JP4117350B2 - Functionally modified phenylalanine dehydrogenase and method for analyzing amino acids in biological samples using this enzyme - Google Patents

Description

  The present invention relates to a modified enzyme in which at least one amino acid has been modified to improve the substrate specificity of phenylalanine dehydrogenase (EC 1.4.1.20) for methionine. Furthermore, the present invention relates to a method for analyzing amino acids such as L-methionine contained in a biological sample using this modified enzyme.

  According to the present inventors, in particular, in diseases such as homocystinuria, phenylketonuria and maple syrup urine disease, which are inborn errors of metabolism, neonatal mass screening for early detection, or regular It is possible to provide inspection methods available for health examination Furthermore, the analysis method of the present invention can also be used for detection and quantification of L-methionine, L-phenylalanine, L-leucine, L-isoleucine, L-valine and the like contained in food or the environment.

  The worldwide spread of neonatal mass screening for the early detection of congenital metabolic disorders is the discovery of a cure for phenylketonuria (PKU) and L-phenylalanine (L-phenylalanine) in dry filter paper blood. Phe) was developed by Guthrie et al. (Pediatrics, Vol. 32, p. 338-343 (1963), Non-Patent Document 1). About 500 cases of inborn errors of metabolism have been reported so far, and in particular, there are 7 to 22 cases of diseases for which normal growth is expected by the establishment of treatment and appropriate treatment. Mass screening is conducted on newborns nationwide.

  For screening for phenylketonuria, an enzymatic method (Screening, Vol. 1, p. 63 (1992), Non-patent document 2, Medicine and pharmacy, Vol. 31, p. 1237 (1994), Non-patent document 3) Alternatively, an enzyme reaction called microplate fluorescence (Clinical Chemistry, Vol. 35, p. 1962 (1989), Non-Patent Document 4) followed by a fluorescence reaction is performed on the microplate, and L-phenylalanine in the sample is determined from the fluorescence intensity. A kit for quantification was developed (Medicine and Pharmacy, Vol. 37, p. 1211 (1997), Non-Patent Document 5). Further, for the screening of maple syrup urine disease, a microplate fluorescence method using an L-leucine-specific dehydrogenase was developed in the same manner as the above-described screening method for phenylketonuria.

On the other hand, for the screening method for homocystinuria, the development of mass screening method for homocystinuria using Methionine γ-lyase (FY 1993, Ministry of Health and Welfare Psychosomatic Disorder Study “Study on Evaluation Method of Mass Screening System” pp. 237- 240 (1993), Non-Patent Document 6) has been reported. In this method, ammonia (NH ₃ ) released from L-methionine by the enzymatic reaction of L-Methionine γ-lyase is detected in the neutral region of o-phthalaldehyde (OPA) and 2-mercaptoethanol (2ME). This is a method of measuring using fluorescence.

These microplate fluorescence quantification methods have an advantage that quantification and recording, which are objective determinations of test results, which have been difficult in the conventional method, can be easily performed in addition to high specimen processing ability. Furthermore, the test result can be obtained in about 3 hours including the pretreatment of the specimen, and the speed, convenience and work efficiency are greatly improved compared to the conventional method.
Pediatrics, vol. 32, p. 338 (1963) Screening, vol. 1, p. 63 (1992) Medicine and pharmacy, vol. 31, p. 1237 (1994) Clinical Chemistry, vol. 35, p. 1962 (1989) Medicine and pharmacy, vol. 37, p. 1211 (1997) 1993 Ministry of Health and Welfare Psychosomatic Research "Study on Evaluation Method of Mass Screening System" pp. 237-240 (1993)

  Mass screening by enzyme fluorescence using microplates for important inborn errors of metabolism other than homocystinuria (phenylketonuria, galactosemia, maple syrup urine disease, etc.) is specific to each measurement item. Using a dehydrogenase, the measurement procedure, reagent composition, detection fluorescence wavelength, etc. are common, and the system allows simultaneous measurement of multiple samples. On the other hand, in the screening method for homocystinuria, that is, the indirect blood methionine quantification method by fluorescence quantification of ammonia using L-methionine γ-lyase, other congenital methods such as measurement procedure, reagent composition and detection fluorescence wavelength are used. This is very different from the method of measuring metabolic disorders. In addition, this method is sensitive to contamination of the sample by ammonia in the environment, and it is necessary to pay close attention. For this reason, there is a need to improve the work efficiency when performing screening because the specimen must be sorted for each diagnostic item.

  In the present invention, an L-methionine-specific dehydrogenase is produced by an evolutionary molecular engineering technique as in the case of important inborn errors of metabolism other than homocystinuria, and the concentration of L-methionine in a blood sample is determined by an enzyme fluorescence method. In addition to providing the same specifications as other diagnostic kits for inborn errors of metabolism in terms of measurement procedure, reagent composition and detection fluorescence wavelength, etc., it will provide a significant improvement in screening work efficiency. Objective.

More specifically, the object of the present invention is to create a phenylalanine dehydrogenase having substrate specificity for L-methionine by an evolutionary molecular engineering technique, and to include L- contained in a test sample (blood sample). Providing a method for analyzing L-methionine contained in a test sample, comprising incubating methionine with a reaction solution containing resazurin, diaphorase, and nicotinamide adenine dinucleotide (NAD ⁺ ), and detecting fluorescence in the reaction solution There is to do. Another object of the present invention is to provide a function-modified amino acid dehydrogenase suitable for enzymatic fluorescence determination of methionine.

  Further, in the present invention, by producing amino acid dehydrogenase having a wide substrate specificity for L-phenylalanine, L-leucine, L-valine, L-isoleucine and L-methionine, abnormal concentrations of these amino acids in blood can be reduced. The present invention provides an appropriate means as a method for detection or primary screening of confirmed inborn errors of metabolism and diseases in which abnormal blood concentrations of the amino acids can be confirmed.

[1] The amino acid sequence of phenylalanine dehydrogenase derived from Bacillus sphaericus R79a is substituted with serine (Ser) at the 124th amino acid residue (described in SEQ ID NO: 4 in the sequence listing), and the 310th amino acid residue is replaced with serine. (Ser), a modified enzyme substituted with threonine (Thr) or alanine (Ala).
[2] In the amino acid sequence of the modified enzyme according to [1], an amino acid sequence having a deletion, substitution and / or addition of 1 to several amino acids (provided that the amino acid to be deleted and / or substituted is 124 serine (Ser), 310 valine (Val) consists is not included), modify the enzyme with improved phenylalanine dehydrogenase activity substrate specificity for methionine.
[3] The modified enzyme according to any one of [1] to [2], wherein the relative activity to methionine is 500 or more when the relative activity to phenylalanine is 100.
[4] A protein in which an oligopeptide consisting of 1 to 12 histidines (histidine tag) is fused to the N-terminal side of the enzyme according to any one of [1] to [3].
[5] Any of the following DNA.
(I) DNA consisting of the base sequence set forth in SEQ ID NO: 3 in the sequence listing, wherein 370th to 372rd ggt (guanine, guanine, thymine) is agt (adenine, guanine, thymine), agc (adenine, guanine, Cytosine), tct (thymine / cytosine / thymine), tcc (thymine / cytosine / cytosine), tca (thymine / cytosine / adenine) or tcg (thymine / cytosine / guanine), and 928th to 930th gtt (guanine / thymine) -Thymine) is tct (thymine, cytosine, thymine), tcc (thymine, cytosine, cytosine), tca (thymine, cytosine, adenine), tcg (thymine, cytosine, guanine), agt (adenine, guanine, thymine), agc (Adenine, guanine, cytosine), act (adenine, cytosine, thymine), acg (adenine, cytosine, guanine), aca (adenine, cytosine, adenine), acg (adenine, cytosine) Shin guanine), gct (guanine cytosine thymine), gcc (guanine cytosine cytosine), DNA is gca (guanine cytosine adenine) or gcg (guanine cytosine guanine),
(B) DNA consisting of a base sequence complementary to the DNA of (a) .
[6] (c) The amino acid sequence described in SEQ ID NO: 4 in the Sequence Listing, wherein the 124th amino acid is serine (Ser), and the 310th amino acid is serine (Ser), threonine (Thr) or alanine (Ala DNA encoding an amino acid sequence that is either
(D) DNA consisting of a base sequence complementary to the DNA of (c) .
[7] A vector comprising the DNA according to any one of [5] to [6].
[8] The vector according to [7], further comprising DNA encoding an oligopeptide consisting of 1 to 12 histidines on any terminal side of the DNA according to any of [5] to [6].
[9] A transformant obtained by transforming a host with the vector according to [7] or [8].
[10] Modification in which at least one amino acid is modified so that the transformant according to [9] is cultured, and the substrate specificity of phenylalanine dehydrogenase (EC 1.4.1.20) to methionine is improved from the culture An enzyme (provided that the modification is a substitution of serine (Ser) at position 124 of glycine (Gly) in the amino acid sequence of phenylalanine dehydrogenase, and the modification is 310 in the amino acid sequence of phenylalanine dehydrogenase; A method for preparing a modified enzyme that collects the second valine (Val) with serine (Ser), threonine (Thr) or alanine (Ala).
[11] A method for analyzing L-methionine contained in a test sample using the modified enzyme or protein according to any one of [1] to [4].
[12] The method according to [11], wherein at least one of L-leucine, L-isoleucine, L-valine and L-phenylalanine is analyzed in combination.
[13] The method according to [11] or [12], which comprises mixing a test sample with resazurin, diaphorase and nicotinamide adenine dinucleotide (NAD ⁺ ) and detecting fluorescence.
[14] The method according to any one of [11] to [13], wherein the test sample is mixed with resazurin, diaphorase, and nicotinamide adenine dinucleotide (NAD ⁺ ) in a well of a microplate.
[15] The method according to any one of [11] to [14], wherein the test sample is a blood sample.

According to the present invention, a modified enzyme of phenylalanine dehydrogenase having substrate specificity for L-methionine can be provided, and by using this modified enzyme, analysis of L-methionine contained in a test sample can be analyzed. , Diaphorase, and nicotinamide adenine dinucleotide (NAD ⁺ ).

  The present invention relates to a modified enzyme in which at least one amino acid has been modified to improve the substrate specificity of phenylalanine dehydrogenase (EC 1.4.1.20) for methionine. In the present invention, phenylalanine dehydrogenase (EC 1.4.1.20) to be modified is an enzyme that specifically catalyzes an oxidative deamination reaction with respect to the amino group of L-phenylalanine. Examples of phenylalanine dehydrogenases include, for example, enzymes derived from Bacillus badius IAM11059, Bacillus sphaericus R79a, Sporosarcina ureae R04, Bacillus halodurans, Geobacillus kaustophilus, Oceanobacillus iheyensis, Rhodococcus sp. M-4 or Thermoactinomyces intermedius be able to.

Phenylalanine dehydrogenase derived from Bacillus badius IAM11059 has an extremely high substrate specificity for L-phenylalanine, and it is an optimal enzyme for the determination of L-phenylalanine in the blood of phenylketonuria. It is used as an enzyme agent for the enzyme fluorescence quantification method used. In addition, this enzyme requires nicotinamide adenine dinucleotide (oxidized form; NAD ⁺ ) as a coenzyme. The oxidation reaction by this enzyme is reversible, and it catalyzes a reductive amination reaction in the presence of ammonium ion and nicotinamide adenine dinucleotide (reduced type: NADH) in the neutral to weakly alkaline pH range. Nucleotide sequencing of phenylalanine dehydrogenase gene from Bacillus badius IAM 11059 Biosci. Biotechnol. Biochem. 59 (10). It is described in 1994-1995 (1995) and described as SEQ ID NOs: 1 and 2.

Phenylalanine dehydrogenase (EC 1.4.1.20) derived from Bacillus sphaericus R79a is an enzyme that specifically catalyzes an oxidative deamination reaction to the amino group of L-phenylalanine or L-tyrosine. This enzyme has high substrate specificity for L-tyrosine as well as L-phenylalanine, and is used in the enzymatic synthesis reaction of L-amino acids. In addition, this enzyme requires nicotinamide adenine dinucleotide (NAD ⁺ ) as a coenzyme as in the case of the phenylalanine dehydrogenase derived from B. badius IAM11059. Oxidation reaction by this enzyme is reversible, and ammonium ions and nicotinamide adenine dinucleotide (reduced form; NADH) are present in the pH range from near neutral to weakly alkaline as in the case of phenylalanine dehydrogenase derived from Bacillus badius IAM11059. An enzyme that also catalyzes a reductive amination reaction. The nucleotide sequence and amino acid sequence of phenylalanine dehydrogenase derived from Bacillus sphaericus R79a are N. Okazaki, Y. Hibino, Y. Asano, M. Ohmori, N. Numao and K. Kondo. Cloning and nucleotide sequencing of phenylalanine dehydrogenase gene of Bacillus sphaericus. Gene. 63. 337-341 (1988), described as SEQ ID NOs: 3 and 4.

  The nucleotide sequence and amino acid sequence of phenylalanine dehydrogenase derived from Sporosarcina ureae R04 are described in DDBJ / EMBL / GenBank databases (Accession No. AB001031), and are described as SEQ ID NOs: 5 and 6.

  The nucleotide sequence and amino acid sequence of phenylalanine dehydrogenase derived from Bacillus halodurans are described in GenBank Database (Accession No. NC_002570) and NCBI Protein Database (Accession No. NP_241084), and are described as SEQ ID NOs: 7 and 8.

  The nucleotide sequence and amino acid sequence of phenylalanine dehydrogenase derived from Geobacillus kaustophilus are described in GenBank Database (Accession No. BA000043.1) and NCBI Protein Database (Accession No. BAD76316), and are described as SEQ ID NOs: 9 and 10.

