antibody 15-88 to the IBV Mass Spike protein indicated that S-FPV-079 was expressing a kD IBV Mass Spike protein. Monoclonal antibodies specific for both HN (3-1G-5) and F (5-3F-2) were shown to react specifically with S-FPV-079 plaques and not with S-FPV-001 negative control plaques. All S-FPV-079 observed plaques reacted with the monoclonal antibodies indicating that the virus was stably expressing the NDV foreign genes.

S-FPV-079 expresses foreign antigens from NDV and IBV.

This virus is useful as a multi-valent vaccine against Newcastle Diseases, Infectious Bronchitis, and Fowlpox.

Example 6 Recombinant fowlpox virus, S-FPV-099 or S-FPV-101, expressing chicken interferon (cIFN) or S-FPV-100, 20 expressing chicken myelomonocytic growth factor (cMGF), are useful to enhance the immune response when added to vaccines against diseases of poultry. Chicken myelomonocytic growth factor (cMGF) is homologous to mammalian interleukin-6 protein, and chicken interferon 25 (cIFN) is homologous to mammalian interferon Type I. When used alone or in combination with vaccines against specific avian diseases, S-FPV-099, S-FPV-100 and S-FPV- 1 01 provide enhanced mucosal, humoral, or cell mediated immunity against avian disease-causing viruses including, but not limited to, Marek's disease virus, Newcastle disease virus, infectious laryngotracheitis virus, infectious bronchitis virus, infectious bursal disease virus.

S-FPV-099 S-FPV-099 is a recombinant fcwlpox virus that expresses WO 96/40880 PCT/US96/1187 two -foreign genes. The genes for chicken interferon (cIFN) and E. coli lacZ were inserted at the uniqe SnaBI restriction endonuclease site in the 2.8 kB EcoRI FPV genomic fragment (681 insertion site). The cIFN gene is under the control of a synthetic late/early promoter LP2EP2, and the E. coli lacZ gene is under the control of a synthetic late promoter LP1.

S-FPV-099 was derived from S-FPV-001. This was accomplished utilizing the homology vector 751-07.D1 (see Materials and Methods) and virus S-FPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING

ENZYMATIC

MARKER GENES. The final result of red plaque purification was the recombinant virus designated S-FPV-099. This virus was assayed for P-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in Materials and 20 Methods. After the initial three rounds of purification, all plaques observed were blue indicating that the virus S-FPV-099 was pure, stable, and expressing the foreign gene.

25 Supernatants from S-FPV-099 have interferon activity in cell culture. Addition of S-FPV-099 conditioned media to chicken embryo fibroblast (CEF) cell culture inhibits infection of the CEF cells by vesicular stomatitis virus or by herpesvirus of turkeys. S-FPV-099 is useful to enhance the immune response alone or when added to vaccines against diseases of poultry.

S-FPV-100 S-FPV-100 is a recombinant fowlpox virus that expresses two foreign genes. The genes for chicken myelomonocytic growth factor (cMGF) and E. coli lacZ were inserted at WO 96/40880 PCT/US96/11187 -71the uniqe SnaBI restriction endonuclease site in the 2.8 kB EcoRI FPV genomic fragment (681 insertion site). The cMGF gene is under the control of a synthetic late/early promoter LP2EP2, and the E. coli lacZ gene is under the control of a synthetic late promoter LP1.

S-FPV-100 was derived from S-FPV-001. This was accomplished utilizing the homology vector 751-56.C1 (see Materials and Methods) and virus S-FPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING

ENZYMATIC

MARKER GENES. The final result of red plaque purification was the recombinant virus designated S-FPV-100. This virus was assayed for 6-galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in Materials and Methods. After the initial three rounds of purification, all plaques- observed were blue indicating that the virus 20 S-FPV-100 was pure, stable, and expressing the foreign gene.

S-FPV-100 is useful to enhance the immune response alone or when added to vaccines against diseases of poultry.

S-FPV-101 S-FPV-101 is a recombinant fowlpox virus that expresses four foreign genes. The genes for chicken interferon (cIFN) and E. coli lacZ were inserted at the uniqe SnaBI restriction endonuclease site in the 2.8 kB EcoRI FPV genomic fragment (681 insertion site). The cIFN gene is under the control of a synthetic late/early promoter LP2EP2, and the E. coli iacZ gene is under the control of a synthetic late promoter LP1. The genes for Newcastle Disease virus F protein and HN protein were inserted at the 680 insertion site. The F and HN genes are each under WO 96/40880 PCT/US96/1187 -72the control of a synthetic early/late promoter EP1LP2.

S-FPV-101 was derived from S-FPV-043. This was accomplished utilizing the homology vector 751-07.D1 (see Materials and Methods) and virus S-FPV-043 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING

ENZYMATIC

MARKER GENES. The final result of red plaque purification was the recombinant virus designated S-FPV-101. This virus was assayed for -galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in Materials and Methods. After the initial three rounds of purification, all plaques observed were blue indicating that the virus S-FPV-101 was pure, stable, and expressing the foreign gene.

0 Supernatants from S-FPV-101 have interferon activity in 20 cell culture. Addition of S-FPV-101 conditioned media to chicken embryo fibroblast (CEF) cell culture inhibits infection of the CEF cells by vesicular stomatitis virus ror by herpesvirus of turkeys. S-FPV-101 is useful to enhance the immune response alone or when added to 25 vaccines against diseases of poultry. S-FPV-101 is useful as a multi-valent vaccine against Newcastle Diseases and Fowlpox.

Example 7 Recombinant fowlpox virus expressing Newcastle's disease virus HN and F proteins lacking the membrane anchor sequences is a superior vaccine against fowlpox and Newcastle's disease.

Day old chicks from hens which have been exposed to or vaccinated against Newcastle's disease virus carry WO 96/40880 PCT/US96/11187 -73antibodies to NDV which may neutralize a vaccine containing a recombinant fowlpox virus expressing the NDV HN and F proteins. In vitro virus neutralization

(VN)

assays using VN monoclonal antibodies specific for either NDV HN or F proteins have been shown to neutralize recombinant fowlpox virus expressing the NDV HN and F proteins. These results suggest that the NDV HN and F glycoproteins are incorporated into the fowlpox virus virion. To increase the efficacy of a vaccine in the presence on maternal antibodies against Newcastle's disease virus, a recombinant fowlpox virus is constructed which expresses the NDV HN and F proteins lacking the membrane anchor domains of each protein. The resulting recombinant virus produces NDV HN and F proteins secreted into the serum of the vaccinated animal producing a strong humoral and cell mediated immune response to the Newcastle's disease virus. The NDV HN and F proteins are not presented on the surface of the FPV particle and thus evade neutralization by maternal antibodies present in 20 the vaccinated day old chicks.

The hemagglutinin-Neuraminidase (HN) and Fusion genes from the B1 strain of Newcastle Disease Virus (ATCC VR- 108) were isolated as cDNA clones, using oligo dT primed poly A selected mRNA.

The fusion protein mediates penetration of NDV into host cells by fusion of the viral envelope with the host cell plasma membrane. A posttranslational cleavage of inactive precursors Fo into two disulfide-bonded polypeptides, Fl and F2, is necessary to produce fusion active F protein and thereby yield infectious virions.

The new hydrophobic N-terminus of Fl generated after cleavage of Fo is responsible for the fusion characteristic of paramyxoviruses and thus determines virulence. The required proteolytic cleavage signal (paired basic residues) in the NDV B1 strain is altered, WO 96/40880 PCT/US96/11187 -74thereby preventing cleavage of F 0 into Fl and F2, resulting in an attenuated NDV strain.

The addition of the NDV F signal sequence (aal-25) to VP2 (vFP147), resulted in the secretion of VP2 in the TC fluid, but abolished its protective response (Paoletti, et. al WO 93/03145). Three hydrophobic domains exist within the F glycoprotein which interact with the lipid bilayer The signal sequence at the N-terminus of the primary translation product Fo; the N-terminus of Fl; and the transmembrane anchor domain near the Cterminus of Fl. The F glycoprotein of the B1 strain of NDV is 544 amino acids in length with the transmembrane anchor domain spanning 27 amino acids from position 500 to 526 (LITYIVLTIISLVFGILSLILACYLMY). Amino acids 1-499 of the NDV F protein are expressed under the control of a synthetic promoter element which functions as both an early and late promoter, such as EP1LP2 or LP2EP2, 0 directing expression throughout the reproduction cycle.

20 This results in the deletion of amino acids 527-544, the cytoplasmic tail, thought to interact with the inner membrane protein before or during virus assembly. A recombinant fowlpox virus is constructed which expresses the NDV F protein lacking the C-terminal membrane anchor 25 domain from a synthetic early/late promoter.

The hemagglutinin-neuraminidase (HN) glycoprotein S: provides NDV with the ability to agglutinate and elute erythrocytes. The process consists of two stages: attachment of the virus to the receptor on the red blood cell surface (agglutination) and destruction of the 0 receptor by the neuraminidase enzyme activity (elution) The major hydrophobic anchor domain is present near the N-terminus of HN, supporting the view that the N-terminus is anchored to the lipid bilayer. The HN glycoprotein of the B1 strain of NDV is 577 amino acids in length with the transmembrane anchor domain spanning 28 amino acids WO 96/40880 PCT/US96/11187 from position 27 to 54 (IAILFLTVVTLAISVASLLYSMGASTPS).

The extreme N-terminal amino acids (1 to 26) are relatively hydrophilic. Amino acids 55 to 577 of the HN protein are expressed under the control of a synthetic promoter element which functions as both an early and late promoter, such as EP1LP2 or LP2EP2, directing expression throughout the reproduction cycle. THE NDV HN polypeptide has a membrane transport signal sequence, such as the PRV gX signal sequence, at its amino terminus to direct the protein to be secreted into the serum of a vaccinated animal. A recombinant fowlpox virus is constructed which expresses the NDV HN protein lacking the N-terminal membrane anchor domain and containing an N-terminal PRV gX signal sequence from a synthetic early/late promoter. Alternatively the NDV HN polypeptide contains a deletion of the transmembrane anchor domain spanning 28 amino acids from position 27 to 54 and retains amino acids 1 to 26 and 55 to 577. A recombinant fowlpox virus is constructed which expresses the NDV HN 20 protein lacking the membrane anchor domain (amino acids 27 to 54) from a synthetic early/late promoter.

A recombinant fowlpox virus is constructed which expresses both the NDV HN and F proteins lacking the membrane anchor domains of each protein from a synthetic early/late promoter. The resulting recombinant virus produces NDV HN and F proteins secreted into the serum of the vaccinated animal producing a strong humoral and cell mediated immune response to the Newcastle's disease virus. The NDV HN and F proteins are not presented on the surface of the FPV particle and thus evade neutralization by maternal antibodies present in the vaccinated day old chicks.

Example 8 Recombinant fowlpox virus expressing cell surface WO 96/40880 PCT/US96/11187 -76receptors on the surface of the FPV viral particle useful for targeting gene products to specific tissues or organs.

Serum from chickens carrying maternal antibodies to Newcastle's disease virus inhibits productive infection and plaque formation by S-FPV-043 on chicken embryo fibroblasts in cell culture. One explanation for this result is that the antigenic epitopes of the NDV HN and F proteins expressed in S-FPV-043 are displayed on the surface of the fowlpox viral particle. Display of proteins on the surface of the FPV particle is useful to target specific gene products to specific normal cell types or tumor cell types. Proteins which are displayed on the surface of the FPV particle include but are not limited to integrins which would target the virus to integrin receptors on the cell surface; erythropoetin which would target the virus to erythropoetin receptors on the surface of red blood cells; antibodies or other proteins which would target to specific proteins or receptors on the surface of normal or tumor cells. The fowlpox virus also delivers cytokines, interleukins, interferons, or colony stimulating factors which stimulate a strong humoral or cell mediated immune 25 response against a tumor or disease causing organism. The proteins displayed on the surface of the fowlpox virus are expressed from the fowlpox genome as fusion proteins to the membrane anchor domains of the NDV HN or F proteins, or to other proteins containing membrane anchor domains. The cytokines, interleukins, interferons, or colony stimulating factors are expressed as fusion proteins to PRV gX, E. coli 0-galactosidase or another protein in a soluble, not membrane bound, form. The fusion protein stabilizes the cytokine protein and allows it to diffuse in the serum of the animal to reach its cellular target.

WO 96/40880 PCT/US96/I1187 -77- Example 9 S-FPV-098 S-FPV-098 is a recombinant fowlpox virus that expresses two foreign genes. The genes for infectious bursal disease virus (IBDV) polymerase gene and E. coli lacZ were inserted at the 681 insertion site. The IBDV polymerase gene is under the control of a synthetic late/early promoter LP2EP2, and the E. coli lacZ gene is under the control of a synthetic late promoter LP1.

S-FPV-098 was derived from S-FPV-001. This was accomplished utilizing the homology vector 749-75.82 (see Materials and Methods) and virus S-FPV-001 in the HOMOLOGOUS RECOMBINATION PROCEDURE FOR GENERATING RECOMBINANT FPV. The transfection stock was screened by the SCREEN FOR RECOMBINANT FPV EXPRESSING

ENZYMATIC

MARKER GENES. The final result of red plaque purification was the recombinant virus designated S-FPV-098. This 20 virus was assayed for 3 -galactosidase expression, purity, and insert stability by multiple passages monitored by the blue plaque assay as described in Materials and Methods. After the initial three rounds of purification, all plaques observed were blue indicating that the virus 25 S-FPV-098 was pure, stable, and expressing the foreign gene.

S-FPV-098 is useful for expression of IBDV polymerase protein. S-FPV-098 is useful in an in vitro approach to a recombinant IBDV attenuated vaccine. RNA strands from the attenuated IBDV strain are synthesized in a bacterial expression system using T3 or T7 promoters (pBlueScript plasmid; Stratagene, Inc.) to synthesize double stranded short and long segments of the IBDV genome. The IBDV double stranded RNA segments and S-FPV-098 are transfected into Vero cells. The fowlpox virus expresses the IBDV polymerase but does not replicate in Vero cells.

WO 96/40880 PCT/US96/11187 -78- The IBDV polymerase produced from S-FPV-098 synthesizes infectious attenuated IBDV virus from the double stranded RNA genomic templates. The resulting attenuated

IBDV

virus is useful as a vaccine against infectious bursal disease in chickens.

As an alternative to the construction of a IBD vaccine using a viral vectored delivery system and/or subunit approaches, IBD virus RNA is directly manipulated reconstructing the virus using full length RNA derived from cDNA clones representing both the large (segment A) and small (segment B) double-stranded RNA subunits.

