JP4134255B2 - Evaluation kit for Fusarium head blight resistant gramineous plant and use thereof - Google Patents

Description

  The present invention is present in the genomic DNA of gramineous plants such as wheat, particularly barley, and imparts the head blight resistance factor (locus involved in head blight resistance, head blight resistance) Genetic markers linked to the gene) and their use. More specifically, the present invention relates to a determination kit for head blight-resistant gramineous plants including a primer set for amplifying the genetic marker, and a method for determining a head blight-resistant gramineous plant using the primer set.

  Barley's head blight is known to be a serious disease that not only lowers the quality and yield of barley, but also causes mold poisons such as deoxynivalenol, which are also harmful to the human body. At present, the infection is increasing all over the world, so it is strongly desired to cultivate varieties resistant to head blight.

  Barley's head blight is a disease caused by common humic fungi such as Fusarium graminearum, F.roseum, F.culmorum, etc. . The pathogenic fungus is parasitically parasitic on gramineous weeds, rice straw, wheat straw, organic matter in the ground in the incomplete generation, but forms coconut shells when conditions such as temperature and day length are met. When the coconut husks are swollen by water and expanded or cleaved, the spore spores scatter and infect wheat such as barley. Infection with wheat occurs in a relatively short period before and after the flowering period, and conidia formed in the diseased ears become a second source of infection to further spread the infection. In addition, since the conidia have a viscous substance, it spreads as a suspension due to rain dew and further spreads the infection. The infection mechanism of barley's head blight is the first infection that occurs through the remnants and degenerated tissues of the reeds remaining in the reeds, and mycelia grow and invade the shell grains or invade through reeds that protrude from the reeds In any case, it is known that moths are greatly involved in the infection.

  In addition, there are varieties having resistance to head blight in barley. Studies have been conducted on the resistance mechanism of such barley head blight resistant varieties, suggesting the involvement of traits such as streak, panicle length, heading time, intercob length, etc. 5). In addition, it is said that barley has no immune resistance against head blight, and it is said that a relatively small number of genes are quantitative traits involved in the resistance (see, for example, Non-Patent Document 6).

  By the way, conventionally, breeding of excellent varieties of agricultural crops is carried out by crossing varieties or wild species having a target trait, actually cultivating a large number of individuals and selecting individuals having the target trait, Had to be fixed to. Therefore, vast fields, a great deal of human power, and considerable years were required. For example, when head blight resistance was the target trait, the selection target population had to be identified by cultivating the selection target population and evaluating the head blight resistance for each individual. . Further, if the target trait is a trait that is easily affected by the cultivation environment factor, it is difficult to determine whether or not the target trait expressed by the selected individual is a gene phenotype.

  Therefore, in recent years, breeding methods by selection using genetic markers as indices have been used in order to shorten the breeding period, reduce labor and field area, and reliably select useful genes. In breeding with such a genetic marker, selection can be made at the seedling stage depending on the genotype of the marker, and the presence or absence of the target trait can be easily confirmed. Therefore, efficient breeding can be realized by using genetic markers. In order to achieve breeding using genetic markers, it is essential to develop genetic markers that are strongly linked to the target trait.

  By the way, many of the traits important in agriculture are many that show continuous mutations in hybrid progeny. Such traits are called quantitative traits because they are measured on a quantitative scale such as weight and length. In general, quantitative traits are often determined by the action of multiple genes, rather than a single dominant gene-dominated trait. Many traits that are targeted for improvement in crop breeding, such as yield, quality, and taste, are often quantitative traits.

  A genetic position occupied by such a gene that governs quantitative traits on a chromosome is referred to as QTL (Quantitative Trait Loci). As a method of estimating QTL, QTL analysis using a genetic marker existing in the vicinity of QTL is used. When genetic markers appeared in the late 1980s, detailed linkage map creation using genetic markers greatly progressed, and QTL analysis was performed on many organisms based on the maps.

  As described above, the development of genetic markers linked to the target trait is enabled by high-accuracy QTL analysis based on a detailed linkage map that can cover the entire chromosome, and by using the obtained genetic markers, it is efficient. It can be said that simple breeding can be realized.

Examples of techniques related to the genetic marker include, for example, barley, 1) a genetic marker linked to a gene that confers aluminum resistance to barley and a technique related to its use (see Patent Document 1), and 2) a nucleic acid derived from a barley chromosome. The present inventors have proposed a novel primer set (see Patent Document 2) for detecting a marker in the background of wheat, a technique relating to its use, and the like.
Steffen BJ. 1998. “Fusarium head blight of barley: epidemics, impact, and breeding for resistance.” NBAA Tech Quart 35: 177-184. Stuchlakova E and Sip V. 1996. “Resistance of Czech and Slovak winter wheat varieties to Fusarium head blight.“ Genet a Slecht Praha (Genetics and plant Breeding) 32: 79-94. Hideo Cluba, Yuji Hiura. 1962. Varietal differences in resistance to head blight. Studies on disease resistance of barley, 13th report. Agricultural study 49: 177-187 Kazuyoshi Takeda, Hideo Cluba. 1989. “Development of a test method for head blight of barley and search for disease-resistant varieties” Breeding Journal 39 Zhu, H., L. Gilchrist, P. Hayes, A. Kleinhofs, D. Kudruna, Z. Liu, L. Porm, B. Steffenson, T. Toojinda, P. Vivar. 1999. “Does function follow form? Principal QTLs for Fusarium head bright (FHB) resistance are coincident with QTLs for inflorescence trits and plant height in a doubled-haploide population of barley. ”Theor Appl Genet 99: 1221-1232. Masao Hori. 1985. "Ecology and control of wheat and barley red mold" Agriculture and horticulture 60: 431-436 JP 2002-291474 A (published on October 8, 2002) JP 2003-111593 A (published on April 15, 2003)

  Studies have been made on the resistance mechanism of barley head blight-resistant varieties, but details of genes involved in barley head blight resistance and the mechanism of resistance have not yet been clarified.

  Therefore, the present invention has been made in view of the above problems, and its purpose is to link to a head blight resistance factor (locus involved in head blight resistance) present in barley genomic DNA. By finding genetic markers, isolation of genes involved in resistance to head blight of barley, elucidation of the mechanism of resistance to head blight of barley, plants that are resistant to head blight (for example, barley including barley) ))) Breeding, and a method for using such as a method for determining head blight-resistant plants (Gramineae plants (for example, barley including barley)).

  In order to solve the above-mentioned problems, the present inventors have developed a recombinant inbred line grown from a cross between barley varieties Russia 6 (Nijo, resistance) and HES4 (Six, susceptibility), which differ greatly in resistance to head blight. Using a RI strain (hereinafter referred to as “RHI population” as appropriate)), QTL analysis related to head blight resistance was performed.

  As a result, two QTLs related to head blight resistance were detected on the 2H chromosome and one on the 5H chromosome. However, one of the QTLs detected on the 2H chromosome coincided with the position of the known striatal gene (vrs1), suggesting the possibility of pleiotropic expression of the vrs1 gene. Therefore, the analysis was advanced focusing on the other QTLs for head blight resistance, and genetic markers (DNA markers and the like) linked to these QTLs were found.

  In addition, the present inventors also developed the above RHI population, an RI strain (hereinafter referred to as “RI2 population”) bred from the cross of Harbin 2-row (resistant) and Turkey 6 (arabic), and Haruna Nijo (resistant). ) And H602 (susceptibility) mating doubling haploid strains (hereinafter referred to as “DH”, the abbreviated name of the doubling halves vs. strain is referred to as “DHHS population”). Further QTL analysis was performed.

  As a result, one QTL was newly detected on chromosomes 2H and 4H in the RHI population, 2H, 4H and 6H in the RI2 population, and 2H, 4H and 5H in the DHHS population. Moreover, the genetic marker linked with the said QTL was found. The present invention has been completed based on the above examination. That is, the present invention includes the following inventions.

A determination kit for head blight-resistant gramineous plants used for determining a head blight-resistant gramineous plant, wherein at least one of the fifteenth and sixteenth primer sets shown below is The determination kit characterized by being included:
A fifteenth primer set, which is a combination of a primer having the base sequence represented by SEQ ID NO: 40 and a primer having the base sequence represented by SEQ ID NO: 41;
A sixteenth primer set, which is a combination of a primer having the base sequence represented by SEQ ID NO: 42 and a primer having the base sequence represented by SEQ ID NO: 43.

The determination kit may further include at least one or more of the following first to thirteenth and seventeenth to eighteenth primer sets:
A first primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 1 and a primer having the base sequence shown in SEQ ID NO: 2;
A second primer set, which is a combination of a primer having the base sequence shown in SEQ ID NO: 3 and a primer having the base sequence shown in SEQ ID NO: 4;
A third primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 5 and a primer having the base sequence shown in SEQ ID NO: 6;
A fourth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 5 and a primer having the base sequence shown in SEQ ID NO: 7;
A fifth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 21 and a primer having the base sequence shown in SEQ ID NO: 20;
A sixth primer set which is a combination of a primer having the base sequence represented by SEQ ID NO: 22 and a primer having the base sequence represented by SEQ ID NO: 23;
A seventh primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 24 and a primer having the base sequence shown in SEQ ID NO: 25;
An eighth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 26 and a primer having the base sequence shown in SEQ ID NO: 27;
A ninth primer set, which is a combination of a primer having the base sequence shown in SEQ ID NO: 28 and a primer having the base sequence shown in SEQ ID NO: 29;
A tenth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 30 and a primer having the base sequence shown in SEQ ID NO: 31;
An eleventh primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 32 and a primer having the base sequence shown in SEQ ID NO: 33;
A twelfth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 34 and a primer having the base sequence shown in SEQ ID NO: 35;
A thirteenth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 36 and a primer having the base sequence shown in SEQ ID NO: 37;
A seventeenth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 44 and a primer having the base sequence shown in SEQ ID NO: 45; and a primer having the base sequence shown in SEQ ID NO: 46; An eighteenth primer set which is a combination with a primer having the base sequence represented by No. 47.

In addition, the method for determining a head blight-resistant gramineous plant according to the present invention uses at least one primer set among the fifteenth and sixteenth primer sets shown below using a genomic DNA of a gramineous plant as a template. A method for determining a head blight resistant gramineous plant comprising the step of detecting a polymorphism of an amplified fragment amplified using
A fifteenth primer set, which is a combination of a primer having the base sequence represented by SEQ ID NO: 40 and a primer having the base sequence represented by SEQ ID NO: 41;
A sixteenth primer set, which is a combination of a primer having the base sequence represented by SEQ ID NO: 42 and a primer having the base sequence represented by SEQ ID NO: 43.

The determination method may be a method characterized by further using at least one of the first to thirteenth and seventeenth to eighteenth primer sets shown below:
A first primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 1 and a primer having the base sequence shown in SEQ ID NO: 2;
A second primer set, which is a combination of a primer having the base sequence shown in SEQ ID NO: 3 and a primer having the base sequence shown in SEQ ID NO: 4;
A third primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 5 and a primer having the base sequence shown in SEQ ID NO: 6;
A fourth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 5 and a primer having the base sequence shown in SEQ ID NO: 7;
A fifth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 21 and a primer having the base sequence shown in SEQ ID NO: 20;
A sixth primer set which is a combination of a primer having the base sequence represented by SEQ ID NO: 22 and a primer having the base sequence represented by SEQ ID NO: 23;
A seventh primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 24 and a primer having the base sequence shown in SEQ ID NO: 25;
An eighth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 26 and a primer having the base sequence shown in SEQ ID NO: 27;
A ninth primer set, which is a combination of a primer having the base sequence shown in SEQ ID NO: 28 and a primer having the base sequence shown in SEQ ID NO: 29;
A tenth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 30 and a primer having the base sequence shown in SEQ ID NO: 31;
An eleventh primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 32 and a primer having the base sequence shown in SEQ ID NO: 33;
A twelfth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 34 and a primer having the base sequence shown in SEQ ID NO: 35;
A thirteenth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 36 and a primer having the base sequence shown in SEQ ID NO: 37;
A seventeenth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 44 and a primer having the base sequence shown in SEQ ID NO: 45; and a primer having the base sequence shown in SEQ ID NO: 46; An eighteenth primer set which is a combination with a primer having the base sequence represented by No. 47.

  The present invention also includes the following inventions. That is, in order to solve the above problems, the genetic marker according to the present invention is a genetic marker that is present in the genomic DNA of gramineous plants and is linked to the head blight resistance factor. It is characterized by being located at a distance in the range of 0 to 10 centimorgans.

  In the genetic marker according to the present invention, in order to solve the above problems, the Gramineae plant may be wheat.

  In the genetic marker according to the present invention, the wheat may be a barley in order to solve the above-mentioned problems.

  Moreover, in order to solve the said subject, the genetic marker concerning this invention may be characterized by the said genomic DNA being 2H chromosome.

  In order to solve the above problems, the genetic marker according to the present invention is a combination of a primer having the base sequence shown in SEQ ID NO: 1 and a primer having the base sequence shown in SEQ ID NO: 2 in addition to the above-described configuration. It may be amplified using a certain first primer set.

  Moreover, in order to solve the said subject, in addition to the said structure, the genetic marker concerning this invention may be located in the distance of about 0 centimorgan from the said head blight resistance factor.

  In order to solve the above-described problem, the genetic marker according to the present invention is a combination of a primer having the base sequence shown in SEQ ID NO: 3 and a primer having the base sequence shown in SEQ ID NO: 4 in addition to the above configuration. It may be amplified using a certain second primer set.

  Moreover, in order to solve the said subject, in addition to the said structure, the genetic marker concerning this invention may be located in the distance of about 0.6 centmorgan from the said head blight resistance factor.

  Moreover, in order to solve the said subject, the genetic marker concerning this invention may have a base sequence shown by sequence number 8 or a base sequence shown by sequence number 9 in addition to the said structure.

  In order to solve the above-described problem, the genetic marker according to the present invention is a combination of a primer having the base sequence shown in SEQ ID NO: 22 and a primer having the base sequence shown in SEQ ID NO: 23, in addition to the above configuration. It may be amplified using a sixth primer set.

  In order to solve the above problems, the genetic marker according to the present invention is a combination of a primer having the base sequence shown in SEQ ID NO: 24 and a primer having the base sequence shown in SEQ ID NO: 25 in addition to the above-described configuration. It may be amplified using a seventh primer set.

  In order to solve the above problems, the genetic marker according to the present invention is a combination of a primer having the base sequence shown in SEQ ID NO: 26 and a primer having the base sequence shown in SEQ ID NO: 27 in addition to the above-described configuration. Amplification may be performed using a certain eighth primer set.

  Moreover, in order to solve the said subject, the genetic marker concerning this invention may be characterized by the said genomic DNA being 5H chromosome.

  In order to solve the above problems, the genetic marker according to the present invention is a combination of a primer having the base sequence shown in SEQ ID NO: 5 and a primer having the base sequence shown in SEQ ID NO: 6 in addition to the above configuration. It may be amplified using a third primer set.

  Moreover, in order to solve the said subject, in addition to the said structure, the genetic marker concerning this invention may be located in the distance of about 9 centimorgans from the said head blight resistance factor.

  Moreover, in order to solve the said subject, the genetic marker concerning this invention may have a base sequence shown by sequence number 10, or a base sequence shown by sequence number 11 in addition to the said structure.

  In order to solve the above problems, the genetic marker according to the present invention is a combination of a primer having the base sequence shown in SEQ ID NO: 5 and a primer having the base sequence shown in SEQ ID NO: 7 in addition to the above configuration. It may be amplified using a certain fourth primer set.

  Moreover, in order to solve the said subject, in addition to the said structure, the genetic marker concerning this invention may be located in the distance of about 9 centimorgans from the said head blight resistance factor.

  Moreover, in order to solve the said subject, the genetic marker concerning this invention may have a base sequence shown by sequence number 12, or a base sequence shown by sequence number 13 in addition to the said structure.

  In order to solve the above-described problems, the genetic marker according to the present invention is a DNA fragment obtained by digesting a gramineous plant genomic DNA with restriction enzymes MseI and EcoRI. MseI universal primer and sequence having the base sequence shown in SEQ ID NO: 19 by ligating the MseI adapter having the base sequence shown and the EcoRI adapter having the base sequence shown in SEQ ID NOs: 14 and 15 and the DNA fragment after the ligation Pre-amplification was performed using an EcoRI universal primer having the base sequence shown in No. 18, and the pre-amplification fragment obtained by the preliminary amplification was further added to a primer having the base sequence shown in SEQ ID No. 21 and SEQ ID No. 20. The base sequence shown Fifth primer set is a combination of a primer that or may be amplified using.

  Moreover, in order to solve the said subject, in addition to the said structure, the genetic marker concerning this invention may be located in the distance of about 2.2 centmorgan from the said head blight resistance factor.

  In order to solve the above problems, the genetic marker according to the present invention is a combination of a primer having the base sequence shown in SEQ ID NO: 28 and a primer having the base sequence shown in SEQ ID NO: 29 in addition to the above-described configuration. It may be amplified using a certain ninth primer set.

  In order to solve the above-mentioned problem, the genetic marker according to the present invention is a combination of a primer having the base sequence shown in SEQ ID NO: 30 and a primer having the base sequence shown in SEQ ID NO: 31 in addition to the above configuration. It may be amplified using a tenth primer set.

  Moreover, in order to solve the said subject, the genetic marker concerning this invention may be characterized by the said genomic DNA being 4H chromosome.

  In order to solve the above-described problems, the genetic marker according to the present invention is a DNA fragment obtained by digesting a gramineous plant genomic DNA with restriction enzymes MseI and EcoRI. MseI universal primer and sequence having the base sequence shown in SEQ ID NO: 19 by ligating the MseI adapter having the base sequence shown and the EcoRI adapter having the base sequence shown in SEQ ID NOs: 14 and 15 and the DNA fragment after the ligation Pre-amplification was performed using an EcoRI universal primer having the base sequence shown in No. 18, and the pre-amplification fragment obtained by the pre-amplification was further added to a primer having the base sequence shown in SEQ ID No. 32 and SEQ ID No. 33. The base sequence shown Be amplified using eleventh primer set is a combination of a primer that may be characterized in.

  In order to solve the above-described problems, the genetic marker according to the present invention is a DNA fragment obtained by digesting a gramineous plant genomic DNA with restriction enzymes MseI and EcoRI. MseI universal primer and sequence having the base sequence shown in SEQ ID NO: 19 by ligating the MseI adapter having the base sequence shown and the EcoRI adapter having the base sequence shown in SEQ ID NOs: 14 and 15 and the DNA fragment after the ligation Preliminary amplification was performed using an EcoRI universal primer having the base sequence shown in No. 18, and the preliminary amplification fragment obtained by the preliminary amplification was further converted into a primer having the base sequence shown in SEQ ID No. 34, and SEQ ID No. 35. The base sequence shown Twelfth primer set is a combination of a primer that or may be amplified using.

  In order to solve the above-described problems, the genetic marker according to the present invention is a DNA fragment obtained by digesting a gramineous plant genomic DNA with restriction enzymes MseI and EcoRI. MseI universal primer and sequence having the base sequence shown in SEQ ID NO: 19 by ligating the MseI adapter having the base sequence shown and the EcoRI adapter having the base sequence shown in SEQ ID NOs: 14 and 15 and the DNA fragment after the ligation Pre-amplification was performed using an EcoRI universal primer having the base sequence shown in No. 18, and the pre-amplification fragment obtained by the pre-amplification was further converted into a primer having the base sequence shown in SEQ ID No. 36 and SEQ ID No. 37. The base sequence shown Be amplified using thirteenth primer set is a combination of a primer that may be characterized in.

  In order to solve the above-described problem, the genetic marker according to the present invention is a combination of a primer having the base sequence represented by SEQ ID NO: 38 and a primer having the base sequence represented by SEQ ID NO: 39 in addition to the above configuration. It may be amplified using a 14th primer set.

  In order to solve the above problems, the genetic marker according to the present invention is a combination of a primer having the base sequence represented by SEQ ID NO: 40 and a primer having the base sequence represented by SEQ ID NO: 41 in addition to the above-described configuration. It may be amplified using a 15th primer set.

  In order to solve the above-described problem, the genetic marker according to the present invention is a combination of a primer having the base sequence shown in SEQ ID NO: 42 and a primer having the base sequence shown in SEQ ID NO: 43 in addition to the above configuration. It may be amplified using a 16th primer set.

  Moreover, in order to solve the said subject, the genetic marker concerning this invention may be characterized by the said genomic DNA being a 6H chromosome.

  In order to solve the above-described problems, the genetic marker according to the present invention is a DNA fragment obtained by digesting a gramineous plant genomic DNA with restriction enzymes MseI and EcoRI. MseI universal primer and sequence having the base sequence shown in SEQ ID NO: 19 by ligating the MseI adapter having the base sequence shown and the EcoRI adapter having the base sequence shown in SEQ ID NOs: 14 and 15 and the DNA fragment after the ligation Preliminary amplification was performed using an EcoRI universal primer having the base sequence shown in No. 18, and the preliminary amplification fragment obtained by the preliminary amplification was further added to a primer having the base sequence shown in SEQ ID No. 44, and SEQ ID No. 45. The base sequence shown Seventeenth primer set is a combination of a primer that or may be amplified using.

  In order to solve the above problems, the genetic marker according to the present invention is a combination of a primer having the base sequence shown in SEQ ID NO: 46 and a primer having the base sequence shown in SEQ ID NO: 47 in addition to the above-described configuration. It may be amplified using a certain eighteenth primer set.

  The above-described genetic marker according to the present invention is present in the genomic DNA of gramineous plants, in particular, wheat (barley), and is linked to a head blight resistance factor (for example, a locus involved in head blight resistance). is doing. In other words, there is a low probability that recombination will occur between the genetic marker and the locus responsible for head blight resistance. Therefore, by using the above genetic marker, obtaining a DNA fragment containing a head blight resistance factor (for example, a gene involved in head blight resistance), determining the presence or absence of head blight resistance, head blight resistance It is possible to determine grasses (barley and other wheat).

  On the other hand, the method for isolating a DNA fragment according to the present invention includes a step of isolating a target DNA fragment using any of the genetic markers according to the present invention. Since the above genetic marker is linked to a head blight resistance factor (for example, a gene locus involved in head blight resistance), the target DNA fragment can be easily obtained by cloning the DNA as a target. It becomes possible to isolate.

  On the other hand, in the method for producing a head blight-resistant plant according to the present invention, the DNA fragment containing the head blight resistance factor obtained by the method for isolating a DNA fragment according to the present invention is used as a plant genomic DNA. It is characterized by including the process of introducing.

  In the method for producing a head blight-resistant plant according to the present invention, the plant may be a grass family plant.

  In the method for producing a head blight-resistant plant according to the present invention, the gramineous plant may be a wheat.

  Further, in the method for producing a head blight-resistant plant according to the present invention, the wheat may be barley.

  One of the above methods for producing a head blight-resistant plant is a method for producing a DNA fragment containing the above-mentioned head blight resistance factor (for example, a locus involved in head blight resistance) from a plant (for example, a Gramineae plant (barley). In the genomic DNA of wheat (including wheat))). A DNA fragment containing a resistance factor for head blight (for example, a locus involved in head blight resistance) has a characteristic of conferring resistance to head blight, so that it is a plant susceptible to head blight. It is possible to impart resistance to (for example, a grass family plant (wheat including barley)) or enhance resistance.

  On the other hand, a head blight resistant plant according to the present invention is a head blight resistant plant obtained by any one of the above methods for producing a head blight resistant plant according to the present invention.