  The nucleotide sequence and amino acid sequence of phenylalanine dehydrogenase derived from Oceanobacillus iheyensis are described in GenBank (Accession No. BA000028) and NCBI Protein Database (Accession No. BAC14834), and are described as SEQ ID NOS: 11 and 12.

The base sequence and amino acid sequence of phenylalanine dehydrogenase derived from Rhodococcus sp. M-4 are described in the following literature, and are described as SEQ ID NOS: 13 and 14.
Brunhuber NM, Banerjee A., Jacobs WR Jr., Blanchard JS Cloning, sequencing, and expression of Rhodococcus L-phenylalanine dehydrogenase.Sequence comparisons to amino-acid dehydrogenases.J. Biol. Chem., 269. 16203-16211 (1994)

The base sequence and amino acid sequence of phenylalanine dehydrogenase derived from Thermoactinomyces intermedius are described in the following literature, and are described as SEQ ID NOS: 15 and 16.
Takada H., Yoshimura T., Ohshima T., Esaki N., Soda K. Thermostable phenylalanine dehydrogenase of Thermoactinomyces intermedius; cloning, expression, and sequencing of its gene.J. Biochem., 109. 371-376 (1991)

  Wild-type phenylalanine dehydrogenase has high substrate specificity for L-phenylalanine. FIG. 1 shows the substrate specificities of phenylalanine dehydrogenases derived from Bacillus badius IAM11059, Bacillus sphaericus R79a and Sporosarcina ureae R04 to L-trypsin, L-leucine, L-isoleucine, L-phenylalanine, L-methionine and L-valine. Shown by relative activity. As shown in FIG. 1, when the relative activity with respect to L-phenylalanine is 100, the above three phenylalanine dehydrogenases have low relative activity with respect to amino acids other than L-phenylalanine, and in particular, relative activity with respect to L-methionine is 10 or less. It is.

  In the present invention, as described above, phenylalanine dehydrogenase having a substrate specificity for L-methionine that is much lower than that for L-phenylalanine is modified to improve the substrate specificity for methionine. Yes, specifically, a modified enzyme in which at least one amino acid of the wild-type enzyme has been modified to improve substrate specificity for methionine. For example, when the relative activity to phenylalanine is 100, the relative activity to methionine is preferably 50 or more, more preferably 100 or more, and further preferably 500 or more.

  Modifications that improve substrate specificity for methionine specifically include a contiguous sequence of threonine (Thr) glycine (Gly) in the range 114 to 125 of the amino acid sequence of wild-type phenylalanine dehydrogenase (provided that Substitution of glycine (Gly) with serine (Ser) in glycine (Gly) is in the 114th to 125th range. The position of glycine (Gly) in the continuous sequence of threonine (Thr) glycine (Gly) in the amino acid sequence of wild-type phenylalanine dehydrogenase (glycine (Gly) is in the 114th to 125th range) depends on the origin of the enzyme Differently, it is in the position shown in the following table.

*スレオニン(Thr)グリシン(Gly)の連続した配列におけるグリシン(Gly)の位置
**野生型酵素の配列

* Position of glycine (Gly) in a continuous sequence of threonine (Thr) glycine (Gly)
** Sequence of wild-type enzyme

  Furthermore, the modification which improves the substrate specificity for methionine specifically includes a continuous sequence of glutamine (Gln) valine (Val) in the range of 297 to 310 of the amino acid sequence of wild-type phenylalanine dehydrogenase (however, Substitution of valine (Val) to serine (Ser), threonine (Thr) or alanine (Ala) in valine (Val) is in the 297-310th range. The position of valine (Val) in the continuous sequence of glutamine (Gln) valine (Val) in the amino acid sequence of wild-type phenylalanine dehydrogenase (valin (Val) is in the range of 297 to 310) depends on the origin of the enzyme. Differently, it is in the position shown in the following table.

*グルタミン（Gln）バリン（Val）の連続した配列におけるバリン（Val）の位置
**野生型酵素の配列

* Position of valine (Val) in contiguous sequence of glutamine (Gln) valine (Val)
** Sequence of wild-type enzyme

Specific examples of the modified enzyme of the present invention include
(1a) a modified enzyme in which the 123rd amino acid residue of the amino acid sequence of phenylalanine dehydrogenase derived from Bacillus badius IAM11059 is substituted with serine (Ser),
(1b) The 123rd amino acid residue of the amino acid sequence of phenylalanine dehydrogenase derived from Bacillus badius IAM11059 is serine (Ser), and the 309th amino acid is either serine (Ser), threonine (Thr) or alanine (Ala). A modified enzyme,
(2a) a modified enzyme in which the 124th amino acid residue of the amino acid sequence of phenylalanine dehydrogenase derived from Bacillus sphaericus R79a is substituted with serine (Ser),
(2b) The amino acid sequence of the amino acid sequence of phenylalanine dehydrogenase derived from Bacillus sphaericus R79a is serine (Ser), and the 310th amino acid is serine (Ser), threonine (Thr) or alanine (Ala). A modified enzyme substituted for either
(3a) a modified enzyme in which the 125th amino acid residue of the amino acid sequence of phenylalanine dehydrogenase derived from Sporosarcina ureae R04 is substituted with serine (Ser),
(3b) The 125th amino acid residue of the amino acid sequence of phenylalanine dehydrogenase derived from Sporosarcina ureae R04 is serine (Ser), and the 308th amino acid is either serine (Ser), threonine (Thr) or alanine (Ala). A modified enzyme,
(4a) a modified enzyme obtained by substituting serine (Ser) for the 122nd amino acid residue of the amino acid sequence of phenylalanine dehydrogenase derived from Bacillus halodurans,
(4b) The amino acid sequence of the amino acid sequence of phenylalanine dehydrogenase derived from Bacillus halodurans is serine (Ser) and the 308th amino acid is either serine (Ser), threonine (Thr) or alanine (Ala) A modified enzyme substituted with
(5a) a modified enzyme in which the 123rd amino acid residue of the amino acid sequence of phenylalanine dehydrogenase derived from Geobacillus kaustophilus is substituted with serine (Ser),
(5b) The 123rd amino acid residue of the amino acid sequence of phenylalanine dehydrogenase derived from Geobacillus kaustophilus is serine (Ser), and the 309th amino acid is either serine (Ser), threonine (Thr) or alanine (Ala) A modified enzyme substituted with
(6a) a modified enzyme in which the 122nd amino acid residue of the amino acid sequence of phenylalanine dehydrogenase derived from Oceanobacillus iheyensis is substituted with serine (Ser),
(6b) The amino acid sequence of the amino acid sequence of phenylalanine dehydrogenase derived from Oceanobacillus iheyensis is serine (Ser) and the 308th amino acid is either serine (Ser), threonine (Thr) or alanine (Ala) A modified enzyme substituted with
(7) a modified enzyme in which the 117th amino acid residue of the amino acid sequence of phenylalanine dehydrogenase derived from Rhodococcus sp. M-4 is replaced with serine (Ser), and (8a) an amino acid of phenylalanine dehydrogenase derived from Thermoactinomyces intermedius A modified enzyme in which the 114th amino acid residue of the sequence is substituted with serine (Ser),
(8b) The 114th amino acid residue of the amino acid sequence of phenylalanine dehydrogenase derived from Thermoactinomyces intermedius is serine (Ser), and the 297th amino acid is either serine (Ser), threonine (Thr) or alanine (Ala) Is a modified enzyme.

  Furthermore, the present invention relates to a recombinant chimera with two phenylalanine dehydrogenases having different origins separated by glycine (Gly) in the continuous sequence of threonine (Thr) glycine (Gly) in the 114th to 125th range. It can be a modified enzyme. Specifically, the amino acid sequence immediately before glycine (Gly) in the above range of one phenylalanine dehydrogenase and the glycine in the above range of another phenylalanine dehydrogenase having a different origin from this phenylalanine dehydrogenase ( Gly) is a chimeric engineered enzyme in which the amino acid sequence from immediately after to the last is linked in this order via serine (Ser).

  The chimeric engineered enzyme of the present invention is a protein in which any one amino acid sequence of the following group (A) and any one amino acid of the group (B) are consecutively arranged in this order via serine (Ser): . However, (B) is selected from an amino acid sequence of an enzyme of a different origin from (A). That is, the numbers (A) and (B) are different combinations.

Group (A)
(A-1) amino acid sequence 1-122 of phenylalanine dehydrogenase derived from Bacillus badius IAM11059,
(A-2) amino acid sequence 1-123 of phenylalanine dehydrogenase derived from Bacillus sphaericus R79a,
(A-3) 1 to 124 of the amino acid sequence of phenylalanine dehydrogenase derived from Sporosarcina ureae R04,
(A-4) 1-121th amino acid sequence of phenylalanine dehydrogenase derived from Bacillus halodurans,
(A-5) amino acid sequence 1-122 of phenylalanine dehydrogenase derived from Geobacillus kaustophilus,
(A-6) amino acid sequence 1-121 of phenylalanine dehydrogenase derived from Oceanobacillus iheyensis,
(A-7) amino acid sequence 1-161 of phenylalanine dehydrogenase derived from Rhodococcus sp. M-4, and
(A-8) 1st to 113th amino acid sequence of phenylalanine dehydrogenase from Thermoactinomyces intermedius

Group (B)
(B-1) amino acid sequence 124-380 of the phenylalanine dehydrogenase derived from Bacillus badius IAM11059,
(B-2) Phenylalanine dehydrogenase amino acid sequence 125-381 from Bacillus sphaericus R79a,
(B-3) 126th to 379th amino acid sequence of phenylalanine dehydrogenase derived from Sporosarcina ureae R04
(B-4) 123-379th amino acid sequence of phenylalanine dehydrogenase derived from Bacillus halodurans
(B-5) 124th to 380th amino acid sequence of phenylalanine dehydrogenase from Geobacillus kaustophilus
(B-6) 123rd to 379th amino acid sequence of phenylalanine dehydrogenase from Oceanobacillus iheyensis
(B-7) 118-356th amino acid sequence of phenylalanine dehydrogenase derived from Rhodococcus sp. M-4
(B-8) 115th to 366th amino acid sequence of phenylalanine dehydrogenase from Thermoactinomyces intermedius

The amino acids in the group (B) may have the following amino acid sequences.
(B-1) is an amino acid sequence in which the 309th amino acid residue of the amino acid sequence of phenylalanine dehydrogenase derived from Bacillus badius IAM11059 is substituted with serine (Ser), threonine (Thr) or alanine (Ala),
(B-2) is an amino acid sequence in which the 310th amino acid residue of the amino acid sequence of phenylalanine dehydrogenase derived from Bacillus sphaericus R79a is substituted with serine (Ser), threonine (Thr) or alanine (Ala),
(B-3) is an amino acid sequence in which the 308th amino acid residue of the amino acid sequence of phenylalanine dehydrogenase derived from Sporosarcina ureae R04 is substituted with serine (Ser), threonine (Thr) or alanine (Ala),
(B-4) is an amino acid sequence in which the 308th amino acid residue of the amino acid sequence of phenylalanine dehydrogenase derived from Bacillus halodurans is substituted with serine (Ser), threonine (Thr) or alanine (Ala),
(B-5) is an amino acid sequence in which the 309th amino acid residue of the amino acid sequence of phenylalanine dehydrogenase derived from Geobacillus kaustophilus is substituted with serine (Ser), threonine (Thr) or alanine (Ala),
(B-6) is an amino acid sequence in which the 308th amino acid residue of the amino acid sequence of phenylalanine dehydrogenase derived from Oceanobacillus iheyensis is substituted with serine (Ser), threonine (Thr) or alanine (Ala),
(B-8) is an amino acid sequence in which the 297th amino acid residue in the amino acid sequence of phenylalanine dehydrogenase derived from Thermoactinomyces intermedius is substituted with serine (Ser), threonine (Thr), or alanine (Ala).

Specific examples of the chimera modifying enzyme include the following.
(1) Modification in which amino acid sequence 125 to 381 of phenylalanine dehydrogenase derived from Bacillus sphaericus R79a is linked in this order via serine (Ser) to amino acid sequence 1 to 122 of phenylalanine dehydrogenase derived from Bacillus badius IAM11059 enzyme,
(2) Modification in which amino acid sequence 126 to 379 of Sporosarcina ureae R04-derived phenylalanine dehydrogenase is linked in this order via serine (Ser) to amino acid sequence 1-122 of phenylalanine dehydrogenase derived from Bacillus badius IAM11059 enzyme,
(3) Modification in which the amino acid sequence 124-380 of the phenylalanine dehydrogenase derived from Bacillus badius IAM11059 is linked in this order via serine (Ser) to the amino acid sequence 1-123 of the phenylalanine dehydrogenase derived from Bacillus sphaericus R79a enzyme,
(4) Modification in which the amino acid sequence of phenylalanine dehydrogenase derived from Bacillus sphaericus R79a is linked to amino acid sequence 126 to 379 of the amino acid sequence of Sporosarcina ureae R04 derived from the amino acid sequence 1 to 123 of serine (Ser) in this order. enzyme,
(5) Modification in which amino acid sequence 124-380 of Bacillus badius IAM11059-derived phenylalanine dehydrogenase is linked in this order via serine (Ser) to amino acid sequence 1-144 of Sporosarcina ureae R04-derived phenylalanine dehydrogenase enzyme,
(6) Modification in which amino acid sequence 125-379 of phenylalanine dehydrogenase derived from Bacillus sphaericus R79a is linked in this order via serine (Ser) to amino acid sequence 1-124 of phenylalanine dehydrogenase derived from Sporosarcina ureae R04 enzyme.

  In addition to the above, a chimeric engineered enzyme can be prepared by combining any two of the eight types of phenylalanine dehydrogenases shown in Table 1 or 2 above.

