JPH09500539A - Linked linear amplification of nucleic acids - Google Patents

Abstract

  (57) [Summary] Extension synthesis ("amplification") of a nucleic acid sequence of interest is accomplished by a series of linked multi-cycle primer extension reactions (LLA). The primer used in each of the primer extension reactions of the method comprises a non-replicable element that halts nucleic acid synthesis, thereby preventing the synthesized molecule from serving as a template in subsequent cycles. The synthesized molecules accumulate mathematically linearly during the primer extension reaction, thereby rendering the method relatively insensitive to nucleic acid contamination. A combination of multiple primers is used to ensure the accumulation of multiple copies of the nucleic acid sequence of interest. The present invention also provides a reagent kit for detecting the amplified nucleic acid sequence of interest and performing the above reaction.

Description

Detailed Description of the Invention                       Linked linear amplification of nucleic acids 1. Technical field   The present invention relates to the replication of nucleic acids in vitro. More specifically, the present invention is directed to The method of replicating the nucleic acid sequence of By doing so, the target nucleic acid sequence is reproduced in large quantities and the target sequence is stored in a mathematically linear manner. Regarding how to stack. 2. Brief description of background art   Elongated replication of nucleic acids, now known as nucleic acid propagation (herein described) However, it finds wide utility in various ways both in terms of application and theory. Have been. H. G. FIG. Khorana and his collaborators first tried DN in vitro. Double chain created by enzymatic ligation of synthetic DNA using the A amplification method To increase the availability of (major yeast alanine t-RNA partial gene sequence) Proposed. K. Kleppe et al .; Mol. Biol.56: 341-361 See (1971). Then, in vitro amplification is performed by amplification of chromosomal DNA (S akai et al., Science 230: 1350-1354 (1985)). Applied as a technique known as the polymerase chain reaction, or "PCR" Was. Synthetic oligonucleotide primers, thermostable DNA polymerase and Due to the wide availability of automated temperature cycling equipment, PCR is a great tool for molecular biologists. It has become a tool with wide utility.   The PCR method is referred to in the literature as the "exponential growth" method. One of primer extension Primer binding to other primers in a circle, or "cycle" The site is synthesized. Thus, each synthetic DN produced in either of the previous cycles The A molecule is used to serve as a template for primer-dependent replication. State of this method , Combined with the presence of a sufficient amount of primer molecule, Accumulate exponentially.   PCR proved to be a valuable technology for molecular biologists Widely used in the fields of gene research, diagnostics, forensic science, and even in the detection of antibodies. However, the disadvantage was never recognized. PCR method is mainly for amplification Accurate quantification can be difficult as the product grows exponentially around is there. PCR products, double-stranded DNA molecules, can be analyzed and sequenced That itself is difficult. Strand separation typically refers to sequencing or other Flow steps, such as a hive for a probe that can detect a sequence of interest. It must be done before redislation.   The PCR method also involves transferring previously amplified DNA sequences to new reactions. It has also proved to be quite sensitive to the resulting pollution. This problem , (1) large amounts of DNA are produced in any given reaction; and ( 2) This method uses all DNA strand products as templates in subsequent cycles. Use It seems to be caused by the fact. Even small amounts of contaminating DNA grow exponentially Lead to wrong results. Kwok and Higuchi, Nature339: 237-238 (1989). Because these pollution problems are widely recognized, , Various methods of reducing such pollution have been published in the literature (eg, chemical decontamination, physical Treatment, enzyme treatment and use of closed systems). "Gen etic Recognition ", November 20, 1992 California John B. presented in San Diego, CA. Findlay, "Development ment of PCR for in vitro Diagnostics "reference.   It provides a large amount of DNA and selectively amplifies only a specific sequence of interest, but "PCR There is a need for new nucleic acid (DNA) amplification methods that avoid the problems associated with reactions. You. In particular, finally, a large amount of the target nucleic acid molecule or a molecule containing a large amount of the target nucleic acid sequence. Although there remains a need for nucleic acid amplification methods to produce the Sensitive. There remains a need for nucleic acid amplification methods that produce single-stranded products .                             Summary of invention   The above and other needs include, in one aspect, the ability to sample a particular nucleic acid sequence of interest. And a method of amplifying within a complementary nucleic acid strand contained in . The method of the present invention comprises the following steps: (A) the strand and a primer containing a non-replicatable element Contact under conditions such that the product is synthesized by using the above strand as a template And the synthesized first generation primer extension product is separated from the strand. The second primer of the primer for complementation of the strand Selected to serve as a template for the synthesis of progenitor extension products; (B) separating the first generation primer extension products from their template to remove single-stranded molecules Generate; and (C) The first generation primer extension product is the first generation primer extension product The above steps (under the conditions that are synthesized using the generation primer extension product as a template) Treat with the primer of a).   Here, the second generation primer extension product is at least the nucleic acid sequence of interest. Extension products of the above primers, including some but extended to produce their templates Cannot serve as a template for the synthesis of   In another aspect of the invention, the product of step (c) is separated to produce a single chain molecule. And repeat all steps at least once. Step (c) is preferably repeated many times The method is automatically performed under the control of a programmable temperature cycler. I will   After accumulation of the second generation primer extension products, each of the products was It is impossible to make that first generation mold by using it as a mold for A new set of primers containing replicable elements can be used. A new set of above Primers are advantageous for binding to second generation synthetic products and amplifying target sequences . This linear replication method is done in many cycles. Multicycle primer The extension reaction thus "links together" so that the original Amplify the target nucleic acid sequence 1,000-fold or 1,000,000-fold. Thus, the method is "linked. Linear amplification ” That is, it is regarded as "LLA".   In another aspect of the invention, a plurality (nested) comprising non-replicable elements. The set of primers can be provided as a single amplification reaction mixture. These groups are up to It is selected so that it can bind to each template under harsh conditions of decreasing. like this In addition, all components needed to perform some combined linear amplification were combined into a single reaction mixture. Can be provided.   In yet another aspect of the invention, the allele-specific nucleic acid replication is of the origin. It is known to be an indicator of genetic diseases or disorders such as sickle cell disease, according to the Performed using primers attached to specific polymorphic sites on the template. Non-replicating Allele-specific primers containing elements are template-only nuclei containing the desired allele. Designed to initiate acid synthesis.   Synthetic nucleic acid molecules according to the present method can be used to As a reagent for techniques such as cloning, it can be used for forensic identification and the like.   