Generation of IBD virus is this manner offers several advantages over the first two approaches. First, if IBD virus is re-generated using RNA templates, one is able to manipulate the cloned cDNA copies of the viral genome prior to transcription (generation of RNA). Using this approach, it is possible to either attenuate a virulent IBD strain or replace the VP2 variable region of the 20 attenuated vaccine backbone with that of virulent strains. In doing so, the present invention provides protection against the virulent IBDV strain while providing the safety and efficacy of the vaccine strain.

Furthermore, using this approach, the present invention 25 constructs and tests temperature sensitive IBD viruses generated using the RNA polymerase derived from the related birnavirus infectious pancreatic necrosis virus (IPNV) and the polyprotein derived from IBDV. The IPNV polymerase has optimum activity at a temperature lower 30 than that of IBDV. If the IPNV polymerase recognizes the regulatory signals present on IBDV, the hybrid virus is expected to be attenuated at the elevated temperature present in chickens. Alternatively, it is possible to construct and test IBD viruses generated using the RNA polymerase derived from IBDV serotype 2 viruse and the polyprotein derived from IBDVserotype 1 virus.

0 a WO 96/40880 PCT/US96/11187 -79cDNA clones representing the complete genome of IBDV (double stranded RNA segments A and B) is constructed, initially using the BursaVac vaccine strain (Sterwin Labs). Once cDNA clones representing full length copies of segment A and B are constructed, template RNA is prepared. Since IBDV exists as a bisegmented doublestranded RNA virus, both the sense and anti-sense

RNA

strands of each segment are produced using the pBlueScript plasmid; Stratagene, Inc.). These vectors utilize the highly specific phage promoters SP6 or T7 to produce substrate amounts of RNA in vitro. A unique restriction endonuclease site is engineered into the 3' PCR primer to linearize the DNA for the generation of run-off transcripts during transcription.

The purified RNA transcripts (4 strands) are transfected into Vero cells to determine whether the RNA is infectious. If IBD virus is generated, as determined by black plaque assays using IBDV specific Mabs, no further 20 manipulations are required and engineering of the vaccine strain can commence. The advantage of this method is that engineered IBD viruses generated in this manner will be pure and require little/no purification, greatly decreasing the time required to generate new vaccines.

25 If negative results are obtained using the purified S* RNA's, functional viral RNA polymerase is required by use of a helper virus. Birnaviruses replicate their nucleic acid by a strand displacement (semi-conservative) mechanism, with the RNA polymerase binding to the ends of the double-stranded RNA molecules forming circularized ring structures (Muller Nitschke, Virology 159, 174- 177, 1987). RNA polymerase open reading frame of about 878 amino acids in fowlpox virus is expressed and this recombinant virus (S-FPV-098) is used to provide functional IBDV RNA polymerase in trans. Fowlpox virus expressed immunologically recognizable foreign antigens in non-avian cells (Vero cells), where there are no signs WO 96/40880 PCT/US96/ 1187 of productive replication of the viral vector (Paoletti et al., Technological Advances in Vaccine Development, 321-334, 1988, Alan R. Liss, Inc.). In the present invention the IBDV polymerase protein is expressed in the same cells as the transfected RNA using the fowlpox virus vector without contaminating the cells with FPV replication.

With the demonstration that IBD virus is generated in vitro using genomic RNA, an improved live attenuated virus vaccines against infectious bursal disease is developed. Using recombinant DNA technology along with the newly defined system of generating IBD virus, specific deletions within the viral genome, facilitating the construction of attenuated viruses are made. Using this- technology, the region of IBDV responsible for virulence and generate attenuated, immunogenic

IBDV

vaccines are identified. The present invention provides a virulent IBD strain or replacement of the VP2 variable 20 region of the attenuated vaccine backbone with that of a virulent strain, thus protecting against the virulent strain while providing the safety and efficacy of the vaccine strain.

25 Example The chicken interferon (cIFN) gene was cloned into wild type (FPV) viruses by homologous recombinant techniques.

Briefly, the entire coding region of cIFN was isolated from activated chicken spleen cell RNA by RT/PCR using primer sequences from the recently published cIFN sequence (Sekellick, et al., 1994). Recombinant

FPV

viruses containing cIFN, and FPV/cIFN (S-FPV-099), were engineered to contain the entire cIFN ORF under the control of a synthetic pox virus promoter (LP2EP2), which functions as both an early and late promoter, directing expression throughout the entire viral replication cycle.

WO 96/40880 PCT/US96/11187 -81- A third recombinant virus, FPV/cIFN+NDV, (S-FPV-101) was made in a similar manner, except that a FPV virus previously engineered to contain the Newcastle Disease (NDV) antigens HN and F was used as the parent virus during homologous recombination, thus yielding a recombinant fowlpox virus co-expressing the cIFN and NDV genes. All recombinant viruses contain the lac Z gene engineered in tandem with cIFN under the control of a synthetic late (LP1) pox promoter. All promoter/gene constructs were sequenced at the promoter/cIFN junction to confirm the integrity of the proper DNA coding frame.

Co-expression of 0-galactosidase facilitated the isolation and plaque purification of the recombinant viruses. Independent viral insertion sites were used for insertion of the cIFN gene and the NDV genes in the fowlpox virus. The insertion sites were found to interrupt nonessential virus genes in both SPV and FPV.

To confirm the presence of the cIFN gene, recombinant viral DNAs were analyzed by PCR, using cIFN specific primers flanking the coding region. All viral DNA's yielded the expected 600 bp amplified cIFN DNA product.

In addition, southern blot analysis on the viral DNA was performed using a non-radioactive- labeled cIFN cDNA 25 probe. Plasmid constructs containing the cIFN gene cassettes were sequenced across the transcriptional and translational initiation/termination signals, to confirm the integrity of the ORF.

Growth Properties of Recombinant Viruses in Cell Culture.

Recombinant FPV/cIFN and FPV/cIFN+NDV were found to be attenuated with respect to their growth in chicken embryo fibroblast (CEF) cells. Plaque size was decreased significantly and viral titers were 0.9-1.4 logs less when compared to wild type FPV. We suggest that fowlpox virus has anti-IFN mechanisms; similar to anti-IFN WO 96/40880 PCT/US96/11187 -82mechanisms reported for other pox viruses, e.g. vaccinia, cowpox. And that these mechanisms help the virus to overcome the inhibitory effects of exogenously expressed cIFN. Therefore, fowlpox virus is able to infect, replicate and retain a productive infectious state.

In Vivo Properties of Recombinant FPV/cIFN Virus in Chicks.

10-day old chicks were inoculated, subcutaneously, with recombinant FPV/cIFN (S-FPV-099) virus at increasing dosages. At 10 days post inoculation, all chicks were inoculated with a mixture of sheep red blood cells (SRBC) and Brucella abortus At 15 days post FPV/cIFN virus inoculation, sera was collected, total body weights and antibody responses to SRBC's and BA were measured, and chicks were sacrificed for necropsy analysis. These data show that there were no significant differences in chick body weight, SRBC and BA antibody responses or 20 gross pathologyc associated with inoculation of recombinant FPV/cIFN virus, as compared to chicks .inoculated with PBS alone. Therefore, this virus appears I. to be safe in 10-day old chicks.

25 Table 3. Determination of safety of recombinant FPV/cIFN .virus in 10-day old chicks.

3 .1.

FPV/cIFN Total body Antibody titers Antibody titers a d (pfu/chick) weight (grams) a,b BA

SRBC

0 (PBS) 438 4.66 2.16 600 460 4.00 2.00 6,000 461 4.25 2.00 SUBSTITUTE SHEET (RULE 26) WO 96/40880 PCT/US96/11187 -83- 60,000 460 4.62 2.00 a. Measured 15 days post FPV/cIFN virus inoculation S Mean body weight There were no detectable gross pathological changes in any of the groups.

d S Mean antibody titers were determined by agglutination assay and expressed as log 2 One-day old chicks were inoculated intranasally/intraocularly with NDV B1 (106 ELDs/chick) alone or in addition to subcutaneous inoculation with FPV/cIFN (103 pfu/chick). Chick mortality was recorded 2 weeks post vaccination. Chicks vaccinated with NDV Bl alone or with NDV B1 plus FPV wild-type virus showed 30% mortality compared to chickens co-vaccinated with 20 NDV-B1 and FPV/cIFN, in which group, all chicks remained !alive. Subsequently, all chicks were challenged at 4 weeks post vaccination with a pathogenic strain of NDV (GB-TX). All chicks were protected, except for those in the "no treatment control group. These data show that 25 NDV Bl vaccine induced mortality was reduced without affecting the vaccine's protective ability.

Table 4. Effect of recombinant FPV/cIFN virus on NVD *i B1 vaccine induced chick mortality and NDV B1 induced protection from NDV challenge.

SUBSTITUTE SHEET (RULE 26) WO 96/40880 PCT/US96/11187 -84- Treatment Vaccine Challenge Post vaccination antiinduced induced NDV antibody responses.

mortality.' mortalityb.c Dead/Total Dead/Total 2 weeksd 4 weeks No treatment 0/25 15/15 <1 <1 NDVB1 alone 7/30 0/12 1.87 (0.31) 2.15 (0.32) NDVB1 FPV 9/30 0/10 1.96 (0.54) 1.99 (0.35) NDVB1 0/30 0/19 2.00 (0.42) 2.15 (0.37) FPV/cIFN a. Mortality was measured 2 weeks post vaccination.

b. Chicks were challenged 4 weeks post vaccination, intramuscularly, with 10,000 ELDsoNDV GB-TX.

c. Mortality was measured 2 weeks post challenge d. Antibody titers were determined by NDV virus neutralization and expressed as group mean (log, 1 17-day-old chicken embryos were inoculated with 500 pfu/embryo with FPV/cIFN/NDV virus, FPV wild-type virus or PBS diluent (0.2 ml). Chicks were allowed to hatch and then placed in an isolation unit and observed for mortality for one week. These data show that inoculation of chicken embryos with FPV/cIFN+NDV or FPV wild-type does not interfere with normal hatching.

Table 5. Effect of FPV/cIFN/NDV virus in ovo.

Treatment Diluent (PBS) FPV (wild-type) FPV/cIFN/NDV Number of Eggs Hatched/Total 15/17 15/17 14/18 Mortality (Dead/Total) a 1/15 3/15 0/14 1 week post hatch SUBSTITUTE SHEET (RULE 26) WO 96/40880 PCT/US96/11187 Three week old SPF chicks were vaccinated, subcutaneously, with 500 pfu/chick of FPV/cIFN/NDV recombinant virus. Sera were collected 9 days and 28 days post vaccination to measure neutralizing antibody responses raised against NDV. All chickens were challenged 28 days post vaccination with a pathogenic strain of NDV and observed for NDV induced mortality for days. These data show that vaccinated chicks developed detectable anti-NDV antibody responses as little as 9 days post vaccination with FPV/NDV/cIFN recombinant virus. These antibody levels were maintained for at least 28 days. In addition, chickens vaccinated with FPV/cIFN/NDV recombinant virus were all protected against challenge with a virulent strain of

NDV.

Table 6. Protective efficacy of FPV/cIFN/NDV vaccine in 3 -week-old-chickens.

20 *oo:o oo* 25 3 S 30 Vaccine Post Post Vaccination Antibody Challenge Responses Mortalitya Dead/Total 9 days 28 days None 19/19

I

b <ic FPV-IFN-NDV 0/20 1.36 (0.12) 1.33 (0.31) a. Chicks were challenged intramuscularly, 28 days post vaccination, with 10,000 ELDo 0 NDV GB-TX.

b. Antibody responses were determined by VN test and expressed as geometric mean titer (loglO) of chickens Antibody responses were determined by VN test and expressed as geometric mean titer (loglO) of chickens SUBSTITUTE SHEET (RULE 26) WO 96/40880 PCT/US96/1187 -86- One day old SPF chicks were vaccinated, subcutaneously, with 500 pfu/chick of FPV/cIFN/NDV recombinant virus.

Chicks were challenged intranasally/intraocularly at 4 7 and 15 days post vaccination with virulent NDV (GB-TX), and observed for NDV induced mortality for 15 days in each case. These data show that vaccinated chicks are resistant to virulent NDV when challenged at 7 days post vaccination, but not as early as 4 days post vaccination.

Thus, onset of immunity to NDV following vaccination with FPV/cIFN/NDV recombinant virus occurs between 4 and 7 days post vaccination.

Table 6. Protective efficacy of FPV/cIFN/NDV vaccine in one day old chicks.

Mortality following challenge at 4, 7, and 15 days post vaccination.

Experiment Vaccine 4-days 7-days No.

Dead/Total Dead/Total Dead/Total 1 None NDa 10/10 10/10 FPV-IFN-NDV ND 0/10 0/10 2 None 10/10 10/10 10/10 25 FPV-IFN-NDV 10/10 1/10 0/10 NDV-B1 4/10 0/10 0/10 a Not Done SUBSTITUTE SHEET (RULE 26) WO 96/40880 PCT/US96/11187 -87- Conclusions 1. Recombinant fowlpox viruses express biologically active chicken interferon into the supernatants of infected cells, as measured by protection of CEF cells from VSV infection.

2. Chicken interferon expressed in supernatants from recombinant SPV/cIFN infected cells has been shown to protect CEF cells against infection with HVT in a dose dependent manner.

20 3. Chicken interferon expressed from SPV/cIFN acted synergistically with LPS to activate chicken macrophages as detected by nitric oxide induction.

4. Recombinant FPV/cIFN virus was found to be safe in day old chicks at a dosage of 6 x 104 pfu/chick.

5. Recombinant FPV/cIFN virus was shown to reduce NDV B1 vaccine induced mortality without affecting the vaccine's ability to protect chicks against NDV infection.

6. Inoculation of recombinant FPV/cIFN/NDV virus in ovo does not appear to interfere with normal hatching.

7. Recombinant FPV/cIFN/NDV virus was shown to induce anti-NDV neutralizing antibody in 3-week-old chicks as early as 9 days post vaccination with sustained immunity thru 28 days post vaccination. Furthermore, three-weekold chicks were fully protected against virulent

NDV

challenge at 28 days post vaccination.

WO 96/40880 PCT/US96/11187 -88- 8. Recombinant FPV/cIFN/NDV virus was shown to protect one-day-old chicks from virulent NDV challenge as early as 7 days post vaccination.

