CN110607290B

CN110607290B - Phenylalanine dehydrogenase mutant with improved substrate specificity and application thereof

Info

Publication number: CN110607290B
Application number: CN201911046656.6A
Authority: CN
Inventors: 饶志明; 王雅玲; 周俊平; 杨套伟; 徐美娟; 张显; 邵明龙
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2019-10-30
Filing date: 2019-10-30
Publication date: 2021-05-28
Anticipated expiration: 2039-10-30
Also published as: CN110607290A

Abstract

The invention discloses a phenylalanine dehydrogenase mutant with improved substrate specificity and application thereof, belonging to the technical field of enzyme engineering and microbial engineering. The phenylalanine dehydrogenase mutant of the invention has obviously improved substrate specificity to the phenylpyruvic acid compared with the wild type, and simultaneously has obviously reduced specificity to the L-norvaline, the L-leucine, the L-valine and the L-phenylglycine compared with the wild type, therefore, when the phenylalanine dehydrogenase mutant of the invention is used for detecting the phenylalanine content in samples such as blood and the like, the interference of other amino acids can be eliminated, the detection sensitivity is improved, and the phenylalanine dehydrogenase mutant has extremely high application prospect in the aspects of preparing phenylalanine detection kits and phenylketonuria detection kits.

Description

Phenylalanine dehydrogenase mutant with improved substrate specificity and application thereof

Technical Field

The invention relates to a phenylalanine dehydrogenase mutant with improved substrate specificity and application thereof, belonging to the technical field of enzyme engineering and microbial engineering.

Background

Phenylketonuria (PKU), which is an autosomal recessive genetic disorder, is one of the most common inherited metabolic diseases. The main reason for this is that the gene coding phenylalanine-4 α -hydroxylase (PAH) or coenzyme tetrahydrobiopterin BH4 in the patient is mutated to cause the lack or reduced activity of phenylalanine-4 α -hydroxylase, which leads to the catabolism of phenylalanine (Phe) in the patient, and thus, the accumulation of phenylalanine and its metabolites in the patient is large.

Depending on the blood phenylalanine concentration and the degree of enzyme deficiency, phenylketonuria can be classified as mild hyperphenylalaninemia, mild PKU, classical PKU, BH4 deficiency, and the like. Clinically, it is usually manifested as mental retardation, epilepsy, abnormal mental behavior, loss of skin pigment, and smell of mouse urine. In the case of neonates, the clinical symptoms of phenylketonuria are manifested primarily as mental retardation. Therefore, the phenylketonuria condition of the newborn is screened in time, early discovery and early treatment are achieved, and the method is very helpful for the newborn in China.

Currently, the method commonly used for screening phenylketonuria in neonates clinically is to measure the phenylalanine concentration in the blood of the neonates by bacterial inhibition assay (see specifically: Rohr FJ, Allred EN, Turner M, Simmons J, Levy HL,1996.Use of the Guthrie bacterial inhibition assay to monitor phenyl analogical assay for diagnosis of phenyl ketonuria. screening 4: 205-. However, this method is only a semi-quantitative test, and cannot accurately measure the content of phenylalanine in blood, and there is a large error in screening phenylketonuria.

Phenylalanine dehydrogenase (PheDH, EC 1.4.1.20) is a redox enzyme, can catalyze the reversible NAD-dependent oxidative deamination of aromatic amino acids to generate NADH and corresponding ketoacids, and has substrate specificity to a natural substrate, namely phenylalanine, so that the phenylalanine dehydrogenase can be used for detecting phenylketonuria. However, since phenylalanine dehydrogenase is active against amino acids other than phenylalanine, such as L-norvaline, L-leucine, L-valine, and L-phenylglycine, the detection of phenylalanine concentration in blood of a newborn using phenylalanine dehydrogenase is often interfered by other impurities in blood, and there is a large error in screening phenylketonuria.

Therefore, a method for screening phenylketonuria with higher accuracy is still needed to be found to solve the defects of the existing screening method.