  Furthermore, the present invention provides a phenylalanine dehydrogenase having an amino acid sequence having a deletion, substitution and / or addition of one to several amino acids in the amino acid sequence of the modified enzyme of the present invention, and improved substrate specificity for methionine It includes a modified enzyme having an amino acid sequence having activity. However, the amino acid to be deleted and / or substituted does not include serine (Ser) having a continuous sequence of threonine (Thr) serine (Ser) having serine (Ser) in the 114th to 125th range. Alternatively, the chimera modifying enzyme of the present invention does not include serine (Ser) linking (A) and (B) to the amino acid to be deleted and / or substituted. The modified enzyme further having a substitution, insertion or deletion has an improved substrate specificity for methionine as compared to the wild-type enzyme. For example, when the relative activity for phenylalanine is 100, the substrate specificity is improved. The relative activity with respect to methionine is preferably 50 or more, and more preferably 100 or more.

  The range of “1 to several” in the “base sequence having deletion, substitution and / or addition of 1 to several bases” as used herein is not particularly limited, but for example, 1 to 40, preferably Means 1 to 30, more preferably 1 to 20, more preferably 1 to 10, further preferably 1 to 5, and particularly preferably about 1 to 3. The same applies to the following.

  Hereinafter, specific examples of the modified enzymes of the present invention (shown in the examples) and relative activities with respect to methionine are shown in a list when the relative activity with respect to phenylalanine is defined as 100.

  The method for obtaining the modified enzyme (protein) of the present invention is not particularly limited, and may be a protein synthesized by chemical synthesis or a recombinant protein produced by a gene recombination technique. When producing a modified enzyme (recombinant protein), first, as described later, a gene (DNA) encoding the modified enzyme (protein) is obtained. The modified enzyme of the present invention can be produced by introducing this DNA into an appropriate expression system. The expression of the protein in the expression system will be described later in this specification.

The modified enzyme of the present invention desirably contains 1 to 12, preferably 6 to 9 consecutive histidine residues located on the N-terminal side of the methionine residue (first amino acid) of the enzyme protein. The present invention includes a protein in which an oligopeptide (histidine tag) comprising 1 to 12 histidines is fused to the N-terminal side of the modified enzyme (protein) of the present invention. The histidine tag linked to the N-terminal side of the modified enzyme (protein) facilitates the purification of the enzyme from the recombinant culture, and the protein mediated by a divalent metal ion such as nickel (Ni ²⁺ ). It is effective for immobilization.

[DNA of the present invention]
Furthermore, the present invention relates to any of the following DNAs.
(1) DNA having the base sequence set forth in SEQ ID NO: 1 in the sequence listing, wherein 367 to 369th ggt (guanine, guanine, thymine) is agt (adenine, guanine, thymine), agg (adenine, guanine, thymine) Cytosine), tct (thymine / cytosine / thymine), tcc (thymine / cytosine / cytosine), tca (thymine / cytosine / adenine) or tcg (thymine / cytosine / guanine),
(2) DNA having the base sequence set forth in SEQ ID NO: 3 in the sequence listing, wherein the 370th to 372rd ggt (guanine, guanine, thymine) is agt (adenine, guanine, thymine), agg (adenine, guanine, thymine) Cytosine), tct (thymine / cytosine / thymine), tcc (thymine / cytosine / cytosine), tca (thymine / cytosine / adenine) or tcg (thymine / cytosine / guanine),
(3) DNA having the base sequence set forth in SEQ ID NO: 5 in the sequence listing, wherein 373rd to 375th ggt (guanine, guanine, thymine) is agt (adenine, guanine, thymine), agg (adenine, guanine, Cytosine), tct (thymine / cytosine / thymine), tcc (thymine / cytosine / cytosine), tca (thymine / cytosine / adenine) or tcg (thymine / cytosine / guanine),
(4) DNA having the base sequence set forth in SEQ ID NO: 7 of the Sequence Listing, wherein 364 to 366th ggt (guanine, guanine, thymine) is agt (adenine, guanine, thymine), agc (adenine, guanine, Cytosine), tct (thymine / cytosine / thymine), tcc (thymine / cytosine / cytosine), tca (thymine / cytosine / adenine) or tcg (thymine / cytosine / guanine),
(5) DNA having the base sequence set forth in SEQ ID NO: 9 in the sequence listing, wherein 367 to 369th ggc (guanine, guanine, cytosine) is agt (adenine, guanine, thymine), agc (adenine, guanine, Cytosine), tct (thymine / cytosine / thymine), tcc (thymine / cytosine / cytosine), tca (thymine / cytosine / adenine) or tcg (thymine / cytosine / guanine),
(6) DNA having the base sequence set forth in SEQ ID NO: 11 of the Sequence Listing, wherein 364 to 366th ggt (guanine, guanine, thymine) is agt (adenine, guanine, thymine), agg (adenine, guanine, thymine) Cytosine), tct (thymine / cytosine / thymine), tcc (thymine / cytosine / cytosine), tca (thymine / cytosine / adenine) or tcg (thymine / cytosine / guanine),
(7) DNA having the nucleotide sequence set forth in SEQ ID NO: 13 in the sequence listing, wherein 349 to 351st gga (guanine, guanine, adenine) is agt (adenine, guanine, thymine), agc (adenine, guanine, Cytosine), tct (thymine / cytosine / thymine), tcc (thymine / cytosine / cytosine), tca (thymine / cytosine / adenine) or tcg (thymine / cytosine / guanine),
(8) DNA having the base sequence set forth in SEQ ID NO: 15 of the Sequence Listing, wherein the 340th to 342th gga (guanine, guanine, adenine) is agt (adenine, guanine, thymine), agc (adenine, guanine, Cytosine), tct (thymine / cytosine / thymine), tcc (thymine / cytosine / cytosine), tca (thymine / cytosine / adenine) or tcg (thymine / cytosine / guanine),
(9) Phenylalanine dehydrogenase having a base sequence having a deletion, substitution and / or addition of one to several bases and improved substrate specificity for methionine in the base sequence of (1) to (8) DNA having a base sequence encoding
(10) DNA having a base sequence complementary to the DNA of (1) to (9).

  (1) to (8) are phenylalanine dehydrogenases derived from Bacillus badius IAM11059, Bacillus sphaericus R79a, Sporosarcina ureae R04, Bacillus halodurans, Geobacillus kaustophilus, Oceanobacillus iheyensis, Rhodococcus sp. M-4 and Thermoactinomyces intermedius, respectively. In this sequence, g (guanine) at a specific position is replaced with a (adenine), and this base substitution corresponds to substitution of glycine (Gly) with serine (Ser) in amino acids.

  The DNA of (9) has a base sequence having 1 to several base deletions, substitutions and / or additions in the base sequences of (1) to (8), and has improved substrate specificity for methionine. It is DNA having a base sequence encoding phenylalanine dehydrogenase. The phenylalanine dehydrogenase with improved substrate specificity for methionine has the same meaning as described above, and the relative activity for methionine is 50 or more, preferably 100 or more when the relative activity for phenylalanine is 100. It is appropriate that the specificity is improved. The DNA (10) is a DNA having a base sequence complementary to the base sequences (1) to (9).

Furthermore, the present invention relates to any of the following DNAs.
(11a) A DNA encoding the amino acid sequence set forth in SEQ ID NO: 2 of the Sequence Listing, wherein the 123rd amino acid is serine (Ser),
(11b) The amino acid sequence described in SEQ ID NO: 2 in the Sequence Listing, wherein the 123rd amino acid is serine (Ser) and the 309th amino acid is serine (Ser), threonine (Thr), or alanine (Ala) DNA encoding the amino acid sequence,
(12a) the amino acid sequence set forth in SEQ ID NO: 4 in the sequence listing, wherein the DNA encoding the amino acid sequence in which the 124th amino acid is serine (Ser);
(12b) The amino acid sequence described in SEQ ID NO: 4 in the Sequence Listing, wherein the 124th amino acid is serine (Ser) and the 310th amino acid is serine (Ser), threonine (Thr), or alanine (Ala) DNA encoding the amino acid sequence,
(13a) DNA encoding the amino acid sequence set forth in SEQ ID NO: 6 of the Sequence Listing, wherein the 125th amino acid is serine (Ser),
(13b) The amino acid sequence set forth in SEQ ID NO: 6 in the Sequence Listing, wherein the 125th amino acid is serine (Ser) and the 308th amino acid is serine (Ser), threonine (Thr), or alanine (Ala) DNA encoding the amino acid sequence,
(14a) the amino acid sequence set forth in SEQ ID NO: 8 in the sequence listing, wherein the DNA encoding the amino acid sequence in which the 122nd amino acid is serine (Ser);
(14b) The amino acid sequence set forth in SEQ ID NO: 8 in the Sequence Listing, wherein the 122nd amino acid is serine (Ser) and the 308th amino acid is serine (Ser), threonine (Thr), or alanine (Ala) DNA encoding the amino acid sequence,
(15a) an amino acid sequence set forth in SEQ ID NO: 10 of the sequence listing, wherein the DNA encoding the amino acid sequence in which the 123rd amino acid is serine (Ser);
(15b) The amino acid sequence set forth in SEQ ID NO: 10 of the Sequence Listing, wherein the 123rd amino acid is serine (Ser) and the 309th amino acid is serine (Ser), threonine (Thr), or alanine (Ala) DNA encoding the amino acid sequence,
(16a) a DNA encoding the amino acid sequence set forth in SEQ ID NO: 12 of the Sequence Listing, wherein the 122nd amino acid is serine (Ser);
(16b) The amino acid sequence described in SEQ ID NO: 12 in the Sequence Listing, wherein the 122nd amino acid is serine (Ser) and the 308th amino acid is serine (Ser), threonine (Thr), or alanine (Ala) DNA encoding the amino acid sequence,
(17) DNA encoding the amino acid sequence set forth in SEQ ID NO: 14 of the Sequence Listing, wherein the 117th amino acid is serine (Ser),
(18a) a DNA encoding the amino acid sequence set forth in SEQ ID NO: 16 of the Sequence Listing, wherein the 114th amino acid is serine (Ser);
(18b) The amino acid sequence set forth in SEQ ID NO: 16 in the Sequence Listing, wherein the 114th amino acid is serine (Ser) and the 297th amino acid is serine (Ser), threonine (Thr), or alanine (Ala) DNA encoding the amino acid sequence,

  (11a)-(16a), (17), (18a) are derived from Bacillus badius IAM11059, Bacillus sphaericus R79a, Sporosarcina ureae R04, Bacillus halodurans, Geobacillus kaustophilus, Oceanobacillus iheyensis, Rhodococcus sp. M-4 and Thermodinoces, respectively. DNA encoding the amino acid sequence in which glycine (Gly) is substituted with serine (Ser) at a specific position in the amino acid sequence of phenylalanine dehydrogenase.

  (11b) to (18b) are amino acid sequences of the amino acid sequence of the phenylalanine dehydrogenase derived from Bacillus badius IAM11059, Bacillus sphaericus R79a, Sporosarcina ureae R04, Bacillus halodurans, Geobacillus kaustophilus, Oceanobacillus iheyensis and Thermoactinomyces intermedius, respectively. ) With serine (Ser), and a DNA encoding an amino acid sequence in which valine (Val) at a specific position is substituted with serine (Ser), threonine (Thr) or alanine (Ala).

  The DNA of (19) has an amino acid sequence having a deletion, substitution and / or addition of one to several amino acids in the amino acid sequence of (11a) to (18b), and has improved substrate specificity for methionine. DNA having a base sequence encoding an amino acid sequence having phenylalanine dehydrogenase activity. The phenylalanine dehydrogenase activity with improved substrate specificity for methionine has the same meaning as described above, and the relative activity for methionine is 50 or more, preferably 100 or more, more preferably 500 or more when the relative activity for phenylalanine is 100. It is appropriate that the substrate specificity for methionine is improved. The DNA (20) is a DNA having a base sequence complementary to the DNAs (11a) to (19).

  Furthermore, the present invention provides a nucleotide sequence agt, agc, tct, tcc that encodes serine (Ser) from any one nucleotide sequence of the following group (a) and any one nucleotide sequence of the following group (b): , Tca or tcg, and a DNA having a base sequence linked in this order. However, (a) and (b) are selected from the base sequences of enzymes of different origins. That is, the numbers in (a) and (b) are different combinations.

(a) Group
(a-1) DNA having a sequence of 1 to 366 of the base sequence set forth in SEQ ID NO: 1 in the sequence listing;
(a-2) DNA having a sequence of 1 to 369 of the base sequence set forth in SEQ ID NO: 3 in the sequence listing;
(a-3) DNA having a sequence of 1 to 372 of the base sequence set forth in SEQ ID NO: 5 in the sequence listing;
(a-4) DNA having a sequence of 1 to 363 of the base sequence set forth in SEQ ID NO: 7 of the Sequence Listing,
(a-5) DNA having a sequence of 1 to 366 of the base sequence set forth in SEQ ID NO: 9 in the Sequence Listing,
(a-6) DNA having a sequence of 1 to 363 of the base sequence set forth in SEQ ID NO: 11 of the Sequence Listing,
(a-7) DNA having a sequence of 1 to 348 of the base sequence set forth in SEQ ID NO: 13 of the Sequence Listing, and
(a-8) DNA having a sequence of 1 to 339 of the base sequence set forth in SEQ ID NO: 15 in the Sequence Listing.