The methods described herein can also be performed using single-stranded nucleic acid as the starting material. You. Such a method consists of the following steps (A) the strand and a primer containing a non-replicatable element Contact under conditions such that the product is synthesized by using the above strand as a template Let; (B) separating the first generation primer extension products from their template to remove single-stranded molecules Generate; and (C) First generation primer extension product and second primer containing non-replicable element The second generation primer extension product as a template for the first generation primer extension product. To be contacted under the conditions to be synthesized.   Here, in the above-mentioned primer, the second-generation primer extension product is the first primer It is chosen not to serve as a template for extension. Multiple steps (a)-(c) Synthesize the extended nucleic acid several times and use a new set of primers to run the reaction. Link to the next reactant.   The invention also relates to reagent kits used to amplify specific nucleic acid sequences. . Such kits include, for example, a DNA polymerase and non-replicating primers A pair of primers for each sequence to be amplified consisting of Control nucleic acid, which can be replicated by the primers and DNA polymerase described above. Contains an array. The kit also detects the presence or absence of amplification products of a particular sequence. Nucleic acid probes that can be shown may also be included.                 Brief description of the drawings   1 to 4 are diagrams showing the overall nucleic acid amplification method of the present invention.   FIG. 5-6 illustrates a nucleic acid amplification method linked to the method illustrated by FIGS. It is a figure generally shown.   FIG. 7 illustrates a nucleic acid amplification method performed by two primers according to the present invention. FIG.   Figures 8-10 are linked by four primers according to the present invention It is a figure which shows a nucleic acid amplification method in detail overall.   FIG. 11 is a diagram showing the entire PCR method and the nucleic acid molecule produced according to the present invention. It is.   FIG. 12 shows the human β-globulin gene (GenBank locus HUMH). BB) and the sequences of some of the primers described herein FIG.                   Detailed description of preferred embodiments   The nucleic acid replication method of the present invention can produce a large amount of a specific nucleic acid sequence of interest. Its preferred state Is a method that links a series of multicycle primer extension reactions. Consists of In each of the multicycle primer extension reactions, the primer Dependent nucleic acid replication is performed by multiple cycles, but the primer extension reaction Objects accumulate numerically linearly from cycle to cycle. Sequence to be amplified A unique primer for each nucleic acid strand in the starting sample containing A set of mars is provided. From primer extension product cycle to cycle Linear accumulation is confirmed using primers containing non-replicable elements. The element is Stops the primer extension reaction and nucleic acid polymerase replicates the entire primer sequence To prevent Suitable primers and primers containing such non-replicable elements Primer that accumulates in maximum amount by selecting Limer annealing conditions The extension reaction product (referred to as the "second generation primer extension product") is Template themselves using the same primers in the cycle of the immer extension reaction It is confirmed that it is not useful as. Thus, the primer from each cycle Unlike nucleic acid amplification methods that utilize extension products as templates for subsequent cycles. Thus, "exponential amplification" does not occur from cycle to cycle.   The method of the present invention comprises oligonucleotide hybridization and primer -Uses many important properties of the extension reaction to bring benefits. The present invention has the following advantages 11A DNA polymerase having By repeating the process, the template DNA can be copied many times. • Primer-dependent extension means that the primer is not completely complementary to the template. If not, it can occur under suitable conditions. -The primer extension reaction uses the template generated in the previous round of primer extension reaction. Can be used. ・ The primer extension reaction has non-basic sites or non-nucleotide residues in the template nucleic acid. When present, it is inhibited by the residue. -The length and composition of the primer are determined by the known method. Affects the conditions that would "activate" the enzyme-induced elongation. -The primer extension reaction can be accomplished in a rapid cycle by a thermal cycler.   The method of the present invention advantageously utilizes a series of linear amplification reactions, which are continuous. Or a very large number of target nuclei that are performed (linked) in parallel (ie, simultaneously) Generates a copy of the acid sequence. Does the nucleic acid sequence of interest essentially span the entire length of the template strand? , Or may consist of only a very small part of it. Including the above target sequence The template strand, which is present in the sample, is present in a substantially homogeneous sample, or is a portion (polar May even exist as a small portion).   According to the present invention, a primer containing a non-replicable element contains a sequence to be amplified. Provided for each chain containing. For double-stranded template, the primer is before template denaturation Alternatively, it may be added later. Primers annealed to each starting template The first generation under conditions suitable for the function of the enzyme in the presence of the polymerase enzyme. Form a primer extension product. This method denatures the resulting double-stranded nucleic acid , Annealing the above primer to the strand, and conducting the primer extension reaction again Is achieved. From the primer extension by the first generation primer extension product A second generation primer extension product was obtained, which is due to the presence of non-replicable elements. Serve as template for these same primers in subsequent cycles I can't.   Figures 1-5 show a series of plaques performed on a DNA template according to the method of the invention. A general representation of the immer extension reaction (ie, one linear amplification reaction). . The above method is a double-helix DNA molecule having a definite end in step (a). La Have been.   The starting duplex is modified by heating, preferably in a buffer containing the same. And the resulting single strand was contacted with a pair of primers (step (b)). Each plastic The imer is preferably provided in a substantial molar excess of the starting template strand and is not Contains replicable elements. This is referred to herein as (x) within the primer sequence. Or (o). Under appropriate conditions, the above primers should be annealed to their respective templates. Presence of DNA polymerase and the above four deoxyribonucleases It is extended below by a primer extension reaction (step (c)). Synthesized DNA Is indicated by a dotted line (...) In FIGS. The DNA synthesized by using it is referred to as "first generation" DNA. Profit The template provided is again denatured and the primers are annealed (step (d)).   As shown in step (e) of Figure 2, using first generation DNA as a template, Upon extension of the lymer, second-generation DNA is produced and incorporated into the first-generation synthetic DNA. It does not pass past non-replicable elements. In this way, the reference number The DNA molecules of Nos. 10 and 20 are synthesized. As shown in the above figure, molecule 1 0 incorporated an effective site for the primer containing the non-replicable element (x) No, molecule 20 is effective for primers containing non-replicable elements (o) These second generation molecules are not incorporated into the primer extension reaction because they do not incorporate a site. No further involvement. 2nd generation as in steps (f) and (g) The offspring accumulate mathematically linearly in subsequent rounds of primer extension.   After the desired number of cycles, starting with the synthetic DNA, the second primer set It was used in a second series of primer extension reactions using a combination (ie I was forced to). Molecules 10 and 20 as shown in FIGS. (A) and (b) so that the reaction product can be used as a template for further DNA synthesis. The primer containing the non-replicable element indicated by) was selected. This series of primers -Synthetic DNA molecules were accumulated when the extension reaction was similarly performed. The molecule is shown in FIG. ) And are utilized in these reactions. It cannot serve as a template for a primer. After the desired number of cycles, Reuse these synthetic molecules again with appropriate primers containing non-replicable elements. You can link to more duplicates.   