Disclosure of Invention

[ problem ] to

The technical problem to be solved by the invention is to provide phenylalanine dehydrogenase (PheDH, EC 1.4.1.20) with high substrate specificity to phenylalanine.

[ solution ]

In order to solve the technical problems, the invention provides a phenylalanine dehydrogenase mutant, which is obtained by mutating the 310 th amino acid of phenylalanine dehydrogenase with the starting amino acid sequence shown as SEQ ID NO. 1.

In one embodiment of the present invention, the phenylalanine dehydrogenase mutant is obtained by mutating valine to serine at position 310 of a phenylalanine dehydrogenase mutant having the starting amino acid sequence shown in SEQ ID NO. 1.

In one embodiment of the invention, the amino acid sequence of the phenylalanine dehydrogenase mutant is shown as SEQ ID No. 2.

In one embodiment of the present invention, the phenylalanine dehydrogenase is described in "Okazaki N Hibino Y. cloning and nucleotide sequencing of phenylalanine dehydrogenase of Bacillus sphaericus Gene,1988,63(2): 337-341".

In one embodiment of the invention, the nucleotide sequence encoding the phenylalanine dehydrogenase is shown as SEQ ID No. 3.

The invention also provides a gene for coding the phenylalanine dehydrogenase mutant.

The invention also provides a recombinant plasmid carrying the gene.

In one embodiment of the present invention, the vector of the recombinant plasmid is a pET vector, a pGEX vector, a pPICZ vector, a pAN vector, or a pUB vector.

In one embodiment of the present invention, the vector of the recombinant plasmid is pET-28a (+) plasmid.

The invention also provides a host cell carrying the gene or the recombinant plasmid.

In one embodiment of the invention, the host cell is a bacterium or a fungus.

In one embodiment of the invention, the host cell is E.coli.

The invention also provides a preparation method of the phenylalanine dehydrogenase mutant, which comprises the steps of inoculating the host cell into a fermentation culture medium for fermentation to obtain fermentation liquor; centrifuging the fermentation liquor, and collecting thalli; crushing the thalli to obtain a cell crushing liquid; centrifuging the cell disruption solution to obtain cell disruption solution supernatant; and separating the supernatant of the cell disruption solution to obtain the phenylalanine dehydrogenase mutant.

The invention also provides the phenylalanine dehydrogenase mutant prepared by the method.

The invention also provides a kit, which contains the phenylalanine dehydrogenase mutant or the host cell.

In one embodiment of the present invention, the kit is a phenylalanine detection kit or a phenylketonuria detection kit.

The invention also provides the application of the phenylalanine dehydrogenase mutant or the gene or the recombinant plasmid or the host cell or the preparation method or the prepared phenylalanine dehydrogenase mutant or the kit in the aspect of detecting phenylalanine.

[ advantageous effects ]

(1) The specificity index of the wild phenylalanine dehydrogenase to the phenylpyruvic acid in the presence of the alpha-oxopentanoic acid is 19.5, while the specificity index of the phenylalanine dehydrogenase mutant of the invention to the phenylpyruvic acid in the presence of the alpha-oxopentanoic acid can reach 101.4, which is improved by 5.2 times compared with the wild phenylalanine dehydrogenase, thus the substrate specificity of the phenylalanine dehydrogenase mutant of the invention to the phenylpyruvic acid is obviously improved compared with the wild phenylalanine dehydrogenase.