(b) Group
(b-1) DNA having a sequence of 370 to 1143 of the base sequence set forth in SEQ ID NO: 1 of the Sequence Listing,
(b-2) DNA having a sequence of 373 to 1146 of the base sequence set forth in SEQ ID NO: 3 in the sequence listing;
(b-3) DNA having a sequence of 376 to 1140 of the base sequence set forth in SEQ ID NO: 5 of the Sequence Listing,
(b-4) DNA having a sequence of 367 to 1140 of the base sequence set forth in SEQ ID NO: 7 of the Sequence Listing,
(b-5) DNA having a sequence of 370 to 1143 of the base sequence set forth in SEQ ID NO: 9 of the Sequence Listing,
(b-6) DNA having a sequence of 367 to 1140 of the base sequence set forth in SEQ ID NO: 11 of the Sequence Listing,
(b-7) DNA having a sequence of 352 to 1071 of the nucleotide sequence set forth in SEQ ID NO: 13 of the Sequence Listing, and
(b-8) DNA having a sequence of 343 to 1101 of the base sequence set forth in SEQ ID NO: 15 of the Sequence Listing.

  Furthermore, the present invention provides a phenylalanine dehydrogenase having a base sequence having a deletion, substitution and / or addition of one to several bases in the above DNA base sequence and improved substrate specificity for methionine. DNA having a nucleotide sequence encoding The phenylalanine dehydrogenase activity with improved substrate specificity for methionine is as defined above, and the relative activity for methionine is 50 or more, preferably 100 or more, more preferably 500 or more when the relative activity for phenylalanine is 100. It is appropriate that the substrate specificity for methionine is improved as described above. The DNA (20) is a DNA having a base sequence complementary to the DNAs (11) to (19).

  Furthermore, the present invention relates to an amino acid of a modified enzyme in which any one amino acid sequence of the following group (A) and any one amino acid sequence of the following group (B) are linked in this order via serine (Ser): It relates to DNA encoding the sequence. However, (A) and (B) are selected from the base sequences of enzymes of different origins. That is, the numbers (A) and (B) are different combinations.

Group (A)
(A-1) amino acid sequence 1-122 of phenylalanine dehydrogenase derived from Bacillus badius IAM11059,
(A-2) amino acid sequence 1-123 of phenylalanine dehydrogenase derived from Bacillus sphaericus R79a,
(A-3) 1 to 124 of the amino acid sequence of phenylalanine dehydrogenase derived from Sporosarcina ureae R04,
(A-4) 1-121th amino acid sequence of phenylalanine dehydrogenase derived from Bacillus halodurans,
(A-5) amino acid sequence 1-122 of phenylalanine dehydrogenase derived from Geobacillus kaustophilus,
(A-6) amino acid sequence 1-121 of phenylalanine dehydrogenase derived from Oceanobacillus iheyensis,
(A-7) amino acid sequence 1-161 of phenylalanine dehydrogenase derived from Rhodococcus sp. M-4, and
(A-8) 1st to 113th amino acid sequence of phenylalanine dehydrogenase from Thermoactinomyces intermedius
Group (B)
(B-1) amino acid sequence 124-380 of the phenylalanine dehydrogenase derived from Bacillus badius IAM11059,
(B-2) Phenylalanine dehydrogenase amino acid sequence 125-381 from Bacillus sphaericus R79a,
(B-3) 126th to 379th amino acid sequence of phenylalanine dehydrogenase derived from Sporosarcina ureae R04
(B-4) 123-379th amino acid sequence of phenylalanine dehydrogenase derived from Bacillus halodurans
(B-5) 124th to 380th amino acid sequence of phenylalanine dehydrogenase from Geobacillus kaustophilus
(B-6) 123rd to 379th amino acid sequence of phenylalanine dehydrogenase from Oceanobacillus iheyensis
(B-7) 118-356th amino acid sequence of phenylalanine dehydrogenase derived from Rhodococcus sp. M-4, and
(B-8) 115th to 366th amino acid sequence of phenylalanine dehydrogenase from Thermoactinomyces intermedius

The amino acids in the group (B) may have the following amino acid sequences.
(B-1) is an amino acid sequence in which the 309th amino acid residue of the amino acid sequence of phenylalanine dehydrogenase derived from Bacillus badius IAM11059 is substituted with serine (Ser), threonine (Thr) or alanine (Ala),
(B-2) is an amino acid sequence in which the 310th amino acid residue of the amino acid sequence of phenylalanine dehydrogenase derived from Bacillus sphaericus R79a is substituted with serine (Ser), threonine (Thr) or alanine (Ala),
(B-3) is an amino acid sequence obtained by substituting the amino acid residue 308 of the amino acid sequence of phenylalanine dehydrogenase derived from Sporosarcina ureae R04 with serine (Ser), threonine (Thr) or alanine (Ala),
(B-4) is an amino acid sequence in which the 308th amino acid residue of the amino acid sequence of phenylalanine dehydrogenase derived from Bacillus halodurans is substituted with serine (Ser), threonine (Thr) or alanine (Ala),
(B-5) is an amino acid sequence in which the 309th amino acid residue of the amino acid sequence of phenylalanine dehydrogenase derived from Geobacillus kaustophilus is substituted with serine (Ser), threonine (Thr) or alanine (Ala),
(B-6) is an amino acid sequence in which the 308th amino acid residue of the amino acid sequence of phenylalanine dehydrogenase derived from Oceanobacillus iheyensis is substituted with serine (Ser), threonine (Thr) or alanine (Ala),
(B-8) is an amino acid sequence in which the 297th amino acid residue in the amino acid sequence of phenylalanine dehydrogenase derived from Thermoactinomyces intermedius is substituted with serine (Ser), threonine (Thr), or alanine (Ala).

  The present invention provides an amino acid sequence having phenylalanine dehydrogenase activity having an amino acid sequence having a deletion, substitution and / or addition of one to several amino acids, and improved substrate specificity for methionine. It includes DNA having a base sequence encoding. However, serine (Ser) linking (A) and (B) is not included in the deleted and / or substituted amino acid. The modified enzyme further having a substitution, insertion or deletion has an improved substrate specificity for methionine compared to the wild-type enzyme, and the improvement of the substrate specificity is, for example, when the relative activity for phenylalanine is 100. The relative activity with respect to methionine is preferably 50 or more, more preferably 100 or more, and further preferably 500 or more. The present invention also includes DNA having a base sequence complementary to these DNAs.

  The method for obtaining the DNA of the present invention is not particularly limited. Appropriate probes and primers are prepared based on the amino acid sequences and base sequence information described in SEQ ID NOs: 1 to 16 in the sequence listing in the present specification, and the bacteria containing the phenylalanine dehydrogenase mentioned above are used by using them. The gene of the present invention can be isolated by screening the cDNA library. A cDNA library can be prepared by a conventional method from a bacterium expressing the gene of the present invention.

  The gene of the present invention can also be obtained by PCR. Using a DNA library or cDNA library derived from the above-mentioned bacteria as a template, a pair of designed to be able to amplify the base sequence described in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13 or 15 PCR is performed using primers. PCR reaction conditions can be set as appropriate. For example, one cycle of a reaction step consisting of 94 ° C. for 30 seconds (denaturation), 55 ° C. for 30 seconds to 1 minute (annealing), and 72 ° C. for 2 minutes (extension) As an example, after performing 30 cycles, a condition of reacting at 72 ° C. for 7 minutes can be exemplified. The amplified DNA fragment can then be cloned into a suitable vector that can be amplified in a host such as E. coli.

Preparation of the probes or primers, construction of cDNA library, screening of cDNA libraries, as well as operations such as cloning the gene of interest are known to those skilled in the art, for example, Molecular Cloning: A laboratory Mannual, 2 nd Ed,. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY., 1989 (hereinafter abbreviated as Molecular Cloning 2nd Edition), Current Protocols in Molecular Biology, Supplement 1-38, John Wiley & Sons (1987-1997) Protocols in Molecular Biology) and the like.

  And having an amino acid sequence having a deletion, substitution and / or addition of 1 to several amino acids in the amino acid sequence described in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14 or 16 in the sequence listing , A gene encoding a protein having glucosidase activity; and a base sequence having a deletion, substitution and / or addition of 1 to several bases in the base sequence set forth in SEQ ID NO: 5 or 6 in the sequence listing As for genes having a nucleotide sequence encoding a glycosylase (hereinafter, these genes are referred to as mutant genes), chemical synthesis, genes based on the amino acid sequence and nucleotide sequence information described in SEQ ID NOs: 1 to 16 It can be made by any method known to those skilled in the art, such as engineering techniques or mutagenesis.

  For example, a method of contacting a DNA having the base sequence described in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13 or 15 of the sequence listing with a drug that becomes a mutagen, a method of irradiating with ultraviolet rays, It can be performed using genetic engineering techniques. Site-directed mutagenesis, which is one of the genetic engineering methods, is useful because it can introduce a specific mutation at a specific position. Molecular cloning 2nd edition, Current Protocols in Molecular. It can be performed according to the method described in biology and the like.

[Vector of the present invention]
The present invention relates to a vector containing any of the DNAs of the present invention. The vector on which any one of the DNAs of the present invention is placed is not particularly limited. For example, it may be a self-replicating vector (for example, a plasmid) or the host cell genome when introduced into the host cell. And may be replicated together with the integrated chromosome. Preferably, the vector used in the present invention is an expression vector. In the expression vector, the gene of the present invention is functionally linked to elements necessary for transcription (for example, a promoter and the like). A promoter is a DNA sequence that exhibits transcriptional activity in a host cell, and can be appropriately selected depending on the type of host.

Promoters operable in bacterial cells include the Bacillus stearothermophilus maltogenic amylase gene, the Bacillus licheniformis alpha-amylase gene, and the Bacillus amyloliquefati. Enns-BAN amylase gene (Bacillus amyloliquefaciens BAN amylase gene), Bacillus subtilis alkaline protease gene (Bacillus subtilis alkaline protease gene) or promoters of the Bacillus pumilus-xylosidase gene (Bacillus pumilus xylosldase gene) or phage lambda, P _R or P _L promoters, lac of E.coli, such as trp or tac promoter and the like.

  Examples of promoters that can operate in mammalian cells include the SV40 promoter, the MT-1 (metallothionein gene) promoter, or the adenovirus 2 major late promoter. Examples of promoters operable in insect cells include polyhedrin promoter, P10 promoter, autographa caliornica polyhedrosic basic protein promoter, baculovirus immediate early gene 1 promoter, or baculovirus 39K delayed early gene. There are promoters. Examples of a promoter operable in a yeast host cell include a promoter derived from a yeast glycolytic gene, an alcohol dehydrogenase gene promoter, a TPI1 promoter, an ADH2-4c promoter, and the like. Examples of promoters that can operate in filamentous fungal cells include the ADH3 promoter or the tpiA promoter.

Moreover, the DNA of the present invention may be functionally bound to an appropriate terminator as necessary. The recombinant vector of the present invention may further have elements such as a polyadenylation signal (for example, derived from SV40 or adenovirus 5E1b region), a transcription enhancer sequence (for example, SV40 enhancer) and the like.
The recombinant vector of the present invention may further comprise a DNA sequence that allows the vector to replicate in the host cell, an example of which is the SV40 origin of replication (when the host cell is a mammalian cell). .

  The recombinant vector of the present invention may further contain a selection marker. Selectable markers include, for example, genes that lack their complement in host cells such as dihydrofolate reductase (DHFR) or Schizosaccharomyces pombe TPI genes, or such as ampicillin, kanamycin, tetracycline, chloramphenicol, Mention may be made of drug resistance genes such as neomycin or hygromycin. Methods for ligating the gene, promoter, and, if desired, terminator and / or secretory signal sequence of the present invention and inserting them into an appropriate vector are well known to those skilled in the art.

[Transformant of the present invention and production of modified enzyme using the same]
A transformant can be prepared by introducing the DNA (gene) or recombinant vector of the present invention into an appropriate host. The host cell into which the gene of the present invention or the recombinant vector is introduced may be any cell as long as it can express the gene of the present invention, and examples thereof include bacteria, yeast, fungi and higher eukaryotic cells.

Examples of bacterial cells include Gram positive bacteria such as Bacillus or Streptomyces or Gram negative bacteria such as E. coli. Transformation of these bacteria may be performed by using competent cells by a protoplast method or a known method.
Examples of mammalian cells include HEK293 cells, HeLa cells, COS cells, BHK cells, CHL cells, or CHO cells. Methods for transforming mammalian cells and expressing DNA sequences introduced into the cells are also known, and for example, electroporation method, calcium phosphate method, lipofection method and the like can be used.

  Examples of yeast cells include cells belonging to Saccharomyces or Schizosaccharomyces, for example, Saccharomyces cerevis 1ae or Saccharomyces kluyveri. Examples of the method for introducing a recombinant vector into a yeast host include an electroporation method, a spheroblast method, and a lithium acetate method.

  Examples of other fungal cells are cells belonging to filamentous fungi such as Aspergillus, Neurospora, Fusarium, or Trichoderma. When filamentous fungi are used as host cells, transformation can be performed by integrating the DNA construct into the host chromosome to obtain a recombinant host cell. Integration of the DNA construct into the host chromosome can be performed according to known methods, for example, by homologous recombination or heterologous recombination.

  When insect cells are used as the host, the recombinant gene transfer vector and baculovirus are co-introduced into the insect cells to obtain the recombinant virus in the insect cell culture supernatant, and then the recombinant virus is further infected with the insect cells. And protein can be expressed (for example, as described in Baculovirus Expression Vectors, A Laboratory Manua1; and Current Protocols in Molecular Biology, Bio / Technology, 6, 47 (1988), etc.).

As the baculovirus, for example, Autographa californica nuclear polyhedrosis virus, which is a virus that infects Coleoptera insects, can be used.
Insect cells include Sf9, Sf21 (Baculovirus Expression Vectors, A Laboratory Manual, WH Freeman and Company), New York, which is an ovarian cell of Spodoptera frugiperda (1992)], HiFive (manufactured by Invitrogen), which is an ovarian cell of Trichoplusia ni, can be used.
Examples of the method for co-introducing a recombinant gene introduction vector into insect cells and the baculovirus for preparing a recombinant virus include the calcium phosphate method and the lipofection method.