9. The foregoing data indicate that recombinant fowlpox viruses expressing chicken IFN may have beneficial applications as immune modulating agents in vitro, in vivo and in ovo.

a a a a a WO 96/40880 PCT/US96/11187 -89- References 1. C. Bertholet, et al., EMBO Journal 5, 1951-1957, 1986.

2. B.H. Coupar, et al., Virology 179, 159-167, 1990.

3. A.J. Davidson and B. Moss, J. Mol. Biol. 210, 749- 769.

4. A.J. Davidson and B. Moss, J. Mol. Biol., 210, 771- 784.

P.L. Earl, et al., Journal of Virology 64, 2448- 2451, 1990.

6. J. Esposito, et al., Virology 165, 313.

7. F.A. Ferrari, et al., Journal of Bacteriology 161, 20 556-562, 1985.

8. U. Gubler and B.J. Hoffman, Gene 25, 263-269.

i 9. D. Hanahan, Molecular Biology 166, 557-580, 1983.

10. M.A. Innis, et al., PCR Protocols A Guide to Methods and Applications, 84-91, Academic Press, Inc., San Diego 1990.

30 11. Maniatis, et al., Molecular Cloning, Cold Spring Harbor Laboratory, New York 1982.

12. L.J.N. Ross, et al., Journal of General Virology, 1789-1804 (1989).

13. L.J.N. Ross, et al., Journal of General Virology, 72, 949-954 (1991).

WO 96/40880 WO 9640880PCTIUS96II 1187 14. J. Sambrook, et al., Molecular Cloning A Laboratory Manual Second Edition, Cold Spring Harbor Press, 1989.

15. J. Taylor, et al., Vaccine 9, 190-193, 1991.

16. A. Leutz, et al., EMBO Journal 8: 175-182 (1989).

17. M.J. Sekellick, et Journal of Interferon 0 Reserch 14: 71-79 (1994).

Page(s) \lb- 22 are claims pages they appear after the sequence listing WO 96/40880 PCT/US96/11187 -91- SEQUENCE LISTING GENERAL INFORMATION: APPLICANTS: Mark D. Cochran and David E. Junker (ii) TITLE OF INVENTION: Recombinant Fowlpox Viruses and Uses Thereof (iii) NUMBER OF SEQUENCES: (iv) CORRESPONDENCE

ADDRESS:

ADDRESSEE: John P. White STREET: 1185 Avenue of the Americas CITY: New York STATE: New York COUNTRY: USA ZIP: 10036 COMPUTER READABLE FORM: MEDIUM TYPE: Floppy disk COMPUTER: IBM PC compatible OPERATING SYSTEM: PC-DOS/MS-DOS SOFTWARE: PatentIn Release Version #1.25 (vi) CURRENT APPLICATION DATA: APPLICATION NUMBER: Not Yet Known FILING DATE: 07-JUN-1995

CLASSIFICATION:

(viii) ATTORNEY/AGENT

INFORMATION:

NAME: White, John P REGISTRATION NO: 28,678 (ix) TELECOMMUNICATION INFORMATION: TELEPHONE: (212)278-0400 TELEFAX: (212)391-0526 40 TELEX: 422523 INFORMATION FOR SEQ ID NO:1: SEQUENCE CHARACTERISTICS: LENGTH: 28 base pairs TYPE: nucleic acid STRANDEDNESS: double S(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL:

NO

(iv) ANTI-SENSE:

NO

0 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: CATAAGGCGG CCGCGGCCCT CGAGGCCA 28 INFORMATION FOR SEQ ID NO:2: SEQUENCE CHARACTERISTICS: LENGTH: 28 base pairs TYPE: nucleic acid WO 96/40880 PCT/US96/11187 -92- STRANDEDNESS: double TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: CATAATGGCC TCGAGGGCCG CGGCCGCC 28 2 INFORMATION FOR SEQ ID NO:3: SEQUENCE CHARACTERISTICS: LENGTH: 1507 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (ix) FEATURE: NAME/KEY: CDS LOCATION: 260..1411 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: CTACTTCATA AAAAGTTAA ACCTTCCGAA AGATTTTGG ATAAAAGTAG AGAACTCGCA 40 TTGCGATTAT GCTCTAGGAC AATCCTGTAA AGTGTCTCGA TCTTAGCATA TAGATAAATG 120 TTTGAACTAA TATCCTAAAG CCTGTATGTA ACAGTTGGTG CCTATTGAAA GATACTGATT 180 ATCAAGGAGA AGAATAATAT AAATCGTAAA AATAATACTT ATTATATAAT ATAATGTATA 240 ATAATATACA AAAACAGCC ATG ATA CGT ATT ATA ATA TTA TCG TTA TTA TTT 292 Met Ile Arg Ile Ile Ile Leu Ser Leu Leu Phe 1 5 ATT AAC GTA ACA ACA GAT AGT CAA GAA TCT TCA AAA AAT ATA CAA AAT 340 Ile Asn Val Thr Thr Asp Ser Gln Glu Ser Ser Lys Asn Ile Gln Asn 15 20 GTA TTG CAC GTT ACA GAA TAT AGT AGA ACT GGT GTA ACA GCT TGC TCG 388 Val Leu His Val Thr Glu Tyr Ser Arg Thr Gly Val Thr Ala Cys Ser 35 TTA CAT TGT TTT GAT CGT TCC AAA GGT TTA GAT CAA CCA AAA ACA TTT 436 Leu His Cys Phe Asp Arg Ser Lys Gly Leu Asp Gin Pro Lys Thr Phe 45 50 ATC CTG CCT GGT AAA TAT AGC AAT AAC AGT ATA AAA CTA GAA GTA GCT 484 Ile Leu Pro Gly Lys Tyr Ser Asn Asn Ser Ile Lys Leu Glu Val Ala 65 70 ATT GAT ACA TAT AAA AAA GAT AGC GAC TTC AGT TAT TCT CAC CCA TGT 532 Ile Asp Thr Tyr Lys Lys Asp Ser Asp Phe Ser Tyr Ser His Pro Cys WO 96/40880 PCT/US96/1 187 -93- 85 CAA ATA ITC CAC TTC TGT GTG TCT CGT AAT TTT ACT GGT AAA CGG TTC 580 Gin Ile Phe Gin Phe Cys Val Ser Gly Asn Phe Ser Gly Lys Arg Phe 95 100 105 GAT CAT TAT CTA TAT GGG TAT ACA ATT TCC GGA TTT ATA GAT ATT GCT 628 Asp His Tyr Leu Tyr Gly Tyr Thr Ile Ser Gly Phe Ile Asp Ile Ala 110 115 120 CCA AAA TAT TAT AGC GGT ATG TCT ATA AGT ACT ATT ACT GTT ATG CCA 676 Pro Lys Tyr Tyr Ser Gly Met Ser Ile Ser Thr Ile Thr Val Met Pro 125 130 135 TTA CAA GAA GGA TCA TTA AAG CAT CAT CAT GCC CAT CAC TAT GAC TAC 724 Leu Gin Giu Gly Ser Leu Lys His Asp Asp Ala Asp Asp Tyr Asp Tyr 140 145 150 155 GAT GAT GAT TGT GTT CCT TAT AAA GAA ACC CAG CCT CGA CAT ATG CCA 772 Asp Asp Asp Cys Val Pro Tyr Lys Glu Thr Gin Pro Arg His Met Pro 160 165 170 GAA TCG GTA ATA AAA GAA GGA TGT AAA CCC ATT CCA CTA CCA AGG TAT 820 Glu Ser Val Ile Lys Glu Gly Cys Lys Pro Ile Pro Leu Pro Arg Tyr 175 180 185 GAT GAA AAT GAC GAT CCT ACT TGT ATT ATG TAT TGG GAT CAC TCG TGG 868 Asp Glu Asn Asp Asp Pro Thr Cys Ile Met Tyr Trp Asp His Ser Trp 190 1.95 200 GAT AAT TAC TGT AAT GTT GGA 'ITT TTT AAT TCT CTA CAG AGT GAT CAC 916 Asp Asn Tyr Cys Asn Val Gly Phe Phe Asn Ser Leu Gin Ser Asp His 205 210 215 35 AAT CCT CTG GTT TTT CCG TTA ACA AGT TAT TCT GAT ATA AAC AAT GCA 964 Asn Pro Leu Val Phe Pro Leu Thr Ser Tyr Ser Asp Ile Asn Asn Ala 220 225 230 235 TTT CAT GCT TTT CAA TCA TCT TAT TGT AGA TCA CTA GGC TTT AAC CAA 1012 Phe His Ala Phe Gin Ser Ser Tyr Cys Arg Ser Leu Gly Phe Asn Gin :240 245 250 TCA TAC AGT GTA TGC GTA TCT ATA GGT GAT ACA CCA TTT GAG GTT ACG 1060 Ser Tyr Ser Val Cys Val Ser Ile Gly Asp Thr Pro Phe Glu Val Thr 255 260 265 TAT CAT AGT TAT GAA AGT GTT ACT GTT GAT CAG TTA TTA CAA GAA ATT 1108 aTyr His Ser Tyr Glu Ser Val Thr Val Asp Gin Leu Leu Gin Glu Ile 270 275 280 AAA ACA CTA TAT GGA GAA GAT GCT GTA TAT GGA TTA CCG TTT AGA AAT 1156 Lys Thr Leu Tyr Gly Glu Asp Ala Val Tyr Gly Leu Pro Phe Arg Asn 285 290 295 ATA ACT ATA AGG GCG CGT ACA CGG ATT CAA AGT TTA CCT CTT ACT AAC 1204 Ile Thr Ile Arg Ala Arg Thr Arg Ile Gin Ser Leu Pro Leu Thr Asn 300 305 310 315 AAT ACC TGT ATC CCT AAA CAA GAC GAT GCT GAT GAT GTT GAC GAT GCT 1252 Asn Thr Cys Ile Pro Lys Gln Asp Asp Ala Asp Asp Val Asp Asp Ala 320 325 330 GAT GAT GTT GAC GAT GCT GAT GAT GCT GAC GAT GAT GAT GAT TAC GAG 1300 Asp Asp Val Asp Asp Ala Asp Asp Ala Asp Asp Asp Asp Asp Tyr Glu 335 340 345 TTA TAT GTA GAA ACT ACA CCA AGA GTG CCA ACA GCG AGA AAA AAA CCC 1348 WO 96/40880 PCT/US96/11187 -94- Leu Tyr Val Glu Thr Thr Pro Arg Val Pro Thr Ala Arg Lys Lys Pro 350 355 360 GTT ACA GAA GAA TAT AAT GAT ATA TTT AGT AGT TTT GAT AAT TTT GAC Val Thr Glu Glu Tyr Asn Asp Ile Phe Ser Ser Phe Asp Asn Phe Asp 365 370 375 ATG AAA AAG AAA TAAGACATAT TTTATTAAAT CAAAAAGTCT GTCGAACTTT Met Lys Lys Lys 380 TAGTGTTTAA CCTATATCGA TTTATGATTT TTCCATGATG ATCCAGGCTA TGACTGACT INFORMATION FOR SEQ ID NO:4: 1396 1448 1507 SEQUENCE CHARACTERISTICS: LENGTH: 383 amino acids TYPE: amino acid TOPOLOGY: linear @000

SO

S. S 6@ 6 5* 9O

S.

*S&S

5055

S

55 5 S S (ii) MOLECULE (xi) SEQUENCE Met Ile Arg Ile Ile 1 5 Asp Ser Gin Glu Ser 20 Glu Tyr Ser Arg Thr 35 Arg Ser Lys Gly Leu 50 Tyr Ser Asn Asn Ser 40 Lys Asp Ser Asp Phe Cys Val Ser Gly Asn 100 Gly Tyr Thr Ile Ser 115 50 Gly Met Ser Ile Ser 130 Leu Lys His Asp Asp 145 55 Pro Tyr Lys Glu Thr 165 Glu Gly Cys Lys Pro 180 Pro Thr Cys Ile Met 195 Val Gly Phe Phe Asn 210 Ser Gly Asp Ile 70 Ser Phe Gly Thr Ala 150 Gin Ile Tyr Ser Lys Val Gin 55 Lys Tyr Ser Phe Ile 135 Asp Pro Pro Trp Leu 215 Asn Thr 40 Pro Leu Ser Gly Ile 120 Thr Asp Arg Leu Asp 200 Gin Ile 25 Ala Lys Glu His Lys 105 Asp Val Tyr His Pro 185 His Ser Gin Cys Thr Val Pro 90 Arg Ile Met Asp Met 170 Arg Ser Asp Asn Ser Phe Ala 75 Cys Phe Ala Pro Tyr 155 Pro Tyr Trp His Val Leu Leu His Ile Leu Ile Asp Gin Ile Asp His Pro Lys 125 Leu Gin 140 Asp Asp Glu Ser Asp Glu Asp Asn 205 Asn Pro 220 His Cys Pro Thr Phe Tyr 110 Tyr Glu Asp Val Asn 190 Tyr Leu Val Thr Phe Asp Gly Lys Tyr Lys Gin Phe Leu Tyr Tyr Ser Gly Ser Cys Val 160 Ile Lys 175 Asp Asp Cys Asn Val Phe TYPE: protein DESCRIPTION: SEQ ID NO:4: Ile Leu Ser Leu Leu Phe Ile Asn Val Thr Thr WO 96/40880 PCT/US96111187 Pro Leu Thr Ser 225 Ser Ser Tyr Cys Tyr Ser 230 Arg Ser 245 Asp Thr Asp Ile Asn Asn Ala 235 Leu Gly Phe Asn Gin 250 Pro Phe Glu Val. Thr 265 Leu Leu Gin Giu Ile Phe His Ala Phe Gin 240 Val. Ser Ile Ser Vai Thr 275 Giu Asp Aia Ser Tyr Ser Val Cys 255 Tyr His Ser Tyr Giu 270 Lys Thr Leu Tyr Gly.

Asp Gin 280 Pro 285 Thr

I

Vai Tyr Gly 290 Thr Leu 295 Leu Phe Arg Asn Ile Arg Ala Arg 305 Lys Arg Ile Gin Ser 310 Asp Pro Leu Thr Asn 315 Ala Thr Cys Ile Pro 320 Gin Asp Asp Ala 325 Asp Asp Vai Asp A-sp 330 Tyr Asp Asp Vai Asp Asp 335 Aia Asp Asp Thr Pro Arg 355 Asn Asp Ile 370 Ala 340 Val.