A series of cycles of synthetic nucleic acid Only when supplied with a combination of mers, they themselves template for further amplification. Can serve as Thus, the first generation linear amplification reaches within 100 cycles. Once formed, the 100 copies produced from this reaction are hybridized to the synthetic template. Linked linear amplification using a new primer combination that can It can be used as a template in the (LLA) reaction. A hundred more cycles The linear amplification of 1 gave a cumulative amplification of 10,000 (100.100). Third combination Repeat the above steps with 1 x 10⁶Accumulation gain of Was. Further amplification using additional primers and additional cycles of primer extension Was achieved.   FIG. 7 more particularly illustrates the use of two primers in the amplification method of the invention. Diagrammatically. As is clear from FIG. 7 above, the two primers follow Used for one round of primer extension. Each primer is complementary to the target sequence, It contains a single non-replicable element (x) instead of one of the complementary nucleotides.   Consider four reactions. In reaction 1, primer P1 is above the template Generate a copy of the strand (first generation nucleic acid; Product I). Professional during each cycle One copy of duct I is produced and m cycles yields m copies. In reaction 2 The primer P2 is a copy of the lower strand of the template (first generation nucleic acid; product II). ). During each cycle, one copy of Product II is created and Klu produces n copies. In fact, n and m are typically the same.   In Reaction 3, the primer P1 was the product II from Reaction 2 (referred to as template II). Is produced) (the second generation nucleic acid; product III), but template II It will not be replicated beyond the non-replicable elements contained therein. Like this, professional Duct III is not a template for either primer P1 or P2.   Similarly, in reaction 4, primer P2 is a copy of template I (second generation nucleic acid; Product IV) but template I is replicated beyond the non-replicable element. Absent. In this way, product IV can be used as a template for either primer P1 or P2. Nor.   Table 1 shows the accumulation of each product as a function of cycle number. I'll be shown there Sea urchin, formula (n²+ N) / 2 can be used to calculate the yield of the reaction.   A first that contains a non-replicable element and is complementary to either Product III or IV. If 3 primers are included in the above reaction, either product III or IV Shorter new products will accumulate. This product is It will be produced in greater quantity than any of the DNA strands of and will remain almost single stranded.   The reaction of the present invention and the "linking" linear amplification reaction together work with excess DNA synthesis. As shown in FIGS. 8-10. 4 primers were used in this reaction The two primer reactions that are performed simultaneously are linked. In this reaction, Markers P1 and P3 are complementary to the upper strand of the target nucleic acid, and primers P2 and P4 is complementary to the lower strand of the target nucleic acid. The complementary site for primer P3 is 5'to the P1 complementation site (relative to the template). Similarly for primer P4 The complementary site is 5'to the P2 complementary site (relative to the template). The target nucleic acid sequence is It will be located within the area delineated by both primer pairs.   It is possible to consider 6 reactions, each with a different template, Is done. Reactions 1A, 1B, 2A, and 2B, respectively, were applied to each strand of the starting nucleic acid template. Linear accumulation of complementary first-generation synthetic nucleic acids (Products IA, IB, IIA and II B) occurs. Second generation synthetic nucleic acid by reactions 3A, 3B, 4A and 4B, respectively Resulting in a linear accumulation of non-synthesized by reactions 1A, 1B, 2A and 2B. Due to the presence of the replicable element, it serves as a template for the primers P1 or P2. Is useless. However, as shown in reactions 5 and 6, primers P3 and P 4 due to the position of their complementary sites, respectively, the original template DNA and template It can function to initiate DNA synthesis in both IVA and IIIA. Proda C. IIIB and IVB are not templates for any of the primers in this reaction, but Contains nucleic acid sequences.   Obviously, variations on the reactions described herein are possible. Was For example, rather than being done simultaneously as described in connection with FIGS. 8-10. The linear amplification reactions are serially linked. Primers P3 and P4 are mixed Compound, then n cycles of p where n is, for example, 2 to 100. Immerse extension.   As another change, the primers P1 and P2 are added to the template DNA. Conditions under which the primers P3 and P4 are not allowed to initiate DNA synthesis by annealing ( E.g. temperature) is selected to be possible. Primer P 1, P2, P3 and P4 would be provided in the first reaction mixture. First line Shape amplification is more stringent than that involving only primers P1 and P2 in the primer extension reaction. It is performed under favorable conditions. After the desired number of cycles, relieve the harsh reaction conditions. No, all four primers are involved in nucleic acid synthesis. Primers P1 and P 2 continued to generate the first generation primer extension products using the starting template, Using the second generation primer extension product as a template, Continue to generate; primers P3 and P4 are second generation of primers P1 and P2 The primer extension product is used as a template. The nucleic acid sequence of interest is again convenient Located within the region of the template strand bound by both primer pairs.   A non-replicable element that is complementary to either product IIIB or IVB. If 5 primers were included in the reaction, either product IIIB or IVB Shorter new products will accumulate. This product is It will be larger than the offset DNA strand and will remain almost single stranded. Molecular biology Those skilled in the art will appreciate that odd numbered primers may be utilized in practicing the present invention to obtain single-stranded D You will realize that NA will accumulate.   The use of primers containing non-replicable elements allows the use of starting materials (herein "primary"). Primer extension product as referred to as "1st generation primer extension product" Except for the primer extension reaction products synthesized on the original template nucleic acid strand present in , The synthetic nucleic acids generated during this method are not used in successive rounds of primer extension reaction. It is confirmed that it does not serve as a casting mold. Cycle-to-cycle mathematical Accumulation of synthetic nucleic acid by extrapolation was performed as in the context of the PCR reaction (Kle ppe et al. and Saiki et al., supra) are avoided.   Scientists in the fields of molecular biology and DNA chemistry contain non-replicable elements A primer could be synthesized. For example, 1,3 to stop DNA synthesis -Primers containing residues of propanediol are described by Seela et al., Nucleic Acids Res.15, 3113-3129 (1987). Falcom Place, Stirling, Virginia, USA, synthesized by 44901 Commercially available from Glen Research I have. 1,4-Anhydrodeo, a model for abasic sites Primers containing residues of xy-D-ribitol are described in Eritja et al., Nucleo. sides & Nuclketides6, 803-814 (1987) It can be synthesized by illuminating. Published European patent application 416,817 A2 (Imperial Chemical Industries PLC; (March 13, 1991) is the non-compound between the primer sequence and the polynucleotide tail. Manufacturable elements include one or more 2'deoxyribofuranosylnaphthalene moieties. The synthesis of the primer is described. Stop polymerase-dependent copy of the above template Other factors, such as ribonucleosides and deoxyribonucleosides Synthesis of oligonucleotide primers containing derivatives should be carried out by those with experience in this field. Would be obvious. The non-replicable element is preferably the end residue of any primer. It is not located in the base.   