(2) The alpha-oxopentanoic acid, 3-methyl-2-oxobutanoic acid, 4-methyl-2-oxopentanoic acid and phenylglyoxylic acid are reverse substrates of L-norvaline, L-leucine, L-valine and L-phenylglycine respectively, the activity and the substrate specificity of the enzyme on the reverse substrate can be represented by the activity and the substrate specificity of the enzyme on the reverse substrate, and on the basis, the specific enzyme activities of the wild-type phenylalanine dehydrogenase on the substrates of the alpha-oxopentanoic acid, 3-methyl-2-oxobutanoic acid, 4-methyl-2-oxopentanoic acid and the phenylglyoxylic acid are respectively 1.097 +/-0.064, 1.166 +/-0.205, 0.995 +/-0.062, 0.549 +/-0.049 U.mg^-1The phenylalanine dehydrogenase mutant of the present invention has a 3-methyl-2-oxobutadine substrateThe acid, 4-methyl-2-oxo valeric acid and phenylglyoxalic acid lose activity, and the specific enzyme activity of alpha-oxo valeric acid as substrate is reduced to 0.177 +/-0.029 U.mg^-1As can be seen, the substrate specificity of the phenylalanine dehydrogenase mutant of the invention to L-norvaline, L-leucine, L-valine and L-phenylglycine is obviously reduced compared with that of the wild type.

(3) The phenylalanine dehydrogenase mutant of the invention has obviously improved substrate specificity to the phenylpyruvic acid compared with the wild type, and simultaneously has obviously reduced specificity to the L-norvaline, the L-leucine, the L-valine and the L-phenylglycine compared with the wild type, therefore, when the phenylalanine dehydrogenase mutant of the invention is used for detecting the phenylalanine content in samples such as blood and the like, the interference of other amino acids can be eliminated, the detection sensitivity is improved, and the phenylalanine dehydrogenase mutant has extremely high application prospect in the aspects of preparing phenylalanine detection kits and phenylketonuria detection kits.

Detailed Description

The invention will be further illustrated with reference to specific examples.

Coli BL21(DE3) was purchased from North Nay organisms and the pET-28a (+) plasmid was purchased from Novagen. (the above-mentioned strain E.coli BL21(DE3) is commercially available and does not require preservation for patent procedures)

The media involved in the following examples are as follows:

LB liquid medium: yeast powder 5.0 g.L^-1Tryptone 10.0 g.L^-1、NaCl 10.0g·L^-1Kanamycin 100 mg. L^-1。

LB solid medium: yeast powder 5.0 g.L^-1Tryptone 10.0 g.L^-1、NaCl 10.0g·L^-115g/L agar powder and 50 mg/L kanamycin^-1。

The detection methods referred to in the following examples are as follows:

the method for measuring the enzyme activity of phenylalanine dehydrogenase comprises the following steps:

adding 2.5mmol/L NAD, 100mmol/L potassium chloride and 4mmol/L substrate into glycine-potassium hydroxide buffer solution with the concentration of 50mmol/L, pH being 10.4 to obtain a reaction system; adding 2 mul of enzyme solution into a 100 mul reaction system to start reaction, reacting for 3 minutes at 25 ℃, measuring the value of absorbance at 340nm every 30s and recording data, and calculating the concentration of NADH according to the increment of the absorbance value of the reaction solution at 340nm to obtain the enzyme activity of phenylalanine dehydrogenase;

wherein phenylalanine dehydrogenase activity (U/mL) ═ absorbance change value × total reaction system (μ L)/(enzyme volume (μ L) × molar absorbance value (6.22 × 10)^-3mol/(L·cm^-2) X colorimetric path).

The specific enzyme activity determination method of phenylalanine dehydrogenase comprises the following steps:

measuring the enzyme activity (U/mL) of the purified phenylalanine dehydrogenase, and measuring the protein content (mg/mL) of the purified phenylalanine dehydrogenase by using a Bradford method to calculate the specific enzyme activity of the phenylalanine dehydrogenase;

wherein, the calculation formula of the specific enzyme activity of the phenylalanine dehydrogenase is as follows:

phenylalanine dehydrogenase specific activity (U/mg) ═ enzyme activity (U/mL) of purified phenylalanine dehydrogenase/protein content (mg/mL) of purified phenylalanine dehydrogenase. (the Bradford method is described in the reference "Bradford, M.M.1976.A Rapid and reactive method for the standardization of microorganisms of protein designing the principal of protein-dyeing. animal. biochem.72: 248-254.")