Asp Asp Asp Asp 345 Lys Giu Leu Tyr Val. Giu Thr 350 Pro Thr Ala Arg 360 Lys Pro Vai Thr Giu Giu 365 LYS Lys Lys Tyr Phe Ser Ser Phe Asp Asn Phe Asp Met .375 380 INFORMATION FOR SEQ ID SEQUENCE

CHARACTERISTICS:

(iv) LENGTH: 2849 base pairs TYPE: nucleic acid STRANDEDNESS: doubie TOPOLOGY: iinear MOLECULE TYPE: DNA (genomic) HYPOTHETICAL:

NO

ANTI-SENSE: NO (ix) FEATURE: NAME/KEY: CDS LOCATION: 300. .i568 (ix) FEATURE: NAME/KEY:

CDS

LOCATION: complement (i685. .2848) (xi) SEQUENCE DESCRIPTION: SEQ ID AAGCCAGT GAATTCAATA 'ITCATCGCCG ATAGT-rGGTA GAAATACTAT

TCATGAAATT

TACCTTCTTC CGTGGCTTAA AAACTrAI-rG TATGTACCAT TCATTATAAG

ATCTGATACT

ATCGGCATCT TCTATrTTCC GAGTTFITA CATCTGG'rrA CTAGTATCCA

TGTTCGTCTA

ATAAGAGGGA AGGAATATAT CTATCTACAT AAACATCATA AGGTTCTTTG

ATAGATTTAT

ATCGCTAATA AAATATAAAT AATAATTAAA GATrTTATGA TATATCGAGC

TTTGCAAAA

i2 0 180 240 299 WO 96/40880 PCT/US96/11187 -96- ATG TCT GTT GAT TGG CGT ACA GAA ATC TAT TCG GGT GAT ATA TCC CTA 347 Met Ser Val Asp Trp Arg Thr Glu Ile Tyr Ser Gly Asp Ile Ser Leu 1 5 10 GTA GAA AAA CT ATA AAG AAT AAA GGT AAT TGC ATC AAT ATA TCT GTA 395 Val Glu Lys Leu Ile Lys Asn Lys Gly Asn Cys Ile Asn Ile Ser Val 25 GAG GAA ACA ACA ACT CCG TTA ATA GAC GCT ATA AGA ACC GGA AAT GCC 443 Glu Glu Thr Thr Thr Pro Leu Ile Asp Ala Ile Arg Thr Gly Asn Ala 40 AAA ATA GTA GAA CTA TTT ATC AAG CAC GGA GCG CAA GTT AAT CAT GTA 491 Lys Ile Val Glu Leu Phe Ile Lys His Gly Ala Gin Val Asn His Val 50 55 AAT ACT AAA ATT CCT AAT CCC TTG TTA ACA GCT ATC AAA ATA GGA TCA 539 Asn Thr Lys Ile Pro Asn Pro Leu Leu Thr Ala Ile Lys Ile Gly Ser 70 75 CAC GAT ATA GTA AAA CTG CTG TITG ATT AAC GGA GTT GAT ACT TCT ATT 587 His Asp Ile Val Lys Leu Leu Leu Ile Asn Gly Val Asp Thr Ser Ile 90 TTG CCA GTC CCC TGC ATA AAT AAA GAA ATG ATA AAA ACT ATA TTA GAT 635 Leu Pro Val Pro Cys Ile Asn Lys Glu Met Ile Lys Thr Ile Leu Asp 100 105 110 AGT GGT GTG AAA GTA AAC ACA AAA AAT GCT AAA TCT AAA ACT TTC TTG 683 Ser Gly Val Lys Val Asn Thr Lys Asn Ala Lys Ser Lys Thr Phe Leu 115 120 125 CAT TAC GCG ATT AAG AAT AAT GAC TTA GAG GTT ATC AAA ATG CTT TTT 731 His Tyr Ala Ile Lys Asn Asn Asp Leu Glu Val Ile Lys Met Leu Phe 130 135 140 GAG TAT GGA GCT GAT GTT AAT ATA AAA GAT GAT AAC ATA TGT TAT TCT 779 Glu Tyr Gly Ala Asp Val Asn Ile Lys Asp Asp Asn Ile Cys Tyr Ser 4 145 150 155 160 :ATA CAC ATA GCT ACT AGG AGT AAT TCA TAT GAA ATC ATA AAA TTA CTA 827 Ile His Ile Ala Thr Arg Ser Asn Ser Tyr Glu Ile Ile Lys Leu Leu 165 170 175 TTA GAA AAA GGT GCT TAT GCA AAC GTA AAA GAC AAT TAT GGT AAT TCT 875 Leu Glu Lys Gly Ala Tyr Ala Asn Val Lys Asp Asn Tyr Gly Asn Ser 180 185 190 CCG TTA CAT AAC GCG GCT AAA TAT GGC GAT TAT GCT TGT ATT AAA TTA 923 Pro Leu His Asn Ala Ala Lys Tyr Gly Asp Tyr Ala Cys Ile Lys Leu 195 200 205 ***GTT TTA GAC CAT ACT AAT AAC ATA AGC AAT AAG TGC AAC AAC GGT GTT 971 Val Leu Asp His Thr Asn Asn Ile Ser Asn Lys Cys Asn Asn Gly Val 210 215 220 ACA CCG TTA CAT AAC GCT ATA CTA TAT AAT AGA TCT GCC GTA GAA TTA 1019 Thr Pro Leu His Asn Ala Ile Leu Tyr Asn Arg Ser Ala Val Glu Leu 225 230 235 240 CTG ATT AAC AAT CGA TCT ATT AAT GAT ACG GAT GTA GAC GGA TAT ACT 1067 Leu Ile Asn Asn Arg Ser Ile Asn Asp Thr Asp Val Asp Gly Tyr Thr 245 250 255 CCA CTA CAT TAT GCT TTG CAA CCT CCG TGT AGT ATA GAT ATT ATA GAT 1115 Pro Leu His Tyr Ala Leu Gin Pro Pro Cys Ser Ile Asp Ile Ile Asp 260 265 270 WO 96/40880 WO 9640880PCT/U596/1 1187 -97- ATA CTA CTA TAT AAC AAC GCC GAT ATA TOT ATA AAA GAT AAT AAC GGA Ile Leu Leu Tyr Asn Asn Ala Asp Ile Ser Ile Lys Asp Asn Asn Gly 275 280 285 CGC AAT COT ATO GAT ACG GCG 'Tr AAG TAT ATr AAC AGA GAT AGO GTT Arg Asn Pro Ile Asp Thr Ala Phe Lys Tyr Ile Asn Arg Asp Ser Vai 290 295 300 1163 1211 ATA AAA Ile Lys 305 GAA CIT OTO OGA AAC GCC GTG TTA A'IT AAC GAG GTC GGT AAA Glu Leu Leu Arg Asn Ala Vai Leu Ile Asn Glu Vai Gly Lys 310 315 320 'ITA AAkA GAT ACT ACT ATO TTA GAA CAC AAA GAA ATA AAA GAO AAT ACC Leu Lys Asp Thr Thr Ile Leu Giu His Lys Giu Ile Lys Asp Asn Thr 325 330 335 GTG rrr TOA AAO TTr GTG TAO GAA TGT AAT GAA GAA ATT AAA AAA ATG Vai Phe Ser Asn Phe Val Tyr Giu Cys Asn Glu Glu Ile Lys Lys Met 340 345 350 AAG AAA ACT AAA TGT GTO GGT GAO TAT AGT ATG TTT GAO GTA TAO ATG Lys Lys Thr Lys Cys Val Giy Asp Tyr Ser Met Phe Asp Val Tyr Met 355 360 365 ATA AGG TAT AAA CAO AAA TAT GAO GGT AAT AAG GAT ACT ATT AAA GAO Ile Arg Tyr Lys His Lys Tyr Asp Gly Asn Lys Asp Ser Ile Lys Asp 370 375 380 TAT TTG OGT TGT CTT GAT GAT AAT AGT ACT CT ATG TTA AAA ACT ATA Tyr Leu Arg Cys Leu Asp Asp Asn Ser Thr Arg Met Leu Lys Thr Ile 385 390 395 400 CAT ATI' AAT GAA TTT COT ATA TAT TOT ATG TAT OTO GTA AGA TGO OTA Asp Ile Asn Clu Phe Pro Ile Tyr Ser Met Tyr Leu Vai Arg Cys Leu 405 410 415 TAT CAT ATG GTA ATA TAT TAAAAGAAAT GGGCTOTTGC

ATAOATAATO

Tyr Asp Met Val Ile Tyr 1259 1307 1355 1403 1451 1499 1547 1595 1655 1715 1775 1835 1895 1955 2015 2075 2135 2195 2255 2315 2375 2435

GGTATAAAAA

GGCCAGTAGC

TTAGACOAAC

'TATGTCTAT

TAGTAAGTAT

111 r'ACTAA

TCTTTTAGTT

A'TTOTCA

ATATGTGOTA

OTACTATOTO

AATGCTATTA

TCTAATAACA

ATAACAAAT TATTAGCGT TACATATCTT

TCAGTATTTC

CGCTAGAATC

TACTGGCTAA

TAATTrCC'T

TAAOGAATAT

cTrCCTrACA

AGGGGTTTAC

TGATATATCT

TAAGTI'CAGC

ATAAAGGATA

TTTTTATAAC

CTATAAAOTO

TAATATTTCA

GGATATGGAA

TATTATAGGA

ATCTAAAGAG

AOTOAAOOAA

TTCAC'TOTG

AAAAGAAAAC

ACCATAATGT

TAATATTGAG

TCTAATTG

GTTITAAGAc

TTATTTACTA

TAAAACATAT

ATACITrAA

ATATCGTGAC

ATATTACTGT

AATAATATAT

AOGGCGGOOG

AGTTTGATAT

ATCTACTTTT

GATOTOOG TA

AGTGATGTAA

TAATAOGAAT

AOGTATOATC

GTATAAAATO

TAAGCTOTT

TTACTATAOO

CATTTACATC

TACACCATA

TATOTATGAG

CCGTTCCTAT

OGGOOCTOGA

CCGGAGAAGT

TTOTAATATT

ATTATAGAAA

OAGGTTOATG

TTTAGATATA

GOTTTGAATA

TTGTATACAT

ATCGATGAOC

ATGATATTOT

OGCTOCGTTA

ATGOAAOGGA

OGTTTTTACA

CTTCTGCGAT

GTAGATAAGT ATT'rGTT OTOATATAOG GATTTGTTOC TTGATTOOTT

ATGTTAATAG

TI'OTGGTTTA OAAITCTTr AGAATTAACA ITAGOTOOTO ATATAAGGCA AAATGTAAAA WO 96/40880 PCT/US96/11187 -98-

AACGCTTCTA

ACAGCGGCAT

AATTCTAACA

GGAGTGATAT

ATGTTTTCTG

TTTTTAGCGT

GGTGCTTGTA

TATCGGCCCC

AATGAATAGG

ACGTATAAC

ACAGACTATC

TATCGTATCC

TAACATCTAT

CCGTGTAATG

GTAATCTAAA AGAGTGTTTA CGTCTTGTCA CAATAATCTC TGTATCTTTA TATCTATCTA AGCGGCGTTA ACATCTGCAC ATTCTTAGCC ATGAGATACA TCCTCTTrCC AATAACTTGG CAAAGGAGTA TrCTATAAA