  The Fusarium head blight-resistant plant according to the present invention is a plant obtained by the production method of the Fusarium head blight-resistant plant (for example, Gramineae plant (barley including barley)). Therefore, it is possible to prevent diseases caused by red mold, and it is possible to improve the yield and quality of the plant (for example, gramineous plants (barley including barley)).

  On the other hand, the method for determining a head blight-resistant plant according to the present invention includes a step of detecting any of the above-described genetic markers according to the present invention.

  The genetic marker according to the present invention is linked to a Fusarium head blight resistance factor (for example, a locus involved in Fusarium head blight resistance), and a plant to be tested is detected by detecting the genetic marker. (For example, grass family (barley and other wheat)) is easily and with a high probability to determine whether the plant is resistant to head blight (for example, grass family (barley and other wheat)). be able to. Moreover, since the said determination method can be determined in the seedling stage, it can perform a quick determination without putting effort.

  On the other hand, the determination kit for head blight-resistant plants according to the present invention is used for carrying out the above method for determining a head blight-resistant plant.

  By making a reagent and an enzyme necessary for carrying out the above-described method for determining a head blight-resistant plant as a kit, a kit for determining a head blight-resistant plant can be constructed. Therefore, according to the determination kit for head blight-resistant plants, there is an effect that it is possible to more easily determine (discriminate) a head blight-resistant plant.

  On the other hand, the gene detection instrument according to the present invention is characterized in that at least one of the genetic markers according to the present invention is fixed.

  It is possible to easily and simultaneously detect a plurality of genetic markers according to the present invention by reacting a probe prepared from a plant to be tested with the gene detection instrument according to the present invention and detecting a signal emitted at that time. Is possible. Therefore, the gene detection instrument can be used as a means for detecting a polymorphism of a genetic marker according to the present invention, and for example, it is possible to easily determine a head blight-resistant plant (for example, Gramineae). There is an effect.

  On the other hand, the primer group according to the present invention is a primer group used for detecting the genetic marker according to the present invention, and the nucleotide sequence represented by any one of SEQ ID NOs: 1 to 7 and SEQ ID NOs: 20 to 47 is used. It is characterized by including at least 2 or more primers among the primers.

  According to the primer set according to the present invention, the genetic marker according to the present invention can be amplified by an amplification reaction such as PCR. Therefore, by detecting the polymorphism of the genetic marker according to the present invention, it is possible to easily determine, for example, a head blight resistant plant (Poaceae plant).

  According to the genetic marker linked to the head blight resistance factor and its use according to the present invention, a DNA fragment containing the head blight resistance factor can be isolated. Therefore, by using the DNA fragment, it is possible to elucidate a gene involved in resistance to head blight of barley, a mechanism of head blight resistance, and the like.

  Further, according to the present invention, plants having resistance to head blight (such as grasses (for example, barley including barley)) or plants having higher resistance to head blight (for example, barley) It is possible to produce wheat such as wheat). Therefore, there is an effect that it is possible to reduce the yield of barley, such as barley, which is important as an edible crop, and to reduce damages such as a decline in barley yield and quality.

  In addition, since the genetic marker according to the present invention is linked to a head blight resistance factor, it is possible to breed a head blight resistant gramineous plant (barley and other wheat) using the genetic marker as an index. Therefore, there is an effect that efficient breeding of head blight-resistant gramineous plants can be realized. More specifically, since the target individual can be selected at the seedling stage, there is no need to select the target individual after actually evaluating the resistance to head blight of the plant individual, and the breeding period can be shortened. In addition, since a plurality of gene loci can be selected at the same time, the target genotype can be surely obtained rather than selecting by observation. In addition, the labor force and the field area can be reduced.

  Furthermore, if selective breeding is performed using the genetic marker according to the present invention as an index, the influence on the phenotype by the cultivation environment factor can be eliminated. Therefore, there is an effect that reliable selection of useful genes (locus) can be achieved.

  Other objects, features, and advantages of the present invention will be fully understood from the following description. The benefits of the present invention will become apparent from the following description.

[Embodiment 1]
An embodiment of the present invention will be described below with reference to FIGS. 1 to 7, but the present invention is not limited to this.

  The present invention relates to genetic markers (eg, DNA markers) linked to head blight resistance factors and examples of their use. Each will be described below.

[1. Genetic marker according to the present invention]
The genetic marker according to the present invention is present in the genomic DNA of a grass family (wheat (eg, barley)) and is linked to a head blight resistance factor.

  In the present invention, wheat refers to, for example, barley, wheat, rye, triticale and the like.

<1-1. Fusarium head blight and head blight resistance factor>
“Red mold” is a disease caused by infection of wheat with Fusarium fungi as described above. The red mold disease is a serious disease that not only causes poor ripening and decreased yield, but also produces mold toxins (for example, deoxynivalenol) and causes toxic symptoms when the diseased wheat is used for food and feed.

  There are varieties of barley that are resistant to such head blight. The detailed mechanism of head blight resistance has not been clarified, but previous studies have suggested the involvement of traits such as streak, head length, heading time, and intercob length. In addition, barley is considered to have no immune resistance against head blight, and it is said that a relatively small number of genes are quantitative traits involved in the resistance. Thus, in the present invention, a gene having a characteristic of imparting resistance to head blight disease, or a gene locus involved in head blight resistance in barley genomic DNA is referred to as “head blight resistance factor”. "

  As a means for searching for a head blight resistance factor, QTL analysis is suitable. As described above, the inventors have performed QTL analysis on the resistance to head blight of barley in order to search for the head blight resistance factor. Specifically, it is as follows. The material used is a recombinant inbred line (RI line) bred from a cross between barley varieties Russia 6 (Nijo, resistant) and HES4 (Six, susceptible) with greatly different resistance to head blight. . Moreover, the evaluation method of head blight resistance is evaluated by a score of 0 (resistance) to 10 (susceptibility) obtained by modifying the “cut ear test method” (see Non-Patent Document 4). In addition, simple interval mapping (SIM) and composite interval mapping (CIM) are used as analysis algorithms, and MAPMKER / QTL and QTL Cartographer are used as analysis software, respectively.

  As a result of the QTL analysis, two QTLs for resistance to head blight were detected on the 2H chromosome of barley and one on the 5H chromosome. One of the QTLs detected on the 2H chromosome of barley coincided with the position of the known striatal gene (vrs1), suggesting the possibility of pleiotropic expression of the vrs1 gene. This result is a result that supports the involvement of streak in resistance to head blight. However, the Fusarium head blight resistance factor that would be present at a locus other than QTL where the vrs1 gene is present is unknown, and it is considered that the Fusarium head blight resistance factor other than the streak gene exists. . Here, the Fusarium head blight resistance factor present on the 2H chromosome of barley and located at a locus different from the location of the vrs1 gene is named “2H-2 factor”, and it sits on the 5H chromosome of barley. Is named “5H-1 factor”. In addition, the head blight resistance factor which exists on the 2H chromosome of a barley and corresponds with the position of the vrs1 gene is called "2H-1 factor" for convenience.

<1-2. Genetic marker>
Based on the information of the high-density linkage map created by the inventors, a genetic marker located in the vicinity of the locus of resistance to head blight resistance factors 2H-2 and 5H-1 is searched. The inventors have found a genetic marker that is strongly linked to a resistance factor, that is, a genetic marker according to the present invention. The genetic markers were cloned into STS, and primers for amplifying each genetic marker were designed from the information.

  More specifically, MM314 and FM677 were discovered as genetic markers linked to the 2H-2 factor.

  MM314 is a template of barley genomic DNA using a first primer set that is a combination of a primer having the base sequence shown by AGAGATCCCTGTCCAGCCTTG (SEQ ID NO: 1) and a primer having the base sequence shown by TCGTATAAGGCCGCATAGG (SEQ ID NO: 2) Is a genetic marker that is amplified as follows: It is located at a distance of about 0 centmorgan (hereinafter referred to as cM) from 2H-2 factor, that is, sits at a position almost overlapping with 2H-2 factor. is there.

  Moreover, FM677 uses a second primer set, which is a combination of a primer having the base sequence shown in GCACGTTAGCGTTCAACATCA (SEQ ID NO: 3) and a primer having the base sequence shown in AACTTTCCCAACCCTTTCC (SEQ ID NO: 4), to the barley genomic DNA. A genetic marker that is amplified as a template and sits at a distance of about 0.6 cM from 2H-2 factor.

  Further, FM677 amplified using the second primer set has a resistance type and a susceptibility type to red mold disease, and the respective base sequences are those shown in SEQ ID NO: 8 and SEQ ID NO: 9. It is.

  On the other hand, FM426 and MM1057 were discovered as genetic markers linked to 5H-1 factor.

  FM426 is a third primer set that is a combination of a primer having the base sequence shown by CCGTGGTTCTCTAGGGTCAA (SEQ ID NO: 5) and a primer having the base sequence shown by CAACTTTGGTGGACGTAGGG (SEQ ID NO: 6), or CCGTGTGTCGTCTAGGTCAA (SEQ ID NO: 5) A genetic marker that is amplified using barley genomic DNA as a template using a fourth primer set that is a combination of a primer having the nucleotide sequence shown and a primer having the nucleotide sequence shown in GTTTTCGCCATCACTCTTCC (SEQ ID NO: 7). It sits at a distance of about 9 cM from one factor.

  In addition, FM426 amplified using the third primer set has a resistance type and a susceptibility type against head blight, and the respective base sequences are those shown in SEQ ID NO: 10 and SEQ ID NO: 11. It is.

  In addition, FM426 amplified using the fourth primer set has a resistance type and a susceptibility type against head blight, and the respective base sequences are those shown in SEQ ID NO: 12 and SEQ ID NO: 13. It is.

  MM1057 sits at a distance of about 2.2 cM from the 5H-1 factor.

  FIG. 1 shows the positional relationship between the genetic marker and the head blight resistance factor (factor 2H-2, factor 5H-1). FIG. 1A shows the positional relationship between the genetic marker on the 2H chromosome and the 2H-2 factor, and FIG. 1B shows the positional relationship between the genetic marker on the 5H chromosome and the 5H-1 factor. In the figure, the left side shows the short arm (5 'end) on the chromosome, and the right side shows the long arm (3' end). Further, the position of the genetic marker on the short arm side from the locus of 2H-2 factor or 5H-1 factor is indicated by a negative value, and the position of the genetic marker on the long arm side is indicated by a positive value.

  According to FIG. 1 (a), MM314 sits at a position (approximately 0 cM) almost overlapping with 2H-2 factor, and FM677 sits at a position of about 0.6 cM on the long arm side with respect to 2H-2 factor. You can see that On the other hand, according to FIG. 1 (b), FM426 sits at a position of about 9 cM (about -9 cM) on the short arm side with respect to 5H-1 factor, and MM1057 has a position on the long arm side with respect to 5H-1 factor. It can be seen that it is seated at a position of 2.2 cM.

  Here, Morgan (M) will be described. One Morgan (M) is a unit of distance on the chromosome that causes an average of one crossing per meiosis. For example, 2.2 cM indicates that an average of 22/1000 crossovers per chromatid occurs between the head blight resistance factor and the genetic marker. That is, at this time, the recombination rate is about 2.2%.

  By the way, genomic DNA used as a template in amplification can be extracted from a barley plant by a conventionally known method. Specifically, a general method for extracting genomic DNA from a plant body (see, for example, Murray, M.G. and W.F.Thompson (1980) Nucleic Acids Res. 8: 4321-4325.) Is a suitable example. The genomic DNA can be extracted using any tissue that constitutes a barley plant such as roots, stems, leaves, and reproductive organs. In some cases, it may be extracted from barley callus. The reproductive organs include flower organs (including male and female reproductive organs) and seeds. Extraction of genomic DNA is performed using, for example, leaves of the barley seedling stage. This is because the tissue is relatively easy to grind, the mixing ratio of impurities such as polysaccharides is relatively small, and can be grown from seeds in a short period of time.

  A conventionally known DNA amplification method can be employed as a method for amplification using barley genomic DNA as a template and the combination of the above primers. In general, a PCR method (polymerase chain reaction method) or a modified method thereof is used. Reaction conditions when using the PCR method or its modification method are not particularly limited, and amplification can be performed under the same conditions as usual.

  By using the genetic marker according to the present invention, it becomes possible to isolate a DNA fragment containing a head blight resistance factor (2H-2 factor, 5H-1 factor). By using the DNA fragment, barley can be isolated. It can be used to elucidate genes involved in resistance to head blight of rice and the mechanism of head blight resistance. In addition, by introducing the above DNA fragment into the genomic DNA of a plant (for example, barley and other wheat), it is possible to produce (breeding) a head blight-resistant plant (for example, barley and other wheat). Become.

  Moreover, since the genetic marker is linked to the head blight resistance factor (2H-2 factor, 5H-1 factor), it is present in the genomic DNA of the plant to be tested (for example, wheat such as barley). By detecting the polymorphism of the genetic marker, it is possible to determine whether or not the plant (for example, wheat such as barley) has a head blight resistance factor. Similarly, since it is linked to a head blight resistance factor (2H-2 factor, 5H-1 factor), the genetic marker in the genomic DNA of a plant to be tested (for example, barley and other wheat). By detecting the polymorphism, it is possible to determine whether or not the plant (for example, barley and other wheat) is a head blight resistant plant (for example, barley and other wheat). . Moreover, if a primer capable of amplifying the genetic marker or a DNA microarray to which the genetic marker is immobilized is made into a kit, a kit for determining the presence or absence of a head blight resistance factor in plants (for example, barley and other wheat). It is possible to provide a kit for determining head blight-resistant plants (for example, barley and other wheat).

As described above, it is obvious that the genetic marker according to the present invention can be used for various purposes. An example of the use of the genetic marker according to the present invention described above will be described in detail later.
[2. Use of genetic markers according to the present invention]
<2-1. Method for Isolating DNA Fragment Containing Fusarium Head Blight Resistance Factor According to the Present Invention>
As described above, the genetic marker (MM314, FM677) according to the present invention is linked to 2H-2 factor among the head blight resistance factors. On the other hand, the genetic markers (FM426, MM1057) according to the present invention are linked to 5H-1 factor among the head blight resistance factors. Therefore, DNA fragments containing 2H-2 factor can be isolated by using genetic markers of MM314 and FM677, and DNA fragments containing 5H-1 factor can be isolated by using genetic markers of FM426 and MM1057. be able to.

  The method for isolating a DNA fragment containing a head blight resistance factor using the genetic marker of the present invention is not particularly limited, and examples thereof include the following method.

  One kind of BAC library of genomic DNA has been created in barley, and a plurality of BAC libraries are currently under development. Therefore, using such a BAC library, according to a conventionally known map-based cloning method, a BAC clone containing the marker is identified by the Fusarium head blight resistance factor and the genetic marker of the present invention linked to the factor. Then, a BAC contig is prepared from the base sequence to determine the base sequence, thereby finally reaching the head blight resistance factor.

  When isolating a DNA fragment containing a head blight resistance factor including the above method, select a genetic marker that sits as close as possible to the target head blight resistance factor. It is preferable to use it. This is because the probability that recombination occurs between the desired head blight resistance factor and the genetic marker is lower, and the head blight resistance factor can be isolated more reliably. For example, when 2H-2 factor is isolated using MM314 (distance from 2H-2 factor: about 0 cM), FM677 (distance from 2H-2 factor: about 0.6 cM), MM314 is better than FM677. It can be said that it is more suitable. Further, when 5H-1 factor is isolated using FM426 (distance from 5H-1 factor: about 9 cM) and MM1057 (distance from 5H-1 factor: about 2.2 cM), MM1057 is better than FM426. It can be said that it is preferable.

<2-2. A method for producing a Fusarium head blight-resistant plant according to the present invention (for example, Gramineae (barley and other wheat)), and a head blight-resistant plant obtained by the production method (for example, Gramineae plant ( Barley and other wheat)) ＞
By introducing the DNA fragment containing the Fusarium head blight resistance factor obtained by the method for isolating the DNA fragment comprising the Fusarium head blight resistance factor according to the present invention into the genomic DNA of the plant, the Fusarium head blight resistance plant It is possible to produce. In particular, by introducing the above DNA fragment into the genomic DNA of a gramineous plant, it is possible to produce a Fusarium head blight resistant gramineous plant. Furthermore, it is possible to produce barley-resistant barley by introducing the above DNA fragment into the genomic DNA of barley.

  More specifically, red mold is introduced by introducing into the genomic DNA of plants (for example, Gramineae plants (barley and other wheat)) using a known method (for example, the Agrobacterium method or the particle gun method). What is necessary is just to produce a disease resistant plant. Thereby, a head blight resistant variety will be obtained. For example, the journal The Plant Journal (1997) 11 (6), 1369-1376 discloses a method for transforming barley using Agrobacterium tumefaciens by Sonia Tingay et al. Can produce barley.

  In addition to barley, a plant into which a DNA fragment containing a head blight resistance factor is introduced is not particularly limited. For example, edible crops, horticultural crops including fruits and vegetables, flowers / trees and other effective trees , Industrial crops, and fertilizer crops. As for the specific crops included in the above-mentioned food crops, horticultural crops, craft crops, and fertilizer crops, for example, the table of contents of the Agricultural University Dictionary 4th edition (Yokendo, issued April 30, 1997) It is also described in detail on pages 8-16. Red mold disease is a problem particularly in plants of wheat (barley, wheat, rye, triticale, etc.), and it is more effective to apply the present invention to such plants.

  Further, the head blight resistance factor to be introduced into a plant (for example, Gramineae plant (barley and other wheat)) is either a DNA fragment containing 2H-2 factor or a DNA fragment containing 5H-1 factor. On the other hand, it is possible to produce a head blight-resistant plant (for example, Gramineae plants (barley and other wheat)), but both DNA fragments (DNA fragments containing 2H-2 factor) When 5H-1 factor-containing DNA fragment) is introduced into the genomic DNA of the same plant (for example, Gramineae (barley and other wheat)), resistance to head blight is further improved. This is more preferable.

  In addition to 2H-2 factor, Fusarium head blight resistance factor 2H-1 factor present on the 2H chromosome (Redhead blight resistance factor consistent with the locus of streak gene vrs1) includes the 2H-2 factor. When introduced into a plant into which a DNA fragment or a DNA fragment containing 5H-1 factor is independently introduced (for example, wheat such as barley), the resistance to head blight is improved as compared with the case of introduction alone. Furthermore, even if the 2H-1 factor is introduced into a plant into which both the DNA fragment containing the 2H-2 factor and the DNA fragment containing the 5H-1 factor have been introduced (for example, wheat such as barley). Fusarium head blight resistance is further improved as compared with the case of introducing two head blight resistance factors.

  The inventors of the present invention have an effect on the head blight resistance of barley when the DNA fragment containing either the DNA fragment containing 2H-2 factor or the DNA fragment containing 5H-1 factor alone is introduced, and both DNAs It is calculated and compared using the analysis software (MAPMAKER / QTL and QTL Cartographer) when the fragment is introduced and when the above three head blight resistance factors are introduced. Table 1 below shows an example of the results of analysis using MAPMAKER / QTL.

Table 1 shows the effect of improving the resistance to head blight of barley when either a DNA fragment containing 2H-2 factor or a DNA fragment containing 5H-1 factor alone is introduced, and both DNAs When a fragment is introduced, it is shown. Furthermore, the resistance to head blight of barley when a DNA fragment containing 2H-1 factor, a DNA fragment containing 2H-2 factor, or a DNA fragment containing 5H-1 factor alone is introduced. The improvement effect is shown when all three DNA fragments are introduced.

  From the results of Table 1, the effect of improving the resistance to head blight of barley when the DNA fragment containing 2H-2 factor alone was introduced was 1.8076, and any of the DNA fragments containing 5H-1 factor When one of these DNA fragments was introduced alone, the effect of improving the head blight resistance of barley was 1.1733, whereas when both DNA fragments were introduced, it was clearly 2.7338. It can be seen that a cumulative effect is seen. Furthermore, it is found that resistance to head blight resistance is significantly improved by adding 2H-1 factor and introducing a DNA fragment containing three head blight resistance factors (introduction of a DNA fragment containing 2H-1 factor alone). In the case of introduction of a single DNA fragment containing 1.3234, 2H-2 factor, 1.5319 in the case of single introduction of a DNA fragment containing 1.5319, 5H-1, and in the case of introduction of a DNA fragment containing the above three factors. 6759). In addition, it shows that the said effect is so large that the value of the "effect which improves a head blight resistance" in Table 1 is large.

  According to the head blight-resistant barley of the present invention, which is obtained by the above-described method, according to the head blight-resistant plant, the quality / harvest amount has been reduced due to head blight, and the plant has been infected with head blight. It is possible to effectively avoid harm to human bodies and livestock by eating food, which is extremely effective for agriculture and livestock industry. It can also improve the food shortage problem.

  In addition, the above-mentioned “Red mold resistant plant”, “Red mold resistant gramineous plant” and “Red mold resistant barley” are plants that did not have resistance at all to Fusarium mold ( For example, plants produced by imparting resistance to head blight (for example, barley and other barleys), and grasses originally produced by barley (barley and other barleys). Plants produced by further enhancing resistance to head blight (for example, grasses such as barley) such as plants that are resistant to mold (for example, grasses (barley and other wheat)). It includes wheat))).

<2-3. Detection method of genetic marker linked to head blight resistance factor according to the present invention>
As described above, the present inventors have found a genetic marker linked to a head blight resistance factor and designed primers for amplification of the genetic marker.

  Specifically, MM314 uses a first primer set that is a combination of a primer having a base sequence shown by AGAGATCCCCTGCTCAGCTTG (SEQ ID NO: 1) and a primer having a base sequence shown by TCGTATAAGGCCGCATAGGG (SEQ ID NO: 2). It is a genetic marker that is amplified using barley genomic DNA as a template. The genetic marker is linked to the 2H-2 factor.

  Moreover, FM677 uses a second primer set, which is a combination of a primer having the base sequence shown in GCACGTTAGCGTTCAACATCA (SEQ ID NO: 3) and a primer having the base sequence shown in AACTTTCCCAACCCTTTCC (SEQ ID NO: 4), to the barley genomic DNA. It is a genetic marker that is amplified as a template. The genetic marker is linked to the 2H-2 factor.

  FM426 is a third primer set which is a combination of a primer having the base sequence shown by CCGTGTGTCTCTAGGTCAA (SEQ ID NO: 5) and a primer having the base sequence shown by CAACTTTGGTGGACGTAGGG (SEQ ID NO: 6), or CCGTGTGTCGTCTAGGTCAA (SEQ ID NO: 5) A genetic marker that is amplified using barley genomic DNA as a template using a fourth primer set that is a combination of a primer having the base sequence shown in FIG. 5 and a primer having the base sequence shown in GTTTTCGCCATCACTCTTCC (SEQ ID NO: 7). The genetic marker is linked to the 5H-1 factor.

  Therefore, a genetic marker linked to the head blight resistance factor (2H-2 factor or 5H-1 factor) is detected by performing an amplification reaction using any of the first primer set to the fourth primer set. Can do. In particular, MM314 linked to 2H-2 factor can be detected by using the first primer set, and FM677 linked to 2H-2 factor can be detected by using the second primer set. Further, FM426 linked to 5H-1 factor can be detected by using the third primer set or the fourth primer set.

  Therefore, the primer set can detect any of the genetic markers by using at least one of the four sets, but uses the first primer set and / or the second primer set, and the third It is more preferable to use the primer set and / or the fourth primer set because both 2H-2 factor and 5H-1 factor can be detected.