Example 1: preparation and expression of different phenylalanine dehydrogenases

The method comprises the following specific steps:

chemically synthesizing a gene encoding phenylalanine dehydrogenase having an amino acid sequence shown in SEQ ID NO.1 (the nucleotide sequence of the gene is shown in SEQ ID NO. 3); connecting the obtained gene with pET-28a (+) plasmid after double enzyme digestion (EcoR I and BamH I), transforming Escherichia coli E.coli BL21(DE3) by the connecting product, coating the transformed product on LB solid culture medium, culturing for 8-10 h at 37 ℃, picking 5 transformants on the LB solid culture medium, inoculating LB liquid culture medium for culturing, culturing for 10h at 37 ℃, extracting plasmid, carrying out sequence determination on the plasmid, and sequencing correctly to obtain recombinant plasmid pET28a-PheDH and recombinant Escherichia coli pET28a-PheDH/E.coli BL 21.

Carrying out site-directed mutagenesis by using the obtained recombinant plasmid pET28a-PheDH as a template by using a whole plasmid PCR technology to obtain mutants L51S, T125P, Y151G and V310S;

wherein the mutant L51S is obtained by mutating leucine to serine at position 51 of wild-type phenylalanine dehydrogenase (SEQ ID No.1), and the primers are as follows:

L51S-For：ACCCTGGGTCCGGCTTCTGGTGGTACCCGTATG(SEQ ID No.4)；

L51S-Rev：GCCTTACTGGTTAGCAGAATG(SEQ ID No.5)；

mutant T125P was obtained by mutating the threonine to proline at position 125 of the wild-type phenylalanine dehydrogenase (SEQ ID No.1) using the following primers:

T125P-Fro：CGTTTCTACACCGGTCCTGACATGGGTACCACC(SEQ ID No.6)；

T125P-Rev：GCCTTACTGGTTAGCAGAATG(SEQ ID No.7)；

mutant Y151G was obtained by mutating tyrosine to glycine at position 151 of a wild-type phenylalanine dehydrogenase (SEQ ID No.1) using the following primers:

Y151G-Fro：GGTATCCCGGAACAGGGAGGTGGTTCTGGTGAC(SEQ ID No.8)；

Y151G-Rev：GCCTTACTGGTTAGCAGAATG(SEQ ID No.9)；

mutant V310S was obtained by mutating valine to serine at position 310 of wild-type phenylalanine dehydrogenase (SEQ ID No.1) using the following primers:

N145A-Fro：GGTGGTCTGATCCAGAGTGCTGACGAACTGTAC(SEQ ID No.10)；

N145A-Rev：GCCTTACTGGTTAGCAGAATG(SEQ ID No.11)，

the PCR reaction is carried out in a 50 mu L system, and the reaction condition is pre-denaturation at 94 ℃ for 4 min; then 30 cycles were entered: denaturation at 98 deg.C for 10s, annealing at 55 deg.C for 5s, and extension at 72 deg.C for 8 min; finally, extension is carried out for 10min at 72 ℃, and heat preservation is carried out at 4 ℃.

Detecting the PCR amplification product by using 1% agarose gel electrophoresis, after the detection is finished, adding 0.5 mu L of methylated template digestive enzyme (Dpn I) into 10 mu L of the amplification product, blowing and sucking the amplification product by a gun head, uniformly mixing, reacting for 1.5h at 37 ℃, converting the amplification product treated by the Dpn I into escherichia coli E.coli BL21(DE3), coating the conversion product on an LB solid culture medium, culturing for 8-10 h at 37 ℃, selecting 5 transformants on the LB solid culture medium, inoculating the transformants into an LB liquid culture medium, culturing for 10h at 37 ℃, extracting plasmids, carrying out sequence determination on the plasmids, and obtaining the recombinant escherichia coli containing the genes of the encoding mutants L51S, T125P, Y151G and V310S after the sequencing is correct.