For example, a typical amplification reaction replicates and integrates into a much longer sequence. It will be done starting from a double-stranded DNA molecule containing the power sequence. Specific orientation for each chain Gonucleotide primers include each primer containing a non-replicable element as described herein. It is annealed to each of its chains by the immers. The above primers are amplified The primer is selected to bind to each of the strands at a position that binds the sequence to be You.   The first cycle of primer extension consists of DNA polymerase and the four deoxynucleotides described above. Ribonucleotides and under conditions suitable for the selected enzyme. The obtained first-generation synthetic DNA has an oligonucleotide primer at its 3'end. Integrated and then downstream (5 ') with all binding sites for other primers. Have.   First-generation synthetic DNA is incorporated into another primer, namely its 3'end. A second cycle of primer extension that serves as a template for the Will be Although DNA synthesis proceeds along the template, non-replicative molecules embedded in the template It stops when the competent element encounters the polymerase molecule. The synthetic DNA obtained is here Is referred to as "second generation synthetic DNA", and the 5 ' It is limited to the ends and encounters a part of the sequence of the other primer, that is, a non-replicable element. Before the treatment, it was restricted to the 3'end by the part copied by DNA polymerase. It has a well-defined end.   Second generation synthetic DNA does not serve as a template for further DNA synthesis There will be. As mentioned above, the second generation synthetic DNA is a part of the necessary primer binding site. Including only. Primer under selected primer annealing and extension conditions -The part of the binding site binds the primer and binds to the primer-dependent DNA synthesis. Not enough to serve as a site. Therefore, the third and When subsequent cycles are performed, the original template DNA and first generation synthetic DNA Only serves as a mold. Proceeding with a copy of these templates will contain the sequence of interest. This results in round-to-round "linear" accumulation of second generation synthetic DNA.   After the desired number of primer extension cycles, provide a second primer for each strand. Further replication can be achieved by providing. The second primer is the original primer. Binds to a region of the original template strand within the region bound by the Limeric combination To be selected. The second primer will also include a non-replicable element. this child And their primer extension products use these same primers. Confirms that it cannot serve as a template for round nucleic acid synthesis .   Whether the specific primer binds to the specific template depends on the primer binding conditions, especially the temperature. It is known that it can be decided whether or not. Rychlik et al., Nucleic A cids Res.18, 6409-612 (1990); Wu et al. , DN A Cell Biol.10, 233-238 (1991). Various bases Primer binding temperatures in reaction mixtures containing primers of composition and / or length The degree of selection can also function to select which primer can initiate DNA synthesis. Can be. For example, first in a single amplification reaction mixture, 72 ° C, 62 ° C and 62 ° C, respectively. The first, second and third combinations of primers that will start at By performing the first series of primer extension reactions at 72 ° C. And the function that only the first primer combination brings about primer-dependent nucleic acid synthesis. Would certainly indicate that After the desired number of cycles, the primer extension temperature Can be lowered to 62 ° C., which allows the combination of the first and second primer to be D Will initiate NA synthesis. Lower the primer extension reaction temperature to 52 ° C And all three brimer combinations were involved in primer-dependent nucleic acid synthesis. Let The use of a mixture of primers in this method allows the developer to separately This method can be performed efficiently without adding any combination of immers as the process progresses. Can be applied.   By using the programmable temperature cycling device obtained, All three primer combinations are provided in a single amplified anti-mix. Up The primer described above is a primer that initiates DNA synthesis under other conditions It will be selected to bind to the immer template 3 '. Similarly, the toughest These primers, which start under certain conditions, bind to the template 5'of the other primer . The first series of primer extension reactions (cycles) is the most stringent (highest temperature) Performed under Mer-annealing conditions, with the first primer combination Is involved in the synthesis of DNA containing the desired sequence. Preselected number of primer extensions After cycling, primer annealing conditions are reduced in stringency. Second plastic The combination of immers is the first set of primer extension services under the conditions selected above. By initiating a linear copy of the second-generation synthetic DNA generated during the icicle Would initiate further DNA amplification. The above condition is the third primer combination When the bruises are further adjusted to be involved in primer-dependent nucleic acid synthesis, first and second Generation DN generated in both the first and second series of primer extension reactions A serves as a template for DNA replication.   Designing a primer that binds at a preselected temperature is within the work of a molecular biologist It is. The temperature at which a specific primer functions depends on the primer length and base composition. Available algorithms (Wu et al., DNA Cell Biol.1 0 , 233-238 (1991)) and a computer program (Rych lik et al., Nucleic Acids Res.18, 6409-612 ( 1990)). Suitable temperature cycling for in vitro DNA amplification The ring can be accomplished manually or by a commercially available programmable temperature cycling device . Hot Air Circulator (Wittwer et al., Nucleic Acids Res.17 , 4353-4357 (1989)). Cycle time can be achieved; cycle time as short as 30 seconds is possible (Witttw er et al., Biotechniques10, 76-83 (1991)). this Thus, 100 cycles of primer extension can be achieved in as little as about 50 minutes.                       Allele-specific linear amplification   In one embodiment of the invention, the primer is modified in its 3'nucleotide. For a particular nucleotide in a template known to be possible (polymorphic) Designed to be complementary. Mutable nucleotides are like sickle cell anemia Another site known to be involved in multiple genetic disorders or polymorphic In the nucleotide. 3'nucleotide of primer and template DNA If there is a mismatch with the corresponding nucleotides in It ensures that the primer has little or preferably no extension. Pe truska et al., PNAS USA85  6252-6256 (1988) visit Teru. Such a primer is "allele-specific" and is within the nucleic acid sequence of interest. The presence or absence of a single base of can be identified. In the method of the present invention The presence of synthetic DNA after using allele-specific primers was originally Shows that the target allele is present in the DNA template of.   Using such allele-specific properties in oligonucleotide initiation Has been used to perform allele-specific PCR. For example, Newton et al., Nu cleic Acids Res.17, 2503-2516 (1989). . However, in general, as with PCR, allele-specific PCR The extrapolative behavior of the response was associated with the difficulty in carrying out the reaction. (Ugozz o li et al., Methods2, 42-48 (1991)), but alleles Of the amplification method of the present invention due to the presence of non-replicable elements within the child-specific primer. Linear behavior from cycle to cycle avoids such difficulties.                   Detection of amplified products   The first product of the amplification method of the present invention is a single-stranded synthetic DNA of limited length. The length of the product chain is determined by the position of the last primer used and the primer -Assemble the length of itself and the 3'end of the primer into a non-replicable element of the template Equal to the total number of nucleotides that can be incorporated. The above product is a radioactive or fluorescent moiety. Alternatively, use a primer or probe labeled with an enzyme, electrophoresis, It can be detected by known nucleic acid detection techniques such as high performance liquid chromatography.   