JP3575633B2 - Nucleic acid synthesis method - Google Patents

Description

[0001]
[Industrial applications]
The present invention relates to a nucleic acid synthesis method, particularly to a nucleic acid synthesis method using a polymerase chain reaction (PCR) method.
[0002]
2. Description of the Related Art
Conventionally, viruses such as HBV, HCV which is a virus causing hepatitis or HIV which is a virus causing AIDS, bacteria which cause sepsis, or genetic tests such as genetic diseases, include viruses, bacteria or peripheral blood leukocytes present in blood. A method has been used in which DNA or cDNA synthesized from RNA by reverse transcriptase is amplified and detected by polymerase chain reaction (PCR).
However, even if a blood, serum or plasma sample is directly added to a PCR reaction solution, PCR is strongly suppressed by impurities contained in the sample, making it difficult to detect a target nucleic acid. Therefore, prior to nucleic acid synthesis, separation or purification of DNA or RNA from viruses, bacteria or cells in a sample is essential (Blin, Nand DW Stafford, Nucleic Acids Res., 3, 2303-2306, 1976). .
[0003]
Separating and purifying nucleic acids of viruses, bacteria, or cells from a sample is performed using various materials such as phenol-chloroform, ion exchange resin, glass beads, and a protein flocculant, and requires a certain period of time. However, genetic testing often requires a high speed, and since the PCR method is extremely sensitive, it is necessary to reduce the chance of contamination as much as possible. There is a need to develop a method for directly amplifying nucleic acids in a sample.
Therefore, an object of the present invention is to provide a method for amplifying a nucleic acid in a sample containing a large amount of blood by a PCR method without complicated pretreatment.
[0004]
[Means for Solving the Problems]
In view of the above situation, the present inventors have conducted intensive studies on the effect of serum on the PCR method. When the human serum was added to the PCR reaction solution at a concentration of 10% and the target DNA was added, PCR was performed. The PCR reaction solution became cloudy, and PCR was inhibited. From this, the present inventors consider that the clouding of the reaction solution is caused by protein aggregation, and that one of the causes of the inhibition of PCR is due to the aggregation of the protein during the reaction. In addition, it was discovered that by performing blood coagulation in advance before performing PCR on a serum sample, the PCR proceeded without being affected by serum. The present invention has been completed by further study based on such findings.
[0005]
That is, the gist of the present invention relates to a nucleic acid synthesis method for amplifying a base sequence of a target nucleic acid , which is present in a sample containing blood as a main component, wherein the blood component is previously coagulated.
[0006]
Hereinafter, the present invention will be described in detail.
The sample containing blood as a main component used in the present invention is not particularly limited as long as it is a sample containing viruses, bacteria, cells, etc., which cause amplification by PCR, such as hepatitis and AIDS.
[0007]
As a method of coagulating blood in the present invention, a method by heat treatment is typical. The method of heat treatment may be any of a method using a heat block, a method using a warm bath, a method using a microwave oven, and other heat treatment methods.
The temperature of the heat treatment in the present invention is usually 65 to 100 ° C, preferably 75 to 100 ° C. The time of the heat treatment varies depending on the temperature of the heat treatment, and is usually 1 second to 60 minutes, preferably 1 second to 10 minutes after the temperature of the sample reaches the processing temperature.
[0008]
The sample according to the present invention to be subjected to the heat treatment was diluted within 1 to 3 times with serum itself containing distilled viruses such as hepatitis and AIDS, bacteria, cells, etc., or distilled water, which was the purpose of amplification by the PCR method. A sample is used.
[0009]
The content of the soluble protein in the sample used in the present invention is usually 25 mg / ml or more, preferably 40 mg / ml or more.
[0010]
By treating a sample containing blood as a main component by the method of the present invention, PCR can be performed without any trouble as shown in the following Examples. If the heat treatment is insufficient and the coagulation of the protein is insufficient, cloudiness occurs during the PCR, and the synthesis of the nucleic acid hardly proceeds. Therefore, by using the method of the present invention, nucleic acid synthesis from a sample containing blood can be performed easily and quickly.
[0011]