Coating the obtained recombinant escherichia coli pET28a-PheDH/E.coli BL21 and the recombinant escherichia coli containing the genes encoding mutant L51S, T125P, Y151G and V310S on an LB solid culture medium, and culturing at 37 ℃ for 8-10 hours to obtain a single colony; selecting a single colony, inoculating the single colony into an LB liquid culture medium, and culturing at 37 ℃ for 12-14 h to obtain a seed solution; inoculating the seed solution into an LB liquid culture medium according to the inoculation amount of 1% (v/v), culturing at 37 ℃ for 2-3 h, adding IPTG (isopropyl thiogalactoside) with the final concentration of 0.5mM into the fermentation liquor, and continuously performing induction culture at 16 ℃ for 12 h to obtain the fermentation liquor; centrifuging the fermentation liquid at 4 deg.C and 8000rpm for 10min, collecting and crushing cells, and collecting cell crushing supernatant; the cell disruption supernatant was filtered through a 0.22 μm filter and purified by Ni-NTA column to obtain wild-type phenylalanine dehydrogenase, mutant L51S, mutant T125P, mutant Y151G and mutant V310S (amino acid sequence is shown in SEQ ID NO. 2).

Example 2: substrate specificity of different phenylalanine dehydrogenases for different substrates

The method comprises the following specific steps:

respectively taking phenylpyruvic acid, alpha-oxopentanoic acid, 3-methyl-2-oxobutanoic acid, 4-methyl-2-oxopentanoic acid and phenylglyoxylic acid (alpha-oxopentanoic acid, 3-methyl-2-oxobutanoic acid, 4-methyl-2-oxopentanoic acid and phenylglyoxylic acid are respectively reverse substrates of L-norvaline, L-leucine, L-valine and L-phenylglycine, the activity and the substrate specificity of an enzyme on the reverse substrate can be represented by the activity and the substrate specificity of the enzyme on the reverse substrate) as substrates, detecting wild-type phenylalanine dehydrogenase, mutant L51S, mutant T125P, mutant Y151G and mutant V310S, The specific enzyme activity of the phenylglyoxalic acid and the detection result are shown in Table 1.

As can be seen from Table 1, the specific enzyme activities of the wild-type phenylalanine dehydrogenase on the substrates phenylpyruvic acid, alpha-oxopentanoic acid, 3-methyl-2-oxobutanoic acid, 4-methyl-2-oxopentanoic acid and phenylglyoxylic acid were 21.339. + -. 0.034, 1.097. + -. 0.064, 1.166. + -. 0.205, 0.995. + -. 0.062 and 0.549. + -. 0.049U mg^-1(ii) a In all mutants, only the mutant V310S has better enzyme activity on phenylpyruvic acid than that of the wild type, and simultaneously, the specific enzyme activity on alpha-oxopentanoic acid, 3-methyl-2-oxobutanoic acid, 4-methyl-2-oxopentanoic acid and phenylglyoxylic acid is obviously reduced compared with that of the wild type, wherein the specific enzyme activity of the mutant V310S on a substrate phenylpyruvic acid can reach 17.944 +/-1.030 U.mg^-1The activity of the enzyme on substrates of 3-methyl-2-oxobutanoic acid, 4-methyl-2-oxovaleric acid and phenylglyoxylic acid is lost, and the specific enzyme activity on the substrate of alpha-oxovaleric acid is reduced to 0.177 +/-0.029 U.mg^-1And other mutant enzymes still have different enzyme activities on each substrate, so that the substrate specificity is influenced and the specificity is not high.

Calculating specificity indexes of the wild phenylalanine dehydrogenase and the mutant V310S for phenylalanine in the presence of alpha-oxopentanoic acid according to specific enzyme activity;

wherein, the specificity index is the specific enzyme activity of the enzyme to the phenylpyruvic acid/the specific enzyme activity of the enzyme to the alpha-oxopentanoic acid;

the detection results are as follows: the specificity index of the wild phenylalanine dehydrogenase to the phenylpyruvic acid in the presence of the alpha-oxopentanoic acid is 19.5, while the specificity index of the phenylalanine dehydrogenase mutant V310S of the invention to the phenylpyruvic acid in the presence of the alpha-oxopentanoic acid can reach 101.4, which is 5.2 times higher than that of the wild phenylalanine dehydrogenase, thus the substrate specificity of the phenylalanine dehydrogenase mutant of the invention to the phenylpyruvic acid is obviously improved compared with that of the wild phenylalanine dehydrogenase.