TGATAACTAC

TAGCATTTAC

GAGTAGAGGC

CCCGCATTAT

GAGGAGTTTC

GTACTAGTCT

CATCTATAGA

ATTGTTTCTT

GTTCGCTCCC

TTGATGTAAT

TAAAGTTCTA

TCCTTTAATG

ACTTAACGAA

ATTC

2495 2555 2615 2675 2735 2795 2849 INFORMATION FOR SEQ ID NO:6: SEQUENCE CHARACTERISTICS: LENGTH: 422 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: Met Ser Val 1 Val Asp Trp Arg 5 Leu Ile Lys Glu Lys Thr Glu Ile Tyr 10 Asn Lys Gly Asn 25 Leu Ile Asp Ala Ser Gly Asp Cys Ile Asn Ile Arg Thr Ala Gin Val Ile Ser Leu Ile Ser Val Gly Asn Ala Asn His Val Glu Glu Thr Thr Thr Pro Ile 40 Lys Lys Asn 65 His Ile Val Glu Thr Lys. Ile Asp Ile Val Leu Phe Ile His Gly Pro Asn 70 Leu Leu Thr Ala 75 Gly Lys Ile Gly Ser Lys Leu Leu 85 Leu Ile Val Asp Thr Ser Ile Leu Pro Val Ser Gly Val 115 His Tyr Ala Cys Val Ile Asn Lys Glu 105 Asn Thr Lys Asn 120 Asn Asn Asp.Leu Ile Lys Thr Ile Lys Ala Lys Ser Glu Val Ile 140 Asp Asp Asn Lys 125 Lys Ile Leia Asp 110 Thr Phe Leu Met Leu Phe Gly Ala Asp Val Glu 145 Ile Leu Ile Lys Ile Cys Tyr 150 Arg His Ile Ala Glu Lys Gly 180 Thr 165 Ala Tyr 170 155 Glu Ser 160 Ser Asn Ser Ile Ile Lys Tyr Ala Asn Val 185 Ala Lys Tyr Gly 200 Lys Asp Asn Tyr Gly 190 Ile Leu Leu 175 Asn Ser Lys Leu Pro Leu His 195 Asn Ala Asp Tyr Ala Cys 205 WO 96/40880 PCT/US96/I1187 -99 Ser Val Leu Asp His Thr Asn Asn Ile Asn Lys Cys Asn 220 210 Asn Gly Val 215 Thr Pro Leu His Asn 225 Leu Pro Ile Arg Ile 305 Leu Val Lys Ile Tyr 35 385 Asp 40 Tyr 6~~ Ile Leu Leu Asn 290 Lys Lys Phe Lys Arg 370 Leu lle Asp Asn His Leu 275 Pro Glu Asp Ser Thr 355 Tyr Arg Asn Met Asn Tyr 260 Tyr Ile Leu Thr Asn 340 Lys Lys Cys Glu Val 420 Arg 245 Ala Asn Asp Leu Thr 325 Phe Cys His Leu Phe 405 Ile Ala 230 Ser Leu Asn Thr Arg 310 Ile Val Val Lys Asp 390 Pro Tyr Ile Ile Gin Ala Ala 295 Asn Leu Tyr Gly Tyr 375 Asp Ile Leu Asn Pro Asp 280 Phe Ala Glu Glu Asp 360 Asp Asn Tyr Tyr Asp Pro 265 Ile Lys Val His Cys 345 Tyr Gly Ser Ser Asn Thr 250 Cys Ser Tyr Leu Lys 330 Asn Ser Asn Thr Met 410 Arg 235 Asp Ser Ile Ile Ile 315 Glu Glu Met Lys Arg 395 Tyr r Ser Ala Val Glu Leu Val Ile Lys Asn 300 Asn Ile Glu Phe Asp 380 Met Leu Asp Asp Asp 285 Arg Glu Lys Ile Asp 365 Ser Leu Val Gly Ile 270 Asn Asp Val Asp Lys 350 Val Ile Lys Arg Tyr 255 Ile Asn Ser Gly Asn 335 Lys Tyr Lys Thr Cys 415 240 Thr Asp Gly Val Lys 320 Thr Met Met Asp Ile 100 Leu *r INFORMATION FOR SEQ ID NO:7: SEQUENCE CHARACTERISTICS: LENGTH: 387 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: 55 Asn Ser Ile Asp Val Tyr Lys Asn Thr Pro Leu His Tyr Thr Val Gin 1 5 10 Ala Pro Ser Leu Ser Arg Leu Val Pro Lys Leu Leu Glu Arg Gly Ile 20 25 Asp Val Asn Ala Lys Asn Ile Lys Gly Glu Thr Pro Leu Tyr Leu Met 40 Ala Lys Asn Gly Tyr Asp Thr Glu Asn Ile Arg Thr Leu Ile Met Arg 55 WO 96/40880 PCT/US96/11187 -100- Gly Ala Asp Val Asn Ala Ala Asp Ser Leu 70 Tyr 75 Ile Thr Pro Leu His Ile Thr Leu Leu Gin Glu Ile Leu Val 145 Thr Ser Ile Arg Asn 225 Asp 35 His Asn Trp Asn 305 Leu I 50 Tyr 55 Ala Glu I 3 Ala Leu His Asp 130 Leu Leu Thr Lys Asn 210 Ile Lys Ile Pro Leu 290 4et Leu [yr Ser :le 70 SSer Gly Tyr 115 Tyr His Ile Pro Met 195 Gin Leu Ser Cys Leu 275 Ser Phe His Phe Asn 355 Leu Thr SAla 100 Ala Gly Phe Asp Leu 180 Leu Tyr Leu Leu Ile 260 Arg Cys Tyr His I Tyr 340 Arg I Asp S Leu 85 Asn Ala Ala Ala Arg 165 His Leu Pro His Asn 245 G1n Glu Lys Ser Leu 325 Asn is Ser Asp Arg Tyr Val Asn Ala Val Arg Asn 120 Asp Ile Glu 135 Leu Tyr Gly 150 Gly Ala Asn Tyr Ala Cys Asp Asn Gly 200 Leu Leu Ile 215 Tyr Gly Ala 230 Ser Asn Met Asp Phe Ile Ile Ile Gin 280 Glu Glu Leu 295 Leu Asp Ile 310 Val Asn Asn Tyr Gly Asp Lys Ile Leu 360 Ser Gly Trr Lys Arg 105 Asn Ala Thr Val Lys 185 Ala Ala Glu Phe Arg 265 Ser Lys Phe Pro Arg 345 Glu SAsp Thr Val 90 Asp Tyr Cys Val Val Ile Leu Ser Gin 140 Asn Pro Tyr 155 Asn Ser Lys 170 Lys Asn Cys Asp Val Asn Leu Glu Tyr 220 Leu Arg Asp 235 Ser Phe Arg 250 His Asp Ile Asp Asp Thr Asp Ile Ser 300 Val Ile Ser 315 Ile Ile Lys 330 Leu Lys Thr Lys Ser Arg Asp Ile 125 Lys Met Asn Lys Ala 205 His Ser Tyr Arg Phe 285 Lys Lys 31u Ser Ser 365 Lys 110 Asn Ile Ser Lys Pro 190 Ile Gly Arg Ile Ser 270 Lys Ile Asn Ile Ile 350 Lys 95 Thi Thr Gly Val Tyr 175 Glu Asn Ile Val Ile 255 Glu Ser Arg Met sn 335 Ser Leu r Pro Leu Thr Lys 160 Leu Val Ile Val Ile 240 Ala Val Ile Ile Asn 320 Thr Leu Asp r. 0 0 0 0* 0@ 4~ 0 0 S *5 *050 Ser Lys Leu Leu Arg Ile Ser Asn 375

L

Ser Gin Tyr INFORMATION FOR SEQ ID NO:8: SEQUENCE CHARACTERISTICS: LENGTH: 40 base pairs WO 96/40880 PCT/US96/11187 -101- TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL:

NO

(iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: AAAAATTGAA AAACTATTCT AATTTATTGC ACGGAGATCT INFORMATION FOR SEQ ID NO:9: SEQUENCE CHARACTERISTICS: LENGTH: 32 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL:

NO

(iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: 35 AATTTCATTT TGTTTTTTTC TATGCTATAA AT 32 INFORMATION FOR SEQ ID SEQUENCE

CHARACTERISTICS:

LENGTH: 37 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO 50 (xi) SEQUENCE DESCRIPTION: SEQ ID S 55 GTATCCTAAA ATTGAATTGT AATTATCGAT AATAAAT 37 INFORMATION FOR SEQ ID NO:11: SEQUENCE CHARACTERISTICS: LENGTH: 42 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO WO 96/40880 PCT/US96/11187 -102- (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: r-1iT-rrrrr TTITTTTTTTT GGCATATAAA TGAATTCGGA TC INFORMATION FOR SEQ ID NO:12: SEQUENCE CHARACTERISTICS: LENGTH: 4177 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (ix) FEATURE: NAME/KEY: CDS LOCATION: 115..1860 (ix) FEATURE: NAME/KEY: CDS LOCATION: 2095..3756 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: CATACTGGCC TCGAGGGCCG CGGCCGCCTG CAGGTCGACT CTAGAAAAAA TTGAAAAACT ATTCTAATTT ATTGCACGGA GATCITTTT iTTTT'rTTT TTTTTGGCAT ATAA ATG Met 1 42 117 165 213 261 309 357 405 453