  By detecting a genetic marker linked to the above-mentioned head blight resistance factor, it is possible to determine the presence or absence of a head blight resistance factor and to determine a head blight resistance plant as described below. The specific method for detecting a genetic marker linked to the above-mentioned head blight resistance factor is “a method for determining the presence or absence of a head blight resistance factor according to the present invention” and “a method for determining a head blight resistance plant”. Will be explained together.

(2-3-1. Method for Determining Presence or Absence of Fusarium Head Blight Resistance Factor According to the Invention)
The method for determining the presence or absence of a head blight resistance factor according to the present invention (hereinafter referred to as “the current resistance factor determination method” as appropriate) is a genetic marker linked to the above-mentioned head blight resistance factor according to the present invention (MM314, FM677, FM426, MM1057), and detecting the polymorphism of at least one genetic marker. Since such a genetic marker is linked to a head blight resistance factor, if there is a head blight resistance type genetic marker in the genomic DNA of a plant to be tested (for example, barley and other wheat), It is possible to determine with high probability whether a target plant (for example, wheat such as barley) has a head blight resistance factor. Here, the presence of 2H-2 factor can be determined by detecting the polymorphism of MM314 or FM677, and the 5H-1 factor can be detected by detecting the polymorphism of FM426 or MM1057. Needless to say.

  This resistance factor determination method may be performed on conventional barley, or may be performed on a barley that has been mutated with a drug or the like, or on a barley (plant) bred by crossing. Further, it can be applied to barley and plants into which a DNA fragment containing the Fusarium head blight resistance factor (2H-2 factor, 5H-1 factor) explained in 2-2 is introduced. Therefore, this resistance factor determination method can be widely applied to plants (for example, barley and other wheat).

  Here, the accuracy (probability) of the determination by this resistance factor determination method is as follows. A genetic marker located at a distance of 2.2 cM from the mildew resistance factor causes an average of 22/1000 crossovers per chromatid between the red mold resistance factor and the genetic marker. That is, recombination occurs with a probability of about 2.2%. Therefore, if a genetic marker of resistance to head blight is detected among these genetic markers, it can be said that it has a head blight resistance factor with a probability of 97.8%. Therefore, it can be said that the closer the distance between the Fusarium head blight resistance factor and the genetic marker, the higher the probability that the presence or absence of the Fusarium head blight resistance factor can be determined.

  Therefore, for any of the above genetic markers for detecting polymorphism, it is possible to determine the presence or absence of a mildew resistance factor in any of the above genetic markers. It is preferable to detect a genetic marker that sits in the vicinity as much as possible. That is, when 2H-2 factor is detected in this resistance factor determination method, MM314 (distance from 2H-2 factor: about 0 cM) is better than FM677 (distance from 2H-2 factor: about 0.6 cM). It can be said that it is preferable. In particular, since MM314 substantially matches the 2H-2 factor, it can be determined with a probability of almost 100% if a polymorphism of the genetic marker is detected. When detecting 5H-1 factor, it can be said that MM1057 (distance from 5H-1 factor: about 2.2 cM) is more suitable than FM426 (distance from 5H-1 factor: about 9 cM).

  In the present detection method, polymorphisms of a plurality of genetic markers may be detected. In particular, in order to improve the accuracy (probability) of the determination, it is only necessary to detect a polymorphism by selecting a genetic marker that has a relationship between the mildew resistance factors. Here, there are MM314 and FM677 as a combination of genetic markers having a relationship between 2H-2 factors (see FIG. 1A). On the other hand, there are FM426 and MM1057 as a combination of genetic markers having a relationship between 5H-1 factors (see FIG. 1B).

  Using FM426 and MM1057 as examples, the accuracy (probability) of the resistance factor determination method in the case where the polymorphisms of the genetic markers are detected alone and in the case where both of the polymorphisms are detected will be described more specifically. To do. FM426 sits at a position of about 9 cM on the short arm side from 5H-1 factor, and the accuracy (probability) of this determination method when the polymorphism of the genetic marker is detected alone is (1-90). ÷ 1000) × 100 = about 91%. On the other hand, MM1057 sits at a position of about 2.2 cM on the long arm side from the 5H-1 factor, and the accuracy of the present resistance factor determination method when the polymorphism of the genetic marker is detected alone. When (probability) is calculated in the same manner, it is 97.8%. When both polymorphisms of the two genetic markers are detected, (1− (90 ÷ 1000) × (22 ÷ 1000)) × 100 = 99.802%, and the presence / absence of 5H-1 is determined with a high probability. Can do. Therefore, it is preferable to detect and determine a genetic marker having a relationship sandwiching the above-mentioned head blight resistance factor in this resistance factor determination method.

  Here, in the present resistance factor determination method, a conventionally known DNA amplification method can be employed for detection of a genetic marker. In general, a PCR method (polymerase chain reaction method) or a modified method thereof is used. Reaction conditions when using the PCR method or its modification method are not particularly limited, and amplification can be performed under the same conditions as usual. Determine whether the test target plant (for example, barley and other wheat) has a head blight resistance factor by determining whether the genetic marker obtained by the amplification reaction is resistant or susceptible It can be done.

  As described above, the genetic marker according to the present invention can be amplified by a combination of the following primers.

  MM314 uses genomic DNA as a template by using a first primer set which is a combination of a primer having a base sequence shown by AGAGATCCCTGTCCAGCCTTG (SEQ ID NO: 1) and a primer having a base sequence shown by TCGTATAAGGCCGCATAGG (SEQ ID NO: 2) Can be amplified.

  FM677 is a template of genomic DNA using a second primer set that is a combination of a primer having the base sequence shown by GCACGTAGCGTTCAACATCA (SEQ ID NO: 3) and a primer having the base sequence shown by AACTTTCCCAACCCTTTCC (SEQ ID NO: 4). Can be amplified as

  FM426 is a third primer set which is a combination of a primer having the base sequence shown by CCGTGTGTCTCTAGGTCAA (SEQ ID NO: 5) and a primer having the base sequence shown by CAACTTTGGTGGACGTAGGG (SEQ ID NO: 6), or CCGTGTGTCGTCTAGGTCAA (SEQ ID NO: 5) A barley genomic DNA can be amplified using a fourth primer set which is a combination of a primer having the base sequence shown in (2) and a primer having the base sequence shown in GTTTTCGCCATCACTCTTCC (SEQ ID NO: 7).

  Table 2 below shows the lengths of DNA fragments (amplified fragment sizes) amplified by the amplification reaction using the above primer combinations.

The DNA fragments amplified by the combination of the above-mentioned primers include the resistance type (polymorphism) amplified when using Fusarium head blight-resistant barley varieties such as Russia6 and Harbin2 as templates, and head blight. There is a (susceptible type) (polymorphism) that is amplified when the susceptible barley varieties HES4, Turkey6, etc. are used as templates. If a resistance-type genetic marker (MM314, FM677, FM426, MM1057) is detected in this resistance factor determination method, the test target plant (for example, Gramineae plant (barley and other wheat)) is red mold. It can be judged that it has a disease resistance factor. On the other hand, if a susceptibility type genetic marker (MM314, FM677, FM426, MM1057) is detected, the plant to be tested (for example, Gramineae plants (barley including barley)) has a mildew resistance factor. It can be determined not to.

  Here, as for the case where MM314 has a difference in amplified fragment size as in the case of MM314, by comparing the fragment size using agarose gel electrophoresis or the like, the amplified M314 is resistant or diseased. It is possible to easily determine whether it is a sex type. That is, when an amplified fragment of> 524 bp is confirmed, it can be seen that the resistant MM314 has been amplified, and the plant to be tested (for example, Gramineae plant (barley and other wheat)) is red mold. It can be judged that it has a disease resistance factor. On the other hand, when an amplified fragment of> 581 bp was confirmed, it was found that the susceptible MM314 was amplified, and the plant to be tested (for example, Gramineae (barley and other wheat)) was red mold. It can be determined that there is no disease resistance factor. This will be further described in Example 2 described later.

  However, for FM677 and FM426, as shown in Table 2, there is no difference in the size of the amplified fragment. Therefore, agarose gel electrophoresis or the like can easily determine whether the amplified genetic marker is resistant or susceptible. Have difficulty. In this case, it may be determined by sequencing the amplified fragment and confirming whether it is a resistant type or a susceptible type from the base sequence information. Alternatively, it may be determined whether the amplified fragment is resistant or susceptible from the restriction enzyme site information of the genetic marker.

  A method for determining whether the amplified fragment is resistant or susceptible using the above base sequence information and restriction enzyme site information will be specifically described with reference to FIG. 2A shows the entire nucleotide sequence (SEQ ID NO: 8) of the resistant type (Harbin2) FM677, and FIG. 2B shows the entire nucleotide sequence (SEQ ID NO: 9) of the susceptible type (Turkey 6) FM677. ). FIG. 2 (c) shows the entire nucleotide sequence (SEQ ID NO: 10) of the resistant type (Russia 6) FM426, and FIG. 2 (d) shows the entire nucleotide sequence (sequence) of the susceptible type (HES4) FM426. Number 11). 2 (a) and 2 (b), the underlined portion indicates the setting portion of the sense primer (SEQ ID NO: 3), and the double underlined portion indicates the setting portion of the antisense primer (complementary sequence of SEQ ID NO: 4). Yes. On the other hand, the underlined portion in FIGS. 2 (c) and 2 (d) indicates the sense primer (SEQ ID NO: 5) setting portion, and the double underline indicates the antisense primer (complementary sequence of SEQ ID NO: 6) setting portion. The underlined portion also shows the antisense primer (complementary sequence of SEQ ID NO: 7) setting sequence. The bases indicated by the boxed characters in FIGS. 2A to 2D indicate portions where the base sequences differ between the resistant type and the susceptible type. Therefore, if the amplified fragment obtained by the amplification reaction is sequenced, it can be determined whether the amplified fragment is resistant or susceptible.

  2 (b) shows the recognition sequence of the restriction enzyme AluI, the broken line portion in FIG. 2 (c) shows the recognition sequence of the restriction enzyme HhaI, and the broken line portion in FIG. 2 (d) is the restriction sequence. The recognition sequence of the enzyme AciI is shown. 2 (b) indicates the cleavage site of the restriction enzyme AluI, the location indicated by the arrow in FIG. 2 (c) indicates the cleavage site of the restriction enzyme HhaI, and is indicated by the arrow in FIG. 2 (d). The location indicates the cleavage site of the restriction enzyme AciI. Therefore, it can be seen that the resistant type FM677 has no AluI site, and the susceptible type FM677 has one AluI site. On the other hand, it can be seen that the resistant type FM426 has one HhaI site, and the susceptible type FM426 has one AciI site.

  Based on this information, the amplified fragment obtained by the amplification reaction using the second primer set shown in SEQ ID NO: 3 and SEQ ID NO: 4, ie, the amplification reaction performed to detect FM677, was digested with AluI. At this time, if only the 208 bp fragment is detected without being cleaved, it can be determined that it is a resistant type FM677, and if it is cleaved at one site and the 118 bp and 90 bp fragments are detected, it is determined that it is a susceptible type FM677. can do.

  On the other hand, when the amplification fragment (335 bp) obtained by the amplification reaction using the third primer set shown in SEQ ID NO: 5 and SEQ ID NO: 6, that is, the amplification reaction performed to detect FM426, was digested with HhaI, If a fragment of 194 bp and 141 bp is detected after cleavage at a site, it can be determined that it is a resistant type of FM426, and if only a 335 bp fragment is detected without being cut, it can be determined that it is a susceptible type of FM426. .

  Conversely, if the amplified fragment obtained in the same amplification reaction is not cleaved when digested with AciI and only a 335 bp fragment is detected, it can be determined that it is a resistant type of FM426, and it is cleaved at one place and 196 bp and 139 bp. Is detected, it can be determined that it is a susceptible type of FM426.

  FM426 can also be detected using an amplification reaction using the fourth primer set shown in SEQ ID NO: 5 and SEQ ID NO: 7. When the amplified fragment (254 bp) obtained by this amplification reaction was digested with HhaI and digested at one site and fragments of 194 bp and 60 bp were detected, it can be determined that it is a resistance type FM426, and 254 bp without being cleaved. If only this fragment is detected, it can be determined that it is a susceptible form of FM426.

  Conversely, if the amplified fragment obtained by the same amplification reaction is not cleaved when digested with AciI and only a 254 bp fragment is detected, it can be determined that it is a resistant type of FM426, and it is cleaved at one place and 196 bp and 58 bp. Is detected, it can be determined that it is a susceptible type of FM426.

  The above items will be described more specifically in Example 2 described later.

  Also, AFLP (Amplified Fragment Length Polymorphisms) analysis can be used as a method for detecting polymorphisms of genetic markers. Hereinafter, AFLP analysis is performed on the genetic marker MM1057 according to the present invention to detect a polymorphism of the genetic marker.

  The procedure for AFLP analysis is not particularly limited. For example, literature (Pieter Vos, Rene Hogers, Marjo Bleeker, Martin Reijans, Theo van de Lee, Miranda Hornes, Adrie Frijters, Jerina Pot, Johan Peleman, Martin Kuiper and Marc Zabeau. (1995) AFLP: a new technique for DNA fingerprinting. Nucleic Asids Research. 23: 21: 4407-4414.) Or a modification thereof. An example in which the inventors conducted AFLP analysis on the genetic marker MM1057 is shown below.

  50 ng of genomic DNA was double digested with 1.5 U of EcoRI (manufactured by Takara Bio) and MseI (manufactured by NEW ENGLAND BioLabs) for 12 hours at 37 ° C. in a total reaction system of 25 μl. 25 μM EcoRI adapter (base sequences are shown in SEQ ID NO: 14 and SEQ ID NO: 15) and 50 μM MseI adapter (base sequences are shown in SEQ ID NO: 16 and SEQ ID NO: 17) were added to 25 U T4 ligase (Takara Bio). Ligation was performed at 37 ° C. for 3 hours. The ligated DNA fragment was preamplified using an EcoRI universal primer (base sequence shown in SEQ ID NO: 18) and an MseI universal primer (base sequence shown in SEQ ID NO: 19). For the 0.06 ng / μl preamplification reaction solution, an amplification reaction was performed using an EcoRI selective primer having the nucleotide sequence shown in SEQ ID NO: 20 and an MseI selective primer having the nucleotide sequence shown in SEQ ID NO: 21. I did it. The combination of the EcoRI selective primer having the base sequence shown in SEQ ID NO: 20 and the MseI selective primer having the base sequence shown in SEQ ID NO: 21 is particularly referred to as “fifth primer set”.

  FIG. 7 shows the result of electrophoresis performed on the DNA fragment obtained by the amplification reaction. In FIG. 7, the lanes marked with “R” are the results of the AFLP analysis performed on Russia 6 which is a barley-resistant barley variety, and the lanes marked with “H” in FIG. It is a figure which shows the result of having performed the said AFLP analysis about HES4 of a disease-susceptible barley variety. For the other lanes, the results of the AFLP analysis of the recombinant inbred line (RI line) bred from the cross between Russia 6 and H.E.S.4 are shown.

  When the results of Russia 6 in FIG. 7 and the results of H.E.S. 4 were compared, a DNA fragment of about 1057 bp (indicated by the arrow in the figure) was confirmed only in Russia 6 of the barley variety resistant to barley. In other words, there are polymorphisms in varieties resistant to head blight and varieties susceptible to head blight. The genetic marker showing this polymorphism is called MM1057. Therefore, if an AFLP analysis is performed on the RI strain and a DNA fragment having a size of about 1057 bp is confirmed, it can be determined that the RI strain has a resistance factor for head blight resistance. Conversely, the DNA fragment is confirmed. Otherwise, it can be determined that the RI strain does not have the head blight resistance factor. In FIG. 7, the lanes marked with M are DNA size markers.

(2-3-2. Determination method of head blight resistant plant according to the present invention (for example, Gramineae plant (barley including barley)))
In the same manner as the method for determining the presence or absence of the head blight resistance factor according to the present invention (the current resistance factor determination method), the plant to be tested (for example, Gramineae plants (barley and other wheat)) is red. It can be determined whether or not it is resistant to mold. Plants having a head blight resistance factor (for example, Gramineae plants (wheats such as barley)) have a head blight resistance, so that the plant ( For example, it can be determined whether or not a grass plant (barley and other wheat) is a head blight resistant plant (for example, a grass family (barley and other wheat)). . In other words, a method for determining a head blight-resistant plant (for example, Gramineae plants (barley and other wheat)) by determining the presence or absence of a head blight resistance factor using this resistance factor determination method. (Hereinafter referred to as “this determination method” as appropriate).

  This determination method can be used as an effective screening means when breeding a head blight-resistant plant (for example, wheat such as barley). For example, when the method for producing head blight-resistant plants (for example, barley and other wheat) according to the present invention described in 2-2 above, a DNA fragment containing a head blight-resistant factor is introduced. The transformed plant (for example, wheat such as barley) can be easily screened from a large number of transformant candidates. It can also be used as a screening means for plants (for example, barley and other wheat) that have been subjected to breeding treatment such as mutation treatment and mating with other drugs.

  Moreover, since this different method can determine separately the presence or absence of 2H-2 factor and 5H-1 factor as demonstrated in the section of this determination method, it is the DNA fragment containing 2H-2 factor, or 5H-1 Whether it is a plant into which a DNA fragment containing a factor has been introduced independently (for example, wheat such as barley) or a plant into which both have been introduced (for example, wheat such as barley) Separately, a head blight resistant plant (for example, wheat such as barley) can be determined.

  The accuracy (probability) of this determination method is the same as that explained in the section of the resistance factor determination method. By detecting a genetic marker located in the vicinity of the head blight resistance factor (2H-2 factor, 5H-1 factor) as much as possible, the plant to be tested (for example, barley and other wheat) is resistant to head blight. This means that it can be determined with higher accuracy (probability) whether it is a sex plant (for example, barley and other wheat). Furthermore, if a genetic marker that is related to the head blight resistance factor is selected and detected, the plant to be tested (for example, barley and other wheat) can be more resistant to head blight. It can be said that it can be determined whether it is a plant (for example, wheat including barley).

<2-4. Primer group according to the present invention>
The primer group concerning this invention is a primer group used in order to detect the genetic marker concerning the said invention, Comprising: The primer which has the base sequence shown in either sequence number 1-7 and sequence number 20-47 Among them, at least two are included.

  The combination of primers included in the primer group according to the present invention is not particularly limited. For example, a primer having the base sequence shown in SEQ ID NO: 1 and a primer having the base sequence shown in SEQ ID NO: 2 A first primer set which is a combination of: a second primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 3 and a primer having the base sequence shown in SEQ ID NO: 4; a base shown in SEQ ID NO: 5 A third primer set which is a combination of a primer having a sequence and a primer having a base sequence represented by SEQ ID NO: 6; a primer having a base sequence represented by SEQ ID NO: 5 and a base sequence represented by SEQ ID NO: 7 A fourth primer set in combination with the primer; A fifth primer set which is a combination of a primer having the base sequence shown in FIG. 21 and a primer having the base sequence shown in SEQ ID NO: 21; a primer having the base sequence shown in SEQ ID NO: 22; and a base shown in SEQ ID NO: 23 A sixth primer set which is a combination of primers having a sequence; a seventh primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 24 and a primer having the base sequence shown in SEQ ID NO: 25; An eighth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 26 and a primer having the base sequence shown in SEQ ID NO: 27; a primer having the base sequence shown in SEQ ID NO: 28; Combination with a primer having a base sequence A tenth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 30 and a primer having the base sequence shown in SEQ ID NO: 31; a base sequence shown in SEQ ID NO: 32 An eleventh primer set which is a combination of a primer having a base sequence shown in SEQ ID NO: 33; a primer having a base sequence shown in SEQ ID NO: 34; and a primer having a base sequence shown in SEQ ID NO: 35 A twelfth primer set that is a combination of a primer having the base sequence shown in SEQ ID NO: 36 and a primer having a base sequence shown in SEQ ID NO: 37; A primer having the base sequence shown in SEQ ID NO: 39 A fourteenth primer set which is a combination of the primer having the base sequence shown in SEQ ID NO: 40; and the tenth primer set which is a combination of the primer having the base sequence shown in SEQ ID NO: 40 and the primer having the base sequence shown in SEQ ID NO: 41 Five primer sets; a sixteenth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 42 and a primer having the base sequence shown in SEQ ID NO: 43; a primer having the base sequence shown in SEQ ID NO: 44 A seventeenth primer set that is a combination of a primer having the base sequence represented by SEQ ID NO: 45; a primer having the base sequence represented by SEQ ID NO: 46; and a primer having the base sequence represented by SEQ ID NO: 47 Izu of the eighteenth primer set which is a combination of Kano primer set, it is preferably contained at least more than one set.

  The primer group concerning this invention is a primer group used in order to detect the genetic marker linked with a head blight resistance factor (2H-2 factor, 5H-1 factor, etc.).

  As described above, MM314 linked to 2H-2 factor can be amplified and detected by using the first primer set, and FM677 linked to 2H-2 factor can be amplified and detected by using the second primer set. be able to. Further, by using the third primer set or the fourth primer set, FM426 linked to 5H-1 factor can be amplified and detected. Moreover, MM1057 linked to 5H-1 factor can be detected by using the fifth primer set. Genetic markers that can be detected using the sixth primer set to the eighteenth primer set will be described later in [Embodiment 2].

  Therefore, if the primer group according to the present invention comprises at least one of the 18 sets, it is possible to detect any of the above genetic markers. For example, the primer group according to the present invention comprises the first primer set and Genetic marker (MM314, FM677) linked to 2H-2 factor and 5H-1 factor linkage if it comprises at least one set of the second primer set and at least one set of the third primer set and the fourth primer set The genetic marker (FM426) is more preferable because both can be amplified and detected. Further, it is most preferable that the primer group according to the present invention comprises all the above primer sets, since all the genetic markers according to the present invention can be amplified and detected.

  Since the primer group according to the present invention can detect the genetic marker according to the present invention, the above-mentioned “2-3-1. Method for determining the presence or absence of a head blight resistance factor according to the present invention” and “ It can be used as a primer for DNA amplification in “2-3-2. Determination method of head blight resistant plant according to the present invention”. Therefore, by including the primer group according to the present invention, a kit for determining the presence or absence of a Fusarium head blight resistance factor, which will be described later, and a kit for determining a head blight resistance plant (for example, barley including barley) can be obtained. it can.

<2-5. Kit for determining presence / absence of head blight resistance factor according to the present invention and kit for determination of head blight resistance plant>
The presence / absence determination kit for head blight resistance factor according to the present invention (hereinafter referred to as “the present resistance factor determination kit” as appropriate) is the above-mentioned “2-3-1. It is a kit used for “the determination method of presence / absence”, and comprises the above “2-4. Primer group according to the present invention” as a primer set for amplifying a genetic marker.

  Therefore, as described above, for example, when the first primer set is included in the resistance factor determination kit, MM314 linked to the 2H-2 factor can be detected, and the second primer set is included in the resistance factor determination kit. Thus, FM677 linked to the 2H-2 factor can be detected. Moreover, FM426 linked to 5H-1 factor can be detected by including the third primer set or the fourth primer set in the resistance factor determination kit. Moreover, MM1057 linked to 5H-1 factor can be detected by including the fifth primer set in this resistance factor determination kit.

  Therefore, if the primer group included in the resistance factor determination kit comprises at least one of the 18 sets, it is possible to detect any of the above genetic markers. A genetic marker (MM314, FM677) linked to factor 2H-2 and 5H-, if at least one of the primer sets and at least one of the third primer set, the fourth primer set and the fifth primer set A genetic factor linked to one factor (FM426, MM1057) is more preferable because both can be detected. Moreover, it is most preferable that the primer group according to the present invention comprises all the above primer sets, since all the genetic markers according to the present invention can be detected.