The present invention has important applications in the diagnosis of genetic diseases in humans and other animals. There will be. Many human genetic diseases are caused by specific changes in genes of known sequence Is known to be. DNA-based diagnostics for these specific mutations Using hybridization or other allele-specific techniques (see above) Which of the various gene sequences are present in the DNA of people at risk of the above genetic diseases It is possible if you decide Clearly, amplification of target DNA opens up these techniques. Very helpful to emit. The main advantages of template amplification are: small Automatic sample size, improved signal-to-noise ratio for detection systems The amplification system itself is the detection system.   The method of the invention provides all of the same advantages afforded by other amplification reactions And provides additional benefits. The product is a single-stranded product, Must not be modified. If an odd number of primers is used, excess single-stranded content Children will be generated. These molecules are, for example, hybridization probes. Would be useful as Therefore, it is even more advantageous than other amplification techniques. further , The product accumulates linearly and thus can be accurately quantified; Using newly synthesized DNA as template in Less than the extrapolation method.                                 Example   The solutions utilized in some of the examples below are described below. TE (Tris-EDTA): 10 mM Tris-HCl, 1 mM EDTA. pH 8.0 TBE (Tris-borate-EDTA): 89 mM Tris-HCl, 89 mM boric acid 2 mM EDTA, pH 8.3 Klenow polymerase buffer: 50 mM Tris-HCl, 10 mM MgCl₂5 mM DTT, pH 7.6 Kinase buffer: 50 mM Tris-HCl, 10 mM MgCl₂5 mM DTT , 0.1 mM spermidine-HCl, 0.1 mM EDTA, pH 7.6 DNA polymerase I buffer: 50 mM Tris-HCl, 10 mM MgSO_Four, 0.1 mM DTT, 50 μM / ml bovine serum albumin, pH 7.2 Sequenase buffer: 40 mM Tris-HCl, 20 m MMgCl₂, 50 mM NaCl, pH 7.5 Bst polymerase buffer: 20 mM Tris-HCl, 20 mM MgCl₂, P H8.5 Thermus aquaticus polymerase Buffer: 50 mM KCl, 10 mM Tris-HCl, 1.5 mM MgCl₂, 0 . 01% w / v gelatin, pH 8.3 10X Ficoll loading buffer: 100 mM Tris-HCl, p H7.5, 10 mM EDTA, 0.5% bromphenol blue, 0.5% key Silencyanol, 30% Ficoll 5XSSPE: 50 mM sodium phosphate pH 7.0, 0.9 mM NaCl and And 5 mM EDTA 6XSSC: 0.9M NaCl, 0.09M sodium citrate   The method of the present invention is illustrated by the following examples, which do not limit the scope of the invention. There is no.EXAMPLE 1-1 Primer extension was blocked by the presence of 1,3-propanediol in the template. Click   One containing a 1,3-propanediol moiety (referred to as the non-replicable element "X") A template with or without heavy nucleotide bases, the 3'end of the template A template having a primer complementary to was synthesized to synthesize the 1,3-propanediol moiety It has shown the ability to serve as a non-replicable element and to arrest DNA synthesis. Synthesized The sequence is as follows:   Anneal the above primer and template to form the following primer-template complex: Was:   The primer-template complex is then combined with α- [³²Various in the presence of P] -dCTP DNA polymerase (Klenow fragment of DNA polymerase I, amplicon ( AmpliTaq) Polymerase (Perkin Elmer Cetus Corp. (P erkin Elmer-Cetus Corp. ), BST polymerase ( Iola Laboratories, Hercules, CA) and Sequence Developed by Polymerase (Biochemicals, Cleveland, Ohio, USA) The product was lengthened and the product was subjected to electrophoresis on denaturing polyacrylamide.   Primer and template are mixed at a primer / template ratio of 10 and polymerase enzyme The appropriate buffer was used. 1 pmol of 207 or 207X, 10 pmol P12, 25 μM dNTPs, 0.5 μCi α- [³²P] -dCTP and Ampritak buffer, BST buffer, Klenow buffer or sequenase buffer 20 μl reaction containing. Heat these samples at 90 ° C for 2 minutes and then at 0 ° C for 5 minutes. After cooling, add 1 unit of DNA polymerase and react at 37 ° C for 10 minutes. Was. These results show that the above propanediol residue has the following four DNA polymerases: Show blocking primer extension for all: Example 2-Primers with propanediol-containing bases do not support PCR I   Two of them are four ori containing the non-replicable 1,3-propanediol moiety. Gonucleotides were prepared. The above sequence is MMT-Probandiol phosphor Eppendorf Ecosin with Midito in Z position syn) Synthesized on a D300 automated DNA synthesizer. Synthesizing the above array Z was introduced when placed in the sizer. These sequences are shown in the table below :   Human β-globulin gene (GenBank locus (Lo) cu) HUMHBB) is shown in FIG. 12 for the site complementary to the oligonucleotide. It is shown.   In vitro amplification reaction achieved by various combinations of the above four primers Was done. Each reaction contained 100 ng of human chromosome DN in standard PCR reaction buffer. A, 2 primers each contained 6 pmol. Heat the reaction product (E ricomp), heat to 94 ° C for 3 minutes, cool to 55 ° C for 30 seconds, then 31 cycles of heating and cooling as follows: 94 ° C. for 1 minute, 55 ° C. 30 seconds, 30 seconds at 72 ℃. After thermal cycling, incubate the sample at 72 ° C for an additional 3.5 minutes. I had a cube. Primer without propanediol (BGP-1 30 or And only the reaction containing BGP-2 22) produced an amplification product. in this way It was confirmed that the above-mentioned propanediol-containing primer did not support PCR. .Example 3 3-Propanediol-Containing Primer Generates Specific DNA Fragments .   Plasmid pHβ^AA propanediol-containing primer (BGP-1 30X And BGP-2 22X) or a control without propanediol Mixed with Immers (BGP-1 30 and BGP-2 22). Primer/ The template mixture was subjected to thermal cycling conditions of 94 ° C. for 20 seconds to dissociate the double-stranded template, Hold at 20 ° C for 20 seconds. After the last cycle, the reaction mixture was further 48 minutes 5 minutes 40 seconds 48. Incubate at ° C to complete the primer extension reaction and anneal the single DNA Was. These reaction mixtures using a propanediol-containing primer were treated with 45 lau. Of the primer for primer extension. PCR reaction product is propanediol part 10 rounds of primer extension were performed by circulating the primer with no minutes. The products of these reactions were electrophoresed on 1.5% agarose (TBE buffer). did. Propanediol-containing primer has a smaller DN than the PCR-generated fragment Generate the A fragment. The smaller dimension is that the primer extension does not extend to the end of the template strand. Based on the fact that it does not extend and the product remains a 5'extension.   FIG. 11 shows a comparison of the products of the PCR reaction and the products of the LLA reaction of the invention. P The major product of the CR reaction was extrapolated and the ends of the used primers were limited. It is completely double-stranded with ends corresponding to. However, the product of the method of the invention is , Corresponding PCR generation, since primer extension after non-replicable elements does not occur Shorter than the thing.Example 4-Propanediol-containing primers support DNA amplification.   Amplification reactions according to the present invention include BGP-1 30X and This is accomplished by using BGP-2 22X. Dot amplification products Blot hybridization and its hybridization signal Was compared to that obtained from known amounts of plasmid DNA containing the sequence.   1.1 ng of plasmid pHβ^A(All human β cloned in pBR322 -Containing the globulin gene), 5 pmol of BGP-1 30X, 5 pmo l of BGP-2 22X, 83 μM dNTP, 2.5 position AmpliTaq ( 15 μl containing registered trademark) DNA polymerase in standard PCR buffer Each reaction was prepared. 45, 32 and 22 cycles of thermal cycling reaction at 94 ° C 20 seconds at 48 ° C for 20 seconds in Corvette Research FTS-1 heat cycle system went. At the end of the cycle, the reaction was heated at 94 ° C for 20 seconds, then at 48 ° C for 4 seconds. Incubated for minutes.   