AAT

Asn

GAA

Glu

TTA

Leu

TAT

Tyr 50

AGG

Arg

CAA

Gin

TTG

Leu TCG GAT CCG GAC CGC GCC GTT AGC CAA GTT GCG TTA GAG AAT GAT Ser Asp Pro Asp Arg Ala Val Ser Gin Val Ala Leu Glu Asn Asp 10 AGA GAG GCA AAA AAT ACA TGG CGC TTG ATA TTC CGG ATT GCA ATC Arg Glu Ala Lys Asn Thr Trp Arg Leu Ile Phe Arg Ile Ala Ile 25 TTC TTA ACA GTA GTG ACC TTG GCT ATA TCT GTA GCC TCC CTT TTA Phe Leu Thr Val Val Thr Leu Ala Ile Ser Val Ala Ser Leu Leu 40 AGC ATG GGG GCT AGC ACA CCT AGC GAT CTT GTA GGC ATA CCG ACT Ser Met Gly Ala Ser Thr Pro Ser Asp Leu Val Gly Ile Pro Thr 55 60 ATT TCC AGG GCA GAA GAA AAG ATT ACA TCT ACA CTT GGT TCC AAT Ile Ser Arg Ala Glu Glu Lys Ile Thr Ser Thr Leu Gly Ser Asn 75 GAT GTA GTA GAT AGG ATA TAT AAG CAA GTG GCC CTT GAG TCT CCA Asp Val Val Asp Arg Ile Tyr Lys Gin Val Ala Leu Glu Ser Pro 90 GCA TTG TTA AAT ACT GAG ACC ACA ATT ATG AAC GCA ATA ACA TCT Ala Leu Leu Asn Thr Glu Thr Thr Ile Met Asn Ala Ile Thr Ser 100 105 110 WO 96/40880 PCT/US96/1 1187 -103- OTC TOT TAT CAG ATT AAT GGA GOT GCA AAC AAC AGO GGG TGG GGG GCA 501 Leu Ser Tyr Gin Ile Asn Gly Aia Ala Asn Asn Ser Giy Trp Gly Ala 115 120 125 CCT ATT CAT GACCC A TAT TA TAGGGGGATA GGC AGACTC AT 549 Pro Ile His Asp Pro Asp Tyr Ile Gly Gly Ile Giy Lys Giu Leu Ile 130 135 140 145 GTA GAT GAT GOT AGT GAT GTC ACA TOA TTC TAT CCC TCT GOA TTT CAA 597 Val Asp Asp Ala Ser Asp Val Thr Ser Phe Tyr Pro Ser Ala Phe Gin 150 155 160 GAA CAT OTG AAT Tfl ATC CCG GCG COT AOT ACA GGA TCA GGT TGC ACT 645 Giu His Leu Asn Phe Ile Pro Ala Pro Thr Thr Gly Ser Giy Cys Thr 165 170 175 CGA ATA CCC TOA TTr GAC ATG AGT GOT AOC OAT TAC TGO TAO ACC CAT 693 Arg Ile Pro Ser Phe Asp Met Ser Ala Thr His Tyr Cys Tyr Thr His 180 185 190 AAT GTA ATA TTG TOT GGA TGO AGA GAT CAC TOA CAC TCA OAT CAG TAT 741 Asn Val Ile Leu Ser Gly Cys Arg Asp His Ser His Ser His Gin Tyr 195 200 205 TTA GCA CTT GGT GTG OTO OGG AOA TOT GCA ACA GGG AGG GTA TTO TTT 789 Leu Ala Leu Giy Vai Leu Arg Thr Ser Ala Thr Gly Arg Val Phe Phe 210 215 220 225 TOT ACT OTG CGT TOO ATO AAO OTG GAO GAO ACC CAA AAT OGG AAG TOT 837 Ser Thr Leu Arg Ser Ile Asn Leu Asp Asp Thr Gin Asn Arg Lys Ser *230 235 240 TGO AGT GTG AGT GCA AOT COO OTG GGT TGT OAT ATG OTG TGO TOG AAA 885 Cys Ser Val Ser Ala Thr Pro Leu Gly Cys Asp Met Leu Cys Ser Lys 35 245 250 255 *GC0 AOG GAG ACA GAG GAA GAA GAT TAT AAC TCA GOT GTO OCT ACG OGG 933 *Ala Thr Giu Thr Giu Glu Giu Asp Tyr Asn Ser Ala Val Pro Thr Arg 26*0 265 270 ATG GTA OAT GGG AGG TTA GGG TI'O GAO GGO CAA TAT CAC GAA AAG GAO 981 Met Val His Gly Arg Leu Gly Phe Asp Gly Gin Tyr His Giu Lys Asp 275 280 285 OTA OAT GTO ACA ACA TrA TTO GGG GAO TGG GTG GOO AAO TAO OCA GGA 1029 Leu Asp Val Thr Thr Leu Phe-Gly Asp Trp Val Ala Asn Tyr Pro Gly ~.:290 295 300 305 GTA. GGG GGT GGA TOT T'IT ATT GAO AGO OGO GTG TGG TTO TOA GTO TAO 1077 50 Val Gly Gly Gly Ser Phe Ile Asp Ser Arg Val Trp, Phe Ser Val Tyr 310 315 320 GGA GGG TTA AAA COO AAT ACA 000 AGT GAO ACT GTA CAG GAA GGG AAA 1125 Gly Gly Leu Lys Pro Asn Thr Pro Ser Asp Thr Val Gin Glu Gly Lys 325 .330 335 TAT GTG ATA TAO AAG OGA TAO AAT GAO AOA TGO OCA GAT GAG CAA GAO 1173 Tyr Val Ile Tyr Lys Arg Tyr Asn Asp Thr Cys Pro Asp Glu Gin Asp 340 345 350 TAO OAG ATT OGA ATG GOO AAG TOT TOG TAT AAG COT GGA OGG TTT GGT 1221 Tyr Gin Ile Arg Met Ala Lys Ser Ser Tyr Lys Pro Gly Arg Phe Gly 355 360 365 GGG AAA OGO ATA OAG OAG GOT ATO TTA TOT ATO AAA GTG TOA ACA TOO 1269 Gly Lys Arg Ile Gin Gin Ala Ile Leu Ser Ile Lys Val Ser Thr Ser 370 375 380 385 WO 96/40880 PCTIUS96/1 1187 -104- TTA GGC GAA GAC CCG GTA CTG ACT GTA CCG CCC AAC ACA GTC ACA CTC 1317 Leu Gly Glu Asp Pro Val Leu Thr Val Pro Pro Asn Thr Val Thr Leu 5.390 395 400 ATG GGG GCC GAA GGC AGA ATT CTC ACA GTA GGG ACA TCC CAT TTC TTG 1365 Met Gly Ala Glu Gly Arg Ile Leu Thr Val Gly Thr Ser His Phe Leu 405 410 415 TAT CAG CGA GGG TCA TCA TAC TI'C TCT CCC GCG TTA TTA TAT CCT ATG 1413 Tyr Gin Arg Gly Ser Ser Tyr Phe Ser Pro Ala Leu Leu Tyr Pro Met 420 425 430 ACA GTC AGC AAC AAA ACA GCC ACT CT' CAT AGT CCT TAT ACA TTC AAT 1461 Thr Val Ser Asn Lys Thr Ala Thr Leu His Ser Pro Tyr- Thr Phe Asn 435 440 445 GCC TI'C ACT CGG CCA GGT AGT ATC CCT TGC CAG GCT TCA GCA AGA TGC 1509 Ala Phe Thr Arg Pro Gly Ser Ile Pro Cys Gin Ala Ser Ala Arg Cys 450 455 460 465 CCC AAC TCA TGT GTT ACT GGA GTC TAT ACA GAT CCA TAT CCC CTA ATC 1557 Pro Asn Ser Cys Val Thr Gly Val Tyr Thr Asp Pro Tyr Pro Leu Ile 470 475 480 TTC TAT AGA AAC CAC ACC 'ITG CGA GGG GTA TTC GGG ACA ATG CTT GAT 1605 Phe Tyr Arg Asn His Thr Leu Arg Gly Val Phe Gly Thr Met Leu Asp 485 490 495 GGT GAA CAA GCA AGA CT!' AAC CCT GCG TCT GCA GTA TTC GAT AGC ACA 1653 Giy Glu Gin Ala Arg Leu Asn Pro Ala Ser Ala Val Phe.Asp Ser Thr 500 505 510 TCC CGC AGT CGC ATA ACT CGA GTG AGT TCA AGC AGC ATC AAA GCA GCA 1701 Ser Arg Ser Arg Ile Thr Arg Val Ser Ser Ser Ser Ile Lys Ala Ala *515 520 525 TAC ACA ACA TCA ACT TGT TTI' AAA GTG GTC AAG ACC AAT AAG ACC TAT 1749 **.Tyr Thr Thr Ser Thr Cys Phe Lys Val Val Lys Thr Asn Lys Thr Tyr 530 535 540 545 **.TGT CTC AGC AT!' GCT GAA ATA TCT. AAT ACT CTC TTC GGA GAA TTC AGA 1797 Cys Leu Ser Ile Ala Giu Ile Ser Asn Thr Leu Phe Gly Giu Phe Arg .550 555 560 45 ATC GTC CCG T!'A CTA GTT GAG ATC CTC AAA GAT GAC GGG GTT AGA GAA 1845 I .:le Val Pro Leu Leu Val Giu Ile Leu Lys Asp Asp Gly Val Arg Giu GCC AGG TCT GGC TAGTI'CAGTC AACTATGAAA GAGT!'GGAAA GATGGCATTG 1897 Ala Arg Ser Gly 580 **TATCACCTAT CTTCTGCGAC ATCAAGAATC AAACCGAATG CCCGGATCCA TAATTAATTA 1957 ATI'AATTrI'T ATCCCTCGAC TCTAGAAAAA AT!'GAAAAAC TATTCTAATT TATTGCACGG 2017 AGATCTTTTT 7"r77rTTTTT TTFIT!GGCA TATAAATGAA TTCGGATCGA TCCCGGTTGG 2077 CGCCCTCCAG GTGCAGG ATG GGC TCC AGA CCT TCT ACC AAG AAC CCA GCA 2127 Met Gly Ser Arg Pro Ser Thr Lys Asn Pro Ala 1 5 CCT ATG ATG CTG ACT ATC COG GTC GCG CTG OTA CTG AGT TGC ATC TOT 2175 Pro Met Met Leu Thr Ile Arg Val Ala Leu Val Leu Ser Cys Ile Cys 20 WO 96/40880 PCTIUS96/1 1187 -l105 CCG GCA AAC TCC ATT GAT GGC AGG CCT CTT GCA GCT GCA GGA ATT GTG 2223 Pro Ala Asn Ser Ile Asp Gly Arg Pro Leu Ala Ala Ala Gly Ile Val 35 GTT ACA GGA GAC.AAA GCA GTC AAC ATA TAC ACC TCA TCC CAG ACA GGA 2271 Val Thr Gly Asp Lys Ala Val Asn Ile Tyr Thr Ser Ser Gin Thr Gly 50 TCA ATC ATA GTT AAG CTC CTC CCG AAT CTG CCA AAG GAT AAG GAG GCA 2319 Ser Ile Ile Val Lys Leu Leu Pro Asn Leu Pro Lys Asp Lys Giu Ala 65 70 TGT GCG AAA GCC CCC 'ITG GAT GCA TAC AAC AGG ACA TTG ACC ACT TTG 2367 Cys Ala Lys Ala Pro Leu Asp Ala Tyr Asn Arg Thr Leu Thr Thr Leu 80 85 CTC ACC CCC CTT GGT GAC TCT ATC CGT AGG ATA CAA GAG TCT GTG ACT 2415 Leu Thr Pro Leu Gly Asp Ser Ile Arg Arg Ile Gin Glu Ser Val Thr 100 105 ACA TCT GGA GGG GOG AGA CAG GGG CGC CIT ATA GGC GCC ATT ATT GGC 2463 Thr Ser Gly Gly Gly Arg Gin Gly Arg Leu Ile Gly Ala Ile Ile Gly 110 115 120 GOT GTG GCT CTr GGG GTT GCA ACT GCC GCA CAA ATA ACA GCG GCC GCA 2511 Gly Val Ala Leu Gly Val Ala Thr Ala Ala Gin Ile Thr Ala Ala Ala 125 130 135 GCT CTG ATA CAA GCC AAA CAA AAT GCT GCC AAC ATC CTC CGA CTT AAA 2559 Ala Leu Ile Gin-Ala Lys Gin Asn Ala Ala Asn Ile Leu Arg Leu Lys 140 145 150 155 GAG AGC ATT GCC GCA ACC AAT GAG GCT GTG CAT GAG GTC ACT GAC GGA 2607 Glu Ser Ile Ala Ala Thr Asn Glu Ala Val His Giu Val Thr Asp Gly 160 165 170 *TTA TCG CAA CTA GCA GTG GCA GTT GOG AAG ATG CAG CAG TTC GTT AAT 2655 *Leu Ser Gin Leu Ala Val Ala Val Gly Lys Met Gin Gin Phe Val Asn 175 180 185 GAC CAA TTAAT AAA ACA GCT CAG GAA 'ITA GAC TGC ATC AAA ATT GCA 2703 *Asp Gin Phe Asn Lys Thr Ala Gin Giu Leu Asp Cys Ile Lys Ile Ala 190 195 200 CAG CAA GTT GOT GTA GAG CTC AAC CTG TAC CTA ACC GAA TCG ACT ACA 2751 Gin Gin Val Gly Val Giu Leu Asn Leu Tyr Leu Thr Giu Ser Thr Thr 205 210 215 GTA TTC GGA CCA CAA ATC ACT TCA CCT GCC TTA AAC AAG CTG ACT ATT 2799 50 Val Phe Gly Pro Gin Ile Thr Ser Pro Ala Leu Asn Lys Leu Thr Ile 220 225 230 235 CAG GCA CTI' TAC AAT CTA GCT GGT GO AAT ATG GAT TAC TTA TTG ACT 2847 Gin Ala Leu Tyr Asn Leu Ala Gly Gly Asn Met Asp Tyr Leu Leu Thr 55 240 245 250 AAG 'FrA GOT ATA GGG AAC AAT CAA CTC AGC TCA TTA ATC GGT AGC GGC 2895 Lys Leu Gly Ile Gly Asn Asn Gin Leu Ser Ser Leu Ile Gly Ser Gly 255 260 265 TTA ATC ACC GOT AAC CCT A'Fr CTA TAC GAC TCA CAG ACT CAA CTC TTG 2943 Leu Ile Thr Gly Asn Pro Ile Leu Tyr Asp Ser Gin Thr Gin Leu Leu 270 275 280 GOT ATA CAG GTA ACT CTA CCT TCA GTC 000 AAC CTA AAT AAT ATG CGT 2991 Gly Ile Gin Val Thr Leu Pro Ser Val Gly Asn Leu Asn Asn Met Arg 285 290 295 WO 96/40880 WO 9640880PCTIUS96/1 1187 -106- GCC ACC-TAC TTG GAA ACC 17A .TCC GTA AGC ACA ACC AGG GGA TTT GCC Ala Thr Tyr Leu Giu Thr Leu Ser Val Ser Thr Thr Arg Gly Phe Ala 300 305 310 315 TCG GCA CTT GTC CCA AAA GTG GTG ACA CGG GTC GGT TCT GTG ATA GAA Ser Ala Leu Val Pro Lys Val Val Thr Arg Val Giy Ser Val Ile Giu 320 .325 330 GAA CTT GAC ACC TCA TAC TGT ATA GAA ACT GAC TTA GAT TTA TAT TGT Glu Leu Asp Thr Ser Tyr Cys Ile Giu Thr Asp Leu Asp Leu Tyr Cys 335 340 345 ACA AGA ATA GTA ACG 'rrC CCT ATG TCC CCT GGT ATT TAC TCC TGC TTG Thr Arg Ile Val Thr Phe Pro Met Ser Pro Gly Ile Tyr Ser Cys Leu 350 358 360 AGC GGC AAT ACA TCG GCC TGT ATG TAC TCA AAG ACC GAA GGC GCA CTT Ser Gly Asn Thr Ser Ala Cys Met Tyr Ser Lys Thr Giu Gly Ala Leu 365 370 375 ACT ACA CCA TAT ATG ACT ATC AAA GGC TCA GTC ATC GCT AAC TGC AAG Thr Thr Pro Tyr Met Thr Ile Lys Gly Ser Val Ile Ala Asn Cys Lys 380 385 390 395 ATG ACA ACA TGT AGA TGT GTA AAC CCC CCG GGT ATC ATA TCG CAA AAC Met Thr Thr Cys Arg Cys Val Asn Pro Pro Gly Ile Ile Ser Gin Asn 400 405 410 TAT GGA GAA GCC GTG TCT CTA ATA GAT AAA CAA TCA TGC AAT GTT TTA Tyr Gly Giu Ala Val Ser Leu Ile Asp Lys Gin Ser Cys Asn Vai Leu 415 420 425 TCC TrA GGC GGG ATA ACT 'ITA AGG CTC AGT GGG GAA TTC GAT GTA ACT Ser Leu Giy Gly Ilie Thr Leu Arg Leu Ser Gly Giu Phe Asp Val Thr 430 435 440 3039 3087 3135 3183 3231 3279 3327 3375 3423 oo* TAT CAG AAG AAT ATC TCA ATA CAA GAT TCT CAA GTA ATA ATA ACA GGC 3471 Tyr Gin Lys Asn Ile Ser Ile Gin Asp Ser Gin Vai Ile Ile Thr Gly 445 450 455 AAT CTT GAT ATC TCA ACT GAG CIT GGG AAT GTC AAC AAC TCG ATC AGT 3519 Asn Leu Asp Ile Ser Thr Giu Leu Gly Asn Val Asn Asn Ser Ile Ser 460 465 470 475 ANT GCC TTG AAT AAG 'ITA GAG GAA AGC AAC AGA AAA CTA GAC AAA GTC 3567 Asn Ala Leu Asn Lys Leu Giu Giu Ser Asn Arg Lys Leu Asp Lys Val 480 485 490 AAT GTC AAA CTG ACC AGC ACA TCT GCT CTC ATT ACC TAT ATC GTT TTG 3615 Asn Vai Lys Leu Thr Ser Thr Ser Ala Leu Ile Thr Tyr Ile Val Leu 495 500 505 ACT ATC ATA TCT CTT GTT ITT GGT ATA CTT AGC CTG ATT CTA GCA TGC 3663 Thr Ile Ile Ser Leu Val Phe Gly Ile Leu Ser Leu Ile Leu Ala Cys 510 515 520 TAC CTA ATG TAC AAG CAA AAG GCG CAA CAA AAG ACC TTA .TTA TGG CTT 3711 Tyr Leu Met Tyr Lys Gin Lys Ala Gin Gin Lys Thr Leu Leu Trp Leu 525 530 535 GOG AAT AAT ACC CTA GAT CAG ATG AGA GCC ACT ACA AAA ATG TGAACACAGA 3 76 3 Gly Asn Asn Thr Leu Asp Gin Met Arg Ala Thr Thr Lys Met 540 545 550 TGAGGAACGA AGGTTTCCCT AATAGTAATT TGTGTGAAAG TTCTGGTAGT CTGTCAGTTC GGAGAGTTAA GAAAAAAAA AAACCCCCCC CCCCCCCCCC CCCCCCCCCT GCAGGCATCG 3823 3883 WO 96/40880 WO 9640880PCT/US96/I 1187 107- TGGTGTCACG CTCGTCGTrr GGTATGGCTr CATTCAGCTc CGGTTCCCAA

CGATCAAGGC

GAGTTACATG ATCCCCCATG TrGTGCAAAA AAGCGGTTAG CTCCTTCGGT

CCTCCGATCG

TTGTCAGAAG TAAGTTGGCC GCAGTGTrAT CACTCATGGT TATGGC.AGCA

CTGCATAATT

CTCTTACTGT CATGCCATCC GTAAGATGCT TFTCTGTGAC TGGTGAGTGA

TCCATAATTA

A'ITAAT'rAAT =Tr'ATCCCG GGTCGACCTG CAGGCGGCCG CGGCCCTCGA

GGCC

INFORMATION FOR SEQ ID NO:13: SEQUENCE

CHARACTERISTICS:

LENGTH: 581 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: 3943 4003 4063 4123 4177 Met 1 Asp Ile Asn Giu Leu Asp Glu Leu Pro 5 Ala Thr Asp Arg Ala Val Ser Gin Val Ala Leu Giu Asn 10 is Lys Asn Thr Trp Leu Thr Asn Pro Ser Al a Ile 145 Gin Thr His Tyr Phe 225 Tyr Arg Gin Leu Leu Pro 130 Val Glu Arg Asn Leu 210 Ser Met Giy Ile Ser Arg Asp Val Vai 85 Ala Leu Leu 100 Ser Tyr Gin 115 Ile His Asp Asp Asp Aia His Leu Asn i6 5 Ile Pro Ser 180 Vai Ile Leu 195 Ala Leu Gly Val Aia Ala 70 Asp Asn Ile Pro Ser i50 Phe Phe Ser Val *Vai Ser 55 Giu Arg Thr Asn Asp 135 Asp Ile Asp Gi y Leu 215 Thr Thr Giu Ile Giu Gly i2 0 Tyr Vai Pro Met Cys 200 Arg 25 Leu Pro Lys Tyr Thr 105 Aila Ile Thr Ala Ser 185 Arg Thr Arg Ala Ser Ile Lys 90 Thr Ala Gi y Ser Pro 170 AlLa Asp S er Leu Ile Asp Thr 75 Gin Ile Asn Gly Phe 155 Thr Thr His Ala Ile Ser Leu Ser Vai Met Asn Ile 140 Tyr Thr His Ser Phe Val Val Thr Ala Asn Ser 125 Giy Pro Gly Tyr His 205 Arg Ala Giy Leu Leu Ala 110 Giy Lys Ser Ser Cys 1.90 Ser Ile Ser Ile Giy Giu Ile Trp Gli Ala Gly 175 Tyr His Val Ala Leu Pro Ser Ser Thr Gly Leu Phe 160 Cys Thr Gin Phe 220 Ser Thr Leu Arg Ser 230 Ile Asn Leu Asp Asp 235 Thr Gin Asn Arg Lys 240 WO 96/40880 PCT/US96/11187 -108- Leu Gly Ser Cys Ser Val Ser Ala Thr Pro

C

Lys Arg Asp Gly 305 Tyr Lys Asp Gly Ser 385 Leu Leu Met Asn.

Cys 465 Ile Asp.