  In addition, this determination kit may contain enzymes and reagents for performing PCR, as well as reagents, buffers, and centrifuge tubes necessary for preparing genomic DNA as a template. Alternatively, genetic markers (MM314, FM677, FM426, etc.) necessary for detection of the target DNA size band or appropriate DNA size markers may be included.

  In addition, it can be set as the determination kit of a Fusarium head blight-resistant plant (For example, gramineous plants (barley including barley)) by the same structure as this determination kit. Regarding this, as described above, by using this resistance factor determination kit to determine the presence or absence of a resistance factor for head blight, the test plant (for example, barley and other wheat) is resistant to head blight. This is due to the fact that it is possible to determine whether or not it has a factor, that is, whether or not the plant is resistant to head blight (for example, a Gramineae plant (barley including barley)).

<2-6. Gene Detection Instrument According to the Present Invention>
A gene detection instrument (for example, a DNA microarray) according to the present invention (hereinafter referred to as “the present gene detection instrument” as appropriate) is prepared by placing the genetic markers (MM314, FM677, FM426, MM1057) according to the present invention on a suitable substrate (glass, (Silicon wafer, nylon membrane, etc.) A plurality of genetic markers can be easily and simultaneously detected by reacting a probe prepared from a plant to be tested with this gene detection instrument and detecting a signal emitted at that time. Therefore, this gene detection instrument can be used as a means for detecting a polymorphism of a genetic marker according to the present invention. Therefore, it can be used as a detection means in a method for determining the presence or absence of a head blight resistance factor and a method for determining a head blight resistant plant (for example, barley including barley). Moreover, this gene detection instrument can also be added to a kit for determining the presence or absence of a mildew resistance factor, or a kit for determining a head blight resistance plant (for example, barley including barley). The kit may contain reagents, instruments, devices, and the like used to detect signals from gene detection instruments (DNA microarrays).

  It is sufficient that at least one genetic marker (eg, MM314, FM677, FM426, MM1057, etc.) according to the present invention is fixed on the substrate of the gene detection instrument. In addition, either one or both of a resistance type genetic marker and a susceptibility type genetic marker may be fixed. In order to determine the presence or absence of a Fusarium head blight resistance factor with higher accuracy (probability), a plurality of inheritances having a relationship sandwiching each Fusarium head blight resistance factor (2H-2 factor, 5H-1 factor, etc.) It is preferable that the combination of markers is fixed. More specifically, a combination of genetic markers having a relationship between 2H-2 factors is a combination of MM314 and FM677, and a combination of genetic markers having a relationship between 5H-1 factors is FM426 and MM1057. There are combinations.

  If at least one of the above combinations is fixed on the substrate, it is possible to determine the presence or absence of the 2H-2 factor or the 5H-1 factor. In the sense that both factors can be detected, the combination of MM314 and FM677 is most preferably fixed on the substrate and the combination of FM426 and MM1057 is included.

  By using the present gene detection instrument to which the plurality of genetic markers are fixed, a plurality of genetic markers can be easily detected in a single trial. Furthermore, the presence or absence of a head blight resistance factor can be determined with high accuracy (probability).

  In addition, not only the genetic marker according to the present invention but also other genetic markers located in the vicinity thereof may be fixed to the gene detection instrument.

  Furthermore, the genetic detection instrument according to the present invention is fixed in the order in which the genetic markers according to the present invention are arranged on the barley chromosome, or is provided with sequence position information corresponding to the order in which the genetic markers are arranged on the barley chromosome. It is preferably fixed. This is because the detection accuracy can be further improved when the test object is a barley. In other words, in the analysis using a conventional gene detection instrument such as a DNA microarray, if a signal for a certain spot is not obtained, there is no genetic marker to be detected, or there is a signal due to an experimental error in the analysis. Whether it was not obtained could not be judged correctly unless it was confirmed again. On the other hand, in the case of using the present gene detection instrument, since it is arranged so that the order of the immobilized genetic marker on the chromosome can be confirmed, whether or not it is an error in the experiment as described above. It becomes possible to determine easily.

  Specifically, for example, it is assumed that a signal is obtained at spots before and after a spot where no signal was obtained. In the array according to the present invention, the spots are arranged so that the order in which the spots are arranged on the chromosome can be confirmed. Usually, in order for only one gene to be recombined on a chromosome in close proximity on a straight line, two recombination must occur in close proximity. Since the probability of such a phenomenon occurring is extremely low, the result that a signal was not obtained is judged to be due to an experimental error. Thus, in this gene detection instrument, even when a signal for a certain spot is not obtained, it is possible to easily determine whether or not there is an experimental error, so that the accuracy of analysis can be improved. it can.

  The present invention includes the following inventions.

(1) a DNA marker present in the genomic DNA of wheat and linked to a head blight resistance factor,
A DNA marker, which is located at a distance in the range of about 0 to 9 centimorgans from the head blight resistance factor.

  (2) The DNA marker according to (1), wherein the wheat is barley.

  (3) The DNA marker according to (2), wherein the genomic DNA is 2H chromosome.

  (4) Amplified using a first primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 1 and a primer having the base sequence shown in SEQ ID NO: 2 (1) Or the DNA marker according to any one of (3).

  (5) The DNA marker according to (4), which is located at a distance of about 0 centmorgan from the head blight resistance factor.

  (6) Amplified using a second primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 3 and a primer having the base sequence shown in SEQ ID NO: 4 (1) Or the DNA marker according to any one of (3).

  (7) The DNA marker according to (6), which is located at a distance of about 0.6 centmorgan from the head blight resistance factor.

  (8) The DNA marker according to (7), which has the base sequence shown in SEQ ID NO: 8 or the base sequence shown in SEQ ID NO: 9.

  (9) The DNA marker according to (2), wherein the genomic DNA is a 5H chromosome.

  (10) Amplified using a third primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 5 and a primer having the base sequence shown in SEQ ID NO: 6 (1) Or the DNA marker as described in (2) or (9).

  (11) The DNA marker according to (10), wherein the DNA marker is located at a distance of about 9 centmorgan from the head blight resistance factor.

  (12) The DNA marker according to (11), which has the base sequence represented by SEQ ID NO: 10 or the base sequence represented by SEQ ID NO: 11.

  (13) Amplified by using a fourth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 5 and a primer having the base sequence shown in SEQ ID NO: 7 (1) Or the DNA marker as described in (2) or (9).

  (14) The DNA marker as set forth in (13), which is located at a distance of about 9 centmorgan from the head blight resistance factor.

  (15) The DNA marker according to (14), which has the base sequence shown in SEQ ID NO: 12 or the base sequence shown in SEQ ID NO: 13.

  (16) The DNA marker as set forth in (9), which is located at a distance of about 2.2 centmorgan from the head blight resistance factor.

  (17) A method for isolating a DNA fragment, comprising isolating a DNA fragment containing a head blight resistance factor using the DNA marker of any one of (1) to (16) above.

  (18) A method for producing a Fusarium head blight-resistant plant, which comprises introducing a DNA fragment containing the Fusarium head blight resistance factor obtained by the isolation method of (17) above into the genomic DNA of the plant.

  (19) The method for producing a head blight-resistant plant according to (18), wherein the plant is wheat.

  (20) The method for producing a head blight-resistant plant according to (19), wherein the wheat is a barley.

  (21) A head blight-resistant plant obtained by the method for producing a head blight-resistant plant according to any one of (18) to (20) above.

  (22) A DNA microarray, wherein at least one DNA marker among the DNA markers of any one of (1) to (16) is fixed on a substrate.

(23) A method for detecting a DNA marker linked to a head blight resistance factor from genomic DNA of a plant,
A first primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 1 and a primer having the base sequence shown in SEQ ID NO: 2,
A second primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 3 and a primer having the base sequence shown in SEQ ID NO: 4,
A third primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 5 and a primer having the base sequence shown in SEQ ID NO: 6, and a primer having the base sequence shown in SEQ ID NO: 5, Of the fourth primer set that is a combination with a primer having the base sequence shown in 7,
A method for detecting a DNA marker, wherein DNA amplified using at least one primer set is used as a DNA marker linked to a head blight resistance factor.

(24) While using at least one of the first primer set and the second primer set,
The method for detecting a DNA marker according to (23), wherein at least one of the third primer set and the fourth primer set is used.

  (25) The method for detecting a DNA marker according to (23) or (24), wherein the plant is wheat.

  (26) The method for detecting a DNA marker according to (25), wherein the wheat is barley.

  (27) Red mold characterized in that polymorphism is detected for at least one DNA marker among DNA markers detected from the genomic DNA of a plant by the detection method of any of (23) to (26) above. A method for determining the presence or absence of a disease resistance factor.

  (28) A polymorphism is detected for at least one DNA marker among DNA markers detected from genomic DNA of a plant by the method for detecting a DNA marker of any one of (23) to (26) above. To identify plants that are resistant to head blight.

(29) a first primer set which is a combination of a primer having the base sequence represented by SEQ ID NO: 1 and a primer having the base sequence represented by SEQ ID NO: 2,
A second primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 3 and a primer having the base sequence shown in SEQ ID NO: 4,
A third primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 5 and a primer having the base sequence shown in SEQ ID NO: 6, and a primer having the base sequence shown in SEQ ID NO: 5, Of the fourth primer set that is a combination with a primer having the base sequence shown in 7,
A primer group comprising at least one set.

(30) at least one of the first primer set and the second primer set;
The primer group according to (29), comprising at least one of the third primer set and the fourth primer set.

(31) A kit for use in a determination method for determining the presence or absence of a head blight resistance factor by detecting a polymorphism of a DNA marker linked to the head blight resistance factor,
A kit for determining the presence or absence of a resistance factor for head blight, comprising the primer group described in (29) or (30) as a primer set for amplifying a DNA marker.

(32) A kit used to discriminate plants resistant to head blight by detecting polymorphisms in DNA markers linked to head blight resistance factors,
A kit for distinguishing head blight-resistant plants, comprising the primer group according to (29) or (30) as a primer set for amplifying a DNA marker.

  The DNA markers (1) to (16) are present in the genomic DNA of wheat (barley) and linked to the head blight resistance factor. That is, there is a low probability that recombination will occur between the DNA marker and the head blight resistance factor. Therefore, by using the above DNA marker, for example, acquisition of a DNA fragment containing a head blight resistance factor, determination of the presence or absence of a head blight resistance factor, a head blight resistance plant (for example, barley including barley) ) And the like can be performed.

  The method for isolating a DNA fragment containing the head blight resistance factor of (17) comprises isolating the DNA fragment using any of the DNA markers of (1) to (16) above. Since the DNA marker is linked to a head blight resistance factor, the target DNA fragment can be easily isolated by cloning with the DNA as a target.

  The method for producing a head blight-resistant plant according to any one of the above (18) to (20) is to introduce a DNA fragment containing the above-mentioned head blight-resistant factor into the genomic DNA of a plant (wheat, barley). It becomes more. Fusarium head blight resistance factor is a gene that has the property of imparting resistance to head blight, so it gives resistance to or resistance to plants susceptible to head blight (wheat, barley). Can be enhanced.

  The (21) head blight-resistant plant is a plant (wheat, barley) obtained by the method for producing a head blight-resistant plant. Therefore, diseases caused by red mold can be prevented, and the yield of the plant (wheat, barley) can be improved and the quality can be improved.

  The DNA microarray of (22) above comprises the DNA marker described in (1) to (16) being immobilized on a substrate. According to such a DNA microarray, a plurality of DNA markers can be detected in one trial, and a larger amount of samples can be processed in a shorter time with less effort.

  In the method for detecting a DNA marker of (23) above, if an amplification reaction is carried out using the first primer set or the second primer set, a DNA marker linked to the head blight resistance factor present in the 2H chromosome is detected. If an amplification reaction is performed using the third primer set or the fourth primer set, it is possible to detect a DNA marker linked to a head blight resistance factor present in the 5H chromosome.

  According to the method for detecting a DNA marker described in (24), at least one of the first primer set and the second primer set is used, and at least one of the third primer set or the fourth primer set is used. Since it consists of using one set, it detects both a DNA marker linked to the Fusarium head blight resistance factor present in the 2H chromosome and a DNA marker linked to the Fusarium head blight resistance factor present in the 5H chromosome. Is possible.

  In addition, the detection method of the DNA marker as described in said (25) or (26) consists of applying the detection method of said (23) or (24) to wheat or barley. Since the DNA marker to be detected is present in the genomic DNA of barley and other wheat and linked to the head blight resistance factor, the method for detecting the DNA marker is suitable for barley and other wheat. Can be used.

  (27) The method of determining the presence or absence of a head blight resistance factor is at least one DNA among DNA markers detected from genomic DNA of a plant by the detection method of any of (23) to (26) above. By detecting the polymorphism (redhead mold resistance or mold susceptibility type) of the marker, the presence or absence of the mildew resistance factor in the test plant (for example, barley and other wheat) Deciding. Since the DNA marker is linked to the head blight resistance factor, the presence or absence of the head blight resistance factor can be determined with high probability by using the marker type as an index.

  (28) The method for discriminating a head blight-resistant plant includes at least one DNA marker among DNA markers detected from the genomic DNA of a plant by the detection method according to any of (23) to (26) above. By detecting the polymorphism (whether it is resistant to head blight or head blight), the test plants (for example, barley and other wheat) are resistant to head blight (for example, barley). Or wheat). Since the DNA marker is linked to a head blight resistance factor, it is possible to determine whether it is a head blight resistance plant or not with a high probability by using the marker type as an index.

  The primer group of (29) or (30) described above detects a DNA marker linked to a head blight resistance factor present in 2H chromosome and / or is linked to a head blight resistance factor present in 5H chromosome. It can be used for detection of DNA markers, and can be used for the determination of the presence or absence of the above-mentioned head blight resistance factor, the detection of head blight resistance plants (for example, barley including barley), and the like.

  The kit for determining presence or absence of a head blight resistance factor according to (31) above is an amplification of a DNA marker linked to a head blight resistance factor present in 2H chromosome and / or a red mold present in 5H chromosome. Primers for use in amplification of DNA markers linked to disease resistance factors are included. Therefore, it becomes possible to more easily determine the presence or absence of the head blight resistance factor in the plant to be tested.

  The discriminating kit for head blight-resistant plants described in (32) above is an amplification of a DNA marker linked to a factor for head blight resistance present in 2H chromosome and / or head blight disease present in 5H chromosome. Primers for use in amplification of DNA markers linked to resistance factors are included. Therefore, it is possible to more easily determine whether the test target plant (for example, wheat such as barley) is a head blight-resistant plant (for example, wheat such as barley).

[Embodiment 2]
The following will describe another embodiment of the present invention with reference to FIGS.

  The present invention relates to genetic markers linked to head blight resistance factors (such as loci involved in head blight resistance) and examples of their use. Each will be described below.

(1) Genetic marker according to the present invention The genetic marker according to the present invention may be any genetic marker as long as it is present in the genomic DNA of a grass family and is linked to head blight resistance. As the gramineous plant, wheat is preferable, and barley is particularly preferable. The grass family plant is not particularly limited as long as it is a plant such as barley, wheat, and rice. The wheat refers to, for example, barley, wheat, rye, triticale and the like.

  “Red mold” is a disease caused by infection of wheat with Fusarium fungi as described above. The red mold disease is a serious disease that not only causes poor ripening and decreased yield, but also produces mold toxins (for example, deoxynivalenol) and causes symptoms of poisoning when the diseased wheat is used for food and feed.

  There are varieties of barley that are resistant to such head blight. The detailed mechanism of head blight resistance has not been clarified, but previous studies have suggested the involvement of traits such as streak, head length, heading time, and intercob length. In addition, barley is considered to have no immune resistance against head blight, and it is said that a relatively small number of genes are quantitative traits involved in the resistance.

  Such quantitative traits can be estimated by QTL analysis to determine the positions of the loci involved in the quantitative traits on the chromosome. Hereinafter, genetic markers linked to loci involved in head blight resistance developed by the present inventors in barley will be described in detail. The genetic marker according to the present invention is not limited to these.

  The inventors conducted a QTL analysis on the resistance to head blight of barley in order to search for the head blight resistance factor (locus involved in head blight resistance). Specifically, it is as follows. Materials include the breeding of the RI strain (RHI population), Harbin 2-row (resistant), and Turkey 6 (affected) that were cultivated from the cross between Russia 6 (Nijo, resistant) and HES4 (Six, susceptible) The RI strain (RI2 population) grown from No. 2 and the DH strain (DHHS population) grown from the cross between Haruna Nijo (resistant) and H602 (susceptible) were used. Moreover, the evaluation method of head blight resistance is evaluated by a score of 0 (resistance) to 10 (susceptibility) obtained by modifying the “cut ear test method” (see Non-Patent Document 4). Further, composite interval mapping (CIM) is used as an analysis algorithm, and MAPMAKER / QTL and QTL Cartographer are used as analysis software, respectively.

  As a result of such QTL analysis, one QTL was detected on the 2H and 4H chromosomes in the RHI population, 2H, 4H and 6H chromosomes in the RI2 population, and 2H, 4H and 5H chromosomes in the DHHS population. Among these detected QTLs, those detected on the 2H chromosome detected from the RHI population were consistent with those explained in the above [Embodiment 1].

  Based on the information of the high-density linkage map created by the inventors for each segregated population, a novel genetic marker linked to the above-mentioned head blight resistance factor (locus involved in head blight resistance) was found. .

  “MMtgaEatc128” and “FMgcgEatc530” are examples of novel genetic markers linked to the head blight resistance factor (locus involved in head blight resistance) on the 4H chromosome detected from the RHI population.

  “MMtgaEatc128” is a DNA fragment obtained by digesting the genomic DNA of a grass family such as barley with restriction enzymes MseI and EcoRI, and has the base sequences shown in GACGATGAGTCCTGAG (SEQ ID NO: 16) and TACTCAGGACTCAT (SEQ ID NO: 17). The MseI adapter and an EcoRI adapter having the base sequences shown by CTCGTAGACTGCGTACC (SEQ ID NO: 14) and AATTGGTACGCAGTCTAC (SEQ ID NO: 15) are ligated, and the DNA fragment after the ligation has the base sequence shown by GATGAGTCCTGAGTAA (SEQ ID NO: 19) Pre-amplification was performed using the MseI universal primer and the EcoRI universal primer having the base sequence shown in GACTGCGTACCAATTC (SEQ ID NO: 18). By the so-called AFLP (Amplified Fragment Length Polymorphisms) amplified using an eleventh primer set that is a combination of a primer having the base sequence shown in FIG. 5 and a primer having the base sequence shown in GACTGCGTACCAATTCTGA (SEQ ID NO: 33) It is a genetic marker to be detected. The genetic marker is about 0.1 centmorgan (hereinafter referred to as the 5 ′ end side) from the head blight resistance factor (locus involved in head blight resistance) detected on the 4H chromosome. sitting on the position of cM).

  The AFLP detection procedure in the above AFLP and the following description is not particularly limited. For example, literature (Pieter Vos, Rene Hogers, Marjo Bleeker, Martin Reijans, Theo van de Lee, Miranda Hornes, Adrie Frijters, Jerina Pot, Johan Peleman, Martin Kuiper and Marc Zabeau. (1995) AFLP: a new technique for DNA fingerprinting. Nucleic Asids Research. 23: 21: 4407-4414.) Or a modification thereof. Various conditions for the amplification reaction such as PCR may be performed under ordinary conditions, or may be appropriately adopted after examining optimum conditions.

  The amplified fragments that are finally amplified using the eleventh primer set are resistant to Fusarium head blight (Russia type 6) and susceptible (HES type 4). The fragment length of the resistant type (Russia type 6) is about 128 bp, and the susceptible type (HES type 4) is 0 bp. In other words, the resistant type (Russia type 6) to Fusarium head blight can obtain an amplified fragment of about 128 bp, whereas the susceptible type (HES type 4) cannot obtain an amplified fragment of about 128 bp. That's what it means. Therefore, by confirming the fragment length of the amplification product obtained by the AFLP detection operation using a known means such as electrophoresis, the plant head resistance factor (the fungus resistance factor on which the target plant individual sits on the 4H chromosome) It is possible to determine whether an allele at the locus responsible for head blight resistance has a resistance genotype or a susceptibility genotype.

  “FMgcgEatc530” is a DNA fragment obtained by digesting the genomic DNA of a grass family such as barley with restriction enzymes MseI and EcoRI, and the nucleotide sequences shown in GACGATGAGTCCTGAG (SEQ ID NO: 16) and TACTCAGGACTCAT (SEQ ID NO: 17). The MseI adapter, and an EcoRI adapter having the base sequences shown in CTCGTAGACTGCGTACC (SEQ ID NO: 14) and AATTGGTACGCAGTCTAC (SEQ ID NO: 15), and the DNA fragment after the ligation was converted into the base sequence shown in GATGAGTCCTGAGTAA (SEQ ID NO: 19) Pre-amplification using the MseI universal primer and EcoRI universal primer having the base sequence shown in GACTGCGTACCAATTC (SEQ ID NO: 18), and the pre-amplified fragment obtained by the pre-amplification 4) Amplified Fragment Length Polymorphisms amplified by using a twelfth primer set that is a combination of a primer having the base sequence shown in 4) and a primer having the base sequence shown in GACTGCGTACCAATTCGCG (SEQ ID NO: 35). ) Is a genetic marker detected by. The genetic marker is located at a position of about 8.0 cM on the long arm side (3 ′ end side) from the head blight resistance factor (gene locus involved in head blight resistance) detected on the 4H chromosome. I'm riding.

  The amplified fragments finally amplified by the twelfth primer set are resistant to Fusarium head blight (Russia type 6) and susceptible (HES type 4). The length is 0 bp for the resistant type (Russia type 6) and about 530 bp for the susceptible type (HES type 4). In other words, the resistant fragment (Russia type 6) does not give an amplified fragment of about 530 bp, whereas the susceptible type (HES type 4) gives an amplified fragment of about 530 bp. That is. Therefore, by confirming the fragment length of the amplification product obtained by the AFLP detection operation using a known means such as electrophoresis, the plant head resistance factor (the fungus resistance factor on which the target plant individual sits on the 4H chromosome) It is possible to determine whether an allele at the locus responsible for head blight resistance has a resistance genotype or a susceptibility genotype.

  Moreover, “FXLRRfor_XLRRrev119” can be mentioned as a novel genetic marker linked to the head blight resistance factor (locus involved in head blight resistance) on the 2H chromosome detected from the RI2 population.

  “FXLRRfor_XLRRrev119” is amplified using a sixth primer set that is a combination of a primer having the base sequence shown by CCGTTGGACAGGAAGGAG (SEQ ID NO: 22) and a primer having the base sequence shown by CCCATAGACCGGACTGTT (SEQ ID NO: 23). It is a genetic marker, a so-called RGA (Resistant Gene Analogs) marker, and is about 0.2 cM on the short arm side from the head blight resistance factor (locus involved in head blight resistance) detected on the 2H chromosome. It sits on a distance. In addition, the said primer sequence was designed from the base-sequence information (gene bank Accession No: U37133) of rice stripe blight resistance gene Xa21.

  The procedure for detecting the RGA marker is not particularly limited. For example, literature (Chen XM, Line RF, Leung H (1998) Genome scanning for resistance-gene analogs in rice, barley, and wheat by high-resolution electrophoresis. Theor Appl Genet 98: 345-355) or a modification thereof. Various conditions for the amplification reaction such as PCR may be performed under ordinary conditions, or may be appropriately adopted after examining optimum conditions.