  More specifically, for example, a site-directed mutagenesis gene amplified by a PCR reaction using a site-directed mutagenesis primer using a phenylalanine dehydrogenase gene (pdh) derived from Bacillus badius IAM11059 or Bacillus sphaericus R79a as a template and / or Alternatively, a complementary sequence thereof is prepared, and this site-specific mutagenesis gene and / or its complementary strand is transferred to, for example, Escherichia coli or other recombinable host cells (eg, animal cells, plant cells, insect cells, etc.) ) To obtain the modified enzyme of the present invention.

  In the present invention, the transformant of the present invention is cultured, and a modified enzyme modified with at least one amino acid so as to improve the substrate specificity of phenylalanine dehydrogenase (EC 1.4.1.20) to methionine from the culture is obtained. It includes a method for preparing a modified enzyme to be collected.

The transformant is cultured in an appropriate nutrient medium under conditions that allow expression of the introduced DNA. In order to isolate and purify the modified enzyme of the present invention from the culture of the transformant, a usual method for isolating and purifying the modified enzyme may be used.
For example, when the modified enzyme of the present invention is expressed in a dissolved state in the cells, the cells are collected by centrifugation after culturing, suspended in an aqueous buffer, and then disrupted by an ultrasonic disrupter or the like. A cell-free extract is obtained. From the supernatant obtained by centrifuging the cell-free extract, an ordinary protein isolation and purification method, that is, a solvent extraction method, a salting-out method using ammonium sulfate, a desalting method, a precipitation method using an organic solvent, Anion exchange chromatography using a resin such as diethylaminoethyl (DEAE) Sepharose, cation exchange chromatography using a resin such as S-Sepharose FF (Pharmacia), resin such as butyl sepharose and phenyl sepharose Use a hydrophobic chromatography method, gel filtration method using molecular sieve, affinity chromatography method, chromatofocusing method, electrophoresis method such as isoelectric focusing etc. alone or in combination to obtain a purified preparation be able to.

[L-methionine analysis method]
The present invention relates to a method for analyzing L-methionine contained in a test sample using the modified enzyme or protein of the present invention.

Specifically, the L-methionine analysis method of the present invention includes mixing a test sample with resazurin, diaphorase, and nicotinamide adenine dinucleotide (NAD ⁺ ), and detecting fluorescent color development. Mixing of a test sample with resazurin, diaphorase and nicotinamide adenine dinucleotide (NAD ⁺ ) can be performed, for example, in a well of a microplate.

Furthermore, the L-methionine analysis method of the present invention comprises (1) mixing a test sample and nicotinamide adenine dinucleotide (NAD ⁺ ), and measuring an increase in the absorbance value of NADH to be reduced, (2) phenazine Mixing a test sample with Into (INT), a reducing coloring reagent, using an electron carrier such as tosulfate (PMS) as a medium to detect formazan-generated color, or (3) 1-methoxy-phenazine methosulfate Metal ions (such as Co ³⁺ ) are reduced via an electron carrier such as (1-Methoxy PMS), reacted with chelate indicator 5-Br-PAPS, etc., and the colored absorbance is measured and detected. It can also be carried out by other methods. Also in the methods (1) to (3) above, the reagent can be mixed in the well of the microplate.

  In the present invention, the test sample can be, for example, a blood sample.

  In the present invention, in parallel with the L-methionine analysis, at least one of L-leucine, L-isoleucine, L-valine and L-phenylalanine can also be analyzed. This is because the modified enzyme or protein of the present invention used in the method of the present invention is a substrate not only for L-methionine but also for at least one of L-leucine, L-isoleucine, L-valine and L-phenylalanine. This is because it has specificity.

  The present invention will be described in more detail with reference to the following examples, but the present invention is not limited to the following examples.

The enzyme fluorescence determination method of L-methionine, L-phenylalanine, L-leucine, L-isoleucine or L-valine in the present invention refers to the present invention for biological samples (extracted liquid or serum extracted from dry filter paper blood). In the presence of nicotinamide adenine dinucleotide (NAD ⁺ ), the functionally modified amino acid dehydrogenase developed in ¹ ) acts in an alkaline buffer solution to oxidatively deaminate the amino group of the substrate and nicotinamide adenine di Convert nucleotide (NAD ⁺ ) to reduced form (NADH) and use oxidase of nicotinamide adenine dinucleotide reduced form (NADH) by acting diaphorase (derived from Clostridium kluyveri; manufactured by Oriental Yeast). Then, resazurin (made by Avocado Research Chemicals Ltd.), which is a fluorescent substrate, is reduced to produce resorufin as a fluorescent substance. Including the process of. The fluorescence intensity of the produced fluorescent substance (resorufin) was measured using a fluorescence / absorption / emission microplate reader GENios (manufactured by Tecan Japan).

Example 1
[Construction of chimeric enzyme]
(1; Preparation of template pdh gene)
Escherichia coli JM109 / pPDH1 and pPDH-DBL incorporating the phenylalanine dehydrogenase gene (pdh) derived from Bacillus badius IAM11059 and Bacillus sphaericus R79a used as templates and its complementary sequence; European Journal of Biochemistry, vol. 168. 153 -159 (1987) and Gene, vol. 63. 337-341 (1988)), plasmid DNA (pPDH1 and pPDH-DBL) was extracted by the alkaline SDS method. The pdh gene sequence and amino acid sequence derived from Bacillus badius IAM11059 are shown in SEQ ID NOs: 1 and 2, and the pdh gene sequence and amino acid sequence derived from Bacillus sphaericus R79a are shown in SEQ ID NOs: 3 and 4, respectively. An RNase solution (manufactured by SIGMA) adjusted to 5 mg / ml was added to the obtained plasmid DNA (0.1 ml) for treatment. The treated reaction solution was treated with phenol / chloroform according to a conventional method. The treatment reaction solution was subjected to polyethylene glycol precipitation treatment to obtain purified template plasmid DNA solutions (pPDH1 and pPDH-DBL).

(2; Preparation of vector pUC18His)
In the vector used in the present invention, EcoRI restriction enzyme recognition sequence was added upstream of the ribosome binding sequence site of pRSET-B vector DNA (Invitrogen) with a synthetic primer (Hokkaido System Science), and BamHI restriction enzyme was added. The sequence up to the recognition sequence was amplified by PCR and inserted into the restriction enzyme recognition sites of the multicloning sites EcoRI and BamHI of pUC18 vector DNA (manufactured by Takara Bio Inc.). This vector induces the target gene with the lac promoter of the pUC18 vector DNA, and expresses the protein in a state where 6 consecutive histidine sequences derived from pRSET-B are fused to the N-terminal side of the expressed protein. The recombination and expression of the function-modified amino acid dehydrogenase gene prepared in the present invention can be performed without being limited to the prepared vector DNA. For example, a commercially available vector DNA such as pRSET-B vector DNA, pUC18 vector DNA, and pET21 (+) vector DNA may be used.

The procedure for preparing the vector DNA used in the present invention is shown below.
Prepare pRSET-B and pUC18 vector DNAs from recombinant E. coli (Escherichia coli JM109) culture solution containing pRSET-B and pUC18 vector DNAs, and purify the vector DNA plasmid by phenol / chloroform extraction and PEG precipitation. went.

(2-1; pRSET-B PCR)
Synthetic oligonucleotide primer 1: 5′-g ccgaat tcttaagaaggagatatacata-3 ′ (Hokkaido System Science Co., Ltd.) (SEQ ID NO: 21) containing EcoRI recognition site (single underline) using the pRSET-B vector DNA obtained above as a template DNA ) And BamHI recognition site (single underlined) synthetic oligonucleotide primer 2: 5'-gc tcggat ccttatcgtcatcgtc-3 '(Hokkaido System Science Co., Ltd.) (SEQ ID NO: 22) is used for PCR (Polymerase Chain Reaction) An approximately 0.1 kb fragment was obtained. The PCR was performed with the following reaction solution composition. 10 ng template DNA plasmid (purified pRSET-B vector DNA), 100 pmol / μl of the synthetic oligonucleotide primer 0.5 μl each, 10 × KOD PCR buffer (TOYOBO) 2.5 μl, 2.5 mM dNTP mixture (Takara) BIO Co., Ltd.) (2.5 μl) and KOD-Plus-DNA polymerase (TOYOBO) (0.5 μl) were added to make the total reaction volume 25 μl. As the PCR reaction conditions, a reaction cycle of 94 ° C. for 15 seconds, 55 ° C. for 30 seconds, and 68 ° C. for 20 seconds was repeated 35 times. PCR was performed using a PTC-200 Peltier thermal cycler (manufactured by MJ Research Japan Co., Ltd.). Run the PCR reaction solution, cut out the resulting amplification target product (about 0.1 kb) under UV irradiation, extract and purify with Gel Extraction Kit Gel-M ^™ Gel Extraction Kit (VIOGENE), 30 μl A purified product was obtained. Add 10 μl of K buffer (Takara Bio), 0.8 μl each of EcoRI and BamHI, and 0.9 μl of sterilized ultrapure water to 29 μl of the purified product to give a total volume of 35 μl. The reaction mixture was subjected to restriction enzyme treatment on both ends of the purified PCR product, and the target fragment (about 0.1 kb) band was extracted with the Gel Extraction Kit Gel-M ^TM Gel Extraction Kit (manufactured by VIOGENE). The purified insert fragment containing 30 μl of His-tag sequence was obtained.

(2-2; Preparation of pUC18 vector DNA)
Add 10 μg of purified pUC18 vector DNA obtained from the above plasmid extraction, 2 μl of 10 × K buffer (Takara Bio), 1 μl each of EcoRI and BamHI, and add 20 μl of sterilized ultrapure water to a total volume of 20 ° C. For 3 hours. Add 20 μl of the reaction solution to 5 μl of 10 × SAP buffer (Boehringer Mannheim), 2 μl of shrimp alkaline phosphatase (Boehringer Mannheim) and 23 μl of sterilized ultrapure water for a total volume of 50 μl and react at 50 ° C. for 1 hour. Then, 1 μl of alkaline phosphatase was further added and reacted at 50 ° C. for 30 minutes. The reaction solution was purified by conventional methods such as phenol / chloroform extraction and ethanol precipitation, and 30 μl of dephosphorylated pUC18 vector DNA dissolved in TE solution was prepared.

(2-3; ligation reaction)
The purified insert fragment and vector DNA obtained in (2-1 and 2-2) above were ligated according to the following procedure. Mix 1 μl of dephosphorylated pUC18 vector DNA, 5 μl of the purified insert, 1 μl of 10 × Reaction buffer (New England Biolabs) and 0.5 μl of T4 DNA ligase (New England Biolabs) Ligation was performed at 10 ° C. for 10 hours at 10 μl.

(2-4; Transformation of Escherichia coli JM109)
A part of the reaction solution was transformed into Escherichia coli JM109. The grown colonies of Escherichia coli were inoculated into an LB liquid medium containing ampicillin salt and cultured with shaking at 37 ° C. for 12 hours. Plasmid DNA was purified from the culture solution according to a conventional method. The base sequence analysis of the purified plasmid DNA was performed using LI-COR dNA Sequencer model 4000L (Aloka). The analysis sample was prepared by PCR using a Thermo Sequenase Cycle Sequencing Kit (manufactured by usb) according to the protocol of the company. A clone in which the correct sequence of the inserted fragment was confirmed was used as Escherichia coli JM109 / pUC18His in the experiment of the present invention.

(3; Preparation of chimeric insert)
An outline of pdh chimera construction of pPDH1 and pPDH-DBL is shown in FIG. That is, the PheDH-derived N-terminal domain of pPDH1 (amino acid sequence including the first methionine (Met) to 122th threonine (Thr)) and the C-terminal domain (124th threonine (Thr) to 380th asparagine (Asn) The amino acid sequence including up to) was amplified as a gene fragment by PCR. However, since the 123rd glycine (Gly; ggt) is used as a ligation site for the heterologous enzyme gene in the construction of the chimera, serine (Ser; agt) and the synthetic oligonucleotide primer sequence used for PCR Designed to be The base sequence of the serine (Ser) was designed to match the recognition sequence of the restriction enzyme ScaI (Nippon Gene). Similarly to the above, the PheDH-derived N-terminal domain of pPDH-DBL (amino acid sequence including the 1st methionine (Met) to 123rd threonine (Thr)) and the C-terminal domain (381st from the 125th threonine (Thr)) Each amino acid sequence including up to glutamic acid (Glu) was amplified as a gene fragment by PCR. However, for the 124th glycine (Gly; ggt), a synthetic oligonucleotide primer was designed to be serine (Ser; agt).

  The following shows synthetic oligonucleotide primers (manufactured by Hokkaido System Science Co., Ltd.) used for amplification of each domain fragment in the chimera construction. For pPDH1 pdh chimeric fragment amplification, fBBnch1: 5'-aaggatccgatgagcttagtagaaaaaaca-3 '(SEQ ID NO: 23) and BBnScaI-2: 5'-cgtttctatacaagtactgat-3' (SEQ ID NO: 24) are used as primers for N-terminal domain amplification, respectively. It was. Further, BBnScaI-1: 5′-cgtttctatacaagtactgat-3 ′ (SEQ ID NO: 25) and BBPstI: 5′-gatattcgcaactaactgcaggg-3 ′ (SEQ ID NO: 26) were used as C-terminal domain amplification primers. Furthermore, for pPDH-DBL pdh chimera fragment amplification, fBSnch1: 5'-aaggatccgatggcaaaacagcttgaaaag-3 '(SEQ ID NO: 27) and BSnScaI-4: 5'-gtcagtacttgtgtaaaatcg-3' (SEQ ID NO: 28) were used as primers for N-terminal domain amplification. Were used respectively. BSnScaI-3: 5′-cgattttacacaagtactgac-3 ′ (SEQ ID NO: 29) and BSPstI: 5′-ccgctgcagttactcttttatg-3 ′ (SEQ ID NO: 30) were respectively used as primers for C-terminal domain amplification.