TABLE 1 specific enzyme Activity of different phenylalanine dehydrogenases on different substrates (unit: U. mg)^-1)

Group of	Wild type	L51S	T125P	Y151G	V310S
						Phenylpyruvic acid	21.339±0.034	10.896±0.781	2.700±0.819	10.683±0.944	17.944±1.030
Alpha-oxopentanoic acid	1.097±0.064	0.152±0.026	NT	0.745±0.109	0.177±0.029
						3-methyl-2-oxobutanoic acid	1.166±0.205	0.100±0.021	0.790±0.044	NT	NT
4-methyl-2-oxopentaneAcid(s)	0.995±0.062	NT	NT	0.958±0.128	NT
						Phenylglyoxylic acid	0.549±0.049	0.151±0.078	NT	NT	NT

Wherein NT represents no detectable activity.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

Sequence listing

<110> university of south of the Yangtze river

<120> phenylalanine dehydrogenase mutant with improved substrate specificity and application thereof

<160> 3

<170> PatentIn version 3.3

<210> 1

<211> 381

<212> PRT

<213> Bacillus sphaericus

<400> 1

Met Ala Lys Gln Leu Glu Lys Ser Ser Lys Ile Gly Asn Glu Asp Val

1 5 10 15

Phe Gln Lys Ile Ala Asn His Glu Gln Ile Val Phe Cys Asn Asp Pro

20 25 30

Val Ser Gly Leu Gln Ala Ile Ile Ala Ile His Asp Thr Thr Leu Gly

35 40 45

Pro Ala Leu Gly Gly Thr Arg Met Tyr Pro Tyr Lys Asn Val Asp Glu

50 55 60

Ala Leu Glu Asp Val Leu Arg Leu Ser Glu Gly Met Thr Tyr Lys Cys

65 70 75 80

Ala Ala Ala Asp Ile Asp Phe Gly Gly Gly Lys Ala Val Ile Ile Gly

85 90 95

Asp Pro Glu Lys Asp Lys Ser Pro Ala Leu Phe Arg Ala Phe Gly Gln

100 105 110

Phe Val Glu Ser Leu Asn Gly Arg Phe Tyr Thr Gly Thr Asp Met Gly

115 120 125

Thr Thr Met Asp Asp Phe Val His Ala Gln Lys Glu Thr Asn Phe Ile

130 135 140

Asn Gly Ile Pro Glu Gln Tyr Gly Gly Ser Gly Asp Ser Ser Ile Pro

145 150 155 160

Thr Ala Gln Gly Val Ile Tyr Ala Leu Lys Ala Thr Asn Gln Tyr Leu

165 170 175

Phe Gly Ser Asp Ser Leu Ser Gly Lys Thr Tyr Ala Ile Gln Gly Leu

180 185 190

Gly Lys Val Gly Tyr Lys Val Ala Glu Gln Leu Leu Lys Ala Gly Ala

195 200 205

Asp Leu Phe Val Thr Asp Ile His Glu Asn Val Leu Asn Ser Ile Lys

210 215 220

Gln Lys Ser Glu Glu Leu Gly Gly Ser Val Thr Ile Val Lys Ser Asp

225 230 235 240

Asp Ile Tyr Ser Val Gln Ala Asp Ile Phe Val Pro Cys Ala Met Gly

245 250 255

Gly Ile Ile Asn Asp Lys Thr Ile Pro Lys Leu Lys Val Lys Ala Val

260 265 270

Val Gly Ser Ala Asn Asn Gln Leu Lys Asp Leu Arg His Ala Asn Val

275 280 285

Leu Asn Glu Lys Gly Ile Leu Tyr Ala Pro Asp Tyr Ile Val Asn Ala

290 295 300

Gly Gly Leu Ile Gln Val Ala Asp Glu Leu Tyr Gly Pro Asn Lys Glu

305 310 315 320

Arg Val Leu Leu Lys Thr Lys Glu Ile Tyr Arg Ser Leu Leu Glu Ile

325 330 335

Phe Asn Gln Ala Ala Leu Asp Cys Ile Thr Thr Val Glu Ala Ala Asn

340 345 350