  The amplified fragments amplified by the sixth primer set are resistant to head blight (Harbin 2-row type) and susceptible (Turkey type 6). The length of each amplified fragment The resistance type (Harbin 2-row type) is 0 bp, and the susceptible type (Turkey 6 type) is about 119 bp. In other words, the resistant fragment (Harbin 2-row type) does not give an amplified fragment of about 119 bp, whereas the susceptible type (Turkey 6 type) has an amplified fragment of about 119 p. It is to be obtained. Therefore, by confirming the fragment length of the amplification product obtained by the above-described operation using a known means such as electrophoresis, the plant head resistance factor (redhead disease) on which the target plant individual sits on the 2H chromosome. It is possible to determine whether an allele at a locus related to resistance has a resistance genotype or a susceptibility genotype.

  Moreover, “FMacgEcgt288” and “HVM67” can be mentioned as novel genetic markers linked to the head blight resistance factor (locus involved in head blight resistance) on the 4H chromosome detected from the RI2 population.

  “FMacgEcgt288” has a nucleotide sequence represented by GACGATGAGTCCTGAG (SEQ ID NO: 16) and TACTCAGGACTCAT (SEQ ID NO: 17), in a DNA fragment obtained by digesting the genomic DNA of a grass family such as barley with restriction enzymes MseI and EcoRI. The MseI adapter and an EcoRI adapter having the base sequences shown by CTCGTAGACTGCGTACC (SEQ ID NO: 14) and AATTGGTACGCAGTCTAC (SEQ ID NO: 15) are ligated, and the DNA fragment after the ligation has the base sequence shown by GATGAGTCCTGAGTAA (SEQ ID NO: 19) Pre-amplification was performed using the MseI universal primer and EcoRI universal primer having the base sequence shown in GACTGCGTACCAATTC (SEQ ID NO: 18). Amplified Fragment Length Polymorphisms (AFLP) amplified using a thirteenth primer set that is a combination of a primer having the base sequence shown in FIG. 5 and a primer having the base sequence shown in GACTGCGTACCAATTCCGT (SEQ ID NO: 37) It is a genetic marker to be detected. The genetic marker sits at a position of about 0.3 cM on the short arm side from the head blight resistance factor detected on the 4H chromosome (the gene locus involved in head blight resistance).

  The amplified fragments amplified by the thirteenth primer set are resistant to head blight (Harbin 2-row type) and susceptible (Turkey type 6). The length is 0 bp for the resistant type (Harbin 2-row type) and about 288 bp for the susceptible type (Turkey 6 type). In other words, the resistant fragment (Harbin 2-row type) does not give an amplified fragment of about 288 bp, whereas the susceptible type (Turkey type 6) has an amplified fragment of about 288 bp. It is to be obtained. Therefore, by confirming the fragment length of the amplification product obtained by the above AFLP detection operation using a known means such as electrophoresis, the plant head resistance factor (S. It is possible to determine whether an allele at the locus responsible for head blight resistance has a resistance genotype or a susceptibility genotype.

  “HVM67” is a barley using a fourteenth primer set which is a combination of a primer having the base sequence shown in GTCGGGCTCCATTGCTCT (SEQ ID NO: 38) and a primer having the base sequence shown in CCGGTACCCAGTGACGAC (SEQ ID NO: 39). A genetic marker amplified using genomic DNA as a template, and a distance of about 46.8 cM on the long arm side from the Fusarium head blight resistance factor (locus involved in Fusarium head blight resistance) detected on the 4H chromosome To sit on. The genetic marker is a so-called SSR (Simple Sequence Repeat) marker.

  The amplification method of “HVM67” is not particularly limited, and may be adopted after considering optimum conditions as appropriate.

  The amplified fragments amplified by the fourteenth primer set are resistant to head blight (Harbin 2-row type) and susceptible (Turkey type 6). The length is 160 bp for the resistant type (Harbin 2-row type) and about 140 bp for the susceptible type (Turkey 6 type). Therefore, by confirming the fragment length of the amplification product obtained by the above-described operation using a known means such as electrophoresis, the plant head resistance factor (redhead disease) on which the target plant individual sits on the 4H chromosome. It is possible to determine whether an allele at a locus related to resistance has a resistance genotype or a susceptibility genotype.

  Moreover, “FMataEagc408” and “HVM11” can be mentioned as novel genetic markers linked to the head blight resistance factor (locus involved in head blight resistance) on the 6H chromosome detected from the RI2 population.

  “FMataEagc408” is a DNA fragment obtained by digesting the genomic DNA of a grass family such as barley with restriction enzymes MseI and EcoRI, and has the base sequences shown in GACGATGAGTCCTGAG (SEQ ID NO: 16) and TACTCAGGACTCAT (SEQ ID NO: 17). The MseI adapter and an EcoRI adapter having the base sequences shown by CTCGTAGACTGCGTACC (SEQ ID NO: 14) and AATTGGTACGCAGTCTAC (SEQ ID NO: 15) are ligated, and the DNA fragment after the ligation has the base sequence shown by GATGAGTCCTGAGTAA (SEQ ID NO: 19) Pre-amplification was performed using the MseI universal primer and the EcoRI universal primer having the base sequence shown in GACTGCGTACCAATTC (SEQ ID NO: 18). Amplified Fragment Length Polymorphisms (AFLP) amplified using a seventeenth primer set that is a combination of a primer having the base sequence shown in FIG. 5 and a primer having the base sequence shown in GACTGCGTACCAATTCAGC (SEQ ID NO: 45). It is a genetic marker to be detected. The genetic marker is located at a position of about 4.1 cM on the short arm side from the head blight resistance factor detected on the 6H chromosome (the gene locus involved in head blight resistance).

  The amplified fragments finally amplified by the seventeenth primer set are resistant to head blight (Harbin 2-row type) and susceptible (Turkey type 6). The fragment length of the resistant type (Harbin 2-row type) is 0 bp, and that of the susceptible type (Turkey 6 type) is about 408 bp. In other words, the resistant fragment (Harbin 2-row type) does not give an amplified fragment of about 408 bp, whereas the susceptible type (Turkey 6 type) has an amplified fragment of about 408 bp. It is to be obtained. Therefore, by confirming the fragment length of the amplification product obtained by the above AFLP detection operation using a known means such as electrophoresis, the plant head resistance factor (S. It is possible to determine whether an allele at the locus responsible for head blight resistance has a resistance genotype or a susceptibility genotype.

  “HVM11” is a barley using an eighteenth primer set that is a combination of a primer having the base sequence shown by CCGGTCGGTGCAGAAGAG (SEQ ID NO: 46) and a primer having the base sequence shown by AAATGAAAGCTAAATGGGCGATAT (SEQ ID NO: 47). A genetic marker amplified using genomic DNA as a template, a distance of about 9.4 cM on the long arm side from the Fusarium head blight resistance factor (locus involved in Fusarium head blight resistance) detected on the 6H chromosome To sit on. The genetic marker is a so-called SSR (Simple Sequence Repeat) marker.

  The amplification method of “HVM11” is not particularly limited, and may be adopted after considering optimum conditions as appropriate.

  The amplified fragments amplified by the eighteenth primer set are resistant to head blight (Harbin 2-row type) and susceptible (Turkey 6 type). The length of the resistant type (Harbin 2-row type) is 144 bp, and the susceptible type (Turkey 6 type) has an amplified fragment of about 100 bp to 160 bp. Therefore, by confirming the fragment length of the amplification product obtained by the above-described operation using a known means such as electrophoresis, the plant head resistance factor (redhead disease) on which the target plant individual sits on the 6H chromosome. It is possible to determine whether an allele at a locus related to resistance has a resistance genotype or a susceptibility genotype.

  Moreover, as a new genetic marker linked to the Fusarium head blight resistance factor (locus related to Fusarium head blight resistance) on the 2H chromosome detected from the DHHS population, “Bmag125” and “k04002” can be mentioned.

  “Bmag125” is a barley genomic DNA using a seventh primer set which is a combination of a primer having a base sequence shown by AATTAGCGAGAACAAAATCAC (SEQ ID NO: 24) and a primer having a base sequence shown by AGATAACGATGCACCACC (SEQ ID NO: 25). Is a genetic marker that is amplified by using as a template and sits at a distance of about 0 cM on the short arm side from the Fusarium head blight resistance factor (gene locus involved in Fusarium head blight resistance) detected on the 2H chromosome. Is. The genetic marker is a so-called SSR (Simple Sequence Repeat) marker.

  The amplification method of “Bmag125” is not particularly limited, and may be adopted after considering optimum conditions as appropriate.

  The amplified fragments amplified by the seventh primer set include a resistance type (haruna nijo type) and a susceptibility type (type H602) against head blight, and each amplified fragment has a resistance length of The sex type (Haruna Nijo type) is about 142 bp, and the susceptible type (H602 type) shows an amplified fragment at about 134 bp. Therefore, by confirming the fragment length of the amplification product obtained by the above-described operation using a known means such as electrophoresis, the plant head resistance factor (redhead disease) on which the target plant individual sits on the 2H chromosome. It is possible to determine whether an allele at a locus related to resistance has a resistance genotype or a susceptibility genotype.

  "K04002" is a barley genome using an eighth primer set which is a combination of a primer having the base sequence shown by GACACAGGACCTGAAGCACA (SEQ ID NO: 26) and a primer having the base sequence shown by CGGCAGGCTCTACTATGAGG (SEQ ID NO: 27). A genetic marker that is amplified using DNA as a template and sits at a distance of about 10 cM on the long arm side from the Fusarium head blight resistance factor (locus involved in Fusarium head blight resistance) detected on the 2H chromosome. To do. The primer sequence is designed based on one of the barley EST sequences independently developed by the inventors (EST clone name: bah32c06, SEQ ID NOs: 55 and 56). SEQ ID NO: 40 shows the base sequence from the 5 'end, and SEQ ID NO: 41 shows the base sequence from the 3' end.

  The amplification method of “k04002” is not particularly limited, and may be adopted after considering optimum conditions as appropriate.

  The amplified fragments amplified using the eighth primer set include a resistance type (Haruna Nijo type) and a susceptibility type (H602 type) to Fusarium head blight, and a resistance type (Haruna Nijo type). The amplified fragment has a fragment length of about 350 bp, while the susceptible fragment (type H602) has an amplified fragment of about 440 bp. Therefore, by confirming the fragment length of the amplification product obtained by the above-described detection operation using a known means such as electrophoresis, the plant fungus resistance factor (red mold) on which the target plant individual sits on the 2H chromosome. It is possible to determine whether an allele at a gene locus involved in disease resistance has a resistant genotype or a susceptible genotype.

  In addition, examples of novel genetic markers linked to the Fusarium head blight resistance factor (locus involved in Fusarium head blight resistance) on the 4H chromosome detected from the DHHS population include “k05042” and “k03289”.

  “K05042” is a barley genome using a 15th primer set which is a combination of a primer having the base sequence shown by ATACATGCATGCCATTGTGG (SEQ ID NO: 40) and a primer having the base sequence shown by ATCCATCCACTGTTTGAGGG (SEQ ID NO: 41). A genetic marker amplified using DNA as a template, at a distance of about 1.2 cM on the short arm side from the Fusarium head blight resistance factor (locus involved in Fusarium head blight resistance) detected on the 4H chromosome. To sit on. The primer sequence is designed based on one of the barley EST sequences independently developed by the inventors (EST clone name: basd1e04, SEQ ID NO: 48).

  The amplification method of “k05042” is not particularly limited, and may be adopted after considering optimum conditions as appropriate.

  In addition, the amplified fragment amplified using the fifteenth primer set has a resistant type and a susceptible type against head blight, and there is a SNP (single nucleotide polymorphism) between them. is there. FIG. 21 shows the base sequence of the portion containing the above SNP in the base sequences of both amplification products. The bottom is the base sequence (SEQ ID NO: 51) of the susceptible type (Haruna Nijo type), and the top is the base sequence (SEQ ID NO: 52) of the resistant type (H602 type). The base surrounded by □ is SNP. The underlined portion indicates the recognition sequence (CCGG) of the restriction enzyme HapII. As is clear from FIG. 21, the resistant amplification product has a restriction enzyme HapII recognition sequence (CCGG) and is thus cleaved by HapII. Is mutated to A (CAGG), it is not cleaved by the restriction enzyme HapII. That is, the present genetic marker k05042 is a cleaved amplified polymorphic sequence (CAPS) marker, and the target plant individual sits on the 4H chromosome by amplification with the fifteenth primer set and cleavage of the amplification product HapII. It can be determined whether an allele of a mold resistance factor (locus involved in resistance to red mold disease) has a resistance genotype or a susceptibility genotype.

  The head blight resistance factor linked to this genetic marker (locus involved in head blight resistance) is the head blight resistance factor (head blight disease) of H602 which is a mold susceptibility to head blight. Gene locus involved in resistance). Therefore, when this genetic marker is detected, the Haruna Nijo type becomes the susceptible type and the H602 type becomes the resistant type.

  “K03289” is a barley using a sixteenth primer set which is a combination of a primer having the base sequence shown by TGCTCTGCATTTCATTCAGC (SEQ ID NO: 42) and a primer having the base sequence shown by CAGCGTTACAGGCATTCTCA (SEQ ID NO: 43). It is a genetic marker amplified using genomic DNA as a template, and sits at a distance of about 4.0 cM on the long arm side from the locus related to head blight resistance detected on the 4H chromosome. The primer sequence is designed based on one of the barley EST sequences independently developed by the inventors (EST clone name: bags3h19, SEQ ID NO: 49).

  The amplification method of “k03289” is not particularly limited, and may be adopted after considering optimum conditions as appropriate.

  The amplified fragment amplified using the sixteenth primer set includes a resistant type and a susceptible type against head blight, and SNP (single nucleotide polymorphisms) is present between the two. is there. FIG. 22 shows the base sequence of the portion containing the SNP in the base sequences of both amplification products. The bottom is the base sequence (SEQ ID NO: 53) of the susceptible type (Haruna Nijo type), and the top is the base sequence (SEQ ID NO: 54) of the resistant type (H602). The base surrounded by □ is SNP. The underlined part shows the recognition sequence (CCGCGG) of the restriction enzyme SacII. As is clear from FIG. 22, since the susceptible amplification product has the recognition sequence (CCGCCGG) of the restriction enzyme SacII, it is cleaved by SacII. Since it is mutated to T (CCGTGG), it is not cleaved by the restriction enzyme SacII. That is, the present genetic marker k03289 is a CAPS marker, and the plant fungus resistance factor (ie, the head plant individual that sits on the 4H chromosome by amplification with the sixteenth primer set and restriction enzyme SacII cleavage of the amplified product) It is possible to determine whether an allele at the locus responsible for head blight resistance has a resistance genotype or a susceptibility genotype.

  The head blight resistance factor linked to this genetic marker (locus involved in head blight resistance) is the head blight resistance factor (head blight disease) of H602 which is a mold susceptibility to head blight. Gene locus involved in resistance). Therefore, when this genetic marker is detected, the Haruna Nijo type becomes the susceptible type and the H602 type becomes the resistant type.

  In addition, examples of novel genetic markers linked to the Fusarium head blight resistance factor (locus involved in Fusarium head blight resistance) on the 5H chromosome detected from the DHHS population include “HvLOX” and “k00835”.

  “HvLOX” is a barley genomic DNA using a ninth primer set which is a combination of a primer having the base sequence shown by CAGCATATCCATCTGATCTG (SEQ ID NO: 28) and a primer having the base sequence shown by CACCCTTATTTATTGCCTTAA (SEQ ID NO: 29). Is a genetic marker that is amplified by using as a template and sits at a distance of about 0.5 cM on the short arm side from the Fusarium head blight resistance factor detected on the 5H chromosome (the gene locus involved in Fusarium head blight resistance). To ride. The genetic marker is a so-called SSR (Simple Sequence Repeat) marker.

  The amplification method of “HvLOX” is not particularly limited, and may be adopted after considering the optimum conditions as appropriate.

  The amplified fragments amplified using the ninth primer set include a resistant type (Haruna Nijo type) and a susceptible type (H602 type) against head blight, and the length of each amplified fragment is The resistant type (Haruna Nijo type) is about 155 bp, and the susceptible type (H602 type) is about 157 bp. Therefore, by confirming the fragment length of the amplification product obtained by the above-mentioned operation using a known means such as electrophoresis, the plant head resistance factor (redhead disease) on which the target plant individual sits on the 5H chromosome. It is possible to determine whether an allele at a locus related to resistance has a resistance genotype or a susceptibility genotype.

  “K00835” is a barley genome using a tenth primer set which is a combination of a primer having a base sequence shown by TCCATGTTCCCAGCTACACA (SEQ ID NO: 30) and a primer having a base sequence shown by AGGAACACATTGGTTCTGGC (SEQ ID NO: 31). A genetic marker amplified using DNA as a template, at a distance of about 1.9 cM on the long arm side from the Fusarium head blight resistance factor (locus involved in Fusarium head blight resistance) detected on the 5H chromosome. To sit on. The primer sequence is designed based on one of the barley EST sequences independently developed by the inventors (EST clone name: baak46e06, SEQ ID NO: 50).

  The amplification method of “k00835” is not particularly limited, and may be adopted after considering appropriate optimum conditions.

  The amplified fragments amplified using the tenth primer set are resistant to head blight (Haruna Nijo type) and susceptible (H602 type). The length of each amplified fragment is as follows: The resistant type (Haruna Nijo type) is about 900 bp, and the susceptible type (H602 type) is about 880 bp. Therefore, by confirming the fragment length of the amplification product obtained by the above-mentioned operation using a known means such as electrophoresis, the plant head resistance factor (redhead disease) on which the target plant individual sits on the 5H chromosome. It is possible to determine whether an allele at a locus related to resistance has a resistance genotype or a susceptibility genotype.

  Here, Morgan (M) will be described. One Morgan (M) is a unit of distance on the chromosome that causes an average of one crossing per meiosis. For example, 2.2 cM indicates that an average of 22/1000 crossovers per chromatids occurs between the head blight resistance factor (locus involved in head blight resistance) and the genetic marker. ing. That is, at this time, the recombination rate is about 2.2%.

  By the way, genomic DNA used as a template in amplification can be extracted from a barley plant by a conventionally known method. Specifically, a general method for extracting genomic DNA from a plant body (see, for example, Murray, M.G. and W.F.Thompson (1980) Nucleic Acids Res. 8: 4321-4325.) Is a suitable example. The genomic DNA can be extracted using any tissue that constitutes a barley plant such as roots, stems, leaves, and reproductive organs. In some cases, it may be extracted from barley callus. The reproductive organs include flower organs (including male and female reproductive organs) and seeds. Extraction of genomic DNA is performed using, for example, leaves of the barley seedling stage. This is because the tissue is relatively easy to grind, the mixing ratio of impurities such as polysaccharides is relatively small, and can be grown from seeds in a short period of time.

  A conventionally known DNA amplification method can be employed as a method for amplification using barley genomic DNA as a template and the combination of the above primers. In general, a PCR method (polymerase chain reaction method) or a modified method thereof is used. Reaction conditions when using the PCR method or its modification method are not particularly limited, and amplification can be performed under the same conditions as usual.

  By using the genetic marker according to the present invention, it becomes possible to isolate a DNA fragment containing a head blight resistance factor (locus involved in head blight resistance), and by using the DNA fragment, It can be used to elucidate the genes involved in resistance to head blight of barley and the mechanism of head blight resistance. Moreover, by introducing the above DNA fragment into the genomic DNA of a plant (especially a grass family (for example, barley and other wheat)), a head blight-resistant plant (particularly a grass family (for example, barley and other wheat). )) Can be produced (breeded).

  In addition, since the above genetic marker is linked to the Fusarium head blight resistance factor (locus involved in Fusarium head blight resistance), the plant to be tested (for example, Gramineae plants such as barley including barley). ) By detecting the polymorphism of the genetic marker in the genomic DNA of the plant (the grass family (for example, barley and other wheat)) is involved in head blight resistance factor (head blight resistance) It is possible to determine whether or not it has a gene locus). Similarly, since it is linked to the Fusarium head blight resistance factor (locus related to Fusarium head blight resistance), the genome of the plant under test (for example, Gramineae plants (for example, barley including barley)). By detecting the polymorphism of the genetic marker in the DNA, the plant (Gramineae plant (for example, barley including barley)) is transformed into a Fusarium head blight resistant plant (for example, barley). It can be determined whether or not it is a wheat))). In addition, if a primer that can amplify the genetic marker or a DNA microarray to which the genetic marker is immobilized is made into a kit, resistance to head blight of plants (for example, gramineous plants (for example, barley including barley)). It is possible to provide a kit for determining the presence or absence of factors (locus involved in resistance to head blight) and a kit for determining head blight resistance plants (for example, gramineous plants such as barley). Become.

  As described above, it is obvious that the genetic marker according to the present invention can be used for various purposes. An example of the use of the genetic marker according to the present invention described above will be described in detail later.

(2) Use of genetic marker according to the present invention <Method of isolating a DNA fragment containing a head blight resistance factor (locus involved in head blight resistance)>
As described above, the genetic markers according to the present invention, “FXLRRfor_XLRRrev119”, “Bmag125”, “k04002” are linked to the head blight resistance factor (locus involved in head blight resistance) detected on the barley 2H chromosome. “MMtgaEatc128”, “FMgcgEatc530”, “FMacgEcgt288”, “HVM67”, “k05042”, “k03289” are the fungi resistance factors (redhead disease resistance) detected on the barley 4H chromosome. "HvLOX" and "k00835" are linked to the Fusarium head blight resistance factor (locus involved in Fusarium head blight resistance) detected on the barley 5H chromosome. “FMataEagc408” and “HVM11” are linked to the head blight resistance factor (locus involved in head blight resistance) detected on the barley 6H chromosome.

  Therefore, a DNA fragment containing the Fusarium head blight resistance factor (locus involved in Fusarium head blight resistance) detected on the barley 2H chromosome by using the genetic markers “FXLRRfor_XLRRrev119”, “Bmag125”, “k04002” Can be isolated, and resistance to red rot detected on the barley 4H chromosome by using genetic markers "MMtgaEatc128", "FMgcgEatc530", "FMacgEcgt288", "HVM67", "k05042", "k03289" A DNA fragment containing a sex factor (locus involved in resistance to Fusarium head blight) can be isolated, and red mold detected on the barley 5H chromosome by using genetic markers “HvLOX” and “k00835” A DNA fragment containing a disease resistance factor (locus involved in head blight resistance) can be isolated, and by using genetic markers such as “FMataEagc408” and “HVM11” It is possible to isolate DNA fragment containing the formate 6H chromosomes on the detected Fusarium head blight (locus relating to the Fusarium head blight resistance).

  The isolation means that the DNA fragment of interest, that is, the DNA fragment containing the head blight resistance factor (locus involved in head blight resistance) is cloned in a broad sense. Selects individuals with a DNA fragment containing one of the head blight resistance factors (locus involved in head blight resistance) of their parents by backcrossing from the cross F1 population, and only the locus region is selected. Isolation includes the generation of isogenic lines to be introduced into the target variety.

  The method for isolating a DNA fragment containing a head blight resistance factor (locus involved in head blight resistance) using the genetic marker according to the present invention is not particularly limited. Such a method can be mentioned.