Thr Ala Tyr C 545 Arg I Glu 1 Ala Met Leu 290 Val Gly Tyr Tyr Gly 370 Leu Met Tyr Thr Ala 450 Pro Phe .iy 3er ryr 530 :ys Ele la Thi Val 275 Asr Gl Gly Val Gin 355 Lys Gly Gly Gin Val 435 Phe Asn Tyr Glu Arg 515 Thr Leu Val Arg 245 Glu Thr Glu 260 His Giy Arg Val Thr Thr Gly Gly Ser 310 Leu Lys Pro 325 Ile Tyr Lys 340 Ile Arg Met Arg Ile Gin Glu Asp Pro 390 Ala Giu Gly 405 Arg Giy Ser 420 Ser Asn Lys Thr Arg Pro Ser Cys Val 470 Arg Asn His 485 Gin Ala Arg 500 Ser Arg Ile Thr Ser Thr Ser Ile Ala 550 Pro Leu Leu I Glt Leu Leu 295 Phe Asn Arg Ala Gin 375 Vai Arg Ser Thr Gly 455 rhr rhr Leu rhr :ys 535 .lu Glu Asp 265 Gly Phe 280 Phe Gly Ile Asp Thr Pro Tyr Asn 345 Lys Ser 360 Ala Ile Leu Thr Ile Leu Tyr Phe 425 Ala Thr 440 Ser Ile Gly Val Leu Arg Asn Pro 505 Arg Val 520 Phe*Lys Ile Ser 250 Tyr Asp Asp Ser Ser 330 Asp Ser Leu Val Thr 410 Ser Leu Pro Tyr Gly 490 Ala Ser Val ksn Asn Gly Trp Arg 315 Asp Thr Tyr Ser Pro 395 Val Pro His Cys Thr 475 Val I Ser 2 Ser Val I Thr I 555 Ser Gin Val 300 Val Thr Cys Lys Ile 380 Pro Gly Ala Ser ln 460 ksp ?he kla er .ys ~eu Ala Tyr 285 Ala Trp Val Pro Pro 365 Lys Asn Thr Leu Pro 445 Ala Pro Gly Val 1 Ser 1 525 Thr Phe G Val 270 His Asn Phe Gin Asp 350 Gly Val Thr Ser Leu 430 yr Ser ryr rhr !he le sn ;ly Prc Gli.

*Tyx Ser Glu 335 Glu Arg Ser Val His 415 Tyr Thr Ala Pro Met 495 Asp Lys Lys Glu Thr 1 Lys Pro Val 320 Gly Gin Phe Thr Thr 400 Phe Pro Phe Arg Leu 480 Leu Ser Ala Thr Phe 560 Cys Asp Met Leu Cys Ser 255 lal Glu Ile Leu Lys Asp Asp Gly 565 Ser Gly 580 Val Arg 575 WO 96/40880 PCT/US96/11187 -109- INFORMATION FOR SEQ ID NO:14: SEQUENCE CHARACTERISTICS: LENGTH: 553 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: Met Gly Ser Arg Pro Ser Thr Lys Asn Pro Ala Pro Met Met Leu Thr 1 5 10 Ile Arg Val Ala Leu Val Leu Ser Cys Ile Cys Pro Ala Asn Ser Ile 25 Asp Gly Arg Pro Leu Ala Ala Ala Gly Ile Val Val Thr Gly Asp Lys 40 Ala Val Asn Ile Tyr Thr Ser Ser Gin Thr Gly Ser Ile Ile Val Lys 55 Leu Leu Pro Asn Leu Pro Lys Asp Lys Glu Ala Cys Ala Lys Ala Pro 65 70 75 Leu Asp Ala Tyr Asn Arg Thr Leu Thr Thr Leu Leu Thr Pro Leu Gly 90 Asp Ser Ile Arg Arg Ile Gin Glu Ser Val Thr Thr Ser Gly Gly Gly 100 105 110 Arg Gin Gly Arg Leu Ile Gly Ala Ile Ile Gly Gly Val Ala Leu Gly 115 120 125 Val Ala Thr Ala Ala Gin Ile Thr Ala Ala Ala Ala Leu Ile Gin Ala 130 135 140 Lys Gin Asn Ala Ala Asn Ile Leu Arg Leu Lys Glu Ser Ile Ala Ala 145 150 155 160 Thr Asn Glu Ala Val His Glu Val -Thr Asp Gly Leu Ser Gin Leu Ala 165 170 175 Val Ala Val Gly Lys Met Gin Gin Phe Val Asn Asp Gin Phe Asn Lys 180 185 190 Thr Ala Gin Glu Leu Asp Cys Ile Lys Ile Ala Gin Gin Val Gly Val 50 195 200 205 Glu Leu Asn Leu.Tyr Leu Thr Glu Ser Thr Thr Val Phe Gly Pro Gin 210 215 220 Ile Thr Ser Pro Ala Leu Asn Lys Leu Thr Ile Gin Ala Leu Tyr Asn 225 230 235 240 Leu Ala Gly Gly Asn Met Asp Tyr Leu Leu Thr Lys Leu Gly Ile Gly 245 250 255 Asn Asn Gin Leu Ser Ser Leu Ile Gly Ser Gly Leu Ile Thr Gly Asn 260 265 270 Pro Ile Leu Tyr Asp Ser Gin Thr Gin Leu Leu Gly Ile Gin Val Thr 275 280 285 Leu Pro Ser Val Gly Asn Leu Asn Asn Met Arg Ala Thr Tyr Leu Glu 290 295 300 WO 96/40880 PCT/US96/11187 Thr 305 Lys Tyr Phe Ala Thr 385 Cys Ser Thr Ser Thr 465 Leu 35 Ser Val Gin Asp 545 Leu Val Cys Pro Cys 370 Ile Val Leu Leu Ile 450 Glu Glu Thr Phe Lys 530 Gln Ser Val Ser Val Ile Met 355 Met Lys Asn Ile Arg 435 Gin Leu Glu Ser Gly 515.

Ala Met Thr Glu 340 Ser Tyr Gly Pro Asp 420 Leu Asp Gly Ser Ala 500 Ile Gin.

Arg Arg 325 Thr Pro Ser Ser Pro 405 Lys Ser Ser Asn Asn 485 Leu Leu Gin Ala -110- Thr Thr Arg Gly Phe Ala Ser Ala 310 315 Val Gly Ser Val Ile Glu Glu Leu 330 Asp Leu Asp Leu Tyr Cys Thr Arg 345 Gly Ile Tyr Ser Cys Leu Ser Gly 360 365 Lys Thr Glu Gly Ala Leu Thr Thr 375 380 Val Ile Ala Asn Cys Lys Met Thr 390 395 Gly Ile Ile Ser Gin Asn Tyr Gly 410 Gin Ser Cys Asn Val Leu Ser Leu 425 Gly Glu Phe Asp Val Thr Tyr Gin 440 445 Gin Val Ile Ile Thr Gly Asn Leu 455 460 Val Asn Asn Ser Ile Ser Asn Ala 470 475 Arg Lys Leu Asp Lys Val Asn Val 490 Ile Thr Tyr Ile Val Leu Thr Ile 505 Ser Leu Ile Leu Ala Cys Tyr Leu 520 525 Lys Thr Leu Leu Trp Leu Gly Asn 535 540 Thr Thr Lys Met 550 Leu Asp Ile 350 Asn Pro Thr Glu Gly 430 Lys Asp Leu Lys Ile 510 Met Val Thr Pro 320 Ser 335 Val Thr Tyr Cys Ala 415 Gly Asn Ile Asn Leu 495 Ser ryr Thr Ser Met Arg 400 Val Ile Ile Ser Lys 480 Thr Leu Lys 0* 0@ 0 4 0 00 S 0@r S

C

Asn Thr Leu

SC

@4 0 5# *405 4 0 @5*5 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 182 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQ ID WO 96/40880 PCT/US96/11187 -111- GGCCTCGAGG GCCGCGGCCG CCTGCAGGTC GACTCTAGAA AAAATTGAAA AACTATTCTA ATTTATTGCA CGGAGATCTT =rnl-mrT rr TT ITrl TG GCATATAAAT GAATTCGGAT 120 CCGGACCGCG CCGTTAGCCA AGTTGCGTTA GAGAATGATG AAAGAGAGGC AAAAAATACA 180 TG TG 182 INFORMATION FOR SEQ ID NO:16: SEQUENCE CHARACTERISTICS: LENGTH: 178 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: ATCTTCTGCG ACATCAAGAA TCAAACCGAA TGCCCGGATC CATAATTAAT TAATTAATTT TTATCCCTCG ACTCTAGAAA AAATTGAAAA ACTATTCTAA TTTATTGCAC GGAGATCTTT 120 ITT-i-i-i-i--r TTTTrr' GG CATATAAATG AATTCGGATC GATCCCGGTT GGCGCCCT 178 INFORMATION FOR SEQ ID NO:17: SEQUENCE CHARACTERISTICS: LENGTH: 60 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear ooo (ii) MOLECULE TYPE: DNA (genomic) S(iii) HYPOTHETICAL:

NO

(iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: 50 AAAAACCCCC CCCCCCCCCC CCCCCCCCCC CTGCAGGCAT CGTGGTGTCA CGCTCGTCGT INFORMATION FOR SEQ ID NO:18: SEQUENCE CHARACTERISTICS: LENGTH: 120 base pairs TYPE: nucleic acid STRANDEDNESS: double S 60 TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO WO 96/40880 PCTIUS96/1 1187 -112- (xi) SEQUENCE DESCRIPTION: SEQ ID N0:18: ATAA'rCTCT TACTGTCATG CCATCCGTAA GATGCTTTC TGTGACTGGT GAGTGATCCA TAA'ITAA'rrA A'rrAATrTTTT ATCCCGGGTC GACCTGCAGG CGGCCGCGGC CCTCGAGGCC 120 INFORMATION FOR SEQ ID NO:19: Wi SEQUENCE CHARACTERISTICS: LENGTH: 1305 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genornic) (iii) HYPOTHETICAL: No (iv) ANTI-SENSE: NO (ix) FEATURE: NAME/KEY: CDS LOCATION: 1. .1305 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19: ATG CAC CGT CCT CAT CTC AGA CGG CAC TCG CGT TAC TAC GCG AAA GGA 48 Met His Arg Pro His Leu Arg Arg His Ser Arg Tyr Tyr Ala Lys Gly 1 5 10 GAG GTG CTT AAC AAA CAC ATG GAT TGC GOT GGA AAA CGG TGC TGC TCA 96 Glu Val Leu Asn Lys His Met Asp Cys Gly Gly Lys Arg Cys Cys Ser 25 *.GGC GCA GCT GTA TTCACTTC TA CT GT GCAGG ATTATG CGG 144 Gly Ala Ala Val Phe Thr Leu Phe Trp Thr Cys Val Arg Ile Met Arg 40 CAT ATC TGC TFT GTA CGC AAC GCT ATG GAC CGC CAT TTA TTT TTG 192 Glu His Ile Cys Phe Val Arg Asn Ala Met Asp Arg His Leu Phe Leu s 55 60 AGO AAT GCT TIT TGG ACT ATC GTA CTG CTI' TCT TCC TTC GCT AGC CAG 240 Arg Asn Ala Phe Trp Thr Ile Val Leu Leu Ser Ser Phe Ala Ser Gln 70 75 AGC ACC GCC GCC GTC ACG TAC GAC TAC ATT T1'A GGC CGT CGC GCG CTC 288 Ser Thr Ala Ala Val Thr Tyr Asp Tyr Ile Leu Gly Arg Arg Ala Leu o 85 90 0: 55 GAC GCG CTA ACC ATA CCG GCG GTT GGC CCG TAT AAC AGA TAC CTC ACT 336 Asp Ala Leu Thr Ile Pro Ala Val Gly Pro Tyr Asn Arg Tyr Leu Thr 100 105 110 :o:AGG GTA TCA AGA GOC TGC GAC GTT GTC GAG CTC AAC CCG ATT TCT AAC 384 60 Arg Val Ser Arg Gly Cys Asp Val Val Glu Leu Asn Pro Ile Ser Asn 115 120 125 GTG GAC GAC ATG ATA TCG GCG GCC AAA GA.A AAA GAG AAG GGG GGC CCT 432 Val Asp Asp Met Ile Ser Ala Ala Lys Glu Lys Glu Lys Gly Gly Pro 130 135 140 ITC GAG GCC TCC OTC GTC TGG TTC TAC OTG ATT AAG GGC GAC GAC GGC 480 WO 96/40880 PCTIUS96/11187 -113- Phe Glu Ala Ser Val Val Trp Phe Tyr Val Ile Lys Gly Asp Asp Gly 145 150 155 160 GAG GAC AAG TAC TGT CCA ATC TAT AGA AAA GAG TAC AGG GAA TGT GGC 528 Glu Asp Lys Tyr Cys Pro Ile Tyr Arg Lys Glu Tyr Arg Glu Cys Gly 165 170 175 GAC GTA CAA CTG CTA TCT GAA TGC GCC GTT CAA TCT GCA CAG ATG TGG 576 Asp Val Gin Leu Leu Ser Glu Cys Ala Val Gin Ser Ala Gin Met Trp 180 185 190 GCA GTG GAC TAT GTT CCT AGC ACC CTT GTA TCG CGA AAT GGC GCG GGA 624 Ala Val Asp Tyr Val Pro Ser Thr Leu Val Ser Arg Asn Gly Ala Gly 195 200 205 CTG ACT ATA TTC TCC CCC ACT GCT GCG CTC TCT GGC CAA TAC TTG CTG 672 Leu Thr Ile Phe Ser Pro Thr Ala Ala Leu Ser Gly Gin Tyr Leu Leu 210 215 220 ACC CTG AAA ATC GGG AGA TT GCG CAA ACA GCT CTC GTA ACT CTA GAA 720 Thr Leu Lys Ile Gly Arg Phe Ala Gin Thr Ala Leu Val Thr Leu Glu 225 230 235 240 GTT AAC GAT CGC TGT TTA AAG ATC GGG TCG CAG CTT AAC TTT TTA CCG 768 Val Asn Asp Arg Cys Leu Lys. Ile Gly Ser Gin Leu Asn Phe Leu Pro 245 250 255 TCG AAA TGC TGG ACA ACA GAA CAG TAT CAG ACT GGA TTT CAA GGC GAA 816 Ser Lys Cys Trp Thr Thr Glu Gin Tyr Gin Thr Gly Phe Gin Gly Glu 260 265 270 CAC CTT TAT CCG ATC GCA GAC ACC AAT ACA CGA CAC GCG GAC GAC GTA 864 His Leu Tyr Pro Ile Ala Asp Thr Asn Thr Arg His Ala Asp Asp Val 275 280 285 TAT CGG GGA TAC GAA GAT ATT CTG CAG CGC TGG AAT AAT TTG CTG AGG 912 Tyr Arg Gly Tyr Glu Asp Ile Leu Gin Arg Trp Asn Asn Leu Leu Arg 290 295 300 AAA AAG AAT CCT AGC GCG CCA GAC CCT CGT CCA GAT AGC GTC CCG CAA 960 Lys Lys Asn Pro Ser Ala Pro Asp Pro Arg Pro Asp Ser Val Pro Gin 305 310 315 320 GAA ATT CCC GCT GTA ACC AAG AAA GCG GAA GGG CGC ACC CCG GAC GCA 1008 Glu Ile Pro Ala Val Thr Lys Lys Ala Glu Gly Arg Thr Pro Asp Ala 325 330 335 GAA AGC AGC GAA AAG AAG GCC CCT CCA GAA GAC TCG GAG GAC GAC ATG 1056 Glu Ser Ser Glu Lys Lys Ala Pro Pro Glu Asp Ser Glu Asp Asp Met 340 345 350 CAG GCA GAG GCT TCT GGA GAA AAT CCT GCC GCC CTC CCC GAA GAC GAC 1104 Gin Ala Glu Ala Ser Gly Glu Asn Pro Ala Ala Leu Pro Glu Asp Asp 355 360 365 GAA GTC CCC GAG GAC ACC GAG CAC GAT GAT CCA AAC TCG GAT CCT GAC 1152 Glu Val Pro Glu Asp Thr Glu His Asp Asp Pro Asn Ser Asp Pro Asp 370 375 380 TAT TAC AAT GAC ATG CCC GCC GTG.ATC CCG GTG GAG GAG ACT ACT AAA 1200 Tyr Tyr Asn Asp Met Pro Ala Val Ile Pro Val Glu Glu Thr Thr Lys 385 390 395 400 AGT TCT AAT GCC GTC TCC ATG CCC ATA TTC GCG GCG TTC GTA GCC TGC 1248 Ser Ser Asn Ala Val Ser Met Pro Ile Phe Ala Ala Phe Val Ala Cys 1405 410 415 WO 96/40880 WO 9640880PCTIUS96/1 1187 -114- GCG GTC GCG CTC GTG GGG CTA CTG GTr TGG AGC ATC GTA AAA TGC GCG 1296 Ala Val Ala Leu Val Gly Leu Leu Val Trp Ser Ile Val Lys Cys Ala 420 425 430 CGT AGC TAA 1305 Arg Ser 435 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 4 34 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID Met His Arg Pro His Leu Axg Arg His Ser Arg Tyr Tyr Ala Lys Gly 1 5 10 Giu Val Leu Asn Lys His Met Asp Cys Gly Gly Lys Arg Cys Cys Ser 20 25 Gly Ala Ala Val Phe Thr Leu Phe Trp Thr Cys Val Arg Ile Met Arg 40 Giu His Ile Cys Phe Val Arg Asn Ala Met Asp Arg His Leu Phe Leu 55 Arg Asn Ala Phe Trp Thr Ile Val Leu Leu Ser Ser Phe Ala Ser Gin 70 75 Ser Thr Ala Ala Val Thr Tyr Asp Tyr Ile Leu Gly Arg Arg Ala Leu 90 *Asp Ala Leu Thr Ile Pro Ala Val Gly Pro Tyr Asn Arg Tyr Leu Thr 100 105 110 ***Arg Val Ser Arg Giy Cys Asp Val-Val Glu Leu Asn Pro Ile Ser Asn 115 120 125 Vai Asp Asp Met Ile Ser Ala Ala Lys Giu Lys Giu Lys Gly Gly Pro 130 135 140 Phe Glu Ala Ser Val Val Trp Phe Tyr Val Ile Lys Gly Asp Asp Gly 145 150 155 160 Giu Asp Lys Tyr Cys Pro Ile Tyr Arg Lys Giu Tyr Arg Glu Cys Gly .:165 170 175 *Asp Val Gin Leu Leu Ser Glu Cys Ala Val Gin Ser Ala Gin Met Trp 55 180 185 190 Ala Val Asp Tyr Val Pro Ser Thr Leu Val Ser Arg Asn Gly Ala Gly *.*195 200 205 60 Leu Thr Ile Phe Ser Pro Thr Ala Ala Leu Ser Gly Gin Tyr Leu Leu 210 215 220 Thr Leu Lys Ile Gly Arg Phe Ala Gin Thr Ala Leu Val Thr Leu Glu 225 230 235 240 Val Asn Asp Arg Cys Leu Lys Ile Gly Ser Gin Leu Asn Phe Leu Pro 245 250 )qC WO 96/40880 WO 9640880PCTIUS96II 1187 -115- Ser His Tyr Lys 305 Glu Giu Gin Giu Tyr 385.