Arg Lys Cys Gln Lys Thr Ile Glu Gly Gln Gln Thr Arg Asn Ser Phe

355 360 365

Phe Ser Arg Gly Arg Arg Pro Lys Trp Asn Ile Lys Glu

370 375 380

<210> 2

<211> 381

<212> PRT

<213> Artificial sequence

<400> 2

Met Ala Lys Gln Leu Glu Lys Ser Ser Lys Ile Gly Asn Glu Asp Val

1 5 10 15

Phe Gln Lys Ile Ala Asn His Glu Gln Ile Val Phe Cys Asn Asp Pro

20 25 30

Val Ser Gly Leu Gln Ala Ile Ile Ala Ile His Asp Thr Thr Leu Gly

35 40 45

Pro Ala Leu Gly Gly Thr Arg Met Tyr Pro Tyr Lys Asn Val Asp Glu

50 55 60

Ala Leu Glu Asp Val Leu Arg Leu Ser Glu Gly Met Thr Tyr Lys Cys

65 70 75 80

Ala Ala Ala Asp Ile Asp Phe Gly Gly Gly Lys Ala Val Ile Ile Gly

85 90 95

Asp Pro Glu Lys Asp Lys Ser Pro Ala Leu Phe Arg Ala Phe Gly Gln

100 105 110

Phe Val Glu Ser Leu Asn Gly Arg Phe Tyr Thr Gly Thr Asp Met Gly

115 120 125

Thr Thr Met Asp Asp Phe Val His Ala Gln Lys Glu Thr Asn Phe Ile

130 135 140

Asn Gly Ile Pro Glu Gln Tyr Gly Gly Ser Gly Asp Ser Ser Ile Pro

145 150 155 160

Thr Ala Gln Gly Val Ile Tyr Ala Leu Lys Ala Thr Asn Gln Tyr Leu

165 170 175

Phe Gly Ser Asp Ser Leu Ser Gly Lys Thr Tyr Ala Ile Gln Gly Leu

180 185 190

Gly Lys Val Gly Tyr Lys Val Ala Glu Gln Leu Leu Lys Ala Gly Ala

195 200 205

Asp Leu Phe Val Thr Asp Ile His Glu Asn Val Leu Asn Ser Ile Lys

210 215 220

Gln Lys Ser Glu Glu Leu Gly Gly Ser Val Thr Ile Val Lys Ser Asp

225 230 235 240

Asp Ile Tyr Ser Val Gln Ala Asp Ile Phe Val Pro Cys Ala Met Gly

245 250 255

Gly Ile Ile Asn Asp Lys Thr Ile Pro Lys Leu Lys Val Lys Ala Val

260 265 270

Val Gly Ser Ala Asn Asn Gln Leu Lys Asp Leu Arg His Ala Asn Val

275 280 285

Leu Asn Glu Lys Gly Ile Leu Tyr Ala Pro Asp Tyr Ile Val Asn Ala

290 295 300

Gly Gly Leu Ile Gln Ser Ala Asp Glu Leu Tyr Gly Pro Asn Lys Glu

305 310 315 320

Arg Val Leu Leu Lys Thr Lys Glu Ile Tyr Arg Ser Leu Leu Glu Ile

325 330 335

Phe Asn Gln Ala Ala Leu Asp Cys Ile Thr Thr Val Glu Ala Ala Asn

340 345 350

Arg Lys Cys Gln Lys Thr Ile Glu Gly Gln Gln Thr Arg Asn Ser Phe

355 360 365

Phe Ser Arg Gly Arg Arg Pro Lys Trp Asn Ile Lys Glu

370 375 380

<210> 3

<211> 1146

<212> DNA

<213> Artificial sequence

<400> 3

atggctaaac agctggaaaa atcttctaaa atcggtaacg aagacgtttt ccagaaaatc 60

gctaaccacg aacagatcgt tttctgcaac gacccggttt ctggtctgca ggctatcatc 120

gctatccacg acaccaccct gggtccggct ctgggtggta cccgtatgta cccgtacaaa 180

aacgttgacg aagctctgga agacgttctg cgtctgtctg aaggtatgac ctacaaatgc 240

gctgctgctg acatcgactt cggtggtggt aaagctgtta tcatcggtga cccggaaaaa 300

gacaaatctc cggctctgtt ccgtgctttc ggtcagttcg ttgaatctct gaacggtcgt 360

ttctacaccg gtaccgacat gggtaccacc atggacgact tcgttcacgc tcagaaagaa 420