  In barley, two types of BAC libraries of genomic DNA have been created, including “Haruna Nijo”, which is being developed by the present inventors, and a plurality of BAC libraries are currently under development. Therefore, using the BAC library, according to a conventionally known map-based cloning technique, the present invention is linked to the head blight resistance factor (locus involved in head blight resistance) and the gene locus. A BAC clone containing the marker is identified with a genetic marker of BAC, and a contig of BAC is prepared from the genetic marker to determine the base sequence, so that it is finally involved in resistance to head blight resistance. Gene locus).

  In addition, as described above, when one parent is backcrossed to the hybrid F1, the DNA fragment containing the other parent's head blight resistance factor (locus involved in head blight resistance) is used as the target variety. It can be introduced (in a broad sense) for isolation.

  In addition, when isolating a DNA fragment containing the head blight resistance factor (locus involved in head blight resistance) including the above method, the target head blight resistance factor (head blight resistance factor) It is preferable to select and use a genetic marker that sits as close as possible to a gene locus involved in disease resistance. The probability of recombination between the desired Fusarium head blight resistance factor (locus involved in Fusarium head blight resistance) and the genetic marker is lower, and the Fusarium head blight resistance factor (head blight resistance) This is because it is possible to isolate a fragment containing a locus related to sex.

<Method for producing head mold resistant plant (Poaceae) and plant resistant to head mold (Poaceae) obtained by the production method>
Fusarium head blight resistance factor (related to head blight resistance) obtained by the method for isolating a DNA fragment containing the head blight resistance factor (locus involved in head blight resistance) according to the present invention. By introducing a DNA fragment containing a gene locus) into the genomic DNA of a plant (Poaceae), it is possible to produce a Fusarium head blight-resistant plant (Poaceae). The plant is preferably a gramineous plant, and the gramineous plant is preferably wheat, and particularly preferably barley. In addition, for example, it is also possible to introduce a DNA fragment containing a head blight resistance factor (locus involved in head blight resistance) isolated from barley into a plant other than barley (Poaceae). However, it is not limited to isolation and introduction only between the same genera.

  The method for introducing the DNA fragment is not particularly limited, and a known method can be appropriately selected and used. More specifically, for example, it may be produced by introducing it into the genomic DNA of a plant (Poaceae) using, for example, Agrobacterium or particle gun, and thereby, a varieties resistant to head blight can be obtained. . For example, the journal The Plant Journal (1997) 11 (6), 1369-1376 discloses a method for transforming barley using Agrobacterium tumefaciens by Sonia Tingay et al. Can produce barley.

  In addition, by crossing between a plant individual having a DNA fragment containing the target fungal resistance factor (locus involved in resistance to head blight) and a plant individual into which the DNA fragment is to be introduced, It is also possible to introduce a DNA fragment containing a disease resistance factor (locus involved in resistance to head blight) into a plant. In this method, as long as crossing is possible, it is possible to introduce a DNA fragment containing a head blight resistance factor (locus involved in head blight resistance) possessed by plants of other species or genera.

  The head blight-resistant plant (Gramineae plant) according to the present invention is obtained by the production method according to the present invention. If the DNA fragment containing a locus having the phenotype of resistance to head blight (redhead fungus resistance type) is introduced into the plant that is resistant to head blight (Poaceae), When a DNA fragment containing a locus having a phenotype susceptibility to head blight (redhead mold susceptibility type) is introduced, the cultivar is more resistant to mold blight and is more resistant to head blight resistance of the original variety. It becomes a weak variety. Therefore, it is preferable to introduce a DNA fragment containing a locus having a head blight resistance type.

  In addition, a DNA fragment containing a head blight resistance factor (locus involved in head blight resistance) to be introduced into a plant (for example, wheat such as barley) is a DNA fragment on the 2H chromosome, on the 4H chromosome. DNA fragment of 5H chromosome, DNA fragment of 6H chromosome, any of the DNA fragments is resistant to Fusarium head blight (for example, Gramineae plants (eg, barley and other wheat)). Although it can be produced, resistance to head blight is further improved by introducing a plurality of DNA fragments into the genomic DNA of the same plant (for example, grasses such as barley). Plant (Poaceae) can be produced.

  The inventors of the present invention used a 2H chromosome for a DNA fragment (hereinafter referred to as a “vrs1 fragment”) containing a Fusarium head blight resistance factor that coincides with the locus of the streak gene vrs1 (locus involved in head blight resistance). It has been confirmed that resistance to head blight is improved by introducing the above DNA fragment or the DNA fragment on the 5H chromosome into a barley introduced alone, compared to the case of single introduction. Furthermore, it has been confirmed that when the above-mentioned vrs1 fragment is introduced into a barley into which both a DNA fragment on the 2H chromosome and a DNA fragment on the 5H chromosome have been introduced, resistance to head blight is further improved.

  According to the Fusarium head blight-resistant gramineous plants including the head blight-resistant barley according to the present invention obtained by the above method, the quality / harvesting amount has been reduced due to the head blight of the head until now, and the head blight was infected. It is possible to effectively avoid harm to the human body and livestock by eating the plant, which is extremely effective for agriculture and livestock industry. It can also improve the food shortage problem.

  In addition, the above-mentioned “Red mold resistant plant”, “Red mold resistant gramineous plant” and “Red mold resistant barley” are plants that did not have resistance at all to Fusarium mold ( Plants produced by conferring resistance to head blight (for example, barley and other wheat), and originally red Plants (such as barleys) produced by further enhancing resistance to head blight (plants such as barley) such as plants that are resistant to mold It includes wheat))).

<Determination method of plant resistant to head blight (Poaceae)>
The determination method (selection method) of the head blight-resistant plant (Gramineae plant) according to the present invention may be any method including the step of detecting the genetic marker according to the present invention, and other steps, conditions, and materials. Etc. are not particularly limited. For example, a conventionally known crop breeding method can be used.

  More specifically, for example, there is a method of extracting (selecting) a plant by extracting genomic DNA of a plant produced by crossing or the like and using the genotype of the genetic marker according to the present invention as an index. As a means for detecting a genetic marker, for example, with respect to a DNA fragment amplified using any of the first to eighteenth primer sets using genomic DNA extracted from a target plant as a template, fragment length or fragment restriction The observation of enzyme digestion patterns can be mentioned. From the amplified fragment, determine whether the test plant individual has a resistance genotype or a susceptibility genotype for the allele of the locus involved in resistance to head blight resistance using each genetic marker as an index The method of performing is as described in the section of the genetic marker according to the present invention.

  Here, the determination accuracy (probability) of this determination method is as follows. The genetic marker located at a distance of 1.2 cM from the Fusarium head blight resistance factor (locus involved in Fusarium head blight resistance) is Fusarium head blight resistance factor (locus involved in Fusarium head blight resistance) and On average, 12/1000 transfers per chromatid between genetic markers. That is, recombination occurs with a probability of about 1.2%. Therefore, if this genetic marker is detected to be resistant to head blight, it has a 98.8% probability of having head blight resistance factor (locus related to head blight resistance). I can say that. Therefore, the closer to the genetic marker, the smaller the resistance between head blight resistance factor (locus related to head blight resistance) and the genetic marker, the higher the probability of head blight resistance factor (locus related to head blight resistance). It can be said that the presence or absence of cane can be determined, that is, a head blight resistant gramineous plant can be determined (selected).

  For the above reasons, any genetic marker for detecting a polymorphism can determine the presence or absence of head blight resistance in any of the above genetic markers. It is preferable to detect a genetic marker that sits as close as possible to the gene locus involved in resistance. For example, in this determination method, when detecting a genetic marker linked to the head blight resistance factor (locus involved in head blight resistance) on the 4H chromosome, “k05042” (head blight resistance factor ( Distance from the locus responsible for head blight resistance: about 1.2 cM) Distance from “k03289” (redhead fungus resistance factor (gene locus involved in head blight resistance): about 1.2 cM) 4.0 cM).

  In the present detection method, polymorphisms of a plurality of genetic markers may be detected. In particular, in order to improve the accuracy (probability) of the determination, it is only necessary to detect a polymorphism by selecting a genetic marker that is sandwiched between the Fusarium head blight resistance factors (locus involved in Fusarium head blight resistance). . For example, “k05042” (reduce mildew resistance factor (locus involved in red mold resistance) to about 1.2 cM on the short arm side) and “k03289” (red mold resistance factor (red mold resistance) There is a combination with a distance from a locus related to sex): about 4.0 cM). Taking this combination as an example, the accuracy (probability) of this determination method in the case where the polymorphism of each genetic marker is detected alone and in the case where both polymorphisms are detected will be described more specifically.

  “K05042” sits at a position of about 1.2 cM on the short arm side from the Fusarium head blight resistance factor (locus involved in Fusarium head blight resistance) and detects the polymorphism of the genetic marker alone In this case, the accuracy (probability) of this determination method is (1-12 ÷ 1000) × 100 = about 98.8%. On the other hand, “k03289” is located at a distance of about 4.0 cM from the head blight resistance factor (locus involved in head blight resistance). The accuracy (probability) of this determination method when a type is detected is similarly calculated to be 96.0%. When both polymorphisms of the two genetic markers are detected, (1− (12 ÷ 1000) × (40 ÷ 1000)) × 100 = 99.952% with high probability, resistance factor for head blight on 4H Presence or absence of (locus involved in resistance to head blight) can be determined.

  Therefore, it is preferable to detect and determine a genetic marker having a relationship sandwiching a Fusarium head blight resistance factor (locus involved in Fusarium head blight resistance). Combinations other than “k05042” and “k03289” include “MMtgaEatc128” and “FMgcgEatc530”, “FMacgEcgt288” and “HVM67”, “FMataEagc408” and “HVM11”, and “Bmag125” And a combination of “k04002”, a combination of “HvLOX” and “k00835”, and the like.

  In addition, this determination method can be used as an effective screening means in breeding a head blight resistant plant (Poaceae (for example, barley including barley)). For example, when the method for producing a head blight-resistant plant (Gramineae plant (for example, barley including barley)) according to the present invention is performed, the head blight resistance factor (head blight resistance) It is possible to easily screen a transformant plant (for example, a grass family (for example, barley such as barley)) into which a DNA fragment containing a gene locus (involved gene locus) is introduced from a large number of transformant candidates. It can also be used as a screening means for plants that have undergone breeding treatment such as mutation treatment and mating of drugs, etc. (for example, gramineous plants (for example, barley including barley)).

<Evaluation kit for head blight resistant plant (Poaceae)>
In addition, a kit for reagents and enzymes necessary for carrying out the above “determination method for head blight-resistant plant (Poaceae)” makes a kit for determining head blight-resistant plant (Poaceae). (Hereinafter referred to as “determination kit” as appropriate). As described in the above section of “Redhead rot resistant plant (method for determining Gramineae)”, by using the genetic marker according to the present invention, the test Gramineous plant individual can It is possible to determine whether an allele (locus involved in head blight resistance) has a resistance genotype or a susceptibility genotype. That is, it is possible to determine whether the test target plant individual (test target Gramineae solid) is resistant to head blight or susceptibility. Therefore, according to the said determination kit, there exists an effect that a Fusarium head blight-resistant plant (Poaceae plant) can be determined more simply.

  The determination kit preferably includes at least one or more primer sets (first to eighteenth primer sets) capable of detecting at least the genetic marker according to the present invention. More preferably, it is preferable that all of the above primer sets (first to eighteenth primer sets) are included. In addition, a primer necessary for detecting a known marker linked to head blight resistance may be included.

  Furthermore, the determination kit may contain enzymes and reagents for performing PCR, as well as reagents, buffers, and centrifuge tubes necessary for preparing genomic DNA as a template. Also, genetic markers required for detection of the target DNA size band (MMtgaEatc128, FMgcgEatc530, FXLRRfor_XLRRrev119, FMacgEcgt288, HVM67, FMataEagc408, HVM11, Bmag125, k04002, k05042, k03289, HvLOX, k00835, etc.) Markers may be included.

<Gene detection instrument (DNA microarray, etc.)>
Genetic markers according to the present invention (MMtgaEatc128, FMgcgEatc530, FXLRRfor_XLRRrev119, FMacgEcgt288, HVM67, FMataEagc408, HVM11, Bmag125, k04002, k05042, k03289, HvLOX, k00835, etc.) on a suitable substrate (glass, silicon wafer, nylon membrane, etc.) By fixing, a gene detection instrument such as a DNA microarray can be constructed. To detect a plurality of genetic markers according to the present invention easily and simultaneously by reacting a probe prepared from a plant to be tested to the gene detection instrument (DNA microarray, etc.) and detecting a signal emitted at that time. Is possible. Therefore, the gene detection instrument (DNA microarray or the like) can be used as a means for detecting a polymorphism of a genetic marker according to the present invention. Therefore, it can be used as a detection means in the determination method of the above-mentioned head blight resistant plant (Poaceae). Moreover, the said gene detection instrument (DNA microarray etc.) can also be added to the determination kit of the said Fusarium head blight-resistant plant (Poaceae plant). In this case, the kit may contain reagents, instruments, devices, etc. used to detect signals from gene detection instruments (DNA microarrays, etc.).

  The genetic markers (MMtgaEatc128, FMgcgEatc530, FXLRRfor_XLRRrev119, FMacgEcgt288, HVM67, FMataEagc408, HVM11, Bmag125, k04002, k05042, k03289, HvLOX, k00835, etc.) on the substrate of this gene detection instrument (DNA microarray etc.) Of these, at least one or more genetic markers may be fixed. In addition, either one or both of a resistance type genetic marker and a susceptibility type genetic marker may be fixed. In order to determine the presence or absence of Fusarium head blight resistance factor (locus involved in Fusarium head blight resistance) with higher accuracy (probability), it is involved in Fusarium head blight resistance factor (Blast blight resistance factor) It is preferable that a combination of a plurality of genetic markers having a relationship sandwiching a gene locus) is fixed. As a combination of such genetic markers, for example, a combination of “k05042” and “k03289”, a combination of “MMtgaEatc128” and “FMgcgEatc530”, a combination of “FMacgEcgt288” and “HVM67”, “FMataEagc408” and “HVM11” A combination of “Bmag125” and “k04002”, a combination of “HvLOX” and “k00835”, and the like. Needless to say, it is most preferable that all genetic markers (resistant type and susceptible type) are fixed.

  By using a gene detection instrument (DNA microarray or the like) to which the plurality of genetic markers are fixed, the plurality of genetic markers can be easily detected in one trial. Further, the presence or absence of a head blight resistance factor (locus involved in head blight resistance) can be determined with high accuracy (probability).

  In addition, not only the genetic marker according to the present invention but also other genetic markers located in the vicinity thereof may be fixed to the gene detection instrument (DNA microarray or the like).

  Furthermore, in the gene detection instrument (DNA microarray or the like), the genetic markers according to the present invention are fixed in the order in which they are arranged on the barley chromosome, or the sequence positions corresponding to the order in which they are arranged on the barley chromosome It is preferable that information is given and fixed. This is because the detection accuracy can be further improved when the test object is a barley. In other words, in the analysis using a conventional DNA microarray, if a signal for a certain spot is not obtained, is there a genetic marker that is really to be detected, or is there no signal obtained due to an experimental error in the analysis? As for, it could not be judged accurately without reconfirmation. In contrast, genetic markers are fixed in the order in which they are arranged on the barley chromosome as described above, or sequence position information corresponding to the order in which they are arranged on the barley chromosome is given and fixed. When using a gene detection instrument (DNA microarray, etc.), it is arranged so that the order of immobilized genetic markers on the chromosome can be confirmed. It is possible to easily determine.

  Specifically, for example, it is assumed that a signal is obtained at spots before and after a spot where no signal was obtained. In the gene detection instrument (DNA microarray or the like), the spots are arranged so that the order in which they are arranged on the chromosome can be confirmed. Usually, in order for only one gene to be recombined on a chromosome in close proximity on a straight line, two recombination must occur in close proximity. Since the probability of such a phenomenon occurring is extremely low, the result that a signal was not obtained is judged to be due to an experimental error. In this way, the gene detection instrument (such as a DNA microarray) can easily determine whether or not there is an experimental error even when a signal for a certain spot is not obtained. Can be improved.

  The base sequence used in the description of the present invention is a base sequence in which one or several bases are substituted, deleted, or added as long as the genetic marker according to the present invention can be amplified. It goes without saying that a primer having the following may be used.

  Hereinafter, the present invention will be described more specifically with reference to examples, but the present invention is not limited thereto.

[Example 1: QTL analysis on resistance to head blight of barley]
QTL analysis was performed to search for the resistance factor of head blight of barley.

  <Material> Recombinant inbred lines (RI lines) bred from crosses of barley varieties Russia 6 (Nijo, resistant) and H.E.S.4 (Shijo, susceptible) with greatly different resistance to head blight.

<Method for evaluating resistance to head blight>
Evaluation was made by a modification of the “cut ear test method” (see Non-Patent Document 4). Briefly, it was performed as follows.

  The material was cultivated according to the customary method, and a leaf was cut at the flowering stage of each line, and the ears were cut off at the second node from the top, and then placed on a stainless steel vat that was flushed with tap water. On the other hand, the suspension adjusted so that the conidia of a Fusarium head blight mold might be about 15 per 200-times microscope visual field was fully sprayed. The plants were cultivated in an artificial weather room at 25 ° C./humidity 100% for 2 days after conidial inoculation, and at 18 ° C./humidity 90% for 6 days thereafter. The light conditions were a day length of 14 hours and an illuminance of about 10,000 lux. On the 8th day after conidia inoculation, the susceptibility spike ratio was investigated by using the buds that were observed with the naked eye and turned yellowish brown to be affected grains, and 0 (resistance) to 10 (susceptibility) according to the criteria shown in Table 3 It is evaluated by the score.

Moreover, simple interval mapping (SIM) and composite interval mapping (CIM) were used for the algorithm of QTL analysis, and MAPMAKER / QTL and QTL Cartographer were used for the analysis software, respectively.

  FIG. 3 shows the results of the QTL analysis, particularly the CIM results. The QTL analysis was performed twice for the same population, and the respective results are shown (the first result is indicated by a solid line and the second result is indicated by a broken line). FIG. 3 (a) shows the results of QTL analysis for the 2H chromosome, and FIG. 3 (b) shows the results of QTL analysis for the 5H chromosome. The horizontal axis shows the locus on the chromosome, the left side shows the short arm side (5 'end side), and the right side shows the long arm side (3' end side). On the other hand, the vertical axis represents the LOD score (LOD score: log likelihood). This LOD score is a measure of the linkage between the gene that controls the characteristics of head blight resistance (head blight resistance factor) and the genetic marker present at that locus. Generally, when the LOD score exceeds 2 or 3 Furthermore, it is presumed that the genetic marker and QTL are linked. In other words, it can be assumed that there is a Fusarium head blight resistance factor at that locus.

  From the results of FIG. 3 (a), two QTLs related to Fusarium head blight resistance are detected on the 2H chromosome of barley, and from the results of FIG. 3 (b), one QTL regarding Fusarium head blight resistance is detected on the 5H chromosome. was detected. One of the QTLs detected on the 2H chromosome of barley coincided with the position of the known striatal gene (vrs1) (indicated by the arrow in FIG. 3 (a)), indicating the possibility of pleiotropic expression of the vrs1 gene. It was suggested. This result is a result that supports the involvement of streak in resistance to head blight. However, the genes present at other QTL loci are unknown, and it was considered that there was a resistance factor for head blight disease other than the streak gene. Here, the Fusarium head blight resistance factor present on the 2H chromosome of barley and located at a locus different from the location of the vrs1 gene is named “2H-2 factor”, and it sits on the 5H chromosome of barley. Was named “5H-1 factor”.

  Based on the information of the high-density linkage map prepared by the inventors, a genetic marker located in the vicinity of the locus of the head blight resistance factor 2H-2 factor, 5H-1 factor is searched. The present inventors have found a genetic marker that is strongly linked to a mold resistance factor, that is, a genetic marker according to the present invention. MM314 and FM677 were discovered as genetic markers linked to factor 2H-2. In addition, FM426 and MM1057 were discovered as genetic markers linked to 5H-1 factor.

  Since these genetic markers are all AFLP markers, each was converted to STS, and primers for amplification of each genetic marker were designed from the sequence information. MM314 can be amplified using the first primer set shown in SEQ ID NO: 1 and SEQ ID NO: 2, and FM677 can be amplified using the second primer set shown in SEQ ID NO: 3 and SEQ ID NO: 4. On the other hand, FM426 can be amplified using the third primer set shown in SEQ ID NO: 5 and SEQ ID NO: 6, or the fourth primer set shown in SEQ ID NO: 5 and SEQ ID NO: 7.

[Example 2: Judgment of presence or absence of resistance factor of head blight disease by detection of genetic marker (judgment of barley blight resistance barley)]
By detecting the genetic marker according to the present invention, it was determined whether or not the test barley had a head blight resistance factor. Based on the results, barley-resistant barley was determined.

<Barley to be tested>
Recombinant inbred lines (RI lines) bred from crosses of barley varieties Russia 6 (Nijo, resistant) and HES4 (Six, resistant) with greatly different resistance to head blight were used.

<Extraction of DNA>
DNA from leaflets of the above-mentioned RI strain grown in a greenhouse by the method of Lanbrige et al. (See Peter Langrige, Angelo Karakousis and Jan Nield. (1997) Practical Workshop in Basic Recombinant DNA Techniques Course Manual. Waite Agricultural Research Institute University of Adelaide.) Extracted. The DNA concentration was measured by a spectrophotometer and 1% agarose gel electrophoresis, and adjusted to 1 μg / μl by adding RNase and 1 × TE.

<PCR>
The composition of the PCR reaction solution was 5 U / μl TaKaRa Ex Taq ^™ (manufactured by Takara Bio Inc.) 0.05 μl, 10 × PCR Buffer 1 μl, 2.5 mM dNTPs 0.8 μl, 10 μM Primer (sense primer, antisense primer) 0. 25 μl and template DNA 1 μl were mixed and made up to 10.0 μl with distilled water.

  The amplification reaction was performed under the conditions shown in FIG.

<HhaI digestion>
PCR product 10 μl, 10 × M buffer (manufactured by Takara Bio Inc.) 1 μl, HhaI (manufactured by Takara Bio Inc.) 0.2 μl were mixed, and the total volume was made 10 μl with distilled water.

  The reaction was performed overnight at 37 ° C.

<Detection of DNA band>
An equal amount of formamide dye was added to the PCR product, heated at 95 ° C. for 5 minutes, and then rapidly cooled in ice. This sample was subjected to electrophoresis (280 V, 3 hours) on a 7% polyacrylamide gel (acrylamide: bisacrylamide = 19: 1, urea: 8.5 M, 0.5 × TBE). DNA staining was performed with TMVistra Green nucleic acid gel stain (Amersham pharmacia biotech co.). For detection of DNA bands, a method using LAS-1000plus (manufactured by Fuji Film) or a silver staining method using sil-Best Stain for Protein / PAGE (manufactured by Nacalai Tesque) (Yasuyoshi Kanno, 1997, “Detection and labeling of amplified fragment 5: Silver staining, forefront of PCR method, from basic technology to application”, Takeo Sekiya and Hen Fujinaga, Kyoritsu Shuppan, p. 85-87).

  In addition, the DNA band was detected by the above method after digesting the PCR product with an appropriate restriction enzyme as necessary.

<Result>
FIG. 5 (a) shows the results of electrophoresis performed on the PCR products obtained by PCR using genomic DNAs from Russia 6, HES4, and RI strains as templates using the primers shown in SEQ ID NOs: 1 and 2. Indicated.