(3-1: PCR amplification of chimeric fragments)
Amplification reaction by PCR of each domain fragment used for chimera construction was performed according to the following procedure and method. The pPDH1 and pPDH-DBL plasmids prepared in (1) above were used as template DNA. 10 ng of template DNA, 100 pmol / μl of the synthetic oligonucleotide primer (sense primer and antisense primer) 0.5 μl each, 10 × PCR buffer (TOYOBO) 2.5 μl, 2.5 mM dNTP mixture (Takara Shuzo) PCR) was performed by adding 2.5 μl of Co., Ltd. and 0.5 μl of KOD-Plus-DNA polymerase to a total volume of 25 μl. As PCR reaction conditions, a reaction cycle of 94 ° C. for 15 seconds, 55 ° C. for 30 seconds, and 68 ° C. for 2 minutes was repeated 35 times. The total amount of the PCR reaction solution was run on a 1.5% agarose gel, and the resulting amplification target product (N-terminal domain fragment; about 0.4 kb, C-terminal domain fragment; about 0.7 kb) was gel extraction kit Gel-M ^™ Gel Extraction Extraction and purification with Kit (manufactured by VIOGENE) gave 30 μl of each purified product. The purified product N-terminal domain fragment was treated with each restriction enzyme of BamHI (manufactured by New England Biolabs) and ScaI (manufactured by Nippon Gene). Further, the purified product C-terminal domain fragment was treated with restriction enzymes ScaI and PstI (manufactured by MBI Fermentas). Each of the reaction solutions was electrophoresed, and the target fragment (N-terminal domain fragment; approximately 0.4 kb, C-terminal domain fragment; approximately 0.7 kb) was excised and gel extraction kit Gel-M ^™ Gel Extraction Kit (manufactured by VIOGENE). Extraction and purification yielded a chimeric domain fragment.

(3-2; Ligation and transformation of chimeric enzyme)
A chimeric enzyme was constructed (ligation reaction) using the purified chimeric domain fragment. The procedure and method are shown below. As the vector DNA, the pUC18His vector DNA constructed in the experiment of the present invention was used, and the vector DNA digested with both BamHI and PstI restriction enzymes according to a conventional method and subjected to dephosphorylation treatment was used. The N-terminal domain of pdh from Bacillus badius IAM11059 and the C-terminal domain of pdh from Bacillus sphaericus R79a were ligated. The reaction solution was transformed into Escherichia coli JM109 according to a conventional method, and then selected by measuring the dehydrogenase activity. The DNA sequence of the selected clone was performed according to the method described above, and the strain having the target chimeric gene and its complementary sequence was selected. The obtained plasmid containing the chimeric enzyme gene was designated as pBBBS-14. In addition, when constructing a chimeric enzyme using the N-terminal domain of pdh derived from Bacillus sphaericus R79a and the C-terminal domain of pdh derived from Bacillus badius IAM11059, the same procedure was performed, and the resulting plasmid containing the chimeric enzyme gene was transformed into pBSBB- 32. The base sequence and amino acid sequence of the obtained pBBBS-14 are shown in SEQ ID NOs: 17 and 18, and the base sequence and amino acid sequence of the chimeric enzyme gene of pBSBB-32 are shown in SEQ ID NOs: 19 and 20.

(4: Error-prone PCR of chimeric enzyme)
Using the chimeric enzyme genes (pdh-14 and pdh-32) constructed in the present invention, the error-prone PCR method (Leung, DW, Chen, E. and Goeddel, DV (1989) J. Methods Cell Mol. Biol. 1, 11-15) was used to construct and screen a random mutagenesis enzyme. That is, PCR reaction was performed using pBBBS-14 and pBSBB-32 plasmid DNA as templates, and each concentration of bases (adenine (A), cytosine (C), guanine (G), and thymine (T)) in the reaction solution was added. DNA Taq polymerase misrecognizes the base sequence reading of the template DNA by adjusting the concentration of magnesium chloride (or magnesium sulfate) and manganese chloride (or manganese sulfate) added to the reaction solution Resulting in random mutagenesis of the template DNA.

  The conditions of error-prone PCR performed in the present invention are shown below. Synthetic oligonucleotide primers used for PCR in the experiments of the present invention were BBnch1; 5′-aaggatccgatgagcttagta gaaaaaaca-3 ′ (SEQ ID NO: 31) as a sense primer and BBPstI; 5′-ccgctgcagttactcttttatg-3 ′ (SEQ ID NO: 32) as an antisense primer. ) Was used. PCR reaction solution composition is template DNA plasmid (appropriate concentration of pBBBS-14 or pBSBB-32; for example, 1 to 100 ng, preferably 10 to 50 ng) 0.25 μl, magnesium-free 10 × PCR buffer (Takara Shuzo) 2.5 μl, 25 mM magnesium chloride 2.5 μl, 2.5 mM dNTP mixture 2.5 μl, each synthetic oligonucleotide primer 0.5 μl, 5 mM manganese chloride 10 μl, Taq polymerase 0.5 μl, and sterile ultrapure water 5.75 μl total volume 25 μl did. The concentration of the dNTP mixture was determined by the following combination of concentrations. (1) 10 mM dATP, 10 mM dCTP, 5 mM dGTP, 5 mM dTTP, (2) 5 mM dATP, 10 mM dCTP, 5 mM dGTP, 10 mM dTTP, (3) 2 mM dATP, 2 mM dCTP, 10 mM dGTP, 10 mM dTTP, and (4) 10 mM dATP, 10 mM dCTP, 2 mM dGTP, 2 mM dTTP.

  The plasmids of the chimeric enzyme random mutant obtained in the experiment of the present invention were pBBBS-14-4d7 (obtained in the dNTP mixture concentration set of (1) above), pBBBS-14-16h3 (dNTP of (2) above) pBBBS-14-92A3 (obtained in the dNTP mixture concentration set in (3) above). In pBBBS-14-4d7, the 144th amino acid in the amino acid sequence of the parent strain BBBS-14 was mutated from asparagine (Asn) to lysine (Lsy). In pBBBS-14-16h3, the 100th amino acid sequence of the parent strain was mutated from aspartic acid (Asp) to valine (Val), and the 148th amino acid was mutated from glutamic acid (Glu) to lysine (Lys). In pBBBS-14-92A3, the 148th amino acid of the parental amino acid sequence is glutamic acid (Glu) to lysine (Lys), the 314th amino acid tyrosine (Tyr) is histidine (His), the 320th amino acid arginine ( Arg) was mutated to tryptophan (Trp).

(5: Mutant expression and enzyme protein purification)
The expression of the random mutation-introducing enzyme gene by the chimeric enzyme gene constructed in the present invention and its error-prone PCR and purification of the expressed enzyme protein are shown below. 50 μg / ml ampicillin salt of colonies of recombinant E. coli (Escherichia coli JM109 / pBBBS-14 and pBSBB-32) transformed with plasmids pBBBS-14 and pBSBB-32 containing the chimeric enzyme gene constructed in the present invention The mixture was cultured with shaking in a test tube containing 4 ml of LB medium (pH 7.5) containing 12 hours at 37 ° C. The culture solution was inoculated into a 2-liter Sakaguchi flask containing 500 ml of LB medium (pH 7.5) containing 50 μg / ml ampicillin salt, and cultured with shaking at 37 ° C. for 12 hours. 0.5 M isopropyl-β-D -Galactoside (IPTG; manufactured by Nacalai Tesque) was added to a final concentration of 0.5 mM, and the culture temperature was lowered to 30 ° C., followed by further 4 hours of shaking culture. The culture solution obtained above was centrifuged (7,000 rpm, 10 minutes, 4 ° C .; Hitachi high-speed cooling centrifuge himac CR20F, manufactured by Hitachi) to precipitate the cultured cells and remove the supernatant. The obtained microbial cells were washed with 0.85% physiological saline, and collected again by centrifugation (7,000 rpm, 15 minutes, 4 ° C.). After suspending in 20 mM Tris-HCl buffer, pH 8.0 containing 300 mM NaCl, 5 mM 2-mercaptoethanol, and 25 mM imidazole, 200 using an ultrasonic crusher (KUBOTA INSONATOR model 201M, manufactured by Kubota) The cells were crushed and the enzyme was extracted at 4 ° C for 20 minutes at W. The disrupted solution was centrifuged (15,000 rpm, 20 minutes, 4 ° C .; Hitachi high-speed cooling centrifuge himac CR20F), and the supernatant was used as a cell-free extract for purification of enzyme protein. The cell-free extract is pre-filled with 0.1 M nickel sulfate (NiSO ₄ · 6H ₂ O; manufactured by Wako Pure Chemical Industries, Ltd.) and contains a binding buffer (300 mM NaCl, 5 mM 2-mercaptoethanol, and 25 mM imidazole). It was added to a column packed with 10 ml of chelating Sepharose Fast Flow resin (Amersham Biosciences) equilibrated with 20 mM Tris-HCl buffer, pH 8.0. Wash the resin with a buffer solution for washing 15 times the volume of the column resin (20 mM Tris-HCl buffer, pH 8.0 containing 300 mM NaCl, 5 mM 2-mercaptoethanol and 75 mM imidazole), and then the column resin. The bound enzyme protein was eluted with a 6-fold volume elution buffer (20 mM Tris-HCl buffer, pH 8.0 containing 300 mM NaCl, 5 mM 2-mercaptoethanol and 500 mM imidazole). The elution fraction was concentrated using a stirring type ultrafiltration concentrator (model 8050; manufactured by Amicon) (ultrafiltration membrane PBQK: molecular weight cut off 50,000; manufactured by Millipore), 0.1 mM EDTA and 5 mM 2- Dialyzed overnight against 20 mM Tris-HCl buffer, pH 8.0 containing mercaptoethanol. The dialyzed sample was subjected to low-pressure chromatography on a 5 ml HighQ column (Bio-Rad) equilibrated in advance with 20 mM Tris-HCl buffer, pH 8.0 containing 0.1 mM EDTA and 5 mM 2-mercaptoethanol. A gradient pump (Econo Gradient Pump; manufactured by Bio-Rad) was added, and the column was washed with the same buffer using the same apparatus. The elution of the enzyme protein bound to the column resin was carried out by using the chromatography pump program with a NaCl concentration gradient from 0 to 0.75 M in a continuous concentration gradient. The elution fraction was fractionated into 3 ml tubes, and the protein concentration in each tube was calculated based on a calibration curve prepared at a specific concentration of bovine serum albumin using the 280 nm filter of the GENios microplate reader. Enzyme activity was confirmed by an increase in absorption at 340 nm in kinetic mode using a 340 nm filter of the same microplate reader. The purity of the purified enzyme was confirmed by sodium dodecyl sulfate / polyacrylamide / gel electrophoresis. Experiments in the present invention were performed using the obtained purified enzyme.

(6; enzyme activity measurement and protein measurement)
The phenylalanine dehydrogenase activity and the activity of the chimeric enzyme and the random mutation enzyme were measured according to the method of Asano et al. (Eur. J. Biochem. (1987) 168 (1), 153-159). U-3210 (manufactured by Hitachi, Ltd.), and measurement was performed with a PMMA cuvette (BRAND) having an optical path length of 1 cm. The composition of the reaction solution was as follows. 0.1 ml of 1 M Glycine-NaCl-NaOH buffer, pH 10.4, 0.1 ml of 25 mM NAD ⁺ (Oriental Yeast) solution, 0.1 M L-phenylalanine (Nippon Riken) or L-leucine (Nippon Riken) ) Or L-methionine (manufactured by Nihon Rikagaku Kabushiki Kaisha), etc. (The substrate specificity varies depending on the nature of the enzyme, so select the appropriate substrate each time) 0.1 ml and the appropriate amount of enzyme solution are added to react. The total liquid volume was 1.0 ml. The molecular extinction coefficient (ε) of coenzyme NAD ⁺ is 6,220 l · mol ⁻¹ · cm ^−1, and the rate of change in absorbance per unit time (min) (Δ340 nm / min) is determined from the increase in absorbance at 340 nm The activity was calculated. One unit (U) of enzyme activity in the present invention is defined as the amount of enzyme that produces 1 μmol of NADH per minute. Specific activity (U / mg) was defined as enzyme activity (U) per mg protein. In addition, as a simple enzyme activity measurement method, the reaction solution composition is made up to a total volume of 200 μl, a 96-well UV plate (made by Greiner) is used, and a fluorescence / absorption / emission microplate reader GENios (made by Tecan Japan) is used. The increase in absorbance value was measured with a 340 nm filter in kinetic mode. The protein concentration of the enzyme solution was calculated from the absorbance value at 595 nm using Protein Assay Kit (Bio-Rad) according to the protocol of the company. A calibration curve was prepared by setting bovine serum albumin (manufactured by Sigma) as a standard protein and setting an arbitrary concentration.

Example 2
[Production of site-specific mutant enzyme]
(1; Creation of site-directed mutagenesis enzyme of pdh gene derived from Bacillus badius IAM11059)
In the amino acid sequence of the chimera construction function-modified amino acid dehydrogenase described above, substitution of glycine (Gly) to serine (Ser) is performed at the ligation site of each domain in both PBBBS-14 and pBSBB-32 derived PheDH. The present inventors consider that this amino acid substitution is important for the change in pdh substrate specificity, and site-directed mutagenesis using the pdh genes derived from pPDH1 and pPDH-DBL as template DNAs, respectively (the 123rd position of pdh derived from pPDH1). And the 124th amino acid of pPDH-DBL-derived pdh).