PCR can be performed according to the method developed by Saiki et al. (Science 230, 1350-1354 (1985)). In this method, when detecting a specific nucleotide sequence region (in the case of the present invention, DNA present in a sample), one of both ends of the region recognizes a positive strand and the other recognizes a negative strand, respectively, to detect a high strand. An oligonucleotide to be hybridized is prepared, and it is used as a primer for a template-dependent nucleotide polymerization reaction on a sample nucleic acid which has been made into a single strand by thermal denaturation, and the generated double-stranded nucleic acid is separated again into a single strand. Then, a similar reaction is caused again. By repeating this series of operations, the copy number of the region sandwiched between the two primers increases until it can be detected.
[0012]
The method of the present invention seems to be applicable not only to PCR but also to reverse transcriptase reaction, ligase chain reaction, and the like.
[0013]
【Example】
Hereinafter, the present invention will be described in more detail with reference to Examples, but the present invention is not limited to these Examples and the like.
[0014]
Example 1
After adding 1 μl (100 ag / μl to 10 fg / μl) of HIV-1 DNA serially diluted to 10 μl of human serum and an appropriate amount of distilled water so as to obtain a 1 to 5-fold dilution, 50 μl of mineral oil was added, and 95 ° C. Heat treated for 5 minutes at was used as a sample. A PCR reaction solution was added to the heat-treated sample, and PCR was performed with a solution volume of 100 μl.
[0015]
The primers for PCR were CY. SK68 (SEQ ID NO: 1) and SK69 (SEQ ID NO: 2) located in the HIV-1 env gene region used by Ou (Science 239, 295-297 , 1988) were used. The base sequences of SK68 and SK69 are as follows, and there are 142 base pairs (including primers) in the region between the two types of primers.
SK68: AGCAGCAGGAAGCACTATGG
SK69: CCAGACTGTGAGTTGCAACAG
The PCR reaction solution was a reaction solution containing 1 μM of each primer and 200 μM of four kinds of deoxyribonucleoside triphosphates (dNTPs) (10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl ₂ , 0.1 mM 01% (w / v) gelatin and 0.025 U / μl thermostable DNA polymerase (AmpliTaq, manufactured by Perkin Elmer Cetus) were used.
The PCR was carried out for 40 cycles, with 1 cycle of heat denaturation at 94 ° C., 1 minute of annealing at 55 ° C., and 1 minute of DNA strand extension at 72 ° C., and finally, at 72 ° C. By performing a DNA chain extension reaction for 7 minutes, the DNA portion in the region between the two types of primers was amplified.
[0016]
After completion of the PCR, 10 μl of the reaction solution was subjected to electrophoresis in a TAE (40 mM Tris-acetic acid, 1 mM EDTA (pH 8.0)) solution containing 3% agarose to stain the DNA with ethidium bromide. Detection was performed.
The result is shown in FIG. The figure shows the results of detection of DNA by electrophoresis. The arrow indicates the migration position of the specific PCR product, and M indicates the marker (125 ng φX174 DNA cut with HincII).
[0017]
Heat treatment of the sample not diluted with distilled water and the sample diluted 2-fold showed coagulation of serum protein, but heat treatment of the sample diluted 3-fold or 5-fold resulted in incomplete coagulation of serum protein. After the heat treatment, PCR was performed. When no dilution or 2-fold dilution of the sample was observed in which the serum protein was coagulated by the heat treatment, no turbidity of the reaction solution was observed during PCR, and 10 copies of the sample were contained in the sample. If HIV-1 DNA was present, a PCR product specific for the HIV-1 env gene was detected. On the other hand, in the case of using a 3-fold or 5-fold diluted sample in which coagulation of serum proteins is incomplete due to heat treatment, clouding of the reaction solution is observed during PCR, and 1000 copies of HIV-1 DNA are contained in the sample. , No specific PCR product was observed.
[0018]
Example 2
2 μl of λ phage (0.05 to 5000 PFU (plaque forming unit) / μl) serially diluted with 10 μl of human serum was added, 50 μl of mineral oil was added, and heat treatment at 95 ° C. for 5 minutes was used as a sample. Was. A PCR reaction solution was added to the heat-treated sample, and PCR was performed with a solution volume of 100 μl.
[0019]
P1 (SEQ ID NO: 3) and P2 (SEQ ID NO: 4) located in the λ phage gene region were used as PCR primers. The base sequences of P1 and P2 are as follows, and a 500 bp base sequence (including primers) exists in the region between the two types of primers.
P1: GATGAGTTCGTGTCCGTACAACTGG
P2: GGTTATCGAAATCAGCCACAGCGCC
The composition of the PCR reaction solution, PCR and electrophoresis were performed in the same manner as in Example 1. FIG. 2 shows the results. FIG. 2 shows the results of DNA detection by electrophoresis, and the arrows and markers are the same as in FIG.