The product of these reactions (3 μl) was 10 μl of 4N NaOH, 250 mM Mixing with DTA, Zeta-Probe membrane (Californi BIO-LA Laboratories, Hercules, A.). On the membrane 56,118 and 231 ng of similarly modified plasmid pHβ^AAlso includes It was 5'-³²P-CTGCAGTAACGGCACTTTCTCC T at 55 ° C. for 3 hours, 5 × SSPE, 1% SDS, 5 mg / ml Blotto, Hybridized in 10 μg / ml Homomix I RNA. Hybrid After diluting, the blots are washed at room temperature in 6X SSC, then viola De-Molecular Imager (Bio-Rad Molecular Im ager). The reaction produced after about 250-fold amplification is according to the method of the invention. It was shown that the nucleic acid sequence of interest was amplified.Example 5-Amplification of the human β-globulin gene from chromosomal DNA   A linear amplification reaction is performed according to the method of the present invention according to Thermus aquaticus Polymerer. Ze buffer, template DNA (800 ng of chromosomal DNA or 10^FourMolecular plasma PH pH β^A), 200 μM of each dNTP (dATP, dTTP, dCTP and dGTP), 2 pmol of the oligonucleotide primer BGP5-22X and And BGP4-22X and 2 units of AmpliTaq polymerase (Perk in-Elmer Cctus) in 15 μl of solution. plus Mid pH β^AIs a human β-globulin cloned at the Pst I site of pBR322. It contains the 4.4 kb Pst I fragment of the brin gene. As a negative control, the previous A reaction is a reaction in which all components are the same except for template DNA ("no template" control). Was done. After denaturing the template DNA for 3 minutes, perform amplification in the following 99 cycles. Annealing: 55 ° C. for 30 seconds, 72 ° C. for 15 seconds, and It was denatured at 94 ° C for 30 seconds. At the end of the final cycle, animate the sample at 55 ° C for 30 seconds. And finally polymerized at 72 ° C. for 4 minutes.   At the end of the first step (100 cycles), 7.5 μl of each sample (chromosomal DNA , Plasmid DNA, and negative controls), and Termus aquati Cux polymerase buffer, 5 pmol of primers BGP1-35X and BG P2-35X with 7.5 μl containing 2 units of AmpliTaq polymerase Mixed. The circulation program is the first stage except that the annealing temperature is 63 ° C. Is similar to the program used for.   Two reactions were performed to control the size of the fragments generated by the above amplification. One reaction was Thermus aquaticus polymerase buffer, 5 pmol plaque Immers BGP 5-22X and BGP 4-22X, 1x10⁸Molecular plasmid pH β^AAnd 3 units of AmpliTaq polymerase. The second control is Other than the primers BGP1-35X and BGP2-35X used in the above reaction Contains the same ingredients. The template DNA was denatured at 94 ° C for 4 minutes, then Cycled using ram 48 times: anneal at 55 ° C for 30 seconds, then at 94 ° C It was denatured for 30 seconds. At the end of the final cycle the sample was annealed at 55 ° C for 30 seconds, Finally, polymerization was carried out at 72 ° C. for 4 minutes. Analysis of LLA products   All reactions (15 μl) were mixed with 1.6 μl of 10X Ficoll loading buffer and . For electrophoresis on 5% agarose gel (Bio-Rad Ultraview Agarose) I took it. Electrophoresis was accomplished in TBE buffer for 90 minutes at 110 volts. Above Le Stain with ethidium bromide (1 μg / ml) for 30 minutes and then for 15 minutes It was destained and photographed by UV irradiation. The electrophoresed DNA is then Transfer to Ron membrane (Zeta probe, Bio-Rad) in alkaline state (Re ed, K.K. C. And D. A. Mann, Rapid transfer of   DNA from afarose gesl to nylon membrane lanes, Nucleic Acids Res. 13: 7207-7221 (1985)), and fixed to the above membrane by ultraviolet irradiation (Church, G. . M. And W.A. Gilbert, Genomic Sequencing, P rc. Natl Acad. Sci. U. S. A. 81: 1991-1995 (1984)). These membranes were treated with 5XSSPE, 1% SDS, 10 μg / ml H omomix I RNA and 0.5% dehydrated skimmed milk powder (Ca 1 hour pre-hive in Runnation, Los Angeles, CA Lysed, then 2.5x10⁶5'of cpm / ml and³²P-labeled probe Hybridized with 5'CAGGAGTCAGGTGCACCATGGT at 55 ° C for 2 hours. Made it to size. Wash the above membrane twice with 6X SSC for 30 minutes at room temperature for 30 minutes at room temperature During autoradiography.   The chromosomal DNA produced the same fragment as the globin gene plasmid DNA control. Was. The size of the fragment was generated by BGP1-35X and BGP2-35X. It was a thing.Example 6: LLA amplification product is resistant to contamination compared to PCR in vitro amplification You.   The "LLA" amplification reaction of the present invention is carried out by the Thermus aquaticus polymerase buffer, Template DNA (3.5x10⁹Molecular plasmid pHβ^A), 200 μM of each dNT P (dATP, dTTP, dCTP and dGTP), 5 pmol oligonuclear Rheotide primers BGP1-22X and BGP2-22X, and 1.25 Unit of AmpliTaq DNA Polymerase (Perkin-Elmer Ce tus) in 15 μl of liquid. After denaturing the template DNA for 1 minute, increase By annealing the width at 48 ° C for 30 seconds and denaturing at 94 ° C for 30 seconds. 49 cycles were performed. At the end of the final cycle, incubate the sample for 4 minutes at 48 ° C. I started.   For comparison, PCR reactions were performed using Thermus aquaticus polymerase buffer, cast. Type DNA (3.5x10⁹Molecular plasmid pHβ^A), 200 μpM of each dNT P (dATP, dTTP, dCTP and dGTP), 5 pmol oligonuclear Rheotide primers BGP1-22X and BGP2-22X, and 1.25 Unit of AmpliTaq DNA Polymerase (Perkin-Elmer Ce tus) in 15 μl of liquid. Denaturation of template DNA for 1 minute, followed by amplification By annealing at 48 ° C for 30 seconds and denaturing at 94 ° C for 30 seconds. Went cycle. Incubate sample at 48 ° C for 4 minutes at the end of the final cycle did.Analysis of LLA and PCR products   Serial 2-fold dilutions of LLA and PCR products (1/64, 1/32, 1/16 , 1/8, 1/4, 1/2, 1, 2, 4 and 8 μl) 1x Ficoll load relaxation The mixture was mixed with the buffer and subjected to electrophoresis on a 1.5% agarose gel. 1x TBE buffer Electrophoresis was performed in the liquid for 90 minutes at 110 volts. Next, electrophoresed DNA Transferred to a nylon membrane in an alkaline state (see Reed and Mann, supra (1 985)) and crosslinked by UV irradiation (Church and Gilbe). rt (1984)) 2xSSC. These membranes are then treated with 5XSS. PE, 1% SDS, 10 μg / ml Homomix RNA and 0.5% powder Kim milk 2.5x10⁶5'of cpm / ml and³²P-labeled probe 5'CA Hybridized with GGAGTCAGGTGCCACATGGT for 2 hours at 55 ° C. I let you. After hybridization, wash this membrane twice at room temperature for 15 minutes in 6xSSC. And quantified by scanning with a Bio-Rad GS-250 molecular imager.Amplicon contamination experiment   Equal volumes of LLΛ (1/26 μl) and PCR (1/16 μl) products (above 10) with distilled water (as determined by major)^Four, 10^FiveAnd 10⁶Diluted twice These dilutions were then used as DNA templates in PCR reactions. amplification The reaction was performed using the Thermus aquaticus polymerase buffer, template DNA (LLA or Is a PCR dilution) and 200 μM of each dNTP (dATP, dTTP, dCTP). And dGTP), 5 pmol of the oligonucleotide primers BGP1-22 and And BGP2-22, and 1 unit of Ampli-Taq polymerase 15 μl of solution in 15 μl reaction. The reaction is performed in duplicate and the first After performing one step at 94 ° C for 3 minutes, the sample was subjected to 25 and 30 cycles (3 hours at 55 ° C. 0 second, 30 seconds at 72 ℃, 30 seconds at 94 ℃), and finally 30 minutes at 50 ℃ Seconds, 72 ° C. for 4 minutes. In addition, all reagents except template DNA Was added to the negative control.   In order to control and quantify the relative amounts of LLA and PCR template DNA, Combination of different primers that prime to BGP1-22 and BGP2-22 A second set of PCR reactions was achieved using mating. Reaction components other than primers And the reaction conditions are as described in the previous paragraph.   Mix 15 μl reaction with 1.6 μl of 10 × Ficoll loading buffer to 1.5 % Electrophoresed in agarose gel (Bio-Rad Ultra Pure Agarose) Was. Electrophoresis was performed at 110 volts for 90 minutes in 1X TBE buffer. This gel Then stain with ethidium bromide (1 μl / ml) for 30 minutes and destain for 15 minutes. Then, it was photographed by UV irradiation. The electrophoresed DNA is then attached to a nylon membrane Under alkaline conditions (Reed and Mann (1985)). It was fixed to the membrane by spraying (Church (1984)). 5X these membranes SSPE, 1% SDS, 10 μg / ml Homomix I RNA and 0. Prehybridized in 5% dehydrated skim milk powder for 1 hour, then 2 . 5x10⁶5'of cpm / ml³²P-labeled probe 5'CAGGAGTCAG It was hybridized with GTGCACCATGGT at 55 ° C. for 2 hours. 6 for the above film Wash with X SSC twice for 30 minutes at room temperature, Bio-Rad GS-250 Molecular ・ Quantified with an imager.result   Outer primer combination (measuring the ability of the amplicon to amplify the second reaction) The reaction paired with the inner primer combination (amplicon Of the reaction amplified by measuring the amount present in the reaction) The measurement ratio was measured. As is clear from the table below, is the LLA reaction an outer primer? Produce amplicons that are highly resistant to their amplification and thus remain Resistant to the effects of pollution.