  FIG. 5 (a) shows the result of PCR using primers having the nucleotide sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2, so that the polymorphism of the genetic marker MM314 according to the present invention was detected. . The results of Russia 6, H.E.S.4, and each RI system (RI lines) are shown in order from the left lane of FIG. Thus, the> 524 bp fragment found in the resistant Russia 6 lane is the resistant MM314. Thus, if such a> 524 bp fragment is detected in the RI strain, it can be determined that the RI strain is likely to have factor 2H-2, and the RI strain may be a head blight resistant barley. It can be judged that the nature is high. That is, it can be judged that a1, a2, a4, and a5 among the RI strains in FIG. 5 (a) are likely to have 2H-2 factor, and the RI strain is resistant to head blight resistance. It was possible to judge that there is a high possibility of being.

  On the other hand, the RI strain having a> 581 bp fragment found in the susceptible HES4 lane is likely not to have 2H-2 factor, and can be judged to be highly likely to be susceptible to head blight. . That is, a3 of RI strains in FIG. 5 (a) has a high possibility of not having 2H-2 factor, and it could be judged that there is a high possibility that it is a barley-susceptible barley.

  Next, PCR products obtained by performing PCR using genomic DNA from Russia 6, HES4, and RI strains as a template using primers having the nucleotide sequences shown in SEQ ID NO: 5 and SEQ ID NO: 7 were digested with HhaI. The result of electrophoresis is shown in FIG.

  By performing PCR using primers having the nucleotide sequences shown in SEQ ID NO: 5 and SEQ ID NO: 7, the polymorphism of the genetic marker FM426 according to the present invention was detected. However, since FM426 has the same size of the amplified fragment obtained as shown in Table 2, it cannot detect the polymorphism of the genetic marker even when the amplified product itself is subjected to electrophoresis. Thus, as shown in FIGS. 2 (c) and 2 (d), a restriction enzyme that cleaves the amplified product of Fusarium head blight-resistant barley, Russia 6, but does not cleave the amplified product of barley HES4, which is susceptible to Fusarium head blight, ie, HhaI. It was decided to determine whether or not it is a genetic marker according to the present invention by confirming the size of the cut fragment.

  More specifically, when the amplified fragment (254 bp) obtained by this amplification reaction is digested with HhaI and a 194 bp and a 60 bp fragment are detected, a resistant genetic marker (FM426) is used. If it can be determined that there is only a 254 bp fragment without being cleaved, it can be determined that it is a susceptibility type genetic marker (FM426).

  FIG. 5 (b) shows the electrophoresis results of the HhaI digests of the above amplified fragments, and shows the results of Russia 6, H.E.S.4, and each RI line (RI lines) in order from the left lane. According to the result of FIG. 5 (b), 194 bp and 60 bp fragments are certainly seen in the lane of the resistant barley variety, Russia 6, and only the 254 bp fragment is found in the lane of the susceptible barley variety, HES4. You can see it. Therefore, if such 194 bp and 60 bp fragments are detected in each RI strain, it can be determined that the RI strain is likely to have 5H-1 factor. Furthermore, the RI strain is a head blight resistant barley. It can be determined that there is a high possibility. That is, it can be judged that b3 and b4 among RI lines in FIG. 5 (b) are highly likely to have 5H-1 factor, and the RI line may be a head blight resistant barley. Can be determined to be high.

  On the other hand, the RI strain having a 254 bp fragment is highly likely not to have 5H-1 factor, and can be judged to be highly likely to be a head blight susceptible barley. That is, b1, b2 and b5 among the RI lines in FIG. 5 (b) are highly likely not to have the 5H-1 factor, and it can be determined that there is a high possibility that the barley is susceptible to head blight.

[Example 3: Relationship between the result of determination of head blight resistance barley according to the present invention and the head blight resistance score]
The relationship between the result of determining whether or not a barley-resistant barley was determined using a genetic marker as an index and the score of the head blight resistance was examined.

<Barley to be tested>
Recombinant inbred lines (RI lines) bred from crosses of barley varieties Russia 6 (Nijo, resistant) and HES4 (Six, susceptible) with greatly different resistance to head blight were used (n = 121).

<Red mold resistance score>
The head blight resistance score (Scab score) was evaluated by a modification of the “cut ear test method” (see Non-Patent Document 4). Briefly, it was performed as follows.

  The barley (RI line) to be tested is cultivated by the conventional method, and the leaves are cut off at the flowering stage of each line and the ears are cut off between the second nodes from the top. Standing on the bat. On the other hand, the suspension adjusted so that the conidia of a Fusarium head blight mold might be about 15 per 200-times microscope visual field was fully sprayed. The plants were cultivated in an artificial weather room at 25 ° C./humidity 100% for 2 days after conidial inoculation, and at 18 ° C./humidity 90% for 6 days thereafter. The light conditions were a day length of 14 hours and an illuminance of about 10,000 lux. On the 8th day after conidia inoculation, the susceptibility spike ratio was investigated by using the buds that were observed with the naked eye and turned yellowish brown to be affected grains, and 0 (resistance) to 10 (susceptibility) according to the criteria shown in Table 3 (See Table 3).

<Detection of genetic markers>
The genetic marker was determined in the same manner as in Example 2 above by determining whether the genetic marker was resistant or susceptible. The head blight resistance factor to be judged was 2H-2 factor, 5H-1 factor and the vrs1 gene.

<Result>
The results are shown in FIG. The horizontal axis of FIG. 6 shows the head blight resistance score (Scab score), and the vertical axis shows the number of individuals (No. of RI lines). In addition, the arrows indicate the Fusarium head blight resistance score of Russia 6 which is resistant to head blight and HES4 which is susceptible to head blight. Also, the black symbols in the figure indicate the results of the Fusarium head blight resistance score for RI strains in which all three genetic markers showed the Fusarium head blight resistance type, and the hatched symbols represent all three genetic markers. The red mold resistance score for the RI strains that showed the susceptibility type is shown, and the open symbol shows the resistance to red mold disease for the RI strains that had both genetic and resistant genetic markers. Shows the score.

  According to the results of FIG. 6, RI strains in which all three genetic markers showed the head blight resistance type have a low head blight resistance score value, that is, a probability that they are a head blight resistance cultivar is high. It was found that RI strains for which all three genetic markers showed susceptibility had a high resistance to head blight resistance, that is, there was a high probability that the strain was susceptible to head blight.

  Therefore, it was found that the method for judging whether or not the barley-resistant barley using the genetic marker according to the present invention as an index is extremely effective.

[Example 4: QTL analysis on resistance to head blight of barley]
QTL analysis was performed to search for loci involved in resistance to head blight of barley.

<Material>
RI strains (RHI population), Harbin 2-row (resistance) and Turkey 6 (rabbit) bred from crosses of barley varieties Russia6 (two-row, resistance) and HES4 (six-row, susceptibility) with different resistance to head blight RI strain (RI2 population) bred from crossing (disease) and RI strain (DHHS population) bred from mating Haruna Nijo (resistance) and H602 (susceptibility) were used.

<Method for evaluating resistance to head blight>
Evaluation was made by a modification of the “cut ear test method” (see Non-Patent Document 4). Briefly, it was performed as follows.

  The material was cultivated according to the customary method, and it was put on a stainless steel bat that was flushed with tap water against the cuts of the second node from the top with leaves attached at the flowering period of each line. . On the other hand, the suspension adjusted so that the conidia of a Fusarium head blight mold might be about 15 per 200-times microscope visual field was fully sprayed. The plants were cultivated in an artificial weather room at 25 ° C./humidity 100% for 2 days after conidial inoculation, and at 18 ° C./humidity 90% for 6 days thereafter. The light conditions were a day length of 14 hours and an illuminance of about 10,000 lux. Eight days after the conidial inoculation, the susceptibility spikelet ratio was investigated using the spiked buds that were observed with the naked eye and turned yellowish brown, and 0 (resistance) to 10 (susceptibility) according to the criteria shown in Table 1. It is evaluated by the score.

Further, composite interval mapping (CIM) was used as an algorithm for QTL analysis, and MAPMAKER / QTL and QTL Cartographer were used as analysis software, respectively. The threshold of the LOD score was set to 2, and when the LOD score exceeded 2, the presence of QTL was estimated at the position with the largest LOD in the two marker sections.

<Result>
The results of the RHI population are shown in Table 5, the results of the RI2 population are shown in Table 6, and the results of the DHHS population are shown in Table 7.

As is clear from Table 5, in the RHI population, one QTL involved in head blight resistance was detected on the 2H chromosome and one on the 4H chromosome. Of these, QTL involved in resistance to head blight detected on the 2H chromosome was already detected by the inventors' previous studies. Therefore, by this examination, one QTL involved in resistance to Fusarium head blight was newly discovered on the 4H chromosome.

  The QTL sits at a position between the genetic markers MMtgaEatc128 and 0.0 cM from the genetic marker FMgcgEatc530 and a distance of 8.0 cM on the short arm side, and the LOD score is 2.7. is there. This QTL can explain 12.4% of the phenotypic variance. In addition, the presence of this QTL lowers the score of the “cut ear test method” by 1.1 (that is, the resistance increases).

The RI2 population was subjected to QTL analysis twice, and in the first QTL analysis, one QTL involved in head blight resistance was detected on the 2H chromosome. In addition, by the second QTL analysis, one was detected on the 4H chromosome and one on the 6H chromosome.

  The QTL detected on the 2H chromosome sits at a position sandwiched between both genetic markers at a distance of 0.2 cM from the genetic marker FXLRRfor_XLRRrev119 to the long arm side and a distance of 3.3 cM from the genetic marker FegtaMacg677 to the short arm side. The LOD score is 2.6. This QTL can explain 10.1% of the phenotypic variance. Further, the presence of this QTL lowers the score of the above-mentioned “cut ear test method” by 1.3 (that is, the resistance increases).

  The QTL detected on the 4H chromosome sits at a position sandwiched between both genetic markers at a distance of 0.3 cM from the genetic marker FMacgEcgt288 to the long arm side and a distance of 46.8 cM from the genetic marker HVM67 to the short arm side. The LOD score is 2.2. This QTL can explain 25.5% of the phenotypic variance. In addition, the presence of this QTL lowers the score of the “cut ear test method” by 0.9 (that is, the resistance increases).

  The QTL detected on the 6H chromosome sits at a position sandwiched between both genetic markers at a distance of 4.1 cM from the genetic marker FMataEagc408 to the long arm side and 9.4 cM from the genetic marker HVM11 to the short arm side. The LOD score is 2.7. This QTL can explain 28.6% of the phenotypic variance. In addition, the presence of this QTL lowers the score of the “cut ear test method” by 1.0 (that is, the resistance increases).

As is clear from Table 7, in the DHHS population, one QTL involved in resistance to head blight was detected on the 2H chromosome, one on the 4H chromosome, and one on the 5H chromosome.

  The QTL detected on the 2H chromosome sits at a position sandwiched between both genetic markers at a distance of 0.0 cM from the genetic marker Bmag125 and at a distance of 10.0 cM from the genetic marker k04002 to the short arm side. The score is 2.0. This QTL can explain 12.2% of the phenotypic variance. In addition, the presence of this QTL lowers the score of the above-mentioned “cut ear test method” by 2.2 (that is, the resistance increases).

  The QTL detected on the 4H chromosome sits at a position sandwiched between both genetic markers at a distance of 1.2 cM from the genetic marker k05042 to the long arm side and a distance of 4.0 cM from the genetic marker k03289 to the short arm side. The LOD score is 3.2. This QTL can explain 27.7% of the phenotypic variance. In addition, the presence of the QTL increases the score of the above-mentioned “cutting head test method” by 2.8 (that is, the resistance decreases).

  The QTL detected on the 5H chromosome sits at a position sandwiched between both genetic markers at a distance of 0.5 cM from the genetic marker HvLox to the long arm side and a distance of 1.9 cM from the genetic marker k00835 to the short arm side. The LOD score is 3.1. This QTL can explain 19.7% of the phenotypic variance. In addition, the presence of this QTL lowers the score of the “cut ear test method” by 2.4 (that is, the resistance increases).

In Tables 5 to 7, “Chromosome” means “chromosome on which genetic marker is located”, “Marker interval (M1-A-QTL-B-M2)” is located near “QTL”, “Two genetic markers (M1, M2) sandwiching the QTL” means “Distance (cM) A + B” means “distance between two genetic markers sandwiching the QTL”, “Position ^a” (cM ) A ”means“ distance between genetic marker M1 and QTL ”,“ Position (cM) B ”means“ distance between genetic marker M2 and QTL ”, and“ LOD ^{b ”} Score means“ LOD score ” "Var. (%) ^C" means "a value indicating what (%) of the phenotypic variance can be explained by the presence of QTL", and "Weight ^d " ⁾ " Means "a value indicating how much the score of the above-mentioned" cut ear test method "increases due to the presence of QTL".

[Example 5: Detection of genetic marker "MMtgaEatc128"]
(Method)
50 ng of test barley genomic DNA was double digested at 37 ° C. for 12 hours in a total reaction volume of 25 μl using 1.5 U of EcoRI (manufactured by Takara Bio) and MseI (manufactured by NEW ENGLAND BioLabs). 25 μM EcoRI adapter (base sequences are shown in SEQ ID NO: 14 and SEQ ID NO: 15) and 50 μM MseI adapter (base sequences are shown in SEQ ID NO: 16 and SEQ ID NO: 17) were added to 25 U T4 ligase (Takara Bio). Ligation was performed at 37 ° C. for 3 hours. The ligated DNA fragment was subjected to preamplification (preliminary amplification) using EcoRI universal primer (base sequence is shown in SEQ ID NO: 18) and MseI universal primer (base sequence is shown in SEQ ID NO: 19). . Amplification reaction of 0.07 mg / ml preamplification reaction solution using an EcoRI selective primer having the nucleotide sequence shown in SEQ ID NO: 33 and an MseI selective primer having the nucleotide sequence shown in SEQ ID NO: 32 ( This amplification) was performed. Note that TaKaRa Ex Taq (manufactured by Takara Bio Inc.) was used for the proliferation reaction.

  In the pre-amplification reaction cycle, 94 ° C. for 2 minutes followed by 94 ° C. for 30 seconds → 56 ° C. for 1 minute → 72 ° C. for 1 minute 20 times.

  The amplification reaction cycle is 94 ° C. for 30 seconds → 68 ° C. for 30 seconds → 72 ° C. for 1 minute, and then 94 ° C. for 30 seconds → 68 ° C. for 30 seconds → 72 ° C. for 30 seconds → 94 ° C. for 30 seconds → 67.3 ° C. for 30 minutes. → 72 ° C 1 minute → 94 ° C 30 seconds → 66.6 ° C 30 seconds → 72 ° C 1 minute → 94 ° C 30 seconds → 65.9 ° C 30 seconds → 72 ° C 1 minute → 94 ° C 30 seconds → 65.2 ° C 30 seconds → 72 ° C 1 minute → 94 ° C 30 seconds → 64.5 ° C 30 seconds → 72 ° C 1 minute → 94 ° C 30 seconds → 63.8 ° C 30 seconds → 72 ° C 1 minute → 94 ° C 30 seconds → 63.1 30 ° C. → 72 ° C. 1 minute → 94 ° C. 30 seconds → 62.4 ° C. 30 seconds → 72 ° C. 1 minute → 94 ° C. 30 seconds → 61.7 ° C. 30 seconds → 72 ° C. 1 minute → 94 ° C. 30 seconds → 61. 0 ° C 30 seconds → 72 ° C 1 minute → 94 ° C 30 seconds → 60.3 ° C 30 seconds → 72 ° C Minutes → 94 ° C. 30 seconds → 59.6 ° C. 30 seconds → 72 ° C. 1 minute → 94 ° C. 30 seconds → 58.9 ° C. 30 seconds → 72 ° C. 1 minute → 94 ° C. 30 seconds → 58.2 ° C. 30 seconds → 72 ° C. 1 minute → 94 ° C. 30 seconds → 57.5 ° C. 30 seconds → 72 ° C. 1 minute → 94 ° C. 30 seconds → 56.8 ° C. 30 seconds → 72 ° C. 1 minute, then 94 ° C. 30 seconds → 56 ° C. 30 seconds → 72 The process for 1 minute at 23 ° C. was performed 23 times.

(result)
FIG. 8 shows the result of electrophoresis performed on the amplified fragment obtained by the amplification reaction. The leftmost lane and the rightmost lane in FIG. 8 show size markers, and the second lane from the leftmost lane in FIG. 8 shows the results of the AFLP detection of the head blight resistant barley variety Russia6. The third lane from the leftmost lane shows the result of AFLP detection for HES4, a barley variety susceptible to head blight. For the other lanes, the results of AFLP detection for the recombinant inbred line (RI line) RHI population grown from the cross between Russia6 and HES4 are shown.

  According to the results shown in FIG. 8, the amplified fragments amplified by the above operation include a resistant type (Russia type 6) and a susceptible type (HES type 4) with respect to head blight. The fragment length of the resistant type (Russia type 6) is about 128 bp (indicated by an arrow in the figure), and that of the susceptible type (HES type 4) is 0 bp. In other words, the resistant type (Russia type 6) to Fusarium head blight can obtain an amplified fragment of about 128 bp, whereas the susceptible type (HES type 4) cannot obtain an amplified fragment of about 128 bp. That's what it means. Therefore, if the above-mentioned AFLP detection operation is performed on the test target plant and the presence or absence of the amplified fragment of about 128 bp is used as an index, the head mold resistance factor (red mold resistance) that the target plant individual sits on the 4H chromosome. It is possible to determine whether the alleles at the gene loci involved are resistant to genotypes or susceptible to genotypes.

[Example 6: Detection of genetic marker "FMgcgEatc530"]
(Method)
The method is the same as that described above except that an amplification reaction (main amplification) is performed using an EcoRI selective primer having the nucleotide sequence shown in SEQ ID NO: 35 and an MseI selective primer having the nucleotide sequence shown in SEQ ID NO: 34. Same procedure as shown in Example 5.

(result)
FIG. 9 shows the result of electrophoresis performed on the amplified fragment obtained by the amplification reaction. The leftmost lane and the rightmost lane in FIG. 9 show size markers, and the second lane from the leftmost lane in FIG. 9 shows the results of the AFLP detection for Russia 6 which is a head blight resistant barley variety. The third lane from the leftmost lane shows the result of AFLP detection for HES4, a barley variety susceptible to head blight. For the other lanes, the results of AFLP detection for the recombinant inbred line (RI line) RHI population grown from the cross between Russia6 and HES4 are shown.

  According to the results shown in FIG. 9, the amplified fragments amplified by the above operation include a resistance type (Russia type 6) and a susceptibility type (HES type 4) with respect to head blight. The fragment length of the resistant type (Russia type 6) is 0 bp, and that of the susceptible type (HES type 4) is about 530 bp (indicated by an arrow in the figure). In other words, the resistant type against Fusarium head blight (Russia type 6) cannot obtain an amplified fragment of about 530 bp, whereas the susceptible type (HES type 4) can obtain an amplified fragment of about 530 bp. That's what it means. Therefore, when the AFLP detection operation is performed on the test target plant and the presence or absence of the amplified fragment of about 530 bp is used as an index, the head fungus resistance factor (redhead disease resistance) that the target plant individual sits on the 4H chromosome. It is possible to determine whether the alleles at the gene loci involved are resistant to genotypes or susceptible to genotypes.

[Example 7: Detection of genetic marker "FXLRRfor_XLRRrev119"]
(Method)
Using primers having the nucleotide sequences shown in SEQ ID NOs: 22 and 23, amplification reaction was performed using the genomic DNA of the barley to be tested as a template. The reaction cycle was 94 ° C. for 5 minutes, followed by 94 ° C. for 1 minute → 45 ° C. for 1 minute → 72 ° C. for 2 minutes 45 times, and then 72 ° C. for 7 minutes.

(result)
FIG. 10 shows the result of electrophoresis performed on the amplified fragment obtained by the amplification reaction. The leftmost lane and rightmost lane in FIG. 10 show size markers, and the second lane from the leftmost lane in FIG. 10 shows the result of the amplified fragment for Harbin 2-row, a head blight resistant barley variety, The third lane from the leftmost lane shows the result of the amplified fragment of Turkey 6 of barley varieties susceptible to head blight. The other lanes show the results of amplified fragments for the recombinant inbred line (RI line) RI2 population grown from the cross of Harbin 2-row (resistant) and Turkey 6 (disease).

  According to the results of FIG. 10, the amplified fragments amplified by the above operation have a resistance type (Harbin 2-row type) and a susceptibility type (Turkey type 6) with respect to head blight. The fragment length of the amplified fragment is 0 bp for the resistant type (Harbin 2-row type) and about 119 bp (indicated by an arrow in the figure) for the susceptible type (Turkey 6 type). In other words, the resistant fragment (Harbin 2-row type) does not give an amplified fragment of about 119 bp, whereas the susceptible type (Turkey 6 type) has an amplified fragment of about 119 p. It is to be obtained. Therefore, if the above-mentioned AFLP detection operation is performed on the test target plant and the presence or absence of an amplified fragment of about 119 bp is used as an indicator, the head mold resistance factor (redhead disease resistance) that the target plant individual sits on the 2H chromosome. It is possible to determine whether the alleles at the gene loci involved are resistant to genotypes or susceptible to genotypes.

[Example 8: Detection of genetic marker "FmacgEcgt288"]
(Method)
The method is the same as that described above except that an amplification reaction (main amplification) is performed using an EcoRI selective primer having the nucleotide sequence shown in SEQ ID NO: 37 and an MseI selective primer having the nucleotide sequence shown in SEQ ID NO: 36. Same procedure as shown in Example 5.

(result)
FIG. 11 shows the result of electrophoresis performed on the amplified fragment obtained by the amplification reaction. The leftmost lane and the rightmost lane in FIG. 11 indicate size markers, and the second lane from the leftmost lane in FIG. 11 shows the results of amplified fragments for Harbin 2-row, a head blight resistant barley variety. The third lane from the leftmost lane shows the result of the amplified fragment of Turkey 6 of barley varieties susceptible to head blight. The other lanes show the results of amplified fragments for the recombinant inbred line (RI line) RI2 population grown from the cross of Harbin 2-row (resistant) and Turkey 6 (disease).

  According to the results shown in FIG. 11, the amplified fragments amplified by the above operation have a resistance type (Harbin 2-row type) and a susceptibility type (Turkey type 6) with respect to head blight. The fragment length of the amplified fragment is 0 bp for the resistant type (Harbin 2-row type) and about 288 bp for the susceptible type (Turkey 6 type) (indicated by an arrow in the figure). In other words, an resistant fragment (Harbin 2-row type) of about 288 bp cannot obtain an amplified fragment of about 288 bp, whereas an susceptible fragment (Turkey type 6) has an amplified fragment of about 288 p. It is to be obtained. Therefore, if the AFLP detection operation is performed on the test target plant and the presence or absence of an amplified fragment of about 288 bp is used as an index, the head fungus resistance factor (redhead disease resistance) that the target plant individual sits on the 4H chromosome. It is possible to determine whether the alleles at the gene loci involved are resistant to genotypes or susceptible to genotypes.

[Example 9: Detection of genetic marker “HVM67”]
(Method)
An amplification reaction was performed using primers having the nucleotide sequences shown in SEQ ID NOs: 38 and 39 and using the genomic DNA of the barley to be tested as a template. The reaction cycle was 94 ° C. for 3 minutes, 94 ° C. for 1 minute → 64 ° C. for 1 minute (decrease by 1 ° C. per cycle) → 72 ° C. for 1 minute 10 times, then 94 ° C. for 1 minute → 55 ° C. 1 30 minutes at 72 ° C. for 1 minute, and then 5 minutes at 72 ° C.