  The procedure is shown below. Site-directed mutagenesis was performed by QuikChange (Site-Directed Mutagenesis Kit (STRATAGENE (manufactured)) according to the protocol of the PCR. The synthetic oligonucleotide primer used for mutagenesis was 5'- as a sense primer. cgtttctatacaagtactgatatggg -3 ′ (SEQ ID NO: 33) was used, and 5′-cccatatcagtacttgtatagaaacg -3 ′ (SEQ ID NO: 34) was used as an antisense primer, respectively, and purified pPDH1 plasmid was used as template DNA. The steps of 30 seconds at 55 ° C., 1 minute at 55 ° C. and 4 minutes at 68 ° C. were repeated 16 times.After the PCR reaction was completed, transformation was performed according to the heat shock method described above. And then incubated at 37 ° C. for 16 hours, and an appropriate number of colonies were selected and cultured in an LB test tube medium containing ampicillin to obtain a site-directed mutagenesis strain culture solution. According to the method, purified plasmid DNA was obtained, and a clone in which the correct sequence of the inserted fragment was confirmed was used as Escherichia coli JM109 / pBB123S in the present experiment, and several amino acids other than pBB123S were used in the present experiment. The mutants that caused the substitution were obtained, which were unintentional mutations that were not intended in this experiment, but in the mutants, the 218th amino acid was threonine (Thr; acg) and serine (Ser; agc). PBB123S218S with amino acid substitution and pBB123S218S287Q with 218th and 287th amino acids substituted with serine (Ser; agc) and glutamine (Gln; cag), respectively, were obtained as mutants.

(2; Creation of site-directed mutagenesis enzyme of pdh gene derived from Bacillus sphaericus R79a)
Similar to the creation of pBB123S described above, in the pdh of Bacillus sphaericus R79a, the glycine (Gly) was replaced with serine (Ser) at the linking site (124th amino acid) at the time of construction of the chimeric enzyme. The change in specificity was examined. The pPDH-DBL plasmid containing the pdh gene derived from Bacillus sphaericus R79a was used as template DNA. Site-directed mutagenesis was performed by QuikChange (Site-Directed Mutagenesis Kit (STRATAGENE (manufactured)) according to the protocol of the PCR. The synthetic oligonucleotide primer used for mutagenesis was 5'- as a sense primer. cgattttacacaagtactgacatgggg-3 ′ (SEQ ID NO: 35) was used, and 5′-ccccatgtcagtacttgtgtaaaatcg-3 ′ (SEQ ID NO: 36) was used as an antisense primer, respectively. The clone was used in the experiment of the present invention as Escherichia coli JM109 / pBS124S, and a site-specific mutant that was not intended for the experiment of the present invention was obtained, but the mutation was changed from the 124th glycine (Gly) to serine (Ser). In addition to the amino acid substitution, the mutant pBS82R124S in which the amino acid alanine (Ala; gcc) at position 82 was substituted with arginine (Arg; cgc) was obtained. There.

(2-1; 20 site-specific amino acid substitutions)
In the pdh derived from Bacillus sphaericus R79a, the substrate specificity of the parent strain could be dramatically altered by substituting glycine (Gly; ggt) with serine (Ser; agt) for the 124th amino acid. Substitution of substrate specificity was attempted by substituting (Gly) with other 20 amino acids (but not being replaced by a stop codon). For site-specific amino acid substitution, synthetic oligonucleotide primers were used, and PCR reaction using QuikChange (Site-Directed Mutagenesis Kit (STRATAGENE)) was performed according to the company's protocol. , Sense primer 5′-cgattttacaca nns actgacatgggg -3 ′ (SEQ ID NO: 37) and antisense primer 5′-ccccatgtcagt snn tgtgtaaaatcg -3 ′ (SEQ ID NO: 38) (n is adenine (a) or cytosine (c) or guanine ( g) or thymine (t), either s = c (cytosine) or g (guanine).) Using purified pPDH-DBL as template plasmid DNA The PCR reaction solution was transformed, and the resulting transformant was cultured, and after centrifugation, the enzyme solution was extracted by freeze-thawing. The selected strain was cultured in LB medium containing ampicillin to obtain a site-directed mutagenized strain culture solution, which was treated according to a conventional method to obtain purified plasmid DNA, and the mutation was confirmed by sequencing. The obtained strain was designated Escherichia coli JM109 / pBS124A, and the resulting plasmid pBS124A had the amino acid at position 124 of the parent strain amino acid sequence mutated from glycine (Gly) to alanine (Ala).

(3: Mutant expression and enzyme protein purification)
The expression of the site-specific mutant gene obtained in the present invention and the expressed enzyme protein were performed according to the method described above. The purity of the purified enzyme was confirmed by sodium dodecyl sulfate / polyacrylamide / gel electrophoresis. Experiments in the present invention were performed using the obtained purified enzyme.

Example 3
[Substrate specificity of the modified enzyme]
FIG. 5 shows the substrate specificity of phenylalanine dehydrogenase derived from the parent strains Bacillus badius IAM11059 and Bacillus sphaericus R79a used in the experiment of the present invention. Phenylalanine dehydrogenase derived from Bacillus badius IAM11059 (European Journal of Biochemistry, vol. 168. 153-159 (1987)) has the highest substrate specificity for L-phenylalanine, whereas phenylalanine dehydrogenase derived from Bacillus sphaericus R79a (The Journal of Biological Chemistry, vol. 262. 10346-10354 (1987)) shows high substrate specificity for L-tyrosine in addition to L-phenylalanine. Chimeric enzymes obtained by the present invention (pBBBS-14 and pBSBB-32), mutant enzymes of chimeric enzymes (pBBBS-14-4d7, pBBBS-14-16h3 and pBBBS-14-92A3), site-directed mutagenesis strains Substrate specificity (especially L-phenylalanine, L-leucine, L-isoleucine, L-methionine and L-valine) was examined using each purified enzyme of the enzyme (pBB123S, pBB123S218S, pBB123S218S287Q, pBS124S, pBS82R124S and pBS124A). The results are shown in FIG. 3 (substrate specificity of the chimeric enzyme), FIG. 4 (substrate specificity of the site-directed mutant enzyme of Bacillus badius IAM11059) and FIG. 5 (substrate of the site-specific mutant enzyme of pdh derived from Bacillus sphaericus R79a). Specificity).

  As shown in FIG. 3, the chimeric enzyme pBBBS-14 obtained in the present invention had the highest specificity for leucine, followed by isoleucine, methionine, valine, and phenylalanine in this order. On the other hand, the chimeric enzyme pBSBB-32 had the highest specificity for isoleucine, followed by leucine, valine, methionine, and phenylalanine. In pBBBS-14-4d7, isoleucine was the highest, followed by methionine, leucine, valine, and phenylalanine. In pBBBS-14-16h3, isoleucine was the highest, followed by leucine, valine, methionine, and phenylalanine. In pBBBS-14-92A3, isoleucine was the highest, followed by methionine, valine, and phenylalanine.

  Further, as shown in FIG. 4, the site-specific mutagenesis strain enzymes pBB123S, pBB123S218S, and pBB123S218S287Q all had the highest specificity for leucine, followed by isoleucine, valine, methionine, and phenylalanine in this order. That is, the most important amino acid for substrate specificity modification (leucine specificity) by amino acid substitution of pdh derived from Bacillus badius IAM11059 is to substitute glycine (Gly), which is the 123rd amino acid, with serine (Ser).

  Furthermore, as shown in FIG. 5, the site-directed mutagenesis enzyme pBS124S had the highest specificity for isoleucine, followed by methionine, phenylalanine, leucine, and valine in this order. pBS82R124S had the highest specificity for phenylalanine, followed by leucine, methionine, isoleucine, and valine. PBS124A had the highest specificity for leucine, followed by valine, isoleucine, methionine, and phenylalanine. That is, it was suggested that the substrate specificity modification of pdh derived from Bacillus sphaericus R79a involves amino acid substitution in addition to substitution of the 124th amino acid glycine (Gly) with serine (Ser).

  Regarding the reactivity to amino acids other than the above-mentioned amino acids, all mutant enzymes showed only low specificity or only undetectable activity. The phenylalanine dehydrogenase gene used in the present invention is a bacterium other than Bacillus badius IAM11059 or Bacillus sphaericus R79a (for example, Sporosarcina ureae R04, Bacillus halodurans, Geobacillus kaustophilus, Oceanobacillus iheyensis, Rhodococcus sp. It may be derived from. For example, Sporosarcina ureae R04 is the 125th amino acid, Bacillus halodurans is the 122nd amino acid, Geobacillus kaustophilus is the 123rd amino acid, Oceanobacillus iheyensis is the 122nd amino acid, Rhodococcus sp. M-4 is the 117th amino acid, or In Thermoactinomyces intermedius, it is the 114th amino acid (the corresponding amino acid is glycine (Gly)).

Example 4
[Quantification of L-methionine in filter paper blood]
As a standard sample, one extracted from standard filter paper blood (Sapporo Immunodiagnostic Laboratories) impregnated with a predetermined concentration of L-methionine was used. Extraction from standard filter paper blood was performed according to the following procedure. Spots on the filter paper blood were punched into a disk shape having a diameter of 3 mm and placed in each well of a 96-well microplate (Corning). Drip and soak 10 µl of fixative solution (acetone: ethanol: ultrapure water = 7: 7: 2 (v / v / v)) into the disk-shaped filter paper blood placed in each well at 37 ° C For 1 hour (ADVANTEC INCUBATOR Cl-410, manufactured by Advantech). After that, the plate is taken out and 100 μl of buffer solution (50 mM Tris-HCl buffer, pH 8.9) containing 40 μM resazurin (Avocado Research Chemicals Ltd.) is added to each well to prevent evaporation. The mixture was allowed to stand at room temperature for 1 hour, and components contained in the filter paper blood were extracted. Transfer 80 μl of the resulting extract to a new black 96-well microplate, add 40 μl of enzyme mixture (0.2 U / ml purified enzyme, 0.2 mg / ml diaphorase, 6 mM NAD +) in the mixer. After stirring, the enzyme reaction was performed by allowing to stand at room temperature for 60 minutes. The fluorescence of the plate was measured with a fluorescence microplate reader using a filter having an excitation wavelength of 545 nm and a fluorescence wavelength of 590 nm.

  Similarly, an extract obtained from standard filter paper blood (Sapporo Immunodiagnostic Laboratories) impregnated with L-phenylalanine was quantified with recombinant phenylalanine dehydrogenase derived from Bacillus badius IAM11059. The extract obtained from standard filter paper blood soaked with L-leucine was quantified using a commercially available leucine dehydrogenase derived from Bacillus stearothermophilus (manufactured by Unitika Ltd .; 0.2 U / ml).

  As a result, enzymatic fluorescence determination of L-phenylalanine, L-leucine and L-methionine is possible by combining the enzyme obtained in the present invention with phenylalanine dehydrogenase derived from Bacillus badius IAM11059 and leucine dehydrogenase derived from Bacillus stearothermophilus I found out.

Example 5
[Molecular modeling of phenylalanine dehydrogenase]
Using the amino acid sequence of phenylalanine dehydrogenase derived from Bacillus sphaericus R79a (Swiss-Prot accession No. P23307) as a template, protein homology modeling was performed using the Canadian Computational Chemistry System Program (MOE). Homologous proteins were searched and some amino acid dehydrogenase proteins were extracted. Multiple sequence alignment was performed based on the amino acid sequence obtained above. Structure retention region analysis using the 3D structure coordinates (PDB accession No. 1LEH, homology: 47.2%) of leucine dehydrogenase from Bacillus sphaericus, which showed the highest homology among amino acid dehydrogenases with known 3D structures. The same program was used to construct a predicted three-dimensional structure of phenylalanine dehydrogenase from Bacillus sphaericus R79a. The predicted three-dimensional structure was optimized by calculating the energy minimization based on the AMBER '89 / '94, CHARMM22 and Engh-Huber force field theories included in the MOE program.

[Coordinate extraction and transcription of coenzyme NAD]
Crystal structure analysis of phenylalanine dehydrogenase has been reported for enzymes derived from Rhodococcus sp. M4 (Biochemistry, 38. 2326-2339 (1999), Biochemistry, 39. 9174-9187 (2000)). In the three-dimensional structure analysis of phenylalanine dehydrogenase derived from Rhodococcus sp. M4, the coordinates of the complex of enzyme protein, coenzyme (NAD ⁺ ) and reaction product (phenylpyruvic acid) are analyzed (PDB accession No. 1BW9). ). The coordinates of NAD ⁺ were extracted from the PDB data and transplanted to the predicted three-dimensional structure data. Amino acid residues interacting with NAD ⁺ and proteins described in the above references are searched from the alignment of amino acid sequences of phenylalanine dehydrogenase derived from B. sphaericus, and amino acid residues 195th valine (Val), 214th Aspartic acid (Asp), 254th alanine (Ala) and 277th asparagine (Asn) were extracted. The MOE program is used to constrain the interatomic distance between the amino acid residue and NAD ⁺ , and the same program is used to perform the energy minimization calculation to obtain the spatial coordinates where NAD ⁺ is most stable in the predicted 3D structure. Derived.

[Coordinate extraction and transcription of substrate L-phenylalanine]
In the same manner as the NAD ^+, the coordinates of the substrate L- phenylalanine extracted from Rhodococcus sp. M4 conformational coordinate (PDB accession No. 1C1D), predicted three-dimensional structure of Bacillus sphaericus R79a from phenylalanine dehydrogenase constructed in the It was transplanted on the coordinates of the data. According to the same procedure as above, the amino acid residue that interacts with the enzyme protein and L-Phe is constrained to the interatomic distance between the 53rd glycine, 79th lysine, 91st lysine and 126th aspartic acid and the substrate L-phenylalanine. The energy minimization calculation was performed over time, and the spatial coordinates where L-Phe was most stable in the predicted 3D structure were derived.