[Procedure of Amendment] Article 184-8 of the Patent Act [Submission date] August 7, 1995 [Correction contents] Article 34 Amendment Claim 1. A method for amplifying a target nucleic acid sequence contained in a complementary nucleic acid chain comprising the following steps So: (A) A primer containing a non-replicable element and a first generation primer extension The chains are allowed to come into contact under conditions such that the product is synthesized using the chains as a template. For the primer, the synthesized first generation primer extension product is separated from the strand Generation primer extension products of primers for complementation of the strands when driven Serving as a template for the synthesis of (B) Separation of first generation primer extension products from their respective templates to obtain single-stranded molecules. Produces; and (C) The first generation primer extension product is treated with the primer of step (a) to generate a second generation primer. The Limer extension product uses the first generation primer extension product as a template Under the conditions as synthesized by   Here, the second generation primer extension product is at least a part of the nucleic acid sequence of interest. A primer extension product of a primer that contains and is extended to synthesize those templates Cannot serve as a template for the synthesis of A method consisting of. 2. In addition, the generated second generation primer extension products were labeled with their respective templates. The method of claim 1 which comprises separating from the single chain molecule to produce a single chain molecule. 3. The method of claim 1, wherein step (c) is repeated at least once. 4. Non-replicable elements are not located at the terminal residues of any of the above primers The method of claim 1. 5. The non-replicable element is a derivative of deoxyribonucleotides. Law. 6. The method of claim 1, wherein the non-replicable element is a derivative of ribonucleotides. 7. The method of claim 5, wherein the non-replicable element is a 1,3-propanediol residue. 8. The non-replicable element is 1,4-anhydro-2-deoxy-D-ribitol residue. The method of claim 5, which is a group. 9. In addition, the second generation primer extension product contains a non-replicable The primer extension reaction product is a template for the second generation primer extension product The method of claim 1 comprising treating under conditions which are utilized as synthetically. 10. A method for amplifying a target nucleic acid sequence contained in a complementary nucleic acid chain consisting of the following steps The law: (A) a first primer and a second primer containing the above strand and a non-replicable element -The first generation primer extension product is the first primer and the second primer From the first ply by contacting the strands under conditions such that they are synthesized using the strand as a template. Mer and the second primer are the synthesized first generation primer extension products. Of the first and second primers when separated from the template of Selected to serve as a template for the synthesis of immer extension products; (B) Separation of first generation primer extension products from their respective templates to obtain single-stranded molecules. Produces; and (C) the first generation primer extension product with the first primer and the second primer , The 2nd generation primer extension product uses the 1st generation primer extension product as a template Treated under conditions such that it will be synthesized by use;   Here, the second generation primer extension product is at least a part of the nucleic acid sequence of interest. And the second generation primer extension product of the first primer is Can serve as a template for the synthesis of lymer extension products; A method consisting of. 11. In addition, the second generation primer extension product generated from step (c) 11. Separation from each of these templates to produce a single-stranded molecule. Law. 12. 11. The method of claim 10, wherein step (c) is repeated at least once. 13. Non-replicable elements should not be located at the terminal residues of any of the above primers. The method of claim 1. 14． 11. The non-replicable element is a derivative of deoxyribonucleotides. the method of. 15. 11. The method of claim 10, wherein the non-replicable element is a derivative of ribonucleotide. 16. 15. The non-replicable element is a 1,3-propanediol residue. Law. 17． The non-replicable element is 1.4-anhydro-2-deoxy-D-ribitol. 15. The method of claim 14, which is a residue. 18. Furthermore, the second generation primer extension product of the second primer is added to the third primer. And the product of the third primer extension reaction is the second generation primer of the second primer. Mer extension product as a template The method of claim 10, wherein each of the third primers comprises a non-replicable element. 19. Each of the above strands has a primer binding site for the first primer and a second primer Contains a primer binding site for the primer and the first primer is the second primer The method of claim 10, which is 3'of the primer binding site for 20. A method for amplifying a target nucleic acid sequence contained in a complementary nucleic acid chain consisting of the following steps The law: (A) a first primer and a second primer containing the above strand and a non-replicable element The first-generation primer extension product from the first primer using the strand as a template. A first combination which is synthesized using but not from a second primer The first primer is allowed to come into contact with the first primer from this step. When the first generation primer extension product is separated from its template, the first primer Selected to serve as a template for the synthesis of second generation primer extension products; (B) Separation of first generation primer extension products from their respective templates to obtain single-stranded molecules. Produces; and (C) The first generation primer extension product is treated with the primer of step (a) to generate a second generation primer. The Limer extension product uses the first generation primer extension product as a template Under the conditions as synthesized by (D) Separation of second generation primer extension products from their respective templates to yield single-stranded molecules. Produces; (E) steps (c) and (d) are repeated at least once; and (F) The reaction mixture of step (e) is treated with the primer extension reaction product as the second primer. From 2nd generation primer extension product as template A second combination of primer extension reaction conditions. 21. The primer extension reaction conditions for the first combination are those for the second combination. 21. The method of claim 20, which is more stringent than the Mer extension reaction conditions. 22. When the condition of the first combination is higher than the condition of the second combination 21. The method of claim 20. 23. No non-replicable element is located at the terminal residue of any of the above primers 21. The method of claim 20. 24. 21. The non-replicable element is a derivative of deoxyribonucleotides. the method of. 25. 21. The method of claim 20, wherein the non-replicable element is a ribonucleotide derivative. 26. 25. The non-replicable element is a 1,3-propanediol residue. Law. 27. The non-replicable element is 1,4-anhydro-2-deoxy-D-ribitol. 25. The method of claim 24 which is a residue. 28. Each of the above strands has a primer binding site for the first primer and a second primer A primer for the first primer, including a primer binding site for the primer The binding site is 3'of the primer binding site for the second primer. 0 method. 29. The nucleic acid sequence contains a polymorphic site associated with a genetic disease, and each of the above primers contains A method selected to initiate nucleic acid synthesis only in the presence or absence of a disease. Method 1. 30. 30. The method of claim 29, wherein the genetic disease is sickle cell anemia. 31. Furthermore, detecting the presence or absence of the amplified nucleic acid sequence of interest. The method of claim 1, comprising: 32. Furthermore, detecting the presence or absence of the amplified nucleic acid sequence of interest. 11. The method of claim 10, comprising: 33. Furthermore, detecting the presence or absence of the amplified nucleic acid sequence of interest. 21. The method of claim 20, comprising: 34. DNA polymerase, each primer is 1,3-propanediol and 1 Non-replicable selected from, 4-anhydro-2-deoxy-D-ribitol Essential A pair of primers for each sequence to be amplified consisting of And a specific nucleic acid sequence that can be replicated by a DNA polymerase A reagent kit for use in amplifying acid sequences. 35. 35. The key of claim 34, wherein the non-replicable element is a 1,3-propanediol residue. And 36. The non-replicable element is 1,4-anhydro-2-deoxy-D-ribitol. 35. The kit of claim 34 which is a residue. 37. DNA polymerase, each primer is 1,3-propanediol and 1 Non-replicable selected from, 4-anhydro-2-deoxy-D-ribitol A primer pair for each sequence to be amplified, consisting of elements and a specific nucleic acid sequence A specific nucleic acid probe capable of detecting the presence or absence of an amplification product in a row, A reagent kit for use in amplifying nucleic acid sequences. 38. 37. Further according to claim 37, further comprising: Consisting of a control nucleic acid sequence that can be replicated and detected by the nucleic acid probe described above. Reagent kit. 39. 38. The test according to claim 37, wherein the non-replicable element is a 1,3-propanediol residue. Medicine kit. 40. The non-replicable element is 1,4-anhydro-2-deoxy-D-ribitol. 38. The kit of claim 37 which is a residue. 41. The above primers amplify a nucleic acid sequence that directs a genetic disease or abnormality. 35. The kit of claim 34, which has been selected.