(result)
FIG. 12 shows the result of electrophoresis performed on the amplified fragment obtained by the amplification reaction. The leftmost lane in FIG. 12 shows the size marker, and the second lane from the leftmost lane shows the result of the amplified fragment of Harbin 2-row, a barley variety resistant to barley varieties, from the leftmost lane in the same figure. The third lane shows the result of an amplified fragment of Turkey 6 of a barley variety susceptible to head blight. The other lanes show the results of amplified fragments for the recombinant inbred line (RI line) RI2 population grown from the cross of Harbin 2-row (resistant) and Turkey 6 (disease).

  According to the results shown in FIG. 12, the amplified fragments amplified by the above operation have a resistance type (Harbin 2-row type) and a susceptibility type (Turkey type 6) with respect to head blight. The fragment length of the amplified fragment is 160 bp (indicated by an arrow in the figure) for the resistant type (Harbin 2-row type), and about 140 bp (the open arrow in the figure) for the susceptible type (Turkey 6 type). Is shown). Therefore, if the above-mentioned detection operation is performed on the test target plant and the presence or absence of an amplified fragment of about 160 bp or about 140 bp is used as an index, the plant head resistance factor (redhead disease) on which the target plant individual sits on the 4H chromosome. It is possible to determine whether an allele at a locus related to resistance has a resistance genotype or a susceptibility genotype.

[Example 10: Detection of genetic marker "FMataEagc408"]
(Method)
The method was carried out as described above, except that the amplification reaction (main amplification) was carried out using an EcoRI selective primer having the base sequence shown in SEQ ID NO: 45 and an MseI selective primer having the base sequence shown in SEQ ID NO: 44. Same procedure as shown in Example 5.

(result)
FIG. 13 shows the result of electrophoresis performed on the amplified fragment obtained by the amplification reaction. The left lane and the right lane in FIG. 13 show size markers, and the second lane from the left lane in FIG. 13 shows the result of the amplified fragment for Harbin 2-row, a head blight resistant barley variety. The third lane from the leftmost lane shows the result of the amplified fragment of Turkey 6 of barley varieties susceptible to head blight. The other lanes show the results of amplified fragments for the recombinant inbred line (RI line) RI2 population grown from the cross of Harbin 2-row (resistant) and Turkey 6 (disease).

  According to the results shown in FIG. 13, the amplified fragments amplified by the above operation have a resistance type (Harbin 2-row type) and a susceptibility type (Turkey type 6) with respect to head blight. The fragment length of the amplified fragment is 0 bp for the resistant type (Harbin 2-row type) and about 408 bp (indicated by an arrow in the figure) for the susceptible type (Turkey 6 type). In other words, an resistant fragment (Harbin 2-row type) of about 408 bp cannot obtain an amplified fragment of about 408 bp, whereas a susceptible type (Turkey type 6) has an amplified fragment of about 408 p. It is to be obtained. Therefore, if the above-mentioned AFLP detection operation is performed on the test target plant and the presence or absence of an amplified fragment of about 408 bp is used as an index, the target plant individual is resistant to head blight resistance (redhead disease resistance). It is possible to determine whether the alleles at the gene loci involved are resistant to genotypes or susceptible to genotypes.

[Example 11: Detection of genetic marker “HVM11”]
(Method)
Using primers having the nucleotide sequences shown in SEQ ID NOs: 46 and 47, amplification reaction was performed using the genomic DNA of the barley to be tested as a template. The reaction cycle was 94 ° C. for 3 minutes, 94 ° C. for 1 minute → 64 ° C. for 1 minute (decrease by 1 ° C. per cycle) → 72 ° C. for 1 minute 10 times, then 94 ° C. for 1 minute → 55 ° C. 1 30 minutes at 72 ° C. for 1 minute, and then 5 minutes at 72 ° C.

(result)
FIG. 14 shows the result of electrophoresis performed on the amplified fragment obtained by the amplification reaction. The rightmost lane in FIG. 14 shows the result of amplified fragment of Harbin 2-row, a barley-resistant barley variety, and the second lane from the rightmost lane in the figure shows the amplification of Turkey 6 which is a susceptible cultivar of barley. The fragment results are shown. The other lanes show the results of amplified fragments for the recombinant inbred line (RI line) RI2 population grown from the cross of Harbin 2-row (resistant) and Turkey 6 (disease).

  According to the results shown in FIG. 14, the amplified fragments amplified by the above operation have a resistance type (Harbin 2-row type) and a susceptibility type (Turkey type 6) to the head blight. The fragment length of the amplified fragment is 144 bp for the resistant type (Harbin 2-row type), and about 100 bp for the susceptible type (Turkey type 6). Amplified fragments can be seen at -160 bp (indicated by white arrows in the figure). Therefore, if the above detection operation is performed on the test target plant and the presence or absence of an amplified fragment of about 144 bp or about 100 bp to 160 bp is used as an index, the head mold resistant factor (red mold) that sits on the 6H chromosome of the target plant individual. It is possible to determine whether an allele at a gene locus involved in disease resistance has a resistance genotype or a susceptibility genotype.

[Example 12: Detection of genetic marker “Bmag125”]
(Method)
Using primers having the nucleotide sequences shown in SEQ ID NOs: 24 and 25, amplification reaction was performed using the genomic DNA of the barley to be tested as a template. The reaction cycle was 94 ° C. for 3 minutes, 55 ° C. for 1 minute, 72 ° C. for 1 minute, 94 ° C. for 1 minute → 55 ° C. for 1 minute → 72 ° C. for 1 minute 30 times, and then 72 ° C. for 5 minutes.

(result)
FIG. 15 shows the result of electrophoresis performed on the amplified fragment obtained by the amplification reaction. In FIG. 15, the leftmost lane and the rightmost lane show size markers, and the second lane from the leftmost lane shows the result of the amplified fragment for Haruna Nijo, which is a barley varieties resistant to head blight. In FIG. The eye shows the result of the amplified fragment of H602 of the barley varieties susceptible to head blight, and the fourth lane shows the result of the amplified fragment of F1. About the other lane, the result of the amplified fragment about the doubling haploid line (DH line) DHHS grown from the cross of Haruna Nijo (resistance) and H602 (disease) is shown.

  According to the results shown in FIG. 15, the amplified fragments amplified by the above operation include a resistant type (Haruna Nijo type) and a susceptible type (H602 type) with respect to head blight. The fragment length of the resistant type (Haruna Nijo type) is 142 bp (indicated by an arrow in the figure), and the susceptible type (H602 type) is about 134 bp (open arrow in the figure). Amplified fragments can be seen in Therefore, if the above-described detection operation is performed on the test target plant and the presence or absence of an amplified fragment of about 142 bp or about 134 bp is used as an index, the head plant resistance factor (redhead disease) on which the target plant individual sits on the 2H chromosome. It is possible to determine whether an allele at a locus related to resistance has a resistance genotype or a susceptibility genotype.

[Example 13: Detection of genetic marker “k04002”]
(Method)
An amplification reaction was performed using primers having the nucleotide sequences shown in SEQ ID NOs: 26 and 27 and the genomic DNA of the test barley as a template. The reaction cycle was 94 ° C. for 2 minutes, followed by 94 ° C. for 30 seconds → 65 ° C. for 30 seconds (decrease by 1 ° C. per cycle) → 72 ° C. for 2 minutes 5 times, then 94 ° C. for 30 seconds → 60 ° C. 30 After performing 35 seconds at 72 ° C. for 2 minutes, 72 ° C. for 7 minutes.

(result)
FIG. 16 shows the result of electrophoresis performed on the amplified fragment obtained by the amplification reaction. In FIG. 16, the leftmost lane and the rightmost lane show size markers, and the second lane from the leftmost lane shows the result of the amplified fragment of Haruna Nijo, which is a barley variety resistant to Fusarium head blight. The eye shows the result of the amplified fragment of H602 of the barley varieties susceptible to head blight, and the fourth lane shows the result of the amplified fragment of F1. About the other lane, the result of the amplified fragment about the doubling haploid line (DH line) DHHS grown from the cross of Haruna Nijo (resistance) and H602 (disease) is shown.

  According to the results of FIG. 16, the amplified fragments amplified by the above operation include a resistant type (Haruna Nijo type) and a susceptible type (H602 type) against the head blight. The fragment length of the resistant type (Haruna Nijo type) is about 350 bp (indicated by an arrow in the figure), the susceptible type (H602 type) is about 440 bp (white in the figure). Amplified fragments can be seen in (indicated by arrows). Therefore, if the above detection operation is performed on the test target plant, and the presence or absence of an amplified fragment of about 350 bp or about 440 bp is used as an index, the head fungus resistance factor (redhead disease resistance) on which the target plant individual sits on the 2H chromosome. It can be determined whether an allele at a genetic locus involved in sex has a resistant genotype or a susceptible genotype.

[Example 14: Detection of genetic marker "k05042"]
(Method)
An amplification reaction was performed using primers having the nucleotide sequences shown in SEQ ID NOs: 40 and 41 and the genomic DNA of the test barley as a template. The reaction cycle was 94 ° C. for 2 minutes, followed by 94 ° C. for 30 seconds → 65 ° C. for 30 seconds (decrease by 1 ° C. per cycle) → 72 ° C. for 2 minutes 5 times, then 94 ° C. for 30 seconds → 60 ° C. 30 After performing 35 seconds at 72 ° C. for 2 minutes, 72 ° C. for 7 minutes.

  The amplified product was digested with restriction enzyme at 37 ° C. for 15 hours using 1.6 U of HapII (manufactured by Takara Bio Inc.).

(result)
FIG. 17 shows the result of electrophoresis of the amplified fragment after the restriction enzyme digestion. The leftmost lane in FIG. 17 shows the results of the amplified fragment for Haruna Nijo, which is a barley-resistant barley cultivar, and the second lane from the leftmost lane of FIG. 17 shows the amplified fragment of H602 of the redhead disease-susceptible barley cultivar. The results are shown, and the third lane shows the results of these F1 amplified fragments. About the other lane, the result of the amplified fragment about the doubling haploid system (DH system) DHHS which grew up from the cross of Haruna Nijo and H602 is shown.

  The genetic marker is a CAPS marker as described above. Therefore, the digestion pattern of restriction enzyme (HapII) is different. According to the results of FIG. 17, the digested fragments obtained by the above operation include Haruna Nijo type and resistant type H602 type against Fusarium head blight, and the length of each digested fragment is Haruna Nijo type. About 150 bp, about 350 bp, and about 500 bp, those of the H602 type have amplified fragments at about 300 bp, about 340 bp, and about 360 bp. Note that the amplified fragments of about 340 bp and about 360 bp of the H602 type may appear to overlap when the resolution of electrophoresis is low. Therefore, if the above operation is performed on the test target plant and the pattern of the digested fragment is used as an index, the head mold resistant factor (locus related to head mold resistance) that the target plant individual sits on the 4H chromosome. Can be determined whether they have a resistant genotype or a susceptible genotype.

  However, as described above, the Fusarium head blight resistance factor linked to this genetic marker (locus involved in Fusarium head blight resistance) is the Fusarium head blight resistance factor possessed by H602, which is a strain susceptible to Fusarium head blight. (Locus involved in resistance to head blight). Therefore, when this genetic marker is detected, the Haruna Nijo type becomes the susceptible type and the H602 type becomes the resistant type.

[Example 15: Detection of genetic marker “k03289”]
(Method)
Using primers having the nucleotide sequences shown in SEQ ID NOs: 42 and 43, an amplification reaction was performed using the genomic DNA of the test barley as a template. The reaction cycle was 94 ° C. for 2 minutes, followed by 94 ° C. for 30 seconds → 65 ° C. for 30 seconds (decrease by 1 ° C. per cycle) → 72 ° C. for 2 minutes 5 times, then 94 ° C. for 30 seconds → 60 ° C. 30 After performing 35 seconds at 72 ° C. for 2 minutes, 72 ° C. for 7 minutes.

  The amplification product was subjected to restriction enzyme digestion using 1.6 U SacII (Takara Bio Inc.) at 37 ° C. for 15 hours.

(result)
FIG. 18 shows the result of electrophoresis performed on the amplified fragment after the restriction enzyme digestion. The rightmost lane in FIG. 18 shows the results of amplified fragments for Haruna Nijo, the second lane from the rightmost lane in FIG. 18 shows the results of amplified fragments of H602, and the third lane shows the results of these amplified fragments of F1. Show. About the other lane, the result of the amplified fragment about the doubling haploid line (DH line) DHHS grown from the cross of Haruna Nijo (resistance) and H602 (disease) is shown.

  The genetic marker is a CAPS marker as described above. Therefore, the digestion pattern of the restriction enzyme (SacII) is different. According to the results of FIG. 18, the digested fragments obtained by the above operation include Haruna Nijo type and H602 type against Fusarium head blight, and the fragment length of each digested fragment is about 250 bp for the Haruna Nijo type. The amplified fragment is seen at about 500 bp for the H602 type. Therefore, if the above operation is performed on the test target plant and the pattern of the digested fragment is used as an index, the head mold resistant factor (locus related to head mold resistance) that the target plant individual sits on the 4H chromosome. Can be determined whether they have a resistant genotype or a susceptible genotype.

  However, as described above, the Fusarium head blight resistance factor linked to this genetic marker (locus related to Fusarium head blight resistance) is Fusarium head blight resistance possessed by H602 which is a mold varieties susceptible to Fusarium head blight. Factor (locus involved in resistance to head blight). Therefore, when detecting this genetic marker, the Haruna Nijo type becomes the susceptibility type and the H602 type becomes the resistance type.

[Example 16: Detection of genetic marker “HvLOX”]
(Method)
Using primers having the nucleotide sequences shown in SEQ ID NOs: 28 and 29, amplification reaction was performed using the genomic DNA of the barley to be tested as a template. The reaction cycle was 94 ° C for 3 minutes, 58 ° C for 1 minute, 72 ° C for 1 minute, 94 ° C for 30 seconds → 58 ° C for 30 seconds → 72 ° C for 30 seconds 30 times, and then 72 ° C for 5 minutes.

(result)
FIG. 19 shows the result of electrophoresis performed on the amplified fragment obtained by the amplification reaction. In FIG. 19, the leftmost lane and the rightmost lane show size markers, and the second lane from the leftmost lane shows the result of the amplified fragment for Haruna Nijo, which is a barley varieties resistant to head blight. The eyes show the results of the amplified fragment of H602 from the head blight susceptible barley cultivar. About the other lane, the result of the amplified fragment about the doubling haploid line (DH line) DHHS grown from the cross of Haruna Nijo (resistance) and H602 (disease) is shown.

  According to the result of FIG. 19, the amplified fragments amplified by the above operation include a resistance type (Haruna Nijo type) and a susceptibility type (H602 type) to the head blight. The fragment length of the resistant type (Haruna Nijo type) is 155 bp (indicated by an arrow in the figure), and the susceptible type (H602 type) is approximately 157 bp (indicated by an open arrow in the figure). Is seen. Therefore, if the above-described detection operation is performed on the test target plant and the presence or absence of an amplified fragment of about 155 bp or about 157 bp is used as an index, the head fungus resistance factor (red mold disease) on which the target plant individual sits on the 5H chromosome. It is possible to determine whether an allele at a locus related to resistance has a resistance genotype or a susceptibility genotype.

[Example 17: Detection of genetic marker “k00835”]
(Method)
An amplification reaction was performed using primers having the nucleotide sequences shown in SEQ ID NOs: 30 and 31 and the genomic DNA of the test barley as a template. The reaction cycle was 94 ° C. for 2 minutes, followed by 94 ° C. for 30 seconds → 65 ° C. for 30 seconds (decrease by 1 ° C. per cycle) → 72 ° C. for 2 minutes 5 times, then 94 ° C. for 30 seconds → 60 ° C. 30 After performing 35 seconds at 72 ° C. for 2 minutes, 72 ° C. for 7 minutes.

(result)
FIG. 20 shows the result of electrophoresis performed on the amplified fragment obtained by the amplification reaction. In FIG. 20, the leftmost lane and the rightmost lane show size markers, and the second lane from the leftmost lane shows the result of the amplified fragment for Haruna Nijo, which is a barley varieties resistant to head blight, and the third lane from the leftmost lane in FIG. The eye shows the result of the amplified fragment of H602 of the barley varieties susceptible to head blight, and the fourth lane shows the result of the amplified fragment of F1. About the other lane, the result of the amplified fragment about the doubling haploid line (DH line) DHHS grown from the cross of Haruna Nijo (resistance) and H602 (disease) is shown.

  According to the result of FIG. 20, the amplified fragments amplified by the above operation include a resistance type (Haruna Nijo type) and a susceptibility type (H602 type) to red mold disease. The fragment length of the resistant type (Haruna Nijo type) is about 900 bp (indicated by an arrow in the figure), and the susceptible type (H602 type) is amplified to about 880 bp (indicated by an open arrow in the figure). A fragment is seen. Therefore, if the above-described detection operation is performed on the test target plant and the presence or absence of an amplified fragment of about 900 bp or about 880 bp is used as an index, the head fungus resistance factor (redhead disease) on which the target plant individual sits on the 5H chromosome. It is possible to determine whether an allele of a locus involved in resistance has a resistant genotype or a susceptible genotype.

  Note that the present invention is not limited to the configurations described above, and various modifications are possible within the scope of the claims, and technical means disclosed in different embodiments and examples respectively. Embodiments obtained by appropriate combinations are also included in the technical scope of the present invention.

  According to the present invention, elucidation of the mechanism of resistance to head blight of barley; production of plants that are resistant to head blight (eg, gramineous plants (for example, barley including barley)); Judgment of Fusarium head blight resistant plant (Gramineae plant (for example, wheat such as barley)) can be performed. Therefore, the disease can be reduced if applied to plants such as barley, which have suffered a decrease in yield, quality, and human damage due to red mold. . Therefore, it can be used for agriculture in general including horticulture. Furthermore, it can be effectively used in the food industry using barley or the like as a raw material.

It is a figure which shows the positional relationship of the DNA marker (MM314, FM677) and 2H-2 factor on 2H chromosome. It is a figure which shows the positional relationship of the DNA marker (FM426, MM1057) on 5H chromosome, and 5H-1 factor. It is a figure which shows the whole base sequence (sequence number 8) of resistant type (Harbin2) FM677. It is a figure which shows the whole base sequence (sequence number 9) of susceptibility type | mold (Turkey6) FM677. It is a figure which shows the whole base sequence (sequence number 10) of resistance type | mold (Russia6) FM426. It is a figure which shows the whole base sequence (sequence number 11) of susceptibility type | mold (H.E.S.4) FM426. It is a graph which shows the result of having performed the QTL analysis (CIM) regarding the head blight resistance of a barley about 2H chromosome of a barley. It is a graph which shows the result of having performed the QTL analysis (CIM) regarding the head blight resistance of a barley about the 5H chromosome of a barley. FIG. 3 is a diagram showing PCR reaction conditions in Example 2. A photograph showing the results of electrophoresis of PCR products obtained when PCR was performed using genomic DNA from Russia 6, HES4, and RI strains as templates using the primers described in SEQ ID NOs: 1 and 2 It is. The PCR product obtained when PCR was performed using genomic DNA from Russia 6, HES4, and RI strains as a template using the primers shown in SEQ ID NOs: 5 and 7 was further electrophoresed on the HhaI digested product. It is a photograph figure which shows the result performed. It is a histogram which shows the relationship between the result of having judged whether it is a barley-resistant barley using a DNA marker as an index, and the head blight-resistant score. It is an electrophoretic diagram which shows the result of having performed polymorphism detection by performing AFLP analysis about genetic marker "MM1057." FIG. 10 is an electrophoretogram showing the results of polymorphism detection of the genetic marker “MMtgaEatc128” in Example 5. It is an electrophoretic diagram which shows the result of having performed the polymorphism detection of the genetic marker "FMgcgEatc530" in Example 6. FIG. 10 is an electrophoretogram showing the results of polymorphism detection of the genetic marker “FXLRRfor_XLRRrev119” in Example 7. 10 is an electrophoretogram showing the results of polymorphism detection of a genetic marker “FmacgEcgt288” in Example 8. FIG. FIG. 10 is an electrophoretogram showing the results of polymorphism detection of the genetic marker “HVM67” in Example 9. It is an electrophoretic diagram which shows the result of having performed the polymorphism detection of genetic marker "FMataEagc408" in Example 10. FIG. FIG. 10 is an electrophoretogram showing the results of polymorphism detection of the genetic marker “HVM11” in Example 11. It is an electrophoretic diagram which shows the result of having performed polymorphism detection of the genetic marker "Bmag125" in Example 12. It is an electrophoretic diagram which shows the result of having performed the polymorphism detection of the genetic marker "k04002" in Example 13. It is an electrophoretic diagram which shows the result of having performed the polymorphism detection of genetic marker "k05042" in Example 14. FIG. FIG. 16 is an electrophoretogram showing the results of polymorphism detection of genetic marker “k03289” in Example 15. It is an electrophoretic diagram which shows the result of having performed the polymorphism detection of the genetic marker "HvLOX" in Example 16. FIG. 16 is an electrophoretogram showing the results of polymorphism detection of genetic marker “k00835” in Example 17. It is a figure which shows the SNP between Haruna Nijo and H602 in the genetic marker “k05042” and the base sequence around the SNP. It is a figure which shows the base sequence of SNP between Haruna Nijo and H602 in the genetic marker “k03289” and the periphery of the SNP.

Claims (2)

A determination kit for head blight-resistant gramineous plants used to determine head blight-resistant gramineous plants,
The determination kit comprising at least one or more of the fifteenth and sixteenth primer sets shown below:
A fifteenth primer set, which is a combination of a primer having the base sequence represented by SEQ ID NO: 40 and a primer having the base sequence represented by SEQ ID NO: 41;
A sixteenth primer set, which is a combination of a primer having the base sequence represented by SEQ ID NO: 42 and a primer having the base sequence represented by SEQ ID NO: 43. The determination kit for head blight-resistant grass plant according to claim 1, further comprising at least one of the following first to thirteenth and seventeenth to eighteenth primer sets. :
A first primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 1 and a primer having the base sequence shown in SEQ ID NO: 2;
A second primer set, which is a combination of a primer having the base sequence shown in SEQ ID NO: 3 and a primer having the base sequence shown in SEQ ID NO: 4;
A third primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 5 and a primer having the base sequence shown in SEQ ID NO: 6;
A fourth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 5 and a primer having the base sequence shown in SEQ ID NO: 7;
A fifth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 21 and a primer having the base sequence shown in SEQ ID NO: 20;
A sixth primer set which is a combination of a primer having the base sequence represented by SEQ ID NO: 22 and a primer having the base sequence represented by SEQ ID NO: 23;
A seventh primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 24 and a primer having the base sequence shown in SEQ ID NO: 25;
An eighth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 26 and a primer having the base sequence shown in SEQ ID NO: 27;
A ninth primer set, which is a combination of a primer having the base sequence shown in SEQ ID NO: 28 and a primer having the base sequence shown in SEQ ID NO: 29;
A tenth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 30 and a primer having the base sequence shown in SEQ ID NO: 31;
An eleventh primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 32 and a primer having the base sequence shown in SEQ ID NO: 33;
A twelfth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 34 and a primer having the base sequence shown in SEQ ID NO: 35;
A thirteenth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 36 and a primer having the base sequence shown in SEQ ID NO: 37;
A seventeenth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 44 and a primer having the base sequence shown in SEQ ID NO: 45; and a primer having the base sequence shown in SEQ ID NO: 46; An eighteenth primer set which is a combination with a primer having the base sequence represented by No. 47.