[Extraction of mutated amino acid residue candidates]
The B. sphaericus-derived phenylalanine dehydrogenase protein / NAD ⁺ / L-phenylalanine complex predicted three-dimensional structure constructed as described above is output in PDB data format, and molecular model display software (PyMOL, DeLano Scientific LLC, South San Francisco, CA) , USA). Extraction was performed while confirming the drawn three-dimensional structure of amino acid residues that can contact the substrate (L-phenylalanine) ligand and the protein molecule surface. Amino acid residues that interact with substrates in Rhodococcus sp. M4-derived phenylalanine dehydrogenase (Non-patent Documents 1 and 2) were extracted from the amino acid sequence of B. sphaericus-derived phenylalanine dehydrogenase by amino acid sequence alignment. By the above operation, a total of 28 amino acid residues were selected as candidates. The selected amino acid residues are as shown in Table 4 below.

[Screening by saturation mutation]
Primers were created for each of the 28 amino acid residue candidates to saturate into 20 types of amino acids (see Table 4), and PCR was performed according to the protocol using QuikChange (Multi Site-Directed Mutagenesis Kit manufactured by Stratagene). In this example, PCR was performed using the primer combinations shown in Table 5 and using the wild strain (pBS) and mutant enzyme (BS124S) of phenylalanine dehydrogenase derived from Bacillus sphaericus R79a as templates. (Set (1), Set (2), Set (3) and Set (4)) The resulting PCR reaction solution was transformed into E. coli JM109 according to a standard method, and LB containing 50 μg / ml ampicillin. It was applied to an agar medium and cultured for 10 hours at 37 ° C. The obtained colonies were inoculated into a 96-well deep plate (NUNC, LB medium containing 80 μg / ml ampicillin; 300 μL) at 1000 rpm, 37 Incubate for 12-18 hours at ℃ The culture broth was collected, and the cell-free extract was extracted by lysozyme treatment and freeze-thawing operation, 10 μL of the extracted enzyme solution was used for enzyme reaction in a well of a 96-well UV microplate, and a microplate reader was used. The increase in absorbance at 340 nm was observed over time, and the activities of L-phenylalanine, L-leucine, and L-methionine against each substrate were screened.

[Secondary screening]
Strains whose activity against L-methionine was improved in the above screening were cultured in 3 mL of LB test tube medium (containing 50 μg / ml ampicillin). 1 mL of the culture solution was collected and sonicated (Bioruptor, Cosmo Bio) to extract a cell-free extract. In addition, the plasmid was extracted and purified from 1 mL of the culture solution as described above according to a conventional method, and the nucleotide sequence was confirmed with a DNA sequencer 310A manufactured by Applied Biosystems.

[Purification of expression mutant enzyme]
One colony was inoculated into a 3 mL LB test tube medium containing 50 μg / ml ampicillin of the mutant strain confirmed to have improved mutagenesis and activity against L-methionine and cultured at 37 ° C. for 10 hours. The culture solution was used as an inoculum and inoculated into a 2 L Erlenmeyer flask containing 400 mL of LB medium and rotated at 37 ° C. for 12 hours. IPTG was added to a final concentration of 0.1 mM, and the cells were further rotated at 30 ° C. for 4 to 6 hours. Bacteria are collected and washed by a conventional method, and suspended by adding 20 mM Tris-HCl buffer (pH 8.0) containing 5 mM volume of 5 mM imidazole, 5 mM 2-mercaptoethanol and 300 mM NaCl to the wet weight of the cells. And sonicated. The cell-free extract obtained by centrifugation is added to a Chelating-Sepharose Fast Flow column (resin amount: about 10 ml) that has been pre-saturated with nickel and equilibrated with the same buffer, and then added to the same buffer containing 75 mM imidazole. After washing the column, the enzyme protein was eluted with the same buffer containing 500 mM imidazole. Ammonium sulfate was added to the eluted enzyme active fraction so as to be 30% saturation, and the mixture was stirred in ice-cold water for 1 hour, and a supernatant was obtained by centrifugation (28,000 × g, 20 minutes, 4 ° C.). The supernatant obtained above was equilibrated with 20 mM Tris-HCl buffer solution (pH 8.0) containing 0.1 mM EDTA and 5 mM 2-mercaptoethanol previously saturated with 30% ammonium sulfate, butyl-TOYOPEARL 650M column (φ1 After washing the column with the same buffer as above, the enzyme protein was eluted by decreasing the ammonium sulfate saturation with a linear gradient (from 30% to 0%). The enzyme activity fraction obtained above was confirmed by SDS polyacrylamide gel electrophoresis and dialyzed against 20 mM Tris-HCl buffer (pH 8.0) containing 0.1 mM EDTA and 5 mM 2-mercaptoethanol. Then, it was concentrated with a centrifugal concentrator (Amicon CentriPrep YM-30) to obtain a purified enzyme.

[Substrate specificity]
The phenylalanine dehydrogenase activity was measured using a double beam spectrophotometer (PharmaSpec UV-1700, manufactured by Shimadzu Corporation) according to the method of Asano et al. (Eur. J. Biochem. (1987) 168 (1), 153-159). The measurement was performed with a PMMA cuvette (BRAND) having an optical path length of 1 cm. The composition of the reaction solution was as follows. 0.1 ml of 1 M Glycine-NaCl-NaOH buffer, pH 10.4, 0.1 ml of 25 mM NAD ⁺ (Oriental Yeast) solution, 0.1 M L-phenylalanine (Nippon Riken) or L-leucine (Nippon Riken) ) Or L-methionine (manufactured by Nihon Rikagaku Kabushiki Kaisha), etc. (The substrate specificity varies depending on the nature of the enzyme, so select the appropriate substrate each time) 0.1 ml and the appropriate amount of enzyme solution are added to react. The total liquid volume was 1.0 ml. The molecular extinction coefficient (ε) of coenzyme NAD ⁺ is 6,220 l · mol ⁻¹ · cm ^−1, and the rate of change in absorbance per unit time (min) (Δ340 nm / min) is determined from the increase in absorbance at 340 nm The activity was calculated. One unit (U) of enzyme activity in the present invention is defined as the amount of enzyme that produces 1 μmol of NADH per minute. Specific activity (U / mg) was defined as enzyme activity (U) per mg protein. The result is shown in FIG. All of the mutant enzymes pBS124S310S, pBS124S310T, and pBS124S310A that had been mutated using pBS124S as a template had improved relative activity to methionine compared to phenylalanine. On the other hand, all of the mutant enzymes (pBS124G310S, pBS124G310T, and pBS124G310A) in which the 124th amino acid of these mutant enzymes (pBS124S310S, pBS124S310T, and pBS124S310A) was modified to wild-type glycine (Gly) recovered their activity against phenylalanine. The activity against methionine was significantly reduced.

Example 6
[Amino acid fluorescence determination of mutant enzyme]
Dispense 0.04 ml each of L-phenylalanine and L-methionine at known concentrations into a 96-well black microplate well, add 0.08 ml of 50 mM Tris-HCl buffer (pH 8.9) containing 40 μM resazurin, and then add 0.04 ml An enzyme mixed solution (containing 10 mU mutant phenylalanine dehydrogenase (pBS124S310S), 4 mM β-NAD +, 0.03 mg / ml diaphorase (manufactured by Oriental Yeast)) was added and incubated at room temperature for 1 hour. The obtained fluorescence was measured with a filter having an excitation wavelength of 545 nm and a fluorescence wavelength of 590 nm using a fluorescence / absorption / luminescence microplate reader (manufactured by Tecan, Genios). The obtained data was analyzed using LS-PATE manager2001 (manufactured by Wako Pure Chemical Industries). The prepared calibration curve is shown in FIG. 7 and the quantitative results are shown in Table 7. From the calibration curve created using pBS124S310S, the L-methionine concentration contained in the control could be quantified. At this time, it was difficult to quantify L-methionine due to the effect of L-phenylalanine concentration with conventional modified enzymes. However, using pBS124S310S enzyme, L-methionine was used regardless of the confluent concentration of L-phenylalanine. Could be quantified.

  By using the function-modified amino acid dehydrogenase obtained in the present invention, L-phenylalanine, L-leucine, L-isoleucine, L-valine and L-methionine can be detected by fluorescence. Further, by combining with existing phenylalanine dehydrogenase, leucine dehydrogenase or valine dehydrogenase, the amino acid can be quantified by the enzyme fluorescence method. This can create unprecedented efficiency in primary screening and other amino acid disease diagnosis leading to early detection of inborn errors of metabolism.

Substrate specificity of phenylalanine dehydrogenases derived from Bacillus badius IAM11059, Bacillus sphaericus R79a and Sporosarcina ureae R04 to L-trypsin, L-leucine, L-isoleucine, L-phenylalanine, L-methionine and L-valine by relative activity Show. Schematic of pdh chimera construction of pPDH1 and pPDH-DBL. Substrate specificity (L-phenylalanine, L-leucine) of chimeric enzymes (pBBBS-14 and pBSBB-32) and mutant enzymes of chimeric enzymes (pBBBS-14-4d7, pBBBS-14-16h3 and pBBBS-14-92A3) L-isoleucine, L-methionine and L-valine). Substrate specificity (L-phenylalanine, L-leucine, L-isoleucine, L-methionine and L-valine) of site-directed mutagenesis strain enzymes (pBB123S, pBB123S218S, pBB123S218S287Q). Substrate specificity (L-phenylalanine, L-leucine, L-isoleucine, L-methionine and L-valine) of site-directed mutagen strain enzymes (pBS124S, pBS82R124S and pBS124A). Substrate specificity (L-phenylalanine, L-leucine, L-isothionine, L-methionine, L-valine and L-tyrosine) of site-directed mutagenesis enzymes (pBS124S310S, pBS124S310T, pBS124S310A, pBS124G310S, pBS124G310T and pBS124G310A). Calibration curve (L-methionine and L-phenylalanine) for enzyme fluorescence determination using site-directed mutagenesis enzyme (pBS124S310S).

Claims (15)

In the amino acid sequence of phenylalanine dehydrogenase derived from Bacillus sphaericus R79a (described in SEQ ID NO: 4 in the sequence listing), the 124th amino acid residue is replaced with serine, and the 310th amino acid residue is serine (Ser). A modified enzyme substituted with threonine (Thr) or alanine (Ala). 2. The amino acid sequence of the modified enzyme according to claim 1, wherein the amino acid sequence has one to several amino acid deletions, substitutions and / or additions (provided that the amino acid to be deleted and / or substituted has a serine at position 124). (Ser), 310 valine (Val) consists is not included), modify the enzyme with improved phenylalanine dehydrogenase activity substrate specificity for methionine. The modified enzyme according to any one of claims 1 to 2, wherein the relative activity to methionine is 500 or more when the relative activity to phenylalanine is 100. A protein in which an oligopeptide (histidine tag) comprising 1 to 12 histidines is fused to the N-terminal side of the enzyme according to any one of claims 1 to 3. Any of the following DNA.
(I) DNA consisting of the base sequence set forth in SEQ ID NO: 3 in the sequence listing, wherein 370th to 372rd ggt (guanine, guanine, thymine) is agt (adenine, guanine, thymine), agc (adenine, guanine, Cytosine), tct (thymine / cytosine / thymine), tcc (thymine / cytosine / cytosine), tca (thymine / cytosine / adenine) or tcg (thymine / cytosine / guanine), and 928th to 930th gtt (guanine / thymine) -Thymine) is tct (thymine, cytosine, thymine), tcc (thymine, cytosine, cytosine), tca (thymine, cytosine, adenine), tcg (thymine, cytosine, guanine), agt (adenine, guanine, thymine), agc (Adenine, guanine, cytosine), act (adenine, cytosine, thymine), acg (adenine, cytosine, guanine), aca (adenine, cytosine, adenine), acg (adenine, cytosine) Shin guanine), gct (guanine cytosine thymine), gcc (guanine cytosine cytosine), DNA is gca (guanine cytosine adenine) or gcg (guanine cytosine guanine),
(B) DNA consisting of a base sequence complementary to the DNA of (a) . (C) The amino acid sequence described in SEQ ID NO: 4 in the Sequence Listing, wherein the 124th amino acid is serine (Ser), and the 310th amino acid is serine (Ser), threonine (Thr), or alanine (Ala) DNA encoding the amino acid sequence
(D) DNA consisting of a base sequence complementary to the DNA of (c) . A vector comprising the DNA according to any one of claims 5 to 6. 8. The vector according to claim 7, further comprising DNA encoding an oligopeptide consisting of 1 to 12 histidines on any terminal side of the DNA according to any one of claims 5 to 6. A transformant obtained by transforming a host with the vector according to claim 7 or 8. A modified enzyme (provided that at least one amino acid is modified so that the substrate specificity of phenylalanine dehydrogenase (EC 1.4.1.20) to methionine is improved from the culture by culturing the transformant according to claim 9 Wherein the modification is a substitution of serine (Ser) for 124th glycine (Gly) in the amino acid sequence of phenylalanine dehydrogenase, and the modification is the 310th valine in the amino acid sequence of phenylalanine dehydrogenase. (Val) is a substitution method for serine (Ser), threonine (Thr) or alanine (Ala). A method for analyzing L-methionine contained in a test sample using the modified enzyme or protein according to any one of claims 1 to 4. 12. The method according to claim 11, wherein at least one of L-leucine, L-isoleucine, L-valine and L-phenylalanine is analyzed in combination. 13. The method according to claim 11 or 12, comprising mixing a test sample with resazurin, diaphorase and nicotinamide adenine dinucleotide (NAD ⁺ ) and detecting fluorescence. The method according to any one of claims 11 to 13, wherein the test sample is mixed with resazurin, diaphorase, and nicotinamide adenine dinucleotide (NAD ⁺ ) in a well of a microplate. The method according to any one of claims 11 to 14, wherein the test sample is a blood sample.

Images