accaacttca tcaacggtat cccggaacag tacggtggtt ctggtgactc ttctatcccg 480

accgctcagg gtgttatcta cgctctgaaa gctaccaacc agtacctgtt cggttctgac 540

tctctgtctg gtaaaaccta cgctatccag ggtctgggta aagttggtta caaagttgct 600

gaacagctgc tgaaagctgg tgctgacctg ttcgttaccg acatccacga aaacgttctg 660

aactctatca aacagaaatc tgaagaactg ggtggttctg ttaccatcgt taaatctgac 720

gacatctact ctgttcaggc tgacatcttc gttccgtgcg ctatgggtgg tatcatcaac 780

gacaaaacca tcccgaaact gaaagttaaa gctgttgttg gttctgctaa caaccagctg 840

aaagacctgc gtcacgctaa cgttctgaac gaaaaaggta tcctgtacgc tccggactac 900

atcgttaacg ctggtggtct gatccaggtt gctgacgaac tgtacggtcc gaacaaagaa 960

cgtgttctgc tgaaaaccaa agaaatctac cgttctctgc tggaaatctt caaccaggct 1020

gctctggact gcatcaccac cgttgaagct gctaaccgta aatgccagaa aaccatcgaa 1080

ggtcagcaga cccgtaactc tttcttctct cgtggtcgtc gtccgaaatg gaacatcaaa 1140

gaataa 1146

Claims

1. A phenylalanine dehydrogenase mutant, which is obtained by mutating leucine to serine at position 51 of phenylalanine dehydrogenase whose starting amino acid sequence is shown in SEQ ID NO. 1.

2. A gene encoding the phenylalanine dehydrogenase mutant according to claim 1.

3. A recombinant plasmid carrying the gene of claim 2.

4. The recombinant plasmid of claim 3, wherein the vector of the recombinant plasmid is a pET vector, a pGEX vector, a pPICZ vector, a pAN vector, or a pUB vector.

5. A host cell carrying the gene of claim 2 or the recombinant plasmid of claim 3 or 4.

6. The host cell of claim 5, wherein the host cell is a bacterium or a fungus.

7. The method for producing a phenylalanine dehydrogenase mutant according to claim 1, wherein the host cell according to claim 5 or 6 is inoculated into a fermentation medium and fermented to obtain a fermentation broth; centrifuging the fermentation liquor, and collecting thalli; crushing the thalli to obtain a cell crushing liquid; centrifuging the cell disruption solution to obtain cell disruption solution supernatant; separating the supernatant of the cell disruption solution to obtain the phenylalanine dehydrogenase mutant according to claim 1.

8. A kit comprising the phenylalanine dehydrogenase mutant according to claim 1 or the host cell according to claim 5 or 6.

9. Use of the phenylalanine dehydrogenase mutant according to claim 1, or the gene according to claim 2, or the recombinant plasmid according to claim 3 or 4, or the host cell according to claim 5 or 6, or the method for producing the phenylalanine dehydrogenase mutant according to claim 7, or the kit according to claim 8 for detecting phenylalanine; this application is for non-therapeutic and non-diagnostic purposes.