Ser Lys Leu Arg 290 Lys Ile Ser Ala Val 370 Tyr Ser Cys Tyr 275 Gly Asn Pro Ser Giu 355 Pro Asn Asn Trp 260 Pro Tyr Pro Ala Giu 340 Ala Giu Asp Aia Thr Thr Giu Gin Tyr Gin Thr Gly Phe Gin Ile Giu Ser Val 325 Lys Ser Asp Met Val 405 Ala Asp Ala 310 Thr Lys Giy Thr Pro 390 Ser Asp Ile 295 Pro Lys Aia Giu Giu 375 Ala Met 265 Thr Asn 280 Leu Gin Asp Pro Lys Ala Pro Pro 345 Asn Pro 360 His Asp Val Ile Pro Ile 270 Giy Giu Thr Arg Arg Giu 330 Giu Ala Asp Pro Phe 410 Arg Trp Pro 31i5 Giy A sp Ala Pro Vai 395 Ala His Asn 300 Asp Arg Ser Leu Asn 380 Giu Ala Ala 285 Asn Ser Thr Giu Pro 365 Ser Giu Phe Asp Asp Leu Leu Vai Pro Pro Asp 335 Asp Asp 350 Giu Asp Asp Pro Thr Thr Val Ala 415 Vai Arg Gin 320 Ala Met Asp Asp Lys 400 Cys Ala Val Ala Leu 420 Arg Ser Vai Giy Leu Leu Val Trp Ser Ile Val 425 Lys Cys Ala 430 *44 0

Claims (20)

1. A recombinant fowlpox virus comprising a foreign DNA sequence inserted into the fowlpox virus genomic DNA, wherein the foreign DNA sequence is inserted within a non-essential region of the fowlpox virus genomic DNA and is capable of being expressed in a fowlpox virus infected host cell.

2. The recombinant fowlpox virus of claim 1, wherein the foreign DNA sequence is inserted into an open reading frame within the non-essential region the fowlpox virus genomic DNA.

3. The recombinant fowlpox virus of claim 1, wherein the foreign DNA sequence encodes a polypeptide.

4. The recombinant fowlpox virus of claim 3, wherein the polypeptide is antigenic.

5. The recombinant fowlpox virus of claim 1, further comprising a foreign DNA sequence which encodes a detectable marker. 25

6. The recombinant fowlpox virus of claim-5, wherein the detectable marker is E. coli beta- galactosidase.

7. The recombinant fowlpox virus of claim 5, wherein 30 the detectable marker is E. coli beta- glucuronidase.

8. The recombinant fowlpox virus of claim 1, wherein the foreign DNA sequence encodes a cytokine.

9. The recombinant fowlpox virus of claim 8, wherein the cytokine is chicken myelomonocytic growth WO 96/40880 PCT/US96/11187 -117- factor (cMGF) or chicken interferon (cIFN). The recombinant fowlpox virus of claim 9, designated S-FPV-100.

11. The recombinant fowlpox virus of claim 9, designated S-FPV-101.

12. The recombinant fowlpox virus of claim 9, further comprising a newcastle disease virus hemagglutinin (NDV HN), or a newcastle disease virus fusion (NDV F).

13. The recombinant fowlpox virus of claim 12, designated S-FPV-099.

14. The recombinant fowlpox virus of claim 8, wherein the cytokine is selected from a group consisting of interleukin-2, interleukin-6, interleukin-12, interferons, granulocyte-macrophage colony stimulating factors, and interleukin receptors.

15. The recombinant fowlpox virus of claim 4, wherein the antigenic polypeptide is derived from the 25 group consisting of: human herpesvirus, herpes simplex virus-1, herpes simplex virus-2, human cytomegalovirus, Epstein-Barr virus, Varicell- Zoster virus, human herpesvirus-6, human herpesvirus-7, human influenza, human 30 immunodeficiency virus, rabies virus, measles virus, hepatitis B virus and hepatitis C virus.

16. The recombinant fowlpox virus of claim 4, wherein the antigenic polypeptide is hepatitis B virus core protein or hepatitis B virus surface protein.

17. The recombinant fowlpox virus of claim 4, wherein WO 96/40880 PCT/US96/1187 -118- the antigenic polypeptide is equine influenza virus neuraminidase or hemagglutinin.

18. The recombinant fowlpox virus of claim 17, wherein the antigenic polypeptide is selected from the group consisting of: equine influenza virus type A/Alaska 91 neuraminidase, equine influenza virus type A/Kentucky 92 neuraminidase, equine influenza virus type A/Prague 56 neuraminidase, equine influenza virus type A/Miami 63 neuraminidase, equine influenza virus type A/Kentucky 81 neuraminidase, equine herpesvirus type 1 glycoprotein B, and equine herpesvirus type 1 glycoprotein D.

19. The recombinant fowlpox virus of claim 4, wherein the antigenic polypeptide is derived from the group consisting of: hog cholera virus gEl, hog cholera virus gE2, swine influenza virus hemagglutinin, neuraminidase, matrix and nucleoprotein, pseudorabies virus glycoprotein B, pseudorabies virus glycoprotein C and pseudorabies *virus glycoprotein D, and PRRS virus ORF7. :e 25 20. The recombinant fowlpox virus of claim 4, wherein the antigenic polypeptide is selected from the group consisting of: infectious bovine rhinotracheitis virus gE, bovine respiratory syncytial virus attachment protein (BRSV G), 30 bovine respiratory syncytial virus fusion protein (BRSV bovine respiratory syncytial virus nucleocapsid protein (BRSV bovine parainfluenza virus type 3 fusion protein, and the bovine parainfluenza virus type 3 hemagglutinin neuraminidase.

21. The recombinant fowlpox virus of claim 4, wherein WO 96/40880 PCT/US96/11187 -119- the antigenic polypeptide is bovine viral diarrhea virus (BVDV) glycoprotein 48 or glycoprotein

53. 22. The recombinant fowlpox virus of claim 4, wherein the foreign DNA sequence encodes an antigenic polypeptide which is derived or derivable from a group consisting of: infectious feline immunodeficiency virus gag, feline immunodeficiency virus env, infectious laryngotracheitis virus glycoprotein B, infectious laryngotracheitis virus gI, infectious laryngotracheitis virus gD, infectious bovine rhinotracheitis virus glycoprotein G, infectious bovine rhinotracheitis virus glycoprotein E, pseudorabies virus glycoprotein 50, pseudorabies virus II glycoprotein B, pseudorabies virus III glycoprotein C, pseudorabies virus glycoprotein E, pseudorabies virus glycoprotein H, marek's disease virus glycoprotein A, marek's disease virus glycoprotein B, marek's disease virus glycoprotein D, newcastle disease virus hemagglutinin or neuraminadase, newcastle disease virus fusion, infectious bursal disease virus VP2, infectious bursal disease virus VP3, infectious bursal 25 disease virus VP4, infectious bursal disease virus polyprotein, infectious bronchitis virus, spike, infectious bronchitis virus matrix, and chick anemia virus. 30 23. The recombinant fowlpox virus of claim 1, wherein the foreign DNA sequence is under control of a promoter. 24. The recombinant fowlpox virus of claim 23, wherein the foreign DNA sequence is under control of an endogenous upstream poxvirus promoter. WO 96/40880 PCT/US96/11187 -120- The recombinant fowlpox virus of claim 23, wherein the foreign DNA sequence is under control- of a heterologous upstream promoter. 26. The recombinant fowlpox virus of claim 23, wherein the promoter is selected from: synthetic pox viral promoter, pox synthetic late promoter 1, pox synthetic late promoter 2 early promoter 2, pox 01L promoter, pox I4L promoter, pox I3L promoter, pox I2L promoter, pox IlL promoter, and pox E1OR promoter. 27. A homology vector for producing a recombinant fowlpox virus by inserting foreign DNA into the viral genome of a fowlpox virus which comprises a double-stranded DNA molecule consisting essentially of: a) double stranded foreign DNA not usually present within the fowlpox virus viral genome; b) at one end the foreign DNA, double-stranded fowlpox virus DNA 25 homologous to the viral genome located at one side of the non- essential region of the coding region of the fowlpox virus viral genome; and c) at the other end of the foreign DNA, double-stranded fowlpox virus DNA homologous to the viral genome located at the other side of the non-essential region of the coding region of the fowlpox virus viral genome. WO 96/40880 PCT/US96/11187 -121- 28. The homology vector of claim 27, wherein the foreign DNA sequence encodes a cytokine. 29. The homology vector of claim 27, wherein the cytokine is chicken myelomonocytic growth factor (cMGF) or chicken interferon (cIFN). The homology vector of claim 27, wherein the foreign DNA sequence encodes a polypeptide. 31. A homology vector of claim 30, wherein the polypeptide is antigenic. 32. The homology vector of claim 27, wherein the foreign DNA sequence is under control of a promoter. 33. A vaccine for immunizing an animal against fowlpox virus which comprises an effective immunizing amount of the recombinant fowlpox virus of claims 1 and a suitable carrier. *O .e 34. A method of immunizing an animal against a human pathogen which comprises administering to the 25 animal an effective immunizing dose of the vaccine of claim 32. 35. A method of immunizing an animal against an animal pathogen which comprises administering to the 30 animal an effective immunizing dose of the vaccine S* of claim 32. O0 36. A method of enhancing an avian immune response which comprises administering to a person an effective dose of a recombinant fowlpox virus of claim 1 and a suitable carrier. Documnt24-08/12/00 -122- 37. A recombinant fowlpox virus according to any one of Claims 1 to 26 or a homology vector according to any one of Claims 27 to 32 or a vaccine according to Claim 33 or a method according to any one of Claims 34 to 36 substantially as hereinbefore defined with reference to the Figures and/or Examples. DATED this eighth day of December 2000. Syntro Corporation by DAVIES COLLISION CAVE Patent Attorneys for the Applicant ee *e*o.