[0020]
When serum was used for PCR without heat treatment in advance, even if 10,000 PFU of λ phage was present, no PCR product specific to the λ phage gene was observed, but when heat treatment was performed in advance to coagulate serum proteins, Specific PCR product was observed when 1 PFU of λ phage was present.
[0021]
Example 3
4 μl of heat-labile entropotoxin (LT) -producing Escherichia coli (0.25 to 2500 cfu / μl) serially diluted with 4 μl of human serum was added, and 25 μl of mineral oil was further added, followed by heat treatment at 95 ° C. for 5 minutes. Used as a sample. A PCR reaction solution was added to the heat-treated sample to make the solution volume 40 μl, and PCR was performed.
[0022]
As primers for PCR, ELT1 and ELT2 (manufactured by Shimadzu Corporation) located in the LT gene region were used. The region between the two types of primers has a 264 bp base sequence (including the primers).
The composition of the PCR reaction solution, PCR and electrophoresis were performed in the same manner as in Example 1. The results are shown in FIG. The figure shows the results of DNA detection by electrophoresis. The arrows and markers are the same as in FIG.
[0023]
When serum was used for PCR without heat treatment in advance, even if 10,000 E. coli cells were present per sample, no PCR product specific to the LT gene was observed in the reaction termination solution. When serum protein was coagulated, a specific PCR product was recognized if E. coli was present in one cell per sample.
[0024]
【The invention's effect】
According to the present invention, it is possible to directly amplify a target DNA from a sample containing blood as a main component without passing through a process of separating and purifying nucleic acids.
Therefore, according to the present invention, it is possible to provide a method for synthesizing a nucleic acid that is simple, rapid, and has little risk of contamination.
[0025]
[Sequence list]
SEQ ID NO: 1
Sequence length: 20
Sequence type: Number of nucleic acid strands: Single-stranded topology: Type of linear sequence: Genomic DNA
Hypothetical sequence: NO
Antisense: NO
Origin: Features of HIV env gene sequence Characterized method: S
Sequence AGCAGCAGGA AGCACTATGG 20
[0026]
SEQ ID NO: 2
Sequence length: 21
Sequence type: Number of nucleic acid strands: Single-stranded topology: Type of linear sequence: Genomic DNA
Hypothetical sequence: NO
Antisense: NO
Origin: Features of HIV env gene sequence Characterized method: S
Sequence CCAGACTGTG AGTTGCAACA G 21
[0027]
SEQ ID NO: 3
Sequence length: 25
Sequence type: Number of nucleic acid strands: Single-stranded topology: Type of linear sequence: Genomic DNA
Hypothetical sequence: NO
Antisense: NO
Origin: Characteristic of λ phage gene sequence Characterized method: S
Sequence GATGAGTTCG TGTCCGTACA ACTGG 25
[0028]
SEQ ID NO: 4
Sequence length: 25
Sequence type: Number of nucleic acid strands: Single-stranded topology: Type of linear sequence: Genomic DNA
Hypothetical sequence: NO
Antisense: NO
Origin: Characteristic of λ phage gene sequence Characterized method: S
Sequence GGTTATCGAA ATCAGCCACA GCGCC 25
[Brief description of the drawings]
BRIEF DESCRIPTION OF DRAWINGS FIG. 1 is an electrophoretogram when PCR is performed after heat-treating a sample prepared by diluting human serum to which HIV-1 DNA has been added with distilled water.
FIG. 2 is an electrophoretogram when human serum to which λ phage has been added is subjected to PCR after heat treatment.
FIG. 3 is an electrophoretogram when PCR is performed after heat treatment of human serum to which heat-labile enterotoxin (LT) -producing Escherichia coli has been added.
[Explanation of symbols]
M Marker A Group without dilution of human serum Group B Group with 2-fold dilution of human serum Group D with 3-fold dilution of human serum Group E with 5-fold dilution of human serum Group F with no serum added and no heat treatment (control) Group G with added and heat treated Group H with no serum added and no heat treatment (control) Group I with serum added and no heat treatment (control) Group J with serum added and heat treated Group K with no serum added and no heat treatment (control) Group 1 with serum added and no heat treatment (control) 1 Copy of HIV-1 DNA added was 1000 copies 2 Copy of HIV-1 DNA added was 100 copies 3 Copy of HIV-1 DNA added was 10 copies 4 HIV-1 No DNA added 5 Lambda phage added was 10 PFU
6 The added λ phage is 1 PFU
7 When the added λ phage is 0.1 PFU
8 No λ phage added 9 λ phage added was 10,000 PFU
10 100 CFU of added E. coli
11 Escherichia coli added is 10 CFU
12 1 E. coli added CFU
13 0.1 CFU of added E. coli
14 No E. coli added 15 E. coli added was 10,000 CFU

Claims (1)

A nucleic acid synthesis method for amplifying a base sequence of a target nucleic acid present in a sample containing blood as a main component, wherein a blood component is coagulated in advance.

Images