Claims (1)

[Claims] 1. A method for amplifying a target nucleic acid sequence contained in a complementary nucleic acid chain comprising the following steps So: (A) A primer containing a non-replicable element and a first generation primer extension The chains are allowed to come into contact under conditions such that the product is synthesized using the chains as a template. For the primer, the synthesized first generation primer extension product is separated from the strand Generation primer extension products of primers for complementation of the strands when driven Serving as a template for the synthesis of (B) Separation of first generation primer extension products from their respective templates to obtain single-stranded molecules. Produces; and (C) The first generation primer extension product is treated with the primer of step (a) to generate a second generation primer. The Limer extension product uses the first generation primer extension product as a template Under the conditions as synthesized by   Here, the second generation primer extension product is at least a part of the nucleic acid sequence of interest. A primer extension product of a primer that contains and is extended to synthesize those templates Cannot serve as a template for the synthesis of A method consisting of. 2. In addition, the generated second generation primer extension products were labeled with their respective templates. The method of claim 1 which comprises separating from the single chain molecule to produce a single chain molecule. 3. The method of claim 1, wherein step (c) is repeated at least once. 4. Non-replicable elements are not located at the terminal residues of any of the above primers The method of claim 1. 5. The non-replicable element is a derivative of deoxyribonucleotides. Law. 6. The method of claim 1, wherein the non-replicable element is a derivative of ribonucleotides. 7. The method of claim 5, wherein the non-replicable element is a 1,3-propanediol residue. 8. The non-replicable element is 1,4-anhydro-2-deoxy-D-ribitol residue. The method of claim 5, which is a group. 9. In addition, the second generation primer extension product contains a non-replicable The primer extension reaction product is a template for the second generation primer extension product The method of claim 1 comprising treating under conditions which are utilized as synthetically. 10. A method for amplifying a target nucleic acid sequence contained in a complementary nucleic acid chain consisting of the following steps The law: (A) a first primer and a second primer containing the above strand and a non-replicable element -The first generation primer extension product is the first primer and the second primer From the first ply by contacting the strands under conditions such that they are synthesized using the strand as a template. Mer and the second primer are the synthesized first generation primer extension products. Of the first and second primers when separated from the template of Selected to serve as a template for the synthesis of immer extension products; (B) Separation of first generation primer extension products from their respective templates to obtain single-stranded molecules. Produces; and (C) the first generation primer extension product with the first primer and the second primer , The 2nd generation primer extension product uses the 1st generation primer extension product as a template Treated under conditions such that it will be synthesized by use;   Here, the second generation primer extension product is at least a part of the nucleic acid sequence of interest. And the second generation primer extension product of the first primer is Can serve as a template for the synthesis of lymer extension products; A method consisting of. 11. In addition, the second generation primer extension product generated from step (c) 11. Separation from each of these templates to produce a single-stranded molecule. Law. 12. 11. The method of claim 10, wherein step (c) is repeated at least once. 13. Non-replicable elements should not be located at the terminal residues of any of the above primers. The method of claim 1. 14． 11. The non-replicable element is a derivative of deoxyribonucleotides. the method of. 15. 11. The method of claim 10, wherein the non-replicable element is a derivative of ribonucleotide. 16. 15. The non-replicable element is a 1,3-propanediol residue. Law. 17． The non-replicable element is 1,4-anhydro-2-deoxy-D-ribitol. 15. The method of claim 14, which is a residue. 18. Furthermore, the second generation primer extension product of the second primer is added to the third primer. And the product of the third primer extension reaction is the second generation primer of the second primer. Mer extension product as a template The method of claim 10, wherein each of the third primers comprises a non-replicable element. 19. Each of the above strands has a primer binding site for the first primer and a second primer Contains a primer binding site for the primer and the first primer is the second primer The method of claim 10, which is 3'of the primer binding site for 20. A method for amplifying a target nucleic acid sequence contained in a complementary nucleic acid chain consisting of the following steps The law: (A) a first primer and a second primer containing the above strand and a non-replicable element The first-generation primer extension product from the first primer using the strand as a template. A first combination which is synthesized using but not from a second primer The first primer is allowed to come into contact with the first primer from this step. When the first generation primer extension product is separated from its template, the first primer Selected to serve as a template for the synthesis of second generation primer extension products; (B) Separation of first generation primer extension products from their respective templates to obtain single-stranded molecules. Produces; and (C) The first generation primer extension product is treated with the primer of step (a) to generate a second generation primer. The Limer extension product uses the first generation primer extension product as a template Under the conditions as synthesized by (D) Separation of second generation primer extension products from their respective templates to yield single-stranded molecules. Produces; (E) steps (c) and (d) are repeated at least once; and (F) The reaction mixture of step (e) is treated with the primer extension reaction product as the second primer. From 2nd generation primer extension product as template A second combination of primer extension reaction conditions. 21. The primer extension reaction conditions for the first combination are those for the second combination. 21. The method of claim 20, which is more stringent than the Mer extension reaction conditions. 22. When the condition of the first combination is higher than the condition of the second combination 21. The method of claim 20. 23. No non-replicable element is located at the terminal residue of any of the above primers 21. The method of claim 20. 24. 21. The non-replicable element is a derivative of deoxyribonucleotides. the method of. 25. 21. The method of claim 20, wherein the non-replicable element is a ribonucleotide derivative. 26. 25. The non-replicable element is a 1,3-propanediol residue. Law. 27. The non-replicable element is 1,4-anhydro-2-deoxy-D-ribitol. 25. The method of claim 24 which is a residue. 28. Each of the above strands has a primer binding site for the first primer and a second primer A primer for the first primer, including a primer binding site for the primer The binding site is 3'of the primer binding site for the second primer. 0 method. 29, the nucleic acid sequence contains a polymorphic site associated with a genetic disease, and each of the above primers contains A method selected to initiate nucleic acid synthesis only in the presence or absence of a disease. Method 1. 30. 30. The method of claim 29, wherein the genetic disease is sickle cell anemia. 31. Furthermore, detecting the presence or absence of the amplified nucleic acid sequence of interest. The method of claim 1, comprising: 32. Furthermore, detecting the presence or absence of the amplified nucleic acid sequence of interest. 11. The method of claim 10, comprising: 33. Furthermore, detecting the presence or absence of the amplified nucleic acid sequence of interest. 21. The method of claim 20, comprising: 34. DNA polymerase, each primer is amplified consisting of non-replicable elements Primer pairs for each sequence to be prepared, and the primers and DNA polymers To amplify a particular nucleic acid sequence, which consists of a control nucleic acid sequence that can be replicated by the enzyme Reagent kit for use in. 35. 35. The key of claim 34, wherein the non-replicable element is a 1,3-propanediol residue. And 36. The non-replicable element is 1,4-anhydro-2-deoxy-D-ribitol. 35. The kit of claim 34 which is a residue. 37. DNA polymerase, each primer consisting of non-replicable elements, amplified Primer pairs for each sequence to be present, and the presence of amplification products of the specific nucleic acid sequences Or to amplify a particular nucleic acid sequence, which consists of a nucleic acid probe capable of detecting its absence. Reagent kit for use in. 38. 37. Further according to claim 37, further comprising: Consisting of a control nucleic acid sequence that can be replicated and detected by the nucleic acid probe described above. Reagent kit. 39. 38. The test according to claim 37, wherein the non-replicable element is a 1,3-propanediol residue. Medicine kit. 40. The non-replicable element is 1,4-anhydro-2-deoxy-D-ribitol. 38. The kit of claim 37 which is a residue. 41. The above primers amplify a nucleic acid sequence that directs a genetic disease or abnormality. 35. The kit of claim 34, which has been selected. 42. The above primers amplify a nucleic acid sequence that directs a genetic disease or abnormality. 38. The kit of claim